RU2391393C1 - Lactobacillus delbrueckii TS1-06 STRAIN USED FOR MAKING BACTERIAL PREPARATIONS AND PRODUCTION OF LIQUID SOUR MILK BROTH AS FOOD PRODUCT FOR MEDICAL AND PREVENTIVE PURPOSES - Google Patents

Abstract

FIELD: chemistry; biochemistry. ^ SUBSTANCE: Lactobacillus delbrueckii TS1-06 strain is isolated from sour milk broth used in production of curdled milk. The obtained Lactobacillus delbrueckii TS1-06 strain is deposited in the collection of microorganisms of the department of microbiology of the Faculty of Biology of M.V. Lomonosov Moscow State University under registration number 497 CM MSU. The strain is used to make bacterial preparations and making sour milk broth as a food product for medical and preventive purposes. ^ EFFECT: high growth rate, wide range of antagonistic effect on gram-positive and gram-negative pathogenic bacteria, bile content, resistance to antibiotics, production of antibiotic-like substances (bacteriocins). ^ 3 dwg, 2 tbl, 3 ex

Description

The invention relates to the field of microbiology and biotechnology, namely to strains of lactobacilli used in medical and food biotechnology. The strain Lactobacillus delbrueckii TS1-06 has pronounced antagonistic properties against Klebsiella pneumoniae, Enterococcus faecalis, E. coli, Staphylococcus aureus, Pseudomonas aeruginosa. A gene encoding the synthesis of bacteriocin was found in the genome of the strain. The strain Lactobacillus fermentum TS3-06 can be used in the medical, food and microbiological industries for the production of drugs and for the preparation of food products.

Human microflora is a system consisting of many microbiocenoses characterized by a specific composition and occupying the corresponding biotopes in the human body. The leading microbiocenoses are the intestines, urogenital tract, lungs and skin [1]. The microflora of the body is influenced by many factors, among them various diseases, antibiotics, stress, eating disorders, all this leads to the development of dysbiosis. Therefore, to restore and maintain the microbiota characteristic of each individual individual, it is relevant to use a new class of drugs - probiotics, which are based on certain types of bacteria that are non-pathogenic for humans [2]. So, probiotic bacteria used for the production of both lactic acid products and drugs are known today.

Known strain of Lactobacillus acidophilus CNCM 1-1225, used as an agent against diarrhea. It has the ability to displace pathogenic bacteria from intestinal cells, especially bacteria responsible for diarrhea [3], but there is no data on the spectrum of antagonistic activity of this strain and its resistance to antibiotics, which are often used in conjunction with probiotics in the treatment of diarrhea.

The known strain of Bifidobacterium longum PO-6, it has acid-forming activity, antagonistic activity against pathogenic and conditionally pathogenic microorganisms, ferments milk, and ensures the normalization of human body microbiocenoses, including gastrointestinal and genitourinary tracts, skin and mucous membranes [4], however, it requires difficult environments for cultivation, anaerobic conditions during cultivation and is not resistant to extreme factors.

A known strain of Lactobacillus delbrueckii subs, bulgaricus B-21, forming a symbiosis with a strain of Lactobacillus acidophilus A-41 and a strain of yeast Saccharomyces lactis S-11, and used for the production of dairy products [5], however, according to the spectrum of antagonistic activity and the spectrum of antibiotic resistance the strain is inferior to the proposed strain.

A known strain of Lactobacillus plantarum 8A-P3 used for the production of the probiotic "Lactobacterin" [6]. It is used for the treatment and prevention of diseases of the gastrointestinal tract, the therapeutic effect of this probiotic is due to the antagonistic effect of lactobacilli against pathogenic and conditionally pathogenic microorganisms, however, the proposed strain of Lactobacillus delbrueckii TS1-06 has a stronger effect against pathogenic and conditionally pathogenic microorganisms with 8 -P3.

Other strains of Lactobacillus delbrueckii are known, for example, the strain Lactobacillus delbrueckii B-8744, however, it is used as a producer of lactic acid [7].

Known for the closest to the technical result of the claimed strain of the strain Lactobacillus delbrueckii subs. bulgaricus (strain ATCC 11842 / DSM 20081) [8], selected as a prototype. It was isolated in 1919 from Bulgarian curdled milk and is used together with thermophilic streptococcus for the production of yogurt. The known strain is effective in gastrointestinal disorders and is able to ferment milk with the formation of nutritious lactic acid products.

The disadvantages of the strain selected as a prototype are lower growth rate compared to the proposed strain, the use of which can significantly reduce the cultivation time; lack of data on the spectrum of antagonistic activity of a known strain and resistance to extreme factors (low acidity, bile content).

The claimed new strain - Lactobacillus delbrueckii TS1-06, isolated from fermented milk sourdough used to obtain yogurt, has higher technological characteristics compared to the known strain selected as a prototype.

The technical result of the claimed invention is a higher growth rate, a wide range of antagonistic activity against gram-positive and gram-negative pathogenic bacteria, resistance to antibiotics, the production of antibiotic-like substances (bacteriocins).

The strain Lactobacillus delbrueckii TS1-06 was obtained by multiple reseeding of individual colonies of lactobacilli in solid nutrient media, followed by elucidation of the antagonistic activity, antibiotic resistance and molecular genetic characteristics of individual clones. As a result, a clone identified as a strain of Lactobacillus delbrueckii TS1-06 was selected.

The obtained strain of Lactobacillus delbrueckii TS1-06 was deposited at the State Research Institute of Experimental Medicine RAMS under registration number "No. 1071 GUNIIEM". Collection address of the Research Institute of Experimental Medicine: 197376, St. Petersburg, ul. Academician Pavlov, 12. The notice is attached to the materials of this application.

The strain Lactobacillus delbrueckii TS1-06 under "No. 1071 GUNIIEM" was repeatedly tested in laboratory conditions at the Research Institute of Experimental Medicine of the Russian Academy of Medical Sciences (NIIEM RAMS). As shown by the results of microbiological studies, the claimed strain has many qualitative characteristics that exceed the known world level.

1. Cultural and morphological characteristics of the strain

Lactobacillus delbrueckii TS1-06 under "No. 1071 GUNIIEM".

The strain Lactobacillus delbrueckii TS1-06 under "No. 1071 GUNIIEM" refers to the family Lactobacillaceae, a species of Lactobacillus, a subspecies of delbrueckii according to the determinant of the bacteria Burji [9]. The bacterial cells are rod-shaped, regular in shape, connected in chains. In a liquid medium, the average chain size is 3 bacilli. Bacteria are gram-positive, do not form spores. The cell size is 0.5-1.2 × 3.0-10.0 microns.

Figure 1 presents the image of a strain of Lactobacillus delbrueckii TS1-06 (an increase of 1350 times) grown on a dense medium MPC (NICP, Russia) for 48 hours at 37 ° C.

When grown in 1.5% milk (sowing dose of 1%) at a temperature of 37 ° C, the fermentation of milk occurs at 8 hours of cultivation; when grown on MPC broth (Hi Media, India) for 24 hours at 42 ° C, uniform turbidity and sediment are formed at the bottom; when growing in a dense medium - translucent beige colonies in the form of buckwheat grain 1.0-1.5 mm in diameter. On the surface of a dense agarized medium with growth for 24-48 hours at a temperature of 37 ° C, irregularly shaped, weakly shaped, translucent beige colonies with a diameter of 1-1.5 mm are formed. The edge of the colonies is uneven, the surface is uneven, slightly shiny, the consistency is soft. Stroke growth is weak. The strain does not form pigments diffusing into the medium.

2. Physiological and biochemical characteristics of the strain Lactobacillus delbrueckii TS1-06 under "No. 1071 GUNIIEM".

Attitude to oxygen:

Optional anaerobic.

General biochemical properties:

Catalase-negative, does not contain cytochromes. Nitrates does not reduce; does not thin the gelatin. Fermentation type metabolism, sugar-plastic.

Growth pattern on media with milk:

Milk ferments with the formation of a curdled loose loose clot of white color. When grown for 7 hours, the pH drops to 5.5; after 24 hours of cultivation, the pH drops to 4.5.

Growth Features:

Temperature optimum 37 ± 2 ° C. It grows at 30 ° C. The optimum pH value is 5.5-6.0. It remains viable in the pH range from 2.5 to 10. It grows when the bile content in the medium is up to 2.5%.

Antagonism to other bacteria:

The strain Lactobacillus delbrueckii TS1-06 under "No. 1071 GUNIIEM" shows pronounced antagonistic properties against Klebsiella pneumoniae, Enterococcus faecalis, E. coli, Staphylococcus aureus, Pseudomonas aeruginosa. The antagonistic activity of Lactobacillus delbrueckii TS1-06 in relation to the listed types of microorganisms is presented in figure 2, which shows the minimum inhibitory concentration of the antagonist at which the growth of indicator cultures is suppressed. Thus, for example, as can be seen from FIG. 2, about 10 ⁵ in 1 ml of Lactobacillus delbrueckii TS1-06 cells is needed to suppress the growth of 10 ⁸ in 1 ml of Enterococcus faecalis cells.

The method, conditions and composition of the media for the propagation of the strain:

The strain Lactobacillus delbrueckii TS1-06 under "No. 1071 GUNIIEM" is grown at 37 ± 2 ° C in a medium based on soy protein (1.5%) "Supro Plus 2640" (Protein Technologies International) or in milk with 1.5% fat. To prepare a medium based on "Supro Plus 2640", 1 liter of water is added to 15 g of soy protein, the pH is adjusted to 7.0 and sterilized by autoclaving under a pressure of 1 atm for 20 minutes at 110-120 ° С. Commercially purchased milk with 1.5% fat is sterilized for 20 minutes by autoclaving at a pressure of 0.5 atm and a temperature of 110-120 ° C.

For the cultivation of individual colonies of the strain Lactobacillus delbrueckii TS1-06 using 1% agar MPC-4 (Man, Rogoza, Sharp) (Research Center, Russia).

For analyzes requiring transparent growth media, MPC broth (Hi Media, India) is used. Cultivation is carried out at 37 ± 1 ° C for 24-48 hours.

The method, conditions and composition of the media for storage of the strain:

The strain Lactobacillus delbrueckii TS1-06 under "No. 1071 GUNIIEM" is stored in sterile skim milk at 4 ° C with periodic reseeding 1 time in 15-20 days, or in freeze-dried form in sealed ampoules (storage duration 2 years or more). The protective environment during drying is sucrose 10%, pH 7.0. It can be stored frozen at -70 ° C for 6 months.

The properties of the strain Lactobacillus delbrueckii TS1-06 under "No. 1071 GUNIIEM" are stable and do not change during storage, during cultivation and when exposed to extreme factors, which makes it possible to judge its industrial applicability.

The stability of the preservation of useful properties during prolonged cultivation of the strain of Lactobacillus delbrueckii TS1-06:

The duration of cultivation of the Lactobacillus delbrueckii TS1-06 strain on liquid and agarized nutrient media (at least 20 transfers) was not accompanied by a change in the spectrum of antibiotic resistance, antagonistic activity against pathogenic microorganisms, and other characteristics of the Lactobacillus delbrueckii TS1-06 strain listed above.

3. Genetic characteristics of the strain Lactobacillus delbrueckii TS1-06:

To facilitate the species identification of the natural strain of Lactobacillus delbrueckii TS1-06 as a species of the Lactobacillaceae family - Lactobacillus delbrueckii, the chromosomal DNA site of the proposed strain was studied by molecular genetics and was subsequently identified and compared with similar sites of other types of microorganisms.

The DNA of the strain Lactobacillus delbrueckii TS1-06 under "No. 1071 GUNIIEM" corresponding to the coding region of the ribosomal operon (16S RNA) was sequenced by the Sanger method. As a result, a nucleotide sequence was established that allows one to identify this strain in any preparations or products containing it.

TTCGGGTGCTTAAAATGCCAGTCGAGCGAGCTGAATTCAAAGATTCC

TTCGGGATGATTTGTTGGACGCTAGCGGCGGATGGGTTAGAGTAACACG

TGGGCAATCTGCCCTAAAGACTGGGATACCACTTGGAAACAGGTGCT

AATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGG

CGTATGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTTGTTGGT

GGGGTAAAGGCCGCCAGCGTTCATCCTGAGCCAAA

This sequence, when compared with the Genbank nucleotide sequence data bank, is characterized by 99% homology with other strains of Lactobacillus delbrueckii, Lactobacillus delbrueckii subsp. bulgaricus - 97%, Lactobacillus delbrueckii subsp. lactis - 98%, Lactobacillus delbrueckii subsp. delbrueckii - 97%. Thus, the proposed strain of Lactobacillus delbrueckii TS1-06 can be easily identified by the above DNA sequence that is unique to this strain. This nucleotide sequence was deposited in the GenBank NCBI nucleotide sequence data bank and assigned bankit1046222. A copy of the account from the original GenBank NCBI database is attached to the materials of this application.

The strain Lactobacillus delbrueckii TS1-06 under "No. 1071 GUNIIEM" contains a gene encoding the synthesis of lactocin B. The presence of the gene is confirmed by polymerase chain reaction with DNA primers for this gene. It can be assumed that the presence of this gene is due to the antagonistic activity of this strain.

Example 1

The results of DNA analysis of the culture of the strain Lactobacillus delbrueckii TS1-06 for the presence in the genome of genes encoding the synthesis of bacteriocins.

To conduct the experiment on determining the presence of genes encoding the synthesis of bacteriocins most commonly found in lactobacilli, using the BLAST computer program [11], primers for the studied genes were designed (Table 1).

Table 1. Encoded gene The nucleotide sequence of the primers straight back plantaricin ccacctgtgaactagcagca agctgctgcgtaccaagatt lactacin F gagtcttggcaacggaagaagt gatgcggcttaactgttcgata lactacin B gttaaggaccaattgccagacc atgtcttcgtcagtttcgtgga lactacin S ggaagggaggtggaacagtatg cagacgcagttggcaataattc

Using these primers, a polymerase chain reaction (PCR) was performed (30 cycles at a synthesis temperature of 58 ° C). As a result of the amplification reaction and detection of its results by electrophoresis, it was found that in the genome of the strain Lactobacillus delbrueckii TS1-06 there is a gene encoding the synthesis of lactocin B.

Figure 3 presents the electrophoresis of the results of GPCR with primers for the lactocin B gene, where the number 1 denotes the band corresponding to the lactocin B gene (250 bp), the number 2 denotes a molecular weight marker of 100 bp. Figure 3 shows that the obtained DNA fragment has a size of about 250 nucleotide pairs, which corresponds to the size of the fragment expected as a result of amplification. The size of the expected fragment was calculated using the BLAST computer program [11].

4. Virulence:

The strain Lactobacillus delbrueckii TS1-06 was isolated from yogurt and is harmless to humans and animals. Lactic acid starter culture obtained by fermenting milk with this strain was consumed by volunteers from the staff of the Department of Molecular Microbiology of the State Research Institute of Medical Sciences, Russian Academy of Medical Sciences for a month. As a result of this study, no side effects were detected.

The invention is illustrated by the following specific examples of the use of a strain of Lactobacillus delbrueckii TS1-06.

Example 2

The results of growing a liquid culture of a strain of Lactobacillus delbrueckii TS1-06 in a microbiological laboratory.

To obtain seed in a vial with a lyophilized culture containing 10 mg of dry matter, add 0.5 ml of a sterile solution of 0.9% sodium chloride. Inoculum is obtained by growing a microbial culture of the strain Lactobacillus delbrueckii TS1-06 on the surface of MPA agar medium (Hi Media, India) by the method of exhausting bar in an incubator at 37 ° C for 24-48 hours. Individual clones of the Lactobacillus delbrueckii TS1-06 strain grown on the surface of the agar are placed in bacteriological tubes containing 7 ml of Supro Plus 2640 medium or milk and grown in an incubator at 37 ° C for 18-24 hours. Lactobacilli grown in a liquid medium cause the fermentation of milk or Supro Plus 2640 medium. From aliquots taken from the resulting culture, smears stained with methylene blue are prepared. In smears, single and chain-linked rods of 0.8 × 5.0–10 μm in size should be detected. There should be no extraneous microflora in the preparations. The resulting seed is used to produce starting biomass. Seed is introduced into vials containing 300-500 ml of sterile milk in an amount of 5% and grown at 37 ° C for 14-16 hours. Starting biomass can be used to grow large volumes of biomass for the production of liquid lactic starter cultures based on the Lactobacillus delbrueckii TS1-06 strain or dry bacteria-containing products.

Example 3

The results of the study of the strain Lactobacillus delbrueckii TS1-06 by the nature of the antagonism to pathogenic bacteria.

To determine the antagonistic activity of the strain Lactobacillus delbrueckii TS1-06, the two-layer agar method was used [10]. The studied culture, which was preliminarily grown for 12–18 h, was placed in various concentrations in agarized MPC medium, forming the lower layer. For this, a series of serial dilutions of cultures was carried out in a sterile 0.5% aqueous NaCl solution. Then 1 ml of the cell suspension was placed in 9 ml of agar medium cooled to 45 ° C. After solidification, tryptose agar (10 g / L tryptone (Difco, USA), 5 g / L yeast extract, 5 g / L NaCl, pH 7.0) was applied in an amount of 10 ml. After 24 hours of incubation, 10 μl of indicator cultures were seeded (Klebsiella pneumoniae cl. Is., Enterococcus faecalis ATCC 29212, E.coli ATCC 25922, E.coli M15, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853, Pseudomonas aer. , Candida albicans ATCC 869) in an amount of 3 × 10 ⁸ CFU / ml. Inoculated media were incubated at 37 ° C for 24 hours.

The antagonistic activity of the studied cultures was expressed as the minimum inhibitory concentration of the antagonist (MICA) - this is the minimum amount of the antagonist that inhibits the reproduction of pathogenic bacteria and fungi. Indicators of the minimum inhibitory concentration of the strain of Lactobacillus delbrueckii TS1-06 are presented in table 2.

Table 2. Indicator culture MIKA, lg CFU / ml Klebsiella pneumoniae cl. is. 4.15 ± 0.02 Enterococcus faecalis ATCC 29212 5.15 ± 0.02 E.coli ATCC 25922 5.15 ± 0.02 E.coli M15 2.15 ± 0.02 Staphylococcus aureus ATCC 25923 4.15 ± 0.02 Staphylococcus aureus 209 4.15 ± 0.02 Pseudomonas aeruginosa ATCC 27853 4.15 ± 0.02 Pseudomonas aeruginosa cl. is. 2.15 ± 0.02 Candida albicans ATCC 869 -

The results of a study of the antagonistic activity of the strain Lactobacillus delbrueckii TS1-06 indicate that this strain is characterized by a high level of antagonism to the indicated strains.

As the results of studies for more than two years have shown, the claimed new strain of lactic acid microorganisms Lactobacillus delbrueckii TS1-06 showed persistent qualitative characteristics, which are an advantage for use in industrial production, and can become the basis for the creation of new drugs and food products for therapeutic and preventive purposes, which will have therapeutic efficacy. The claimed strain corresponds to the specified technical result and has pronounced antagonistic properties against gram-negative and gram-positive pathogens, resistant to antibiotics, a gene encoding the synthesis of an antibiotic-like substance (bacteriocin) was found in its genome.

References

1. Intestinal dysbiosis: a guide to diagnosis and treatment / Ed. E.I. Tkachenko and A.N. Suvorov. - St. Petersburg: 2006 .-- 196 p.

2. Shenderov B.A. The microflora of humans and animals and its functions. M .: Grant, 1998, 416 p.

3. RF patent 2126446 C1, published on 02.20.1999, priority from 07/06/1993.

4. RF patent 2317326 C1, published on 02/20/2008, priority from 07/13/2006.

5. RF patent 97116294 A, published 03/27/1999, priority from 09/26/1997.

6. Bondarenko V.M., Vorobyov A.A. Dysbiosis and drugs with probiotic function. Zhurn. microbiol. 2004. No1. S.84-92.

7. RF patent 2004129918 A, published March 27, 2006, priority since October 14, 2004.

8. Belgian co-ordinated collections of micro-organisms, Belgian Federal Science Policy, Wetenschapsstraat 8 Rue de la Science B-1000, Brussels http://bccm.belspo.be/db/lmg_search_form.php (prototype).

9. The determinant of bacteria Bergey, Moscow, publishing house Mir, 1997, v.2, p.574

10. Ermolenko E.I., Isakov V.A., Zhdan-Pushkina S.Kh., Tets V.V. A quantitative assessment of the antagonistic activity of lactobacilli // Journal. microbiol., epidemic., immunobiol. - 2004. - No. 5. - S. 94-98.

11. http://www.ncbi.nlm.nih.gov/BLAST.

Claims (1)

The strain Lactobacillus delbrueckii TS1-06 is deposited in the collection of microorganisms of the Department of Microbiology of the Biological Faculty of Moscow State University. MV Lomonosov under registration number 497 KM Moscow State University, used for the manufacture of bacterial preparations and the production of liquid lactic acid starter culture as a food product for medical purposes.

Images