RU2391394C1 - Saccharomyces cerevisiae TS2-06 STRAIN USED FOR MAKING BACTERIAL PREPARATIONS AND PRODUCTION OF LIQUID SOUR MILK BROTH AS FOOD PRODUCT FOR MEDICAL AND PREVENTIVE PURPOSES - Google Patents

Abstract

FIELD: chemistry; biochemistry.

SUBSTANCE: Saccharomyces cerevisiae TS2-06 strain is isolated from sour milk broth used in production of curdled milk. The obtained Lactobacillus delbrueckii TS1-06 strain is deposited in the collection of microorganisms of the department of microbiology of the Faculty of Biology of M.V. Lomonosov Moscow State University under registration number 498 CM MSU. The strain is used to make bacterial preparations and making sour milk broth as a food product for medical and preventive purposes.

EFFECT: possibility of the strain growing in milk with formation of nutrients, resistance to a wide range of antibiotics, capacity for survival under the effect of hydrochloric acid - resists low pH of up to 1,2, ability of growing in a medium containing up to 2,5% bile.

2 dwg, 3 tbl, 5 ex

Description

The invention relates to the field of microbiology and biotechnology, and in particular to yeast strains used in medical and food biotechnology. The strain Saccharomyces cerevisiae TS2-06 has antagonistic properties against E. coli. The strain Saccharomyces cerevisiae TS2-06 is resistant to extreme factors, such as low acidity and bile content, and can be used in the medical, food and microbiological industries for the production of medicines and for the preparation of food products.

Human microflora is a system consisting of many microbiocenoses characterized by a specific composition and occupying the corresponding biotopes in the human body. The leading microbiocenoses are the intestines, urogenital tract, lungs and skin [1]. The microflora of the body is influenced by many factors, among them various diseases, antibiotics, stress, eating disorders, all this leads to the development of dysbiosis. Therefore, to restore and maintain the microbiota characteristic of each individual individual, it is relevant to use a new class of drugs - probiotics, which are based on certain types of bacteria that are non-pathogenic for humans [2].

A known strain of Bifidobacterium bifidum 79-31, which has acid-forming activity, antagonistic activity against pathogenic and conditionally pathogenic microorganisms [3]. However, this strain requires complex culture media and anaerobic conditions, which complicates its industrial use.

A known strain of Lactobacillus acidophilus 100Ash, which is part of the probiotic preparation "Acylact" [4]. The strain has a wide spectrum of antagonistic activity against opportunistic and pathogenic microorganisms due to the production of acids and antibiotic substances and is used to restore the normal flora of the gastrointestinal and urogenital tract, but there is no data on the survival of this strain under conditions of exposure to low acidity and the presence of bile, which may significantly reduce the effectiveness of the drug.

A known strain of Saccharomyces lactis S-11, forming a symbiosis with strains of Lactobacillus acidophilus A-41, Lactobacillus delbrueckii subs, bulgaricus B-21 and used for the production of dairy products [5], however, given the survival rate under the influence of extreme environmental factors and the antibiotic resistance spectrum given the strain is inferior to the proposed strain.

Known for the technical result closest to the claimed strain of the strain Saccharomyces boulardii, used for the production of probiotic preparations [4, 6, 7] and selected as a prototype. A known strain is used for the treatment and prevention of gastrointestinal diseases, but is not its natural inhabitant. In contrast to the proposed strain of Saccharomyces cerevisiae TS2-06, which was isolated from a food product - yogurt, the culture of Saccharomyces boulardii was isolated from the surface of the fruit [6, 7].

The disadvantages of the strain selected as a prototype are fears about the possibility of causing hematogenous fungal infection (fungemia) in case of an overdose, the possibility of causing diseases in people with reduced immunity, the lack of data on the resistance of the strain under the influence of acids and bile, a smaller spectrum of antibiotic resistance .

The claimed new strain - Saccharomyces cerevisiae TS2-06, isolated from fermented milk sourdough used to obtain yogurt, has higher technological characteristics compared to the known strain selected as a prototype.

The technical result of the claimed invention is the ability to develop in milk by the formation of nutrients, antibiotic resistance, a high level of resistance to low acidity and the ability to develop on an environment containing bile.

The strain Saccharomyces cerevisiae TS2-06 was obtained by multiple reseeding of individual yeast colonies on solid nutrient media, followed by clarification of the antagonistic activity, antibiotic resistance, and molecular genetic characteristics of individual clones. As a result, a clone identified as Saccharomyces cerevisiae TS2-06 strain was selected.

The obtained strain of Saccharomyces cerevisiae TS2-06 was deposited at the State Research Institute of Experimental Medicine of the Russian Academy of Medical Sciences under registration number "No. 1072 GUNIIEM". Collection address of the Research Institute of Experimental Medicine: 197376, St. Petersburg, ul. Academician Pavlov, 12. The notice is attached to the materials of this application.

The strain Saccharomyces cerevisiae TS2-06 under "No. 1072 GUNIIEM" was repeatedly tested in laboratory conditions at the Scientific Research Institute of Experimental Medicine of the Russian Academy of Medical Sciences (NIIEM RAMS). As shown by the results of microbiological studies, the claimed strain has many qualitative characteristics that exceed the known world level.

1. Cultural and morphological characteristics of the strain Saccharomyces cerevisiae TS2-06 under "No. 1072 GUNIIEM"

The strain Saccharomyces cerevisiae TS2-06 under "No. 1072 GUNIIEM" belongs to the family Saccharomycetaceae, a species of Saccharomyces, a subspecies of cerevisiae according to the determinant of the bacteria of Bergey [8]. The yeast cells are oval, 5-10 microns in diameter, some of the cells on the surface of the kidney or connected to daughter cells.

Figure 1 presents the image of the strain Saccharomyces cerevisiae TS2-06 (an increase of 1350 times) grown in liquid medium MPC (Hi Media, India) for 16 hours at 37 ° C.

The yeast culture grows on 1.5% milk at a temperature of 37 ° C, milk fermentation does not occur, gas is formed (CO ₂ ). When grown on MRS or Saburo broth (Research Center, Russia) for 24 hours at a temperature of 37 ° C, a sediment forms at the bottom. When growing in a dense environment - beige colonies in the form of lentils 1.5-2.0 mm in diameter. On the surface of a dense agar medium, round convex, light cream-colored opaque colonies with a smooth edge are formed, the size is 2-4 mm, the surface is smooth, shiny, the texture is soft, oily. Growth by stroke - moderate, continuous. The culture has a characteristic smell of yeast. The strain does not form pigments diffusing into the medium.

2. Physiological and biochemical characteristics of the strain Saccharomyces cerevisiae TS2-06 under "No. 1072 GUNIIEM"

Attitude to oxygen:

Optional anaerobic.

General biochemical properties:

Many simple compounds, such as glucose, sucrose, glycerin, can be used as a carbon source. Fermentation of sugars forms CO ₂ and ethyl alcohol.

Growth pattern on media with milk:

Able to grow in milk. Milk does not ferment; as a result of cultivation, gas is formed. When grown in liquid media, the pH practically does not decrease.

Growth Features:

Temperature optimum 36 ± 1 ° С. Cells grow in the range from 4 ° C to 40 ° C. The optimum pH value is 5.5-6.0. It remains viable in the pH range from 1.2 to 10. It grows with a bile content in the medium of up to 2.5%.

Antibiotic resistance:

The strain Saccharomyces cerevisiae TS2-06 under «№1072 GUNIIEM" is resistant to gentamicin, oxacillin, cefazolin, amoxiclav, tetracycline, norfloxacin, vancomycin, erythromycin, cefotaxime, ciprofloxacin, cefuroxime, metronidazole, ketoconazole, amphotericin.

Antagonism to other bacteria:

Strain Saccharomyces cerevisiae TS2-06 under "No. 1072 GUNIIEM" exhibits pronounced antagonistic properties against E. coli. The antagonistic activity of Saccharomyces cerevisiae TS2-06 is shown in FIG. 2, which shows the minimum inhibitory concentration of Saccharomyces cerevisiae TS2-06 at which the growth of E. coli is suppressed. As can be seen from figure 2, about 10 ⁵ in 1 ml of Saccharomyces cerevisiae TS2-06 cells is needed to suppress the growth of 10 ⁸ in 1 ml of E. coli cells.

The method, conditions and composition of the media for the propagation of the strain:

The strain Saccharomyces cerevisiae TS2-06 under No. 1072 GUNIIEM is grown at 36 ± 1 ° C in milk with 1.5% fat. For analyzes requiring transparent media, MRS or Saburo broth is used. Cultivation is carried out at 36 ± 1 ° C for 24 hours.

Commercially purchased milk (1.5% fat) is sterilized for 20 minutes by autoclaving at a pressure of 0.5 atm and a temperature of 110-120 ° C.

For the cultivation of individual colonies of the strain Saccharomyces cerevisiae TS2-06, 1% MPC-4 agar (Man, Rogoza, Sharp) (NICF, Russia) or Saburo agar (NICF, Russia) are used.

The method, conditions and composition of the media for storage of the strain:

The strain Saccharomyces cerevisiae TS2-06 under "No. 1072 GUNIIEM" is stored in freeze-dried form in sealed ampoules (storage duration 1 year or more). It can be stored frozen at -70 ° C for 6-12 months.

The properties of the strain Saccharomyces cerevisiae TS2-06 under "No. 1072 GUNIIEM" are stable and do not change during storage, during cultivation and when exposed to extreme factors, which allows us to judge its industrial applicability.

The stability of the preservation of useful properties during prolonged cultivation of the strain Saccharomyces cerevisiae TS2-06:

The duration of cultivation of the Saccharomyces cerevisiae TS2-06 strain on liquid and agarized nutrient media (at least 20 transfers) was not accompanied by a change in the spectrum of antibiotic resistance, antagonistic activity against pathogenic microorganisms, and other characteristics of the Saccharomyces cerevisiae TS2-06 strain listed above.

3. Genetic characteristics of the strain Saccharomyces cerevisiae TS2-06:

To facilitate the species identification of the natural strain of Saccharomyces cerevisiae TS2-06 as a species of the Saccharomycetaceae family - Saccharomyces cerevisiae, the chromosomal DNA site of the proposed strain was studied by molecular genetics and was subsequently identified and compared with similar sites of other types of microorganisms.

DNA strain Saccharomyces cerevisiae TS2-06 under "No. 1072 GUNIIEM" corresponding to the coding region of the ribosomal operon (26S RNA) was sequenced by the Sanger method. As a result, a nucleotide sequence was established that allows one to identify this strain in any preparations or products containing it.

GCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCA

TAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAG

TGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTG

GTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAAC

AAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAA

AAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATG

GTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTT

This sequence, when compared with the GenBank nucleotide sequence data bank, is characterized by 100% homology with other Saccharomyces cerevisiae strains. These data confirm the belonging of this strain to the species Saccharomyces cerevisiae.

4. Virulence:

The strain Saccharomyces cerevisiae TS2-06 was isolated from yogurt and is harmless to humans and animals. The lactic acid starter obtained by fermenting milk with a Bulgarian bacillus with the participation of the proposed strain was consumed by volunteers from the staff of the Department of Molecular Microbiology of the NIIEM RAMS for a month. As a result of this study, no side effects were detected.

The invention is illustrated by the following specific examples of the use of strain Saccharomyces cerevisiae TS2-06.

Example 1

The results of growing a liquid culture of a strain of Saccharomyces cerevisiae TS2-06 in a microbiological laboratory.

To obtain seed in a vial with a lyophilized culture containing 10 mg of dry matter, add 0.5 ml of a sterile solution of 0.9% sodium chloride. Inoculum is obtained by growing a microbial culture of the strain Saccharomyces cerevisiae TS2-06 on the surface of an agar medium MPC (Hi Media, India) or Saburo (Research Center, Russia) by the method of exhausting bar in an incubator at 37 ° C for 18-20 hours. Individual clones of the strain Saccharomyces cerevisiae TS2-06 grown on the surface of the agar are placed in bacteriological tubes containing 7 ml of milk and grown in an incubator at 37 ° C for 14-16 hours. The yeast grown in a liquid medium causes the appearance of a characteristic odor and gas bubbles while stirring the suspension. From aliquots taken from the resulting culture, smears stained with methylene blue are prepared. Typical yeast cells should be detected in smears. There should be no extraneous microflora in the preparations. The resulting seed is used to produce starting biomass. Seed is introduced into vials containing 300-500 ml of sterile milk in an amount of 5% and grown at 37 ° C for 14-16 hours. Starting biomass can be used to grow large volumes of biomass.

Example 2

The results of the study of the strain Saccharomyces cerevisiae TS2-06 by the nature of the antagonism to pathogenic bacteria.

To determine the antagonistic activity of the strain Saccharomyces cerevisiae TS2-06, the two-layer agar method was used [9]. The studied cultures preliminarily grown for 12–18 h were placed in various concentrations in agarized MPC medium, forming the lower layer. For this, a series of serial dilutions of cultures was carried out in a sterile 0.5% aqueous NaCl solution. Then 1 ml of the cell suspension was placed in 9 ml of agar medium cooled to 45 ° C. After solidification, tryptose agar (10 g / L tryptone (Difco, USA), 5 g / L yeast extract, 5 g / L NaCl, pH 7.0) was applied in an amount of 10 ml. After 24 hours of incubation, 10 μl of indicator cultures were seeded (Klebsiella pneumoniae cl. Is., Enterococcus faecalis ATCC 29212, E. coli ATCC 25922, E.coli Ml5, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853, Pseudomonas aer. , Candida albicans ATCC 869) in an amount of 3 × 10 ⁸ CFU / ml. Inoculated media were incubated at 37 ° C for 24 hours.

The antagonistic activity of the studied cultures was expressed as the minimum inhibitory concentration of the antagonist (MICA) - this is the minimum amount of the antagonist that inhibits the reproduction of pathogenic bacteria and fungi. Indicators of the minimum inhibitory concentration of the strain Saccharomyces cerevisiae TS2-06 are presented in table 2.

Table 1 Indicator culture MIKA, lg CFU / ml E. coli M15 5.13 ± 0.02

The obtained results of the study of the antagonistic activity of the strain Lactobacillus fermentum TS3-06 indicate that this strain is characterized by a high level of antagonism to the presented culture of E. coli.

Example 3

The results of the study of the strain Saccharomyces cerevisiae TS2-06 on the ability to develop in an environment containing bile.

In the growth medium — liquid medium of MRS containing from 0 to 10% bile, 1% (volume) of the studied culture was added in the stationary phase of growth. Inoculated media were incubated at 37 ° C for 24 hours. Growth was assessed by the optical density of the cell suspension on the SF at a wavelength of 600 nm. Table 3 presents the concentration of cells of the strain Saccharomyces cerevisiae TS2-06 grown on a medium with different bile contents.

table 2 The concentration of bile,% Optical density of cell suspension (600nm) 10 5 - 2.5 0.06 ± 0.02 1.25 0.70 ± 0.02 0.625 1.29 ± 0.02 0.3 1.71 ± 0.02 0.15 1.18 ± 0.02 0 1.26 ± 0.02

Thus, we can conclude that the culture of the strain Saccharomyces cerevisiae TS2-06 is able to grow on a medium with a bile content of 2.5% or less.

Example 4

The results of the study of the strain Saccharomyces cerevisiae TS2-06 for survival at low pH.

To determine the resistance of microorganisms to low pH, the technique proposed by C. Dunne et al. [10] was used. A culture of Saccharomyces cerevisiae TS2-06 strain pre-grown for 18 h was precipitated by centrifugation, then resuspended in MPC medium with pH 1.2 and 2.5. The acidity of the medium was adjusted to the required unimolar hydrochloric acid. Samples were taken from the moment the culture was added to the medium (0 min), then after 5, 30 and 60 minutes. To determine the number of cells in the medium, the method of seeding on solid nutrient media (Koch method) was used. The survival of the studied cultures at different pH values (logKOE / ml) are presented in table 3.

Table 3 Culture pH Incubation time, min 0 5 thirty 60 Saccharomyces strain 1,2 6.6 ± 0.1 6.5 ± 0.1 4.8 ± 0.1 3.6 ± 0.1 cerevisiae TS2-06 2.5 6.7 ± 0.1 6.5 ± 0.1 5.6 ± 0.1 4.3 ± 0.1

From the above data, it can be concluded that the culture of the strain Saccharomyces cerevisiae TS2-06 retains its viability even at pH 1.2.

As the results of studies for more than two years have shown, the claimed new strain of yeast Saccharomyces cerevisiae TS2-06, capable of developing in milk, showed stable qualitative characteristics, which are an advantage for use in industrial production, and can become the basis for the creation of new drugs and food products therapeutic and prophylactic purposes. Yeast of the species Saccharomyces cerevisiae has been used since ancient times, and now this type of yeast is used for beer production, in bakery [11], as well as in winemaking [12, 13] and ethyl alcohol [14], but is not used in lactic acid industry. The claimed strain meets the specified technical result and is characterized by survival when exposed to hydrochloric acid - can withstand a decrease in pH to 1.2, able to grow in an environment with bile content up to 2.5%, resistant to a wide range of antibiotics. These data suggest that the proposed strain is able to survive when it enters the human or animal body, namely when passing through the aggressive environment of the gastrointestinal tract, which is often an insurmountable barrier for other microorganisms.

Literature

1. Intestinal dysbiosis: a guide to diagnosis and treatment / Ed. E.I. Tkachenko and A.N. Suvorov. - St. Petersburg: 2006 .-- 196 p.

2. Shenderov B.A. The microflora of humans and animals and its functions, Moscow, Grant Publishing House, 1998, 416 pp.

3. RF patent 2314342 C1, published January 10, 2008, priority from July 13, 2006.

4. Bondarenko V.M., Vorobev A.A. Dysbiosis and drugs with probiotic function. Journal of Microbiology. 2004. No1. S.84-92 (prototype).

5. RF patent 97116294 A, published on 03/27/1999, priority from 09/26/1997.

6. Role of a probiotic (Saccharomyces boulardii) in management and prevention of diarrhea / Billoo A.G., Memon M.A., Khaskheli S.A. et al. // World Journal of Gastroenterology. - 2006. - No. 12 (28) - p.4557-4560 (prototype).

7. Genotypic and physiological characterization of Saccharomyces boulardii, the probiotic strain of Saccharomyces cerevisiae / Edwards-Ingram L, Gitsham P, Burton N et al. // Appl Environ Microbiol. - 2007. - No. 8 (73) - p. 2458-2467.

8. The determinant of bacteria Bergey, Moscow, Mir Publishing House, 1997, v.2, p.574.

9. Ermolenko E.I., Isakov V.A., Zhdan-Pushkina S.Kh., Tets V.V. A quantitative assessment of the antagonistic activity of lactobacilli // Journal. microbiol., epidemic., immunobiol. - 2004. - No. 5. - S. 94-98.

10. In vitro selection criteria for probiotic bacteria of human origin: correlation with in vivo findings / Dunne C., O'Mahony L., Murphy L. et al. // The American Journal of Clinical Nutrition. - 2001. - V.7 (suppl) - P.386S-392S.

11. RF patent 2164941 C1, published April 10, 2001, priority from November 1, 1999.

12. RF patent 2003132274 A, published on 04/27/2005, priority from 05/11/2003.

13. RF patent 2003132275 A, published July 10, 2005, priority from November 5, 2003.

14. RF patent 2005137212 A, published on June 10, 2007, priority from November 30, 2005.

Claims (1)

The strain Saccharomyces cerevisiae TS2-06 is deposited in the collection of microorganisms of the Department of Microbiology of the Biological Faculty of Moscow State University. MV Lomonosov under registration number 498 KM Moscow State University, used for the manufacture of bacterial preparations and the production of liquid lactic acid starter culture as a food product for medical purposes.

Images