RU2435857C2 - VECTORS OF RECOMBINANT VIRUSES OF Mononegavirales ORDER - Google Patents

Abstract

FIELD: medicine. ^ SUBSTANCE: vector carries an additional transcription unit containing a foreign gene functionally coupled with an overlying starting sequence of a virus gene (GS) of Mononegavirales order and an underlaying end sequence of a virus gene (GE) of Mononegavirales order; between the GS sequence and an initiator codon of the foreign gene and between a stop sign of the foreign gene and the GE sequence there are respectively 3'-noncoding area and 5'-noncoding area (a genome sense chain) of the virus gene of Mononegavirales order. ^ EFFECT: higher expression level of the protein coded by the foreign gene. ^ 22 cl, 9 dwg, 6 tbl, 6 ex

Description

The present invention relates to a vector based on a recombinant virus of the Mononegavirales order, carrying an additional transcriptional unit containing a foreign gene functionally linked to the start sequence of the Mononegavirales virus of the Monodegavirales virus and to the terminal sequence of the Mononegavirales virus (GE) gene, as well as to a vaccine, containing this vector based on a recombinant Mononegavirales virus.

Live viruses capable of replicating in the infected host elicit a strong and lasting immune response against the expressed antigens of these viruses. They effectively elicit both humoral and cellular immune responses, and also stimulate biochemical pathways mediated by cytokines and chemokines. Therefore, live attenuated viruses have certain advantages over vaccine compositions based either on inactivated immunogens or on individual immunogen subunits, which, as a rule, stimulate only the humoral part of the immune system.

Over the past decade, recombinant DNA technology has revolutionized the genetic engineering of the genomes of both DNA and RNA viruses. In particular, it is now possible to introduce foreign genes into the genome of the virus so that when a new viral vector is replicated in an animal host, a foreign protein is expressed that can exhibit biological activity in the animal host. As such, recombinant viral vectors are used not only to control and prevent microbial infections, but also to develop targeted therapies for diseases not caused by microorganisms, such as malignant diseases, and for gene therapy.

The first publication in 1994 (Schnell et al., EMBO J., 13 , 4195-4203, 1994) on the creation of non-segmented (-) RNA viruses (viruses of the Mononegavirales order) completely from cloned cDNA using methods called “reverse genetics”, also allowed the use of viruses of the Mononegavirales order (MV viruses) as vectors. Since then, studies have been published regarding the use of many Mononegavirales viruses as viral vectors for the expression of pathogen-derived foreign antigens for the development of vaccines against pathogens.

The Mononegavirales order includes four main families: Paramyxoviridae, Rhabdoviridae, Filoviridae and Bornaviridae. Viruses belonging to these families have genomes represented by a single negative sense (-) RNA molecule, i.e. the polarity of the genome is the opposite of the polarity of messenger RNA (mRNA or mRNA), which is designated as positive semantic (+). The classification of the main human and animal viruses from the Mononegavirales order is presented in the table below:

Table 1:
Mononegavirales Order Virus Classification Family Kind View Rhabdoviridae Lyssavirus Rabies Virus (RV) Vesiculovirus Vesicular Stomatitis Virus (VSV) Novirhabdovirus Infectious Hematopoietic Necrosis Virus (IHNV) Paramyxoviridae Respirovirus Sendai Virus (SeV) Human parainfluenza virus type 1 and 3 (hPIV 1/3) Bovine parainfluenza virus type 3 (bPIV 3) Morbillivirus Measles virus Cattle plague virus Canine distemper virus (CDV) Rubulavirus Monkey Virus 5 (SV-5) Type 2 human parainfluenza virus (hPIV 2) Mumps virus Avulavirus Newcastle disease virus (NDV) Pneumovirus Human Respiratory Syncytial Virus (hRSV) Bovine Respiratory Syncytial Virus (bRSV) Filoviridae Ebola-like viruses Ebola virus Marburg virus

The genomic organization and life cycle details of the Mononegavirales order viruses (today) are well known, and their description is presented in reviews by many authors (Neumann et al., J. Gen. Virology 83 , 2635-2662, 2002; Whelan et al., Curr . Top. Microbiol. Immunol. 203 , 63-119, 2004; Conzelmann, K .; Curr. Top. Microbiol. Immunol. 203 , 1-41, 2004). Despite the fact that the viruses of the Mononegavirales order have different hosts and different morphological and biological properties, they have many common properties, such as genomic organization and elements necessary for the usual method of replication and expression of genes, which indicates that they came from a common ancestor. These coated viruses replicate in the cytoplasm of cells and synthesize mRNA that does not require splicing.

The viruses of this order consist of two main functional units, the ribonucleotide-protein complex (RNP) and the envelope. Complete genomic sequences have already been identified for the representative genera of each family listed above. The size of their genomes varies from about 9000 nucleotides to about 19000 nucleotides, and the genome of viruses contains from 5 to 10 genes. The structure and organization of the genomes of the viruses of the order Mononegavirales are very similar and are determined by a certain type of gene expression. The genomes of all MV viruses contain three major coding genes: nucleoprotein (N or NP), phosphoprotein (P), and RNA-dependent RNA polymerase (L). A virus envelope consists of a matrix (M) protein and one or more transmembrane glycoproteins (e.g., G, HN, and F proteins) that are involved in the assembly / budding of viral particles, as well as in the process of attachment and / or penetration of the virus into the cell . Depending on the genus to which the virus belongs, the amount of proteins can be increased due to auxiliary proteins having certain specific regulatory functions during transcription and viral replication, or proteins that are involved in the host virus reaction (for example, proteins C, V, and NS ) The arrangement of genes in the genome of MV viruses is very conservative, with the main proteins located at or near the 3'-end, and the large (L) gene located at the 5'-end. The genes for the M proteins, surface glycoproteins, as well as other auxiliary genes are located between the N, P, and L.

In the RNP complex, genomic or antigenomic RNAs are encapsulated in protein N and linked to an RNA-dependent RNA polymerase, which consists of proteins L and P. After infection of the cell, it is the RNP complex, not the naked RNA genome, that serves as a matrix for two different RNA synthesis functions, i.e. transcription of subgenomic mRNA and replication of full-size genomic RNA.

Each tandem located gene is divided by the so-called “gene connection” structures. The gene assembly contains a conserved “gene terminal sequence” (GE), a non-transcribed “inter-gene region” (IGR), and a conserved “gene start sequence” (GS). Both of these sequences are necessary and sufficient for gene transcription. During transcription, each gene is sequentially transcribed into mRNA using a viral RNA-dependent RNA polymerase, which starts the transcription process from the 3'-end of genomic RNA in the first GS sequence. At each site of the connection of genes, transcription is interrupted as a result of detachment of the RNA polymerase on the GE sequence. Re-initiation of transcription occurs in the next GS sequence, albeit with less efficiency. As a result of this interrupted process, also called the “stop-start” process, transcription is weakened at each site of the gene connection, as a result of which the genes located in the 3'-region of the MV virus genome are transcribed more than subsequent genes located in the 5'-region. The modular form of transcription of MV virus genes, in which each gene is part of a separate cistron or transcription unit, makes these viruses unusually suitable for the insertion and expression of foreign genes. Each transcription unit in the genome of MV viruses contains the following elements: 3'-GS-open reading frame (ORF) -GE-5 '.

At the 3'- and 5'-ends of the MV virus genome there are short non-transcribed regions called “leader” (approximately 40-50 nucleotides) and “trailer” (approximately 20-600 nucleotides), respectively. Leader and trailer sequences are essential sequences that control the replication of genomic RNA, encapsulation of the virus and packaging of the virus.

Reverse genetics methods and the possibility of reconstructing the infectious MV virus made it possible to manipulate its RNA genome via a cDNA copy. The minimum replication initiation complex necessary for the synthesis of viral RNA is the RNP complex. The infecting MV virus can be restored by co-expression of antigenic RNA and the corresponding auxiliary proteins with plasmids under the control of T7 phage RNA polymerase. Based on the original protocol published in 1994 (Schnell et al., 1994 (supra)), (or with minor variations), many types of MV viruses were restored.

Newcastle disease and bird flu are important poultry diseases that can cause serious economic losses in the global poultry industry. Newcastle disease virus (NDV) is an unsealed (-) RNA virus belonging to the Mononegavirales order. The genome, which is 15 kb in length, contains six genes that encode nucleoprotein (NP), phosphoprotein and V protein (P / V), matrix protein (M), fusion protein (F), hemagglutinin protein neuraminidase (HN) and an RNA-dependent RNA polymerase or large (L) protein. The genes of this virus are arranged sequentially in the following order 3'-NP-P-M-F-HN-L-5 'and are separated by regions between genes of different lengths. All genes are preceded by a gene start sequence (GS), followed by a non-coding region encoding NDV proteins, an open reading frame, a second non-coding region and a gene end sequence (GE). The length of the NDV genome is a multiple of six, which should be taken into account when embedding foreign genes.

Avian influenza (AI) is a disease of poultry, characterized in that it can be a disease with symptoms from mild respiratory manifestations to severe illness with high mortality. The agent causing this disease is Avian Influenza A (AIV) virus, belonging to the Orthomyxoviridae family. AIV contains eight genomic RNA segments of negative polarity that encode 10 proteins. Based on the antigenic properties of hemagglutinin (HA) and neuraminidase (N) glycoproteins, avian influenza viruses were divided into subtypes. To date, 16 hemagglutinin (H1-H16) and nine neuraminidase (N1-N9) subtypes are known. Antibodies to hemagglutinin and neuraminidase are important for the humoral immune response and inhibit infection or prevent disease.

Avian influenza and Newcastle disease viruses can be grouped into two different pathotypes according to their virulence. Symptoms caused by low pathogenic AIV (LPAI) or lentogenic NDV are considered less significant. In contrast, highly pathogenic avian influenza (HPAI) and Newcastle disease caused by highly virulent viruses (NDV: mesogenic and velogenic strains) are extremely important diseases.

While vaccination against NDV with lentogenic strains of NDV is carried out to protect chickens from highly virulent NDV strains, HPAI vaccination is not carried out in most countries because the spread of HPAI is controlled by killing the infected population. However, vaccination can be used as a strategy to minimize losses and reduce the incidence of the disease. The vaccine-induced immunity is specific for the virus subtype, which means that the vaccine for the H5 subtype can protect against H5 AIV, but cannot protect against other H subtypes. Usually, influenza virus replication is limited to the lungs, since the hemagglutinin of the LPAI viruses can only cleave Clara cell tryptase, which is a serine protease expressed in the lungs. Today, all HPAI viruses are subtypes of H5 and H7. These HPAI viruses in the H cleavage site contain many essential amino acids, so they can be cleaved by the widely expressed furin and subtilisin-like enzymes into HA1 and HA2 subunits. Therefore, these viruses can multiply in other organs.

H5 and H7 subtypes can protect chickens and turkeys against clinical manifestations and prevent death following HPAI infection. In addition to the traditional inactivated whole oil-based AIV, the effectiveness of immunization against AI using viral vectors, protein subunit vaccines or DNA vaccines has been experimentally shown. Since the creation of reverse genetics, the production of recombinant viruses for use as vaccine vectors has been an important use for various viruses. Various recombinant (-) RNA viruses expressing foreign proteins have been constructed. Hemagglutinin from AIV was also inserted into various viral vectors, such as infectious laryngotracheitis virus (ILTV) (Luschow et al., Vaccine 19 , 4249-59, 2001), cattle plague virus (Walsh et al., J. Virol. 74 , 10165-75, 2000) and vesicular stomatitis virus (VSV) (Roberts et al., J. Virol. 247 , 4704-11, 1998).

Bovine plague virus was also used as a virus for the expression of FMD virus capsid protein VP1 (Baron et al., 1999, J. of Gen. Virol., Vol. 80, p. 2031-2039).

In an article by Tao et al. (1998, J. of Virol., Vol. 72, p.2955-2961) describes the creation of a chimeric type 3 human parainfluenza virus (hPIV), in which the HN and F genes of type 1 hPIV are used as a substitute (and not as a complement) ) endogenous genes HN and F of type 3 hPIV virus.

NDV is also used to express AIV hemagglutinin. The influenza A / WSN / 33 hemagglutinin gene was inserted between the P and M genes of the Newcastle disease virus Hitchner B1 strain. This recombinant virus protected mice from a fatal infection, although there was noticeable weight loss in mice that fully recovered within 10 days (Nakaya et al. J. Virol. 75 , 11868-73, 2001). In addition, recombinant NDV with the same insertion site for a foreign gene was used to express H7 from LPAI, but in this case only 40% of the vaccinated chickens were protected against velogenic NDV and HPAI (Swayne et al., Avian Dis. 47 , 1047-50 , 2003).

However, these publications do not describe any beneficial effect of the so-called non-coding regions of the endogenous genes of MV viruses on the expression of additional foreign genes embedded in the genome of the MV vector.

An object of the present invention is to provide a recombinant MV viral vector that provides a higher level of expression of a protein encoded by a foreign gene inserted into the viral vector gene and / or which provides higher immunogenicity than existing MV viral vectors.

The inventors have found that this problem is solved by a vector based on the recombinant virus of the Mononegavirales order of the present invention. Thus, the present invention relates to a vector based on a recombinant virus of the Mononegavirales order, carrying an additional transcriptional unit containing a foreign gene, operably linked to the upstream start sequence of the MV virus gene (GS) gene and the downstream (GE) gene sequence of the MV virus gene characterized in that between the GS sequence and the start codon of the foreign gene and between the stop codon of the foreign gene and the GE sequence there is a 3'-non-coding region and 5'-non-coding yuschaya region (genome sense) of the gene MV-virus, respectively.

It should be noted that the indicated polarity of the nucleotide chains in this document is given in the context of the genomic (-) sense strand, with the exception of mRNA and cDNA sequences.

It was found that the presence of 3'- and 5'-non-coding regions of the MV virus gene in a transcriptional unit containing a foreign gene inserted into the MV virus genome positively affects the transcription and / or expression of a foreign gene. Figure 3 shows that the introduction of non-coding regions of the MV virus gene between the GS sequence and the avian influenza hemagglutinin (HA) gene increases the amount of HA mRNA synthesized by the MV virus vector carrying the HA gene from AIV. A positive effect was also observed at the protein level: comparing MV-viral vectors showed that serum intensive immunological staining specific for HA AIV, observed only in case of MV-viral vector carrying the HA AIV heterologous gene flanked by noncoding regions (Figure 4). Thus, it was found that the presence of non-coding regions of the MV virus flanking the foreign gene positively affects the characteristics of the resulting MV virus vector, although the inventors would not want to associate this with any theory or model that explains these observations.

An alien gene is a polynucleotide molecule that encodes a polypeptide or protein that is not present in the natural recipient MV genome.

As emphasized above, a common property of the genomic organization of MV viruses is their modular form of transcription, in which tandem located transcriptional units are sequentially transcribed. In wild-type MV viruses, the transcribed genes are flanked (i) at their 3'-ends by the GS sequence and the nucleotide sequence, referred to in this area as the "non-coding region", and (ii) at their 5'-ends by the nucleotide sequence, also designated as a "non-coding region", and a GE sequence. Therefore, the term (3 ′ or 5 ′) used in the present description - “non-coding region” defines a nucleotide sequence that is located above (in the 3′-direction) or below (in the 5′-direction) of the natural MV virus gene and covers between the GS sequence and the start codon (ATG) of the MV virus gene; and the region between the stop codon (TAA, TAG or TGA) of the MV virus gene and the GE sequence, respectively. The non-coding regions used in the present invention are derived from the virus gene on the basis of which the vector is created (i.e., the non-coding regions are homologous to the MV virus vector).

Detailed information on the organization of the MV virus genome is known in the art, including the nucleotide sequences of various MV virus genes and the sequences that control their transcription (GS and GE) and non-coding sequences flanking the genes. Such information can, for example, be obtained from the database of the National Center for Biotechnological Information (NCBI), for example, on a web page on the Internet; see tables 2 and 3).

Non-coding sequences that are preferably used in the invention are derived from genes of natural MV viruses, but it is also believed that replacing one or more nucleotides in a natural non-coding region is within the scope of the invention. In particular, nucleotide substitutions are provided that are located directly above or below the start / stop codon of a foreign gene, respectively, and the result of the introduction of an artificial restriction enzyme cleavage site, allowing genetic manipulation of these regions.

In a preferred recombinant MV viral vector of the present invention, the non-coding regions belong to a gene encoding the envelope protein of the MV virus, in particular the M, G, F or HN protein, or the protein included in the RNP, in particular the N, P or L. protein

In a particularly preferred MV virus of the present invention, non-coding regions belong to a gene encoding an F or HN protein.

Specific nucleotide sequences of non-coding regions for use in the recombinant MV virus vector of the present invention are presented in table 3.

Table 2:
Information about the genome of viruses from the order Mononegavirales and vectors based on them MV virus Genome Information: Access Number in the NCBI Database Literary source about the recombinant viral vector RV NC_001542 Mebatsion et al., PNAS 93 , 7310-14.1996 VSV NC_0011560 Kretzschmar et al., J. Virol. 71 , 5982-89, 1997 Ihnv NC_001652 - SeV NC_001552 Sakai et al., FEBS Lett. 456 , 22106, 1999 hPIV1 NC_003461 - H PIV3 NC_001796 Tao et al., J. Virol. 74 , 6448-58, 2000 bPIV3 NC_002161 Tang et al., Vaccine 23, 1657-67, 2005 Measles virus NC_001498 Singh et al., Virol. 73 4823-28, 1999 Cattle plague virus NC_006296 Walsh et al., J. Gen. Virol. 81 , 709-18, 2000 Cdv NC_001921 Plattet el al., Virus Res. 101 , 147-53, 2004 SV 50 NC_006430 He et al., Virology 237 , 249-60, 1997 Ndv NC_002617 Zhao et al., J. Gen. Virol. 84 , 781-88, 2003 Mumps virus NC_002200 - hPIV2 NC_003443 - hRSV NC_001781 Bukreyev et al., PNAS 96 , 2367-72, 1999 bRSV NC_001989 Stope et al., J. Virol., 75 , 9367-77, 2002 Ebola disease virus NC_006432 - Marburg disease virus NC_001608 -

Preferred GS and GE sequences used in the present invention as transcriptional control sequences are sequences derived from the natural genes of MV viruses. It is believed that these sequences modulate the activity of RNA polymerase during the transcription process, in particular during the initiation of transcription and modification of the 5'-end of mRNA, and in the control of 3'-polyadenylation and termination of transcription. For each MV virus, the start of each gene is marked by a sequence of approximately 10 nucleotides. While in some types of MV viruses, GS sequences are the same for each gene, GS sequences in the genome of other types of MV viruses may have slight differences.

Due to their common function in the formation of the 3'-polyA tail in mRNA and termination of transcription of the GE sequence in MV viruses, they have common sequence design features. The characteristic GE sequence contains a U-shaped region of 4-8 nucleotides in length. In addition, the cytosine residue located directly above the U-shaped region is conservative, and in front of it is a nucleotide chain rich in A / U residues. In various GE sequences, 4 nucleotides located immediately above the U-shaped region are 3'-AUUC-5 '.

Transcriptional control sequences that define the boundaries and junctions of the MV virus genes have been identified for many MV virus genes by comparing the nucleotide sequences of the genomic matrix and the nucleotide sequences present at the end of the mRNA. In addition, a large number of studies have identified consensus GS and GE sequences necessary for efficient gene expression. General characteristics and specific examples of GS and GE sequences can be obtained from the NCBI sequence database (see table 2 for access numbers in the NCBI database); their overview is also given in articles by Neumann et al. (J. Virol. 83 , 2635-2662, 2002) and Whelan et al. (Current Topics Microbiol. Immunol. 203 , 63-119, 2004).

The specific preferred GS and GE sequences used in the recombinant MV virus vector of the invention are shown in Table 3, although it is known that it is not always possible to determine the exact boundary between GS sequences, non-coding region and GE. Information about these sequences is disclosed in the NCBI database (see access numbers in table 2). For the NDV1 virus, a reference is given to the access number in the EMBL database (Y18898), for RV, to the access number in the GenBank database (M31046).

Table 3:
Information about the sequence at the junction of the genes of various MV viruses (+ sense strand) Virus GS Non-coding
area (nucleotides)
between GS and
start codon Open reading frame Non-coding
region (nucleotides)
between the stop codon and GE GE The region between genes (between GE and GS) (IGR) RV aacacccct 3 N fifty tgaaaaaaa ct aacacccct twenty P 59 tgaaaaaaa caggc aacaccact 6 M 171 tgaaaaaaa ctatt aacatccct eighteen G 459 agaaaaaaa cattagatcagaagaaaactggc aacacttct 21 L 52 tgaaaaaaa Ihnv ggcacttcagttg one hundred NP 70 tagaaaaaaa t ggcactatagtgc 25 P 32 agaaaaaaa t ggcacgcaagtgt 41 M2 90 agacagaaaaaaa t ggcacttttgtgc 39 G 28 agacagaaaaaaa c ggcacatttgtgc fourteen NV -6 agatag aaaaaaa t ggcacttttgtgc 64 L 41 agatacaaaaaaaa Virus
Sendai agggtcaaag 54 NP 34 taagaaaaa ctt agggtgaaag 93 P 74 taagaaaaa ctt agggtgaaag 22 M 85 taagaaaaa ctt agggataaag 43 F 61 taagaaaaa ctt agggtgaaag 46 Hn 95 taagaaaaa ccc agggtgaatg eighteen L 76 taagaaaaa HPIV1 agggtaaag 54 N 31 aagtaagaaaaa ctt agggtgaatg 93 P 71 aattaagaaaaa ctt agggtcaaag 22 M 82 aaataagaaaaa cgt agggacaaag 265 F 76 aagtaagaaaaa ctt agggttaaag 46 Hn 98 gaataagaaaaa ctt agggttaatg eighteen L 88 tagtaagaaaaa bPIV3 aggattaaag 45 N 34 taagaaaaa ctt aggattaatg 69 P 116 taagaaaaa ctt aggatgaaag 22 M 51 aaacaaaaa ctt aggatcaaag 101 F 26 tacaaaaaa ctt aggaacaaag 63 Hn 86 taataaaaaa ctt aggagaaaag 12 L 62 taagaaaaa hPIV3 aggattaaag 45 NP 34 taagaaaa ctt aggattaag 69 P 53 taagaaaaa ctt aggattaaag 22 M 51 taatcaaaaa ctt aggacaaaag 183 F 28 ttataaaaaa ctt aggagtaaag 63 Hn 81 tataaaaaa ctt aggagcaaag 12 L 62 taataaaaa Virus
measles aggattcaaag 42 N 49 ttataaaaaa ctt aggaaccagg fifty P 62 ttataaaaaa ctt aggagcaaag 22 M 417 taaacaaaa ctt agggccaagg 574 F 128 taattaaaa ctt agggtgcaag 10 H 74 ttaagaaaaa cgt agggtccaag 12 L 59 ttaaagaaaa Virus
plague
large
horns
Togo
cattle aggattcaag 42 N 49 ttataaaaaa ctt aggacccagg 49 P 62 ttataaaaaa ctt aggagcaaag 22 M 408 taccaaacaaaa ctt agggtcaaag 579 F 125 tataaacaaaaa ctt aggatgcaag 10 H 98 ttataaaaaa cgt agggtccaag 12 L 60 taaagaaaa Cdv agggtcaatg 42 N 49 ttataaaaaa ctt aggacccagg 49 P 62 ttataaaaaa ctt aggacacaag 22 M 394 taattaatcaaaa ctt agggtccagg 16 F 122 ttaaagaaaa ctt agggctcagg 10 H one hundred ttataaaaa
aa cta aggatccaag 12 L 53 tacgaaaaaaaaa Sv5 aggtccggaacct 83 NP 92 tttaaagaaaaaaaa t aggcccggcgggt 47 P 54 ttttagaaaaaa cgattaacgataaata agcccgaacact twenty M 193 Ttcaaagaa
aa caatcatattaagactatccta agcacgaacccat fifteen F 25 ttttaagaaaaaaa cgat aggaccgaacct 67 SH 64 ttttaaagaaaaaaa ta aggcccgaacact 54 Hn 99 ttttaagaaaaa ccaagagaacaat aggccaga atg -3 L 22 tttaagaaaaaa VSV aacagtaatc 3 NP 42 tgaaaaaaa ct aacagatatc 0 NS -3 tga aaaaaa gt aacagatatc 31 M 98 tgaaaaaaa ct aacagagatc 19 G 98 tgaaaaaaa ct aacagcaatc 0 L 31 tgaaaaaaa Ndv acgggtagaa 56 NP 200 ttagaaaaaa gt acgggtagaa 73 P 169 ttaagaaaa
aa t acgggtagaa 24 M 102 Ttagaaaa
aa c acgggtagaa 36 F 73 ttaagaaaaa ctaccggttgtagatgaccaaaggacgatat acgggtagaa 81 Hn 166 ttaagaaaa
aa tgtaagtggcaatgagatacaaggcaaaacagctcatggtaaataat acgggtagga one L 67 ttagaaaaaa

In a preferred recombinant MV virus vector of the invention, GS, GE sequences and non-coding regions are derived from a gene of the same MV virus.

Methods for producing a recombinant MV viral vector carrying an additional transcription unit containing a foreign gene are well known in the art. For example, Table 2 provides links to documents describing the production of such recombinant vector viruses for various types of MV viruses. In principle, the method used in the present invention is the same as the prototype, except that the foreign gene inserted into the MV virus genome is flanked by the corresponding 3 ′ and 5 ′ non-coding regions described above.

In the general case of the method of the invention, a recombinant MV viral vector is obtained by embedding an isolated nucleic acid molecule containing (i) a foreign gene flanked by the 3 ′ and 5 ′ non-coding regions described above and (ii) the corresponding transcriptional control sequences in the MV virus genome so that in the resulting MV virus vector, before and after the foreign gene, there are regions of the connection of the MV virus genes, in particular, a fragment of the genomic nucleotide sequence containing the elements of GE-IGR-GS. The presence of these upstream and downstream elements ensures appropriate transcription of not only the integrated foreign genes, but also the homologous MV virus genes located above and below the embedded foreign gene.

Moreover, in the method of the present invention, the isolated nucleic acid molecule and the MV virus genome are used in the form of cDNA (+ sense). This provides ease of manipulation with the desired nucleotide molecules and their integration into the viral genome.

As a rule, to embed a foreign gene, you can use different parts of the genome between two genes, i.e. a foreign gene can be inserted in the region between the genes (IGR), 3 'or 5'-non-coding regions of the gene, as well as in the 3'-promoter-proximal (between N / NP genes) or the 5'-distal end (after L genes) genome.

It is best to embed a foreign gene before the N / NP gene, between the NP-P, P-M, M-G / F, G / F-HN, HN-L and after the L gene.

The easiest way to embed a foreign gene is to use a restriction enzyme (RE) recognition sequence already existing in one of these regions by cutting it with the enzyme and inserting a suitable expression cassette. Since natural recognition sequences for restriction enzymes are not always located in the right place, restriction enzyme recognition sequences can be inserted into the genome by commonly used methods, such as site-directed or PCR mutagenesis. Examples of suitable IGR sites for embedding a foreign gene are presented in table 3.

The composition of the transcriptional cassette for embedding depends on the site of embedding. For example, in the case when the transcription cassette is inserted into the IGR, it may contain the following elements: 3'-restriction enzyme recognition site-GS-non-coding region-open reading frame (foreign gene) -non-coding region-GE-5'-restriction enzyme recognition site.

Alternatively, when the transcription cassette is inserted into the 5'-non-coding region of the natural MV virus gene, it may consist of: 3'-restriction enzyme recognition site-GE-IGR-GS-non-coding region-open reading frame (foreign gene) non-coding region-5'-restriction enzyme recognition site.

Similarly, when a transcriptional cassette is inserted into the 3'-non-coding region of the natural MV virus gene, it can consist of: 3'-restriction enzyme-non-coding recognition region-open reading frame (foreign gene) non-coding region-GE-IRG-GS -5'-restriction enzyme recognition site.

Obtaining such transcriptional cassettes and embedding them in the genome of the MV virus involves the use of routine biological techniques, examples of which are given in the literature references listed in table 2 and in the examples of the present description. In particular, site-directed and PCR mutagenesis can be used for these purposes (Peeters et al., 1999, supra; Current Protocols in Molecular Biology, eds .: FM Ausubel et al., Wiley NY, 1995 edition, pages 8.5.1 .-8.5.9; Kunkel et al., Methods in Enzymology Vol. 154, 376-382, 1987).

Moreover, the recombinant MV virus vector of the present invention can be obtained using the generally recognized reverse genetics technique, which makes it possible to carry out genetic modifications of non-segmented (-) RNAs of the Mononegavirales order viruses (for example, a review is given in Conzelmann, KK, Current Topics Microbiol Immunol. 203 , 1-41, 2004; and Walpita et al., FEMS Microbiol. Letters 244 , 9-18, 2005).

In accordance with this technique, the corresponding cells are transfected with a vector containing a nucleotide sequence encoding a full-sized gene, or preferably an antigen (positive sense strand) of the MV virus, together with one or more vectors including cDNA molecules containing nucleotide sequences that encode the necessary auxiliary proteins, under conditions, the ability to transcribe and co-express the (anti) genome of the MV virus and auxiliary proteins and products MV-th recombinant vector. In this technique, said nucleic acid molecule encoding the full-sized (anti) genome of the MV virus contains the additional transcriptional unit described above.

By vector is meant a replicon, such as a plasmid, phage or cosmid, to which another DNA segment can be attached to replicate the attached DNA segment and its transcription and / or expression in a cell transfected with this vector.

The preferred transcription vector of the full-sized genome is a plasmid containing a cDNA sequence encoding the (anti) MV virus gene flanked by a T7 phage polymerase promoter at its 5'-end and a ribozyme sequence (hepatitis delta) at its 3'-end, although promoters can be used RNA polymerase of phages T3 and SP6.

For intracellular expression of the corresponding auxiliary proteins, it is preferable to use plasmids containing cDNA sequences encoding these proteins under the control of the corresponding expression control sequences, for example, under the control of the T7 phage polymerase promoter.

In a particularly preferred method for producing the recombinant MV virus vector of the present invention, expression plasmids encoding the N (or NP), P and L proteins of the MV virus are used.

The number and ratio of transfected auxiliary plasmids used by this reverse genetics technique are in a wide range. The ratio for auxiliary plasmids N: P: L can vary from 20: 10: 1 to 1: 1: 2, and the protocols giving efficient transformation are known for each virus.

An exact copy of genomic RNA is synthesized in a transfected cell by the combined action of the T7 phage RNA polymerase promoter and a ribozyme sequence, and then this RNA is packaged and replicated using auxiliary viral proteins expressed from parallel transfected expression plasmids.

Preferably, the expression of phage T7 polymerase is provided by a recombinant smallpox vaccine virus that infects transfected cells, in particular vTF7-3 smallpox vaccine virus, although other vectors based on recombinant smallpox viruses such as avian pox virus can be used to express phage T7 polymerase for example, fpEFLT7pol, or other viral vectors.

The reconstituted virus can be easily separated from the vaccinia virus by simple physical methods, such as filtration. Sendai virus or NDV can be restored by inoculating fertilized eggs with the supernatant of transfected cells.

In an even more preferred embodiment, cell lines constitutively expressing RNA polymerase (T7 phage) and / or one or more of the necessary auxiliary proteins are used for transfection with transcriptional and expression vectors.

For example, measles virus can be restored in the cell line of the kidney of a human embryo, 293-3-46, in which both phage T7 RNA polymerase and auxiliary measles virus proteins N and P are expressed (Radecke et al., EMBO J. 14 , 5773- 5784, 1995). Another suitable cell line that can be successfully used in the present invention is based on BSR cells expressing T7 phage RNA polymerase, namely the BSR-T7 / 5 cell line (Buchholz et al., J. Virol. 73 , 251-259 , 1999).

In addition, more detailed information on reverse genetics methods used in the present invention to obtain the MV virus of the present invention is disclosed in a review by Conzelmann, K.K. (supra) and in example 1.

Due to the ability of recombinant MV viral vectors to stably express foreign genes, vectors have been developed for prophylactic and therapeutic use.

In the recombinant MV virus vector of the present invention, the foreign gene may vary depending on the particular type of MV virus and the use of the viral vector.

A foreign gene can encode an antigen of a (other) microbial pathogen (e.g., virus, bacteria or parasite), mainly a foreign gene encodes a pathogen antigen that can elicit a protective immune response.

For example, sequences of heterologous genes that can be inserted into the viral vectors of the invention include, but are not limited to, influenza glycoprotein genes, in particular avian influenza hemagglutinin H5 and H7 genes, genes derived from infectious bursitis virus (IBDV), especially from strain VP2 (IBDV virus), genes derived from infectious bronchitis virus (IBV), feline leukemia virus, canine distemper virus, equine infectious anemia virus, rabies virus, ehrlichia, in particular Ehrlichia canis , respiratory syncytial virus whiskers, parainfluenza viruses, metapneumoviruses and measles virus.

Alternatively, a foreign gene may encode a polypeptide immunomodulator that is capable of enhancing or modulating the immune response to a viral infection, for example, by co-expression of a cytokine such as interleukin (e.g. IL-2, IL-12, IFN-γ, TNF-α or GM-CSF).

The Mononegavirales order includes viruses that are capable of replication in the human and animal body, or in the body of only a person and only an animal (for example, rabies virus or Newcastle disease virus). Therefore, a foreign gene can be selected from a wide range of microbial pathogens in humans and animals.

Although all MV viruses can be used as the vector virus of the present invention, in a preferred embodiment, the recombinant MV virus vector is a virus of the Rhabdoviridae family, preferably of the genus Lyssavirus or Novirhabdovirus, more preferably a type of rabies virus or IHNV, respectively.

In yet another preferred embodiment, the recombinant MV virus is a virus of the Paramyxoviridae family, preferably of the Respovirus genus, in particular of the hPlV3 or bPIV3 genus, of the Morbillivirus genus, in particular of the CDV genus, of the Pneumovirus genus, in particular of the RSV genus, and of the Avulavirus genus, in particular, the view of NDV.

In a particularly preferred embodiment, the present invention relates to a recombinant MV viral vector, wherein the virus is Newcastle disease virus (NDV). Since NDV is capable of replicating in humans and animals, in particular in poultry, more specifically chickens, the recombinant NDV vector according to the invention may contain a foreign gene that encodes a pathogen antigen, in particular a respiratory pathogen, or an immunomodulator that can induce the corresponding immune the answer is in humans or in any of the listed animals.

Reverse genetics methods for genetic manipulation of NDV are described in detail for the case of NDV in Peeters et al. (J. Virology 73 , 5001-5009, 1999), Römer-Oberdörfer et al. (J. Gen. Virol. 80 , 2987-2995, 1999) and in a review by Conzelmann, KK (supra). In addition, it is also known that NDV can be used as a vector for the expression of foreign genes, for example, to stimulate the immune response in animals infected with the NDV vector (Nakaya et al., 2001, supra) and Swayne et al., Avian Dis. 47 , 1047-50, 2003).

A foreign gene can be successfully introduced at various positions of the NDV genome, as has been generally described above for MV viruses. In particular, in the recombinant NDV vector of the invention, a foreign gene (as part of the corresponding transcription unit) can be inserted between the following NDV genes: NP-P, PM, MF, F-HN, HN-L and in the 3'-proximal and 5 ' distal loci (Zhao et al., 2003, supra; Nakaya et al., 2001, supra), preferably in the 3'-proximal, PM, MF and F-HN regions, with the F-HN region being most preferred.

In addition, in the recombinant NDV vector of the present invention, non-coding regions flanking a foreign gene can be obtained from all natural NDV genes, in particular from N, P, M, F or HN genes, preferably from the HN gene.

In a specific embodiment, the invention relates to a recombinant NDV vector in which an additional transcriptional unit is located between the F-HN genes, and the inserted foreign gene is flanked by non-coding regions of the HN gene from the NDV.

More specifically, the invention relates to an NDV vector in which the 3 ′ and 5 ′ non-coding regions (and, optionally, GS and GE sequences) have nucleotide sequences shown as in SEQ ID NO: 1 and 2 or 3 and 4 .

The recombinant NDV vector of the present invention has the advantage of using the induction of an immune response against other pathogens in poultry, in particular chickens. Therefore, the recombinant NDV vector preferably contains a foreign antigen encoding an immune response antigen of a bird pathogen, in particular influenza virus, Marek's disease virus (MDV), infectious laryngotracheitis virus (ILTV), infectious bronchitis virus (IBV), infectious bursitis virus (IBDV), chicken anemia virus (CAV), reovirus, bird retrovirus, bird adenovirus, turkey rhinotracheitis virus (TRTV), E. coli, Eimeria, Cryptosporidia species, mycoplasmas such as M.gallinarum, M.synoviae and M.meleagridis , Salmonella-, Campylobacter-, Ornithobacterium (ORT) or Pasteurella sp.

More preferably, the recombinant NDV vector contains a foreign gene encoding the antigens AIV, MDV, ILTV, IBV, TRTV, E. coli, ORT or mycoplasma.

In particular, the recombinant NDV vector mutant contains the influenza virus hemagglutinin (HA) gene, preferably avian influenza virus (AlV) gene, more preferably the highly pathogenic H5 or H7 AIV strains hemagglutinin.

In principle, in accordance with the invention, the HA gene of all influenza strains (birds) can be used. The nucleotide sequences of many HA genes are described in the art and can be obtained from nucleotide databases, such as GenBank or EMBL.

The hemagglutinin gene (HA) of the recently isolated strain A / chicken / Italy / 8/98 of the highly pathogenic subtype H5N2 AIV can be effectively used as a foreign gene of the present invention, as described above. The gene was transcribed backwards, the gene was cloned into the pcDNA3 eukaryotic expression vector (Invitrogen) and its nucleotide sequence was determined (Lüschow et al., Vaccine, vol.19, p.4249-4259, 2001, access number in the Gen Bank database No. AJ305306 ) From the obtained expression plasmid pCD-HA5, the HA gene can be obtained by amplification from specific primers that create artificial restriction sites that allow the integration of the HA gene into the NDV genomic sequences.

In a further embodiment, the HA gene of strain A / chicken / Italy / 445/99 of the highly pathogenic subtype H7N1 AIV can be used as a foreign gene in the present invention, as described above. The HA gene was obtained by reverse transcription and PCR amplified. Product length 1711 bp cloned into pUC18 vector (Amersham) digested with restriction enzyme SmaI and sequenced (Veits et al., J. Gen. Virol. 84 , 3343-3352, 2003; GenBank accession number is AJ580353).

In a particularly effective recombinant MV virus vector of the present invention, the MV vector virus is attenuated, i.e. the vector virus is not pathogenic for the target animal or its virulence is significantly reduced compared to the wild-type virus. Many MV viruses used as viral vectors in the present invention have safety attenuated live attenuated vaccines over a long period of time, such as measles and NDV viruses, and other viruses such as SeV and VSV are considered non-pathogenic in humans. In addition, there are generally accepted methods for the production and screening of attenuated viruses with limited replication and infection. Such techniques include serial (cold) passage of the virus in a heterologous substrate and chemical mutagenesis.

The recombinant NDV vector of the invention can be obtained from any conventional Newcastle disease vaccine strain. Examples of such suitable NDV strains present in commercially available vaccines are: Clone-30®, La Sota, Hitchner B1, NDW, C2 and AV4, with Clone-30® being the preferred strain.

The inventors have also found that the recombinant MV virus vector of the present invention is capable of eliciting a protective immune response in animals.

Therefore, another embodiment of the invention relates to a vaccine against a microbial pathogen containing the recombinant MV virus vector described above, in live or inactivated form, and a pharmaceutically acceptable carrier or diluent.

The vaccine according to the invention can be obtained by well-known methods, such as methods commonly used for commercially available live and inactivated MV virus vaccines.

Briefly, a recombinant MV virus vector is introduced into a susceptible substrate and propagated until the desired titer of the virus is reached, after which virus-containing material is collected. Then, a pharmaceutical preparation having immunogenic properties is obtained from the collected material.

Any substrate that is capable of supporting replication of the recombinant MV virus vector can be used in the present invention. Both prokaryotic and eukaryotic cells can be used as a substrate, depending on the MV virus. Suitable host cells may be cells of vertebrates, such as primates. Examples of suitable cells are: HEK, WI-38, MRC-5 or H-239 human cell lines, Vero monkey cell line, CHO, BHK rodent cell lines, MDCK dog cell line, or bird cells CEF or CEK.

A particularly suitable substrate for propagating the recombinant NDV vector of the present invention is pathogenic (SPF) fertilized eggs. Fertilized eggs can, for example, be inoculated with 0.2 ml of NDV-containing allantoid fluid containing at least 10 ^2.0 EID ₅₀ per egg. Preferably, inoculate the fertilized 9-11 day old eggs with 10 ^5.0 EID ₅₀ and then incubate for 2-4 days at 37 ° C. After 2-4 days, the ND virus product can be collected, preferably by withdrawing the allantoid fluid. Then, the liquid can be centrifuged for 10 min at 2500 g, followed by filtration of the supernatant through a filter (100 microns).

The vaccine of the invention comprises a recombinant MV viral vector together with a pharmaceutically acceptable carrier or diluent commonly used for such compositions.

A live virus-containing vaccine can be prepared and sold as a suspension or as a lyophilisate. Carriers include stabilizers, preservatives and buffers. Thinners include water, aqueous buffers and polyalcohols.

In another aspect, the present invention relates to a vaccine containing a recombinant MV viral vector in inactivated form. The main advantages of an inactivated vaccine are its safety and the ability to induce a high titer of long-lived protective antibodies.

The goal of the inactivation of viruses collected after the breeding stage is to eliminate the ability of viruses to reproduce. This can usually be achieved by known chemical or physical means.

If desired, the vaccine of the invention may contain an adjuvant. Examples of compounds and compositions having adjuvant activity suitable for this purpose are hydroxide, phosphate or alumina, oil-in-water or water-in-oil emulsions based on, for example, a mineral oil such as Bayol F® or Marcol 52® , or vegetable oil, such as vitamin E acetate, and saponins.

The vaccines of the invention can be administered by any known effective method, which depends on the type of MV virus vector. Suitable routes of administration include parenteral, intranasal, oral and aerosol vaccination.

It is preferable to administer the NDV vector vaccine according to the invention using inexpensive mass application methods commonly used for vaccination against NDV. For vaccination against NDV, these methods include vaccination with drinking water and aerosol vaccination.

The vaccine according to the invention contains an effective dosage of a recombinant MV viral vector as an active ingredient, i.e. a certain amount of immunizing MV virus material that will induce immunity in vaccinated birds against antigenic stimulation by a virulent microbial organism. In the present description, immunity is defined as the induction after vaccination of a sufficiently high level of protection against mortality and clinical symptoms in a population of people or animals compared with an unvaccinated group. In particular, the vaccine according to the invention protects the majority of vaccinated people or animals from the onset of clinical symptoms of disease and mortality.

Typically, a live vaccine can be administered at a dosage of 10 ^2.0 -10 ^8.0 culture / embryonic infectious doses (TC / EID ₅₀ ), preferably at a dosage varying between 10 ^4.0 -10 ^7.0 TC / EID ₅₀ . Inactivated vaccines may contain the antigenic equivalent of 10 ^4.0 -10 ^9.0 TC / EID ₅₀ .

The invention also relates to combination vaccines containing, in addition to the recombinant MV virus vector of the invention, a vaccine strain capable of inducing protection against yet another pathogen.

EXAMPLES

Example 1: Creation of a recombinant MV viral vector expressing the avian influenza virus HA gene (NDV / AIVH5)

Viruses and cells

Reconstituted recombinant NDV and influenza virus A / chicken / Italy / 8/98 isolate were propagated in pathogen-free (SPF) 10-day-old fertilized chicken eggs. Used the velogenic strain of Herts 33/56 of the Newcastle disease virus and the Clone 30 vaccine (Nobilis®) against NDV.

BSR-T7 / 5 cells stably expressing T7 phage RNA polymerase were used to restore infectious NDV from cDNA.

Construction of cDNA Encoding NDV Antigenic RNA Containing HIV AIV Gene

The numbering in parentheses used in the present description to identify nucleotide positions in the NDV genome and amino acid residues in the NDV proteins is described in the article by Römer-Oberdörfer et al. (J. Gen. Virol. 80 , 2987-2995, 1999, access number in the EMBL database No. Y18898). Plasmid pflNDV expressing the full-size Clone 30 antigenic RNA (Römer-Oberdörfer et al., Supra) was used to insert the H5 AIV gene, which was obtained by amplification of the pCD-HA5 plasmid (Luschow et al., Supra) from specific primers with artificial M restriction sites (PH5F1: 5'- cta a ac gcg t aa aat gga gaa aat agt gc -3 '(SEQ ID NO: 5) and PH5R1: 5'- tcg g ac gcg t tt aaa tgc aaa ttc tgc act g -3' (SEQ ID NO: 6), MluI restriction sites are underlined) for rNDV / AIVH5-A and with NcoI or AflII sites (PH5F2: 5'-cct t cc atg g ag aaa ata gtg ctt c -3 '(SEQ ID NO: 7) and PH5R2: 5'- cct c ct taa g ta taa ttg act caa tta aat gca aat tct gca ctg caa tga t cc -3 '(SEQ ID NO: 8), restriction sites are underlined) for rNDV / AIVH5-B . The H5 gene in the Clone 30 antigen (FIG. 1A) was inserted using MluI sites as previously described for embedding GFP (Engel-Herbert et al., J. Virol. Methods 108 , 19-28, 2003). Briefly, to create a full-length plasmid pflNDV / AIVH5-A, the open H5 reading frame was amplified with primers containing artificial MluI restriction sites (see above), which were used to insert the open H5 reading frame into the minimal gene cassette between the F and HN NDV genes (Fig. 1A). The construction of a full-size plasmid containing the H5 gene AIV to create rNDV / AlVH5-B is shown in figure 1B. Mutagenesis was performed using the Quik Change® II XL site-directed mutagenesis kit (Stratagene). For this, we used the plasmid pUC 18 (pUCNDV1) containing the NotI / BsiWI fragment (nucleotides 4953-8852) of the Clone 30 genome and the following primers: MP1 (5'-gac aac agt cct caa cca tgg acc gcg ccg -3 ') (SEQ ID NO: 9) and MP2 (5'-ctg gct agt tga gtc aat tct taa gga gtt gga aag atg gc -3 ') (SEQ ID NO: 10) for mutagenesis A (Fig. 1B), resulting in plasmid pUCNDV1a with newly introduced NcoI and AflII sites (restriction sites in primers are underlined). After cleavage of NcoI and AflII, the open HN reading frame from Clone 30 was replaced with an amplified open H5 reading frame from AIV. In mutagenesis B, MP3 primers (5'-caa aac agc tca tgg tac gta ata cgg gta gga cat gg -3 ') (SEQ ID NO: 11) were used to create the SgfI and SnaBI restriction sites in the region between the genes in front of the L gene of the pUCNDVH5 plasmid. and MP4 (5'-gta agt ggc aat gcg atc gca ggc aaa aca gct cat gg -3 ') (SEQ ID NO: 12), resulting in plasmid pUCNDV / AIVH5-1b (Figure 1B). In mutagenesis C, MP3 and MP5 primers (5'-gaa aaa act acc ggc gat cgc tga cca aag gac gat ata cgg g -3 ') were used (SEQ ID NO: 13) to obtain plasmid pUCNDV1c in order to introduce SgfI and SnaBIs used to insert the HN gene from Clone 30 into the region between the genes in front of the L gene in plasmid pUCNDVH5_1b. In the end, the NotI / BsiWI fragment was replaced by the NotI / BsiWI fragment from the plasmid pUCNDVH5_1c (Fig. 1B). The length of the newly created full-sized genes was a multiple of six (16938 nucleotides for rNDV / AIVH5-A and 17196 nucleotides for rNDV / AIVH5-B).

Transfection and reproduction of the virus

Transfections, virus propagation and confirmation of the recovery of the infectious virus were performed as previously described (Römer-Oberdörfer et al., Supra; Engel-Herbert et al., Supra). The only difference was that the total amount of DNA used in transfection was 20 μg (10 μg of the plasmid containing the full-sized genome, 6 μg of the plasmid pCiteNP, 2 μg of the plasmid pCiteP and 2 μg pCiteL).

results

An open reading frame of the H5 gene from AIV was inserted between the F and HN genes of the previously described plasmid pflNDV (Römer-Oberdörfer et al., Supra). For this, the open reading frame H5 AIV was amplified from the A / chicken / Italy / 8/98 (H5N2) isolate of the bird flu virus using the plasmid pCD-HA5 (Luschow et al., Supra) and specific primers with restriction sites Mlu I which were used to embed an open reading frame of the H5 gene of the avian influenza virus into a single Mlu I site of the plasmid pflNDVoligo1; (Engel-Herbert et al., Supra), resulting in the plasmid pflNDV / AIVH5-A (figa). In this design, the open H5 reading frame of the bird flu virus was flanked by artificial start (GS) and terminal (GE) gene sequences in the region between the F and HN NDV genes. To create a full-length plasmid pflNDV / AlVH5-B, the open reading frame of the HN gene from plasmid pUCNDV1a was replaced by the amplified open reading frame of the H5 gene in the form of an Nco I / Afl II fragment ( Fig. 1B ). In the obtained plasmid pUCNDVH5, restriction sites Sgf I and SnaB I were created in the region between the genes below the H5 gene, resulting in plasmid pUCNDVH5_1b (Fig. 1B). The created restriction sites Sgf I and SnaB I were used to insert the HN gene from plasmid pUCNDV1c, in which the HN gene is also flanked by the restriction sites Sgf I and SnaB I ( Fig. 1B ). Finally, the obtained plasmid pUCNDVH5_1c was used to replace the Not I / BsiW I fragment from the plasmid pflNDV (Fig. 1B). The resulting plasmid pflNDV / AlVH5-B differs from the plasmid pflNDV / AIVH5-A because non-coding regions of the HN gene from NDV were additionally inserted between the transcriptional control elements (GS, GE) and the open reading frame of the H5 gene.

Recombinant Newcastle disease viruses rNDV / AIVH5-A and rNDV / AIVH5-B were restored in BSR-T7 / 5 cells transfected with the corresponding full-length cDNA and auxiliary plasmids, as described previously (Römer-Oberdörfer et al., Supra; Engel-Herbert et al. al., supra). To restore the virus, injections were performed by transfection supernatants into the allantoid cavity of 10-day-old fertilized chicken eggs and incubated for 5 days. The allantoid fluid was collected and analyzed for the presence of the virus using a hemagglutination test or indirect immunofluorescence (IF) method. The allantoid fluid containing the virus was used in re-passaging the virus in eggs for further virus propagation. The presence of the inserted H5 gene in the rNDV / AIVH5-A and rNDV / AIVH5-B viruses genome was confirmed by RT-PCR and sequencing (data not shown). Figures 2A and 2B show the nucleotide sequence of regions flanking the open reading frame of the HN gene in the NDV and the open reading frame of the H5 gene in the NDV vector.

Example 2: in vitro characterization of the vector NDV / AIVH5

RNA analysis

CEF cells were infected with NDV Clone 30, rNDV / AIVH5-A, rNDV / AIVH5-B and AIV A / chicken / Italy / 8/98 (H5N2) with a multiplicity of infection (MOI) of 10 per cell and incubated for 8 hours at 37 ° C. Total RNA was obtained from infected and uninfected cells, separated on a denaturing agarose gel, and hybridized with radiolabeled cRNA. Plasmids pCD-HA5 and pCD-NDVHN, which contained an open reading frame of the H5 AIV gene A / chicken / ltaly / 8/98 (H5N2) and the HN NDV Clone 30 gene, were used for in vitro transcription of ³² P-labeled cRNA (SP6 / T7 Transcription kit, Roche).

In order to confirm the transcription of the H5 gene from AIV integrated into rNDV / AIVH5-A and -B, Northern blots were performed on total RNA from primary fibroblasts of chicken embryos infected with recombinant NDV / AIVH5. RNA preparations from cells infected with NDV Clone 30 and AIV A / chicken / Italy / 8/98 (H5N2) were used as a control. Using specific antisense cRNA, transcription of the inserted H5 gene from AIV was detected for rNDV / AIVH5-A as well as for rNDV / AIVH5-B (FIG. 3). It was noted that the AIV-H5B transcript was extended by approximately 81 nt and was more common than the AIV-H5A transcript.

Western blot

CEF cells were infected with NDV Clone 30, rNDV / AIVH5-A, rNDV / AIVH5-B and AIV A / chicken / Italy / 8/98 (H5N2) and incubated for 20 hours at 37 ° C. Lysates of infected and uninfected control cells were separated into SDS-PAGE (approximately 10 ⁴ cells per lane) and transferred to nitrocellulose filters (Trans-Blot® SD cell, Bio-Rad). Blots were incubated with a polyclonal rabbit antiserum against NDV or a polyclonal chicken antiserum against subtype H5 AIV at a dilution of 1: 20,000 and 1: 2500, respectively. The binding of peroxidase-conjugated secondary antibodies was detected by the chemiluminescent method using a SuperSignal® West Pico Chemiluminescent Substrate chemiluminescent substrate (Pierce) and X-ray film (Hyperfilm® MP, Amersham).

In the Western blot analysis, H5 protein was detected only in cells infected with rNDV / AIVH5-B. The H5 subtype-specific AIV antiserum detected two noticeable proteins with an approximate molecular weight of 70 and 50 kD and a barely visible protein with an approximate molecular weight of 25 kD that were not found in cells infected with NDV Clone 30 (Figure 4).

Indirect immunofluorescence

For indirect fluorescence analysis, CEF cells were infected with low MOI viruses NDV Clone 30, rNDV / AIVH5-A, rNDV / AIVH5-B and AIV A / chicken / Italy / 8/98 (H5N2) for 20 hours. After fixation in methanol and acetone (1: 1), the cells were then incubated with either a polyclonal rabbit antiserum against NDV or a polyclonal chicken antiserum against subtype H5 AIV at a dilution of 1: 3000 and 1: 100, respectively. After incubation with F (ab) ₂ fragments of anti-rabbit IgG and fluorescein-conjugated anti-chicken IgG antibodies, the samples were analyzed using conventional fluorescence microscopy.

H5 expression in infected cells was tested by indirect immunofluorescence. After incubation with an NDV-specific antiserum, pronounced fluorescence was observed in cells infected with NDV Clone 30, rNDV / AIVH5-A and rNDV / AIVH5-B, but not in cells infected with AIV A / chicken / Italy / 8/98 (H5N2), or uninfected cells (Fig. 5, right panel). Incubation with antiserum specific for the H5 subtype of AIV showed a marked fluorescence of cells infected with AIV. When comparing the two recombinants, rNDV / AIVH5-B showed a more intense H5 specific fluorescence than rNDV / AIVH5-A, indicating a higher level of expression of the H5 protein (Figure 5, left panel).

Immunoelectron Microscopy

Viral cells were sorbed on a copper mesh with a formvar substrate for 7 minutes. The nets were washed four times with a PBS solution containing 0.5% bovine serum albumin, and then incubated with NDV-specific or subtype-specific H5 AIV antiserum for 45 minutes. After several washes, PB nets were incubated for another 45 minutes with protein A conjugated to colloidal gold (10 nm, PAG 10, Biocell International) and secondary rabbit antibodies against chicken immunoglobulins conjugated to colloidal gold (10 nm, RCHL 10, Biocell International). After the final washings with PB buffer, the virus particles were tinted with phosphofungstate acid (PTA, pH 7.2) and examined using an electron microscope.

When studying virions from NDV Clone 30 or rNDV / AIVH5-A, staining was observed only when using NDV-specific antiserum. In contrast, for rNDV / AIVH5-B, staining was observed when using anti-NDV antiserum and also when using anti-AIV antiserum, which demonstrated that rNDV / AIVH5-B virions contain H5 hemagglutinin. Gold particles were found predominantly on the surface of rNDV / AIVH5-B virions, which indicated that hemagglutinin was attached to the viral membrane.

Example 3: in vivo characterization of the NDV / AIVH5 vector

Assessment of protection provided by recombinant rNDV / AIVH5-A and rNDV / AIVH5-B:

One-day-old chickens were randomly divided into two groups and oculonasal vaccination was performed with 10 ⁶ EID ₅₀ rNDV / AIVH5-A or the commercially available NDV Clone 30 vaccine (Nobilis®, Intervet, NL) by spraying. On day 28, a second vaccination was performed in the same manner. Blood samples were taken on day 12 after the second immunization to assess the presence of anti-NDV and H5 AIV antibodies using a hemagglutination test. Two weeks after the second vaccination, the immunized groups were separated and one part of each group was infected oculonasally with 10 ⁸ EID _{50 of the} highly pathogenic isolate AIV A / chicken / Italy / 8/98 (H5N2). Other chickens were used to evaluate the efficacy of the vaccine against velogenic NDV. For this, birds and additional control animals received 10 ^5.3 EID ₅₀ strain Herts 33/56 of the NDV virus intramuscularly.

After immunization and test infection, all birds were monitored daily for 10 days and the clinical signs were monitored, while the birds were classified as healthy (0), sick (1; one of the following symptoms: respiratory symptoms, depression, diarrhea, cyanosis, edema, anxiety), seriously ill patients (2; more than one of the following symptoms: respiratory symptoms, depression, diarrhea, cyanosis, edema, anxiety) or dead (3). A clinical score was calculated, which is the average of all chickens in the group over this period. Finally, three weeks after infection, blood samples were taken from surviving animals to determine the titer of antibodies against AIV and NDV.

The recombinant Newcastle disease virus rNDV / AIVH5-B was tested in a separate animal test using an almost identical experimental design. The only difference was that immunization with 10 ⁶ EID ₅₀ rNDV / AIVH5-A or NDV Clone 30 vaccine was performed in both groups oculonasally and did not carry out NDV infection.

All data from these experiments are combined in table 4 and figure 6. The serum of immunized chickens was analyzed using a hemagglutination test three weeks after vaccination, but in both cases could not detect HA-specific antibodies in serum. All animals in both groups showed a high level of NDV-specific antibodies, after the first immunization (average hemagglutination titers were 26-27), the animals were completely protected against infection by velogenous NDV, while all control animals died within 4 days with typical signs of Newcastle disease. As expected, AIV infection caused severe illness in chickens immunized with NDV Clone 30 with a mortality rate of 90%. Animals from the rNDV / AlVH5-A immunized group survived with a lethal dose of the highly pathogenic AIV, but all chickens showed different signs of bird flu with a clinical rating of 0.64, indicating poor protection. While after infection with the highly pathogenic avian influenza A virus, chickens immunized with rNDV / AIVH5-B were completely protected from any signs of the disease.

Table 4
Summary of animal experiments using rNDV / AIVH5-A and rNDV / AIVH5-B 1. Immunization Timeline ^one) rNDV / AIVH5-A oculonasally Clone 30 spray the control Timeline ^one) rNDV / AIVH5-B oculonasally Clone 30 oculo-nasal EID ₅₀ /
animal 10 ^5.7 10 ^6.0 - 10 ^6.0 10 ^6.0 Mortality 1-10 d.p. 0/24 0/34 - 1-10 d.p. 0/5 0/5 Incidence 1-10 d.p. 6/24 5/34 - 1-10 d.p. 0/5 0/5 clinical assessment ²⁾ 0,034 0.016 0 0 NDV-specific
antibodies 17 d.p. 22/22 34/34 - 21 d.p. 5/5 5/5 ⌀ HI title 2 ^5.6 2 ^7.2 2 ^5.6 2 ^7.6 NA-specific
antibodies 17 d.p. 22/22 34/34 21 d.p. 5/5 5/5 ⌀ HI title 0 0 0 0

2. Immunization 28 D.P.I. rNDV / AIVH5-A oculonasally Clone 30 spray The control 28 D.P.I. rNDV / AIVH5-B oculonasally Clone 3 oculo-nasal EID ₅₀ /
animal 10 ^6.0 10 ^6.0 - 10 ^6.0 10 ^6.0 Mortality 1-10 d.p.i. 0/22 0/24 - 1-10 d.p.i. 0/5 0/5 Incidence 1-10 d.p.i. 4/22 3/24 - 1-10 d.p.i. 0/5 0/5 clinical assessment ²⁾ 0,023 0.017 0 0 NDV-specific
antibodies 12 d.p.i. 21/21 24/24 5/5 12 d.p.i. 5/5 5/5 ⌀ HI title 2 ^7.3 2 ^6.8 0 2 ^6.0 2 ^7.8 HA-specific
antibodies 12 d.p.i. 2/21 24/24 5/5 12 d.p.i. 5/5 5/5 ⌀ HI title 2 ³ 0 0 0 0

Infection
EID ₅₀ / animal 14 d.p.i. NDV Herts 33/56
10 ^5.3 Mortality 3-4 d.p.z. 0/10 0/10 5/5 Incidence 1-10 d.p.z. 4/10 5/10 5/5 clinical assessment ²⁾ 0.04 0.05 2,4 NDV-specific antibodies 20 d.p.z. 10/10 10/10 † ⌀ HI title 2 ^8.9 2 ^9.2

Infection fourteen AIV A / chicken / Italy / 8/98 (H5N2) AIV A / chicken / Italy / 8/98 (H5N2) EID ₅₀ / animal d.p.v.i. 10 ^8.0 10 ^7.7 Mortality 3-6
d.p.z. 0/10 9/10 3-4 d.p.z. 0/5 4/5 Incidence 1-10 10/10 10/10 1-10 d.p.z. 0/5 5/5 clinical assessment ²⁾ d.p.z. 0.64 2,57 0 22.2 AIV-specific antibodies 20 d.p.z. 10/10 1/1 24 d.p.z. 5/5 1/1 ⌀ HI title 2 ^6.5 2 ^9.0 2 ^8.0 2 ¹¹ d.p.i. - days after immunization;
d.p.v.i. - days after secondary immunization;
d.p.z. - days after infection;
HI titer - hemagglutination inhibition titer

Example 4: Construction of the NDV / AIV-H5 Vector with the Flanking Non-coding Region of the F NDV Gene

Using basically the same methods and materials described above (Engel-Herbert et al., Supra), an NDV vector construct was created that carries the H5 AIV gene between the F and HN genes of the previously described plasmid pflNDV (Römer-Oberdörfer et al. , supra), but in this case, the H5 insert was flanked by non-coding regions of the NDV F gene.

A brief description of the various materials and stages used:

Mutagenesis of plasmid pUC with a 1.6 kb NotI-PstI fragment was performed. from NDVH5 (pUCIRA) in order to create a MluI site using mutagenesis primers: pMPMLUIGRFHNF (5'-ggt tgt aga tga cca aag gac qcg tta cgg gta gaa cgg taa gag agg -3 '; SEQ ID NO: 14) and pMPMLUIGRFHNR (5'- cct ctc tta ccg ttc tac ccg taa cgc gtc ctt tgg tca tct aca acc -3 '; SEQ ID NO: 15) (MluI site underlined, GS sequence in bold), resulting in the plasmid pUCIRAMLU.

Two nucleotides were annealed: OFVOF: 5'-agg acg cgt tac ggg tag aag att ctg gat ccc ggt tgg cgc cct cca ggt gca gca cca tgg ag -3 '(SEQ ID NO: 16, MluI site underlined) and OFVOR: 5 '- ctc cat ggt gct gca cct gga ggg cgc caa ccg gga t cc aga atc ttc tac ccg ta a cgc gt c ct -3' (SEQ ID NO: 17, MluI site underlined). Next, these constructs were digested with restriction enzymes MluI and NcoI.

Cleavage of the plasmid pUCIRAMLU with restriction enzymes MluI and NcoI.

Ligation of the MluI-NcoI fragment from the pUCIRAMLU plasmid with an approximate length of 4.3 kb with cleaved MluI-NcoI hybridized OFVOF / OFVOR oligonucleotides. The resulting plasmid was named PUCIRA2.

The pUC plasmid (pUCAROK) was digested with the NotI-BsiWI fragment from NDV with an open reading frame of H5 instead of the open reading frame of the HN gene and the plasmid pUCIRA2 with restriction enzymes NcoI and SgfI, and the NotI-NcoI fragment from pUCAROK was replaced by a fragment from pUCIRAO2 in pUCARA2, .

High-precision PCR (Roche) was performed to amplify the non-coding region of the F NDV gene behind the inserted F gene using primers: PNCRFHIF: 5'-ata ctt aag ttc cct aat agt aat ttg tgt -3 '(SEQ ID NO: 18, AflII site underlined) and PNCRFHIR: 5'- cac gcg atc gc a ttg cca ctg tac att ttt tct taa ctc tct gaa ctg aca gac tac c -3 '(SEQ ID NO: 19, SgfI site underlined), and plasmid pUCAROA (plasmid pUC c fragment NotI-SpeI from NDV). The resulting fragment is approximately 100 bp in length. ligated into the pGEMTeasy vector to give the plasmid pGEMFncrhi.

The restriction enzymes AflII and SgfI digested the plasmids pUCAROK2 and pGEMFncrhi to replace the non-coding region of the HN gene behind H5 in plasmid pUCAROK2 with the same region of the F gene from pGEMFncrhi. The resulting plasmid was named pUCAROK4.

In the last step, the NotI-SgfI fragment of the NDVH5 plasmid was replaced with the same fragment from the pUCAROK4 plasmid, which resulted in a new full-length plasmid E18C containing the H5 AIV gene inserted into the NDV vector between the F and HN genes and flanked by non-coding regions of the F gene .

The recombinant virus was propagated and the restoration of the infectious virus was confirmed in transfection experiments with new constructs, as described above. Next, a biochemical and biological characterization of the virus was performed.

Example 5: Creation of other NDV vector constructs and recombinant viruses:

Using similar techniques, other genes were inserted into the NDV vector at other embedding sites.

With the details given in the present description, the strategies for creating these structures will be obvious to specialists, therefore, it is sufficient to present these structures in the form of a table:

Table 5:
Other constructions based on the NDV vector according to the invention: Built-in gene NDV embed area NDV non-coding region flanking an inserted gene H5 AIV Rm Hn H5 AIV M-F Hn H7 AIV F-hn Hn N1 AIV F-hn Hn H5 AIV Before NP Hn

Example 6: Creation of a vector based on a recombinant rabies virus expressing the EIAV coat protein gene

In order to demonstrate that the advantage provided by the invention (the use of non-coding regions of MV genes to increase the expression and / or presentation of foreign proteins in recombinant MV virions), rabies virus (a member of the Rhabdoviridae family) was used as a vector for the Paramyxoviridae family expression of a coat protein from an unrelated virus, equine infectious anemia virus (EIAV).

This example describes the construction of a recombinant rabies virus containing the EIAV envelope protein inserted between the G and L genes of the rabies virus, the envelope gene being flanked by non-coding regions of the rabies virus G protein gene.

Subclones of rabies viruses were obtained in the pBluescript® SK + phagemid using the full-sized clone SAD-D29 (Mebatsion, 2001, J. Virol., Vol. 75, p. 11496-11502), which is called ORA-D in this description. To obtain a cloning vector, the pSK vector was first digested with SacI, then the protruding ends were extended with the Klenov fragment, HindIII was then restricted, and a fragment of about 3 kb was purified via gel. The insert was obtained by cleavage of ORA-D with StuI and HindIII restriction enzymes, and the resulting 1.3 kb fragment was purified. and ligated it with the prepared pSK vector to obtain the plasmid pNCR-b.

Plasmid pNCR-b was digested with restriction enzymes BstXI and HindIII and a fragment of about 4 kb in length. were purified and used in the ligation reaction with the BSSNH + and BSSNH- oligonucleotides (see table 6) in order to create the plasmid pSSNsc containing the minimal transcription cassette, and used in the ligation reaction with the RABGNCR1-4 oligonucleotides (table 6) to create the GNCR-b construct, containing non-coding regions in addition to a minimal transcriptional unit (Figure 7).

The coat protein gene of the Wyoming EIAV strain was obtained by amplification of a synthetic gene with a length of 2052 nucleotides, in which codons were optimized, RNA splicing sites were removed (Cook, et al. 2005, Vet. Micro., Vol. 108, p.23-37) and which was shortened by 134 amino acids at the 3'-coding end of the original gene.

Table 6:
The sequences of oligonucleotides used in the design of recombinant rabies viruses The name of the oligonucleotide SEQ ID NO: The sequence of the oligonucleotide (5 '-> 3') BSSNH + twenty CTGGTGAAAAAAACTAACACCCCTGCTAGCA BSSNH- 21 CGTTGACCACTTTTTTTGATTGTGGGGACGAT-CGTTCGA RABGNCRoligo1 (*) 22 CTGGTGAAAAAAACTATTAACATCCCTCAAAA-
GACTCAAGGATACGTACT RABGNCRoligo2 23 GTATCCTTGAGTCTTTTGAGGGATGTTAATAG-
TTTTTTTCACCAGTTGC RABGNCRoligo3 24 GGCCGTCCTTTCAACGATCCAAGTCCTGAAGA-
TCACCTCCCCTTGGGGGA RABGNCRoligo4 25 AGCTTCCCCCAAGGGGAGGTGATCTTCAGGAC-
TTGGATCGTTGAAAGGACGGCCAGTAC EIAsynCDF 26 ATGGTGTCCATCGCCTTCTA EIAsynCDstopR 27 TCAGTGTATGTTGTGTTGGGC (*) 3 nucleotides changed in the original sequence
ORA-D: GGA A A G G G ACTGG
on: GGA T A C G T ACTGG

The amplified gene was kinated and inserted into subclones according to the following scheme: an amplicon of 2 kb in size, designed so that it represented the entire shortened EIAV membrane protein, was obtained using the EIAsynCDF + EIAsynCDstopR primer set (see table 6). The amplicon was inserted into the GNCR-b subclone, pre-digested with restriction enzyme SnaBI and dephosphorylated to obtain the recombinant plasmid pGNCR-b: envG. A fragment of ~ 2 kbp SSNsc pre-cleaved with NheI was also inserted into the subclone, the protruding ends of which were blunted and dephosphorylated to obtain the recombinant plasmid pSSNsc: env.

Each recombinant construct was digested with SphI and HindIII and ligated with an SSNsc subclone pre-digested with SphI / HindIII and dephosphorylated with CIAP (calf intestinal alkaline phosphatase). After returning to the SSNsc subclone, the modified inserts were returned to the ORA-D framework by cleavage of SphI and MluI in order to obtain the recombinant rabies viruses RV-env and RV-envG (Figure 8). The 5 ′ and 3 ′ ends of the constructs were checked by PCR sequencing using Big-Dye® Terminators (Applied Biosystems) and analyzing the reactions by capillary electrophoresis on an Applied Biosystems 3100-Avant sequencer.

The construction of a full-sized cDNA clone based on a modified SAD strain of the rabies virus ORA-D and the creation of a recombinant rabies virus have been described (Schnelt et al., 1994, EMBO J., vol.13, p.4195-4203; Mebatsion, 2001, supra ) BSR cells were transfected with each recombinant rabies virus as previously described (Schnell, et al., 1994, supra) using the Mirus Trans-IT-LT1 kit. Three days after transfection, cells and supernatants were harvested and passaged. Successive passages were performed only with supernatants, using an approximate infection multiplicity of 0.5. To confirm the stability of the virus, each recombinant virus was reassigned at least 5 times.

BSR cells infected with recombinant rabies viruses were fixed approximately 40 hours after infection. They were analyzed by direct immunofluorescence using FITC-labeled anti-rabies monoclonal antibodies (FDI Diagnostics Inc.) or using horse serum against EIAV. Also, to monitor the stability of the virus and the expression of recombinant antigen in a series of 10-fold dilutions, the ratio of the number of infected cells producing rabies virus to the number of infected cells expressing the EIAV envelope protein was compared.

After the fifth passage, recombinant viruses were introduced into T-75 culture bottles with BSR cells with a multiplicity of infection of 0.01. 24 hours after infection, the medium was replaced with serum-free medium. Supernatants were collected and purified by centrifugation (10,000 x g) 72 hours after infection. For analysis of purified virions, viral supernatants were purified in a sucrose gradient.

The purified virions and the total protein of the infected cells were mixed with 2x Lamley sample recovery buffer and placed in boiling water for 5-10 minutes. Samples were applied to 10% Tris-HCL acrylamide gel (Bio-Rad) in 1x separation buffer. SDS-PAGE electrophoresis was performed at 20 mA until the dye front reached the bottom of the gel. The separated proteins were transferred onto an Immobilon-P membrane (PVDF) (IPVH10100, Immobilon) at 225 mM for 45 minutes. Blots were incubated in blocking buffer (PBS-Tween 20 + 1% skimmed milk powder) for one hour at room temperature and then washed three times for 5 minutes in PBS-Tween 20. Rabies virus expression was detected using rabbit polyclonal serum against glycoprotein and rabies virus nucleoprotein diluted 1: 20,000 and 1: 2000, respectively, in blocking buffer.

Next, expression of the EIAV coat protein was detected using anti-EIAV polyclonal equine serum diluted 1: 500 in blocking buffer. Blots were incubated for one hour at room temperature and then washed 3 times for five minutes in PBS-Tween20. Blots were placed in HRP-labeled goat IgG (H + L) conjugate against rabbit antibodies (KPL) and HRP-labeled goat IgG (H + L) conjugate against horse antibodies (Bethyl Labs), each diluted 1: 2000 in blocking buffer , and incubated for one hour at room temperature. Blots were then washed 3 × 5 minutes in PBS-Tween20. Blots were incubated in TMB peroxidase substrate (KPL) until completion of the reaction, approximately 1-3 minutes. Blots were placed in distilled water to stop the reaction.

A typical result of such a Western blot is shown in Figure 9, and it demonstrates the protein composition of recombinant rabies viruses expressing the EIAV envelope protein.

Lane 1: broad-spectrum molecular weight marker (Bio-Rad);

Lane 2: parent ORA-D virus;

Lane 3: RV-env (recombinant rabies virus containing the EIAV envelope protein) containing the EIAV envelope protein gene inserted between the G and L genes of the rabies virus without flanking non-coding regions;

Lane 4: RV-envG (recombinant rabies virus containing the EIAV envelope protein) containing the EIAV envelope protein gene flanked by non-coding regions of the rabies virus G protein.

Both recombinant viruses gave comparable infectious titers and stably expressed the integrated EIAV envelope protein gene after multiple in vitro passages.

However, despite the fact that comparable amounts of virions were applied to the blot, the recombinant RV-env constructed in the traditional way (namely, without flanking non-coding regions) gave a very weak band corresponding to the EIAV envelope protein; while the recombinant RV-envG, in which the integrated EIAV envelope protein gene was flanked by non-coding regions of the G-protein, expressed it with much greater intensity: in figure 9, compare the bands of the envelope protein in lanes 3 and 4.

Since the constructs and inserts of RV-envG and RV-env are identical, this is strong evidence that non-coding regions have a positive effect in enhancing the production of high levels of foreign protein and its immunopresentation.

Claims (22)

1. The expression vector based on the recombinant virus of the Mononegavirales order, carrying an additional transcriptional unit containing a foreign gene, functionally associated with the upstream start sequence of the Mononegavirales virus (GS) gene and the downstream gene sequence of the Mononegavirales virus, characterized in that the GS sequence and the start codon of a foreign gene and between the stop codon of a foreign gene and the GE sequence are located 3'-non-coding region and 5'-non-coding, respectively region (genomic sense strand) of the gene of the virus of the order Mononegavirales. 2. A vector based on the recombinant virus of the Mononegavirales order according to claim 1, characterized in that the 3 ′ and 5 ′ non-coding regions belong to the gene encoding the envelope protein of the virus from the Mononegavirales order, in particular the M, G, F or HN gene. 3. A vector based on the recombinant virus of the Mononegavirales order according to claim 1, characterized in that the 3 ′ and 5 ′ non-coding regions belong to the gene encoding the RNP protein of the Mononegavirales order virus. 4. A vector based on the recombinant virus of the Mononegavirales order according to claim 1, characterized in that the foreign gene encodes an antigen or pathogen. 5. A vector based on the recombinant virus of the Mononegavirales order according to claim 1, characterized in that the foreign gene encodes an immunomodulator. 6. A vector based on a recombinant virus of the Mononegavirales order according to claim 1, characterized in that the vector based on a virus from the Mononegavirales order is a virus of the Rhabdoviridae family. 7. A vector based on a recombinant virus of the Mononegavirales order according to claim 6, characterized in that the vector based on a virus from the Mononegavirales order is a rabies virus. 8. A vector based on a recombinant virus of the Mononegavirales order according to claim 6, characterized in that the vector based on a virus from the Mononegavirales order is an infectious hematopoietic necrosis virus. 9. A vector based on the recombinant virus of the Mononegavirales order according to any one of claims 6 to 8, characterized in that the 3 ′ and 5 ′ non-coding regions belong to the N, P, M, or G. 10. A vector based on the recombinant virus of the Mononegavirales order according to any one of claims 6 to 8, characterized in that the additional transcriptional unit is located at the 3'-proximal position or between the PM, M-G or G-L genes. 11. A vector based on the recombinant virus of the Mononegavirales order according to claim 1, characterized in that the vector based on the virus of the Mononegavirales order is a virus of the Paramyxoviridae family. 12. The vector based on the recombinant virus of the order Mononegavirales according to claim 11, characterized in that the vector based on the virus of the order Mononegavirales is a Newcastle disease virus, canine distemper virus or (bovine) parainfluenza virus. 13. A vector based on a recombinant virus from the Mononegavirales order according to any one of claims 11-12, characterized in that the 3 ′ and 5 ′ non-coding regions belong to the NP, P, M, F or HN genes. 14. A vector based on the recombinant virus of the Mononegavirales order according to claim 11, characterized in that the additional transcriptional unit is located at the 3'-proximal position or between the genes PM, M-F, F-HN or HN-L. 15. The vector based on the recombinant virus of the order Mononegavirales according to claim 11, characterized in that the vector based on the virus of the order Mononegavirales is a Newcastle disease virus. 16. A vector based on the recombinant virus of the Mononegavirales order according to claim 15, characterized in that the additional transcriptional unit is located between the F-HN genes. 17. A vector based on the recombinant virus of the Mononegavirales order according to claim 15, characterized in that the non-coding regions belong to the HN gene. 18. A vector based on the recombinant virus of the Mononegavirales order according to Claim 15, wherein the foreign gene encodes an avian pathogen antigen. 19. A vector based on the recombinant virus of the Mononegavirales order according to Claim 15, wherein the foreign gene encodes hemagglutinin (HA) of the influenza virus, preferably hemagglutinin H5 or H7. 20. A vector based on a recombinant virus of the Mononegavirales order according to any one of claims 1 to 8, 11 or 14-18, characterized in that the vector is constructed on the basis of an attenuated virus of the Mononegavirales order. 21. A vaccine against a microbial pathogen, characterized in that it contains a vector according to any one of claims 1 to 20, constructed on the basis of a recombinant virus of the Mononegavirales order, in live or inactivated form and a pharmaceutically acceptable carrier or diluent. 22. The vaccine according to item 21, characterized in that it further comprises an adjuvant.

Images