RU2391395C1 - Lactobacillus fermentum TS3-06 STRAIN USED FOR MAKING BACTERIAL PREPARATIONS AND PRODUCTION OF LIQUID SOUR MILK BROTH AS FOOD PRODUCT FOR MEDICAL AND PREVENTIVE PURPOSES - Google Patents

Abstract

FIELD: chemistry; biochemistry.

SUBSTANCE: Lactobacillus fermentum TS3-06 strain is isolated from sour milk broth used in production of curdled milk. The obtained Lactobacillus fermentum TS3-06 strain is deposited in the collection of microorganisms of the department of microbiology of the Faculty of Biology of M.V. Lomonosov Moscow State University under registration number 498 CM MSU. The strain is used to make bacterial preparations and making sour milk broth as a food product for medical and preventive purposes.

EFFECT: higher growth rate, high resistance to extreme effects such as low acidity, bile content, resistance to antibiotics.

2 dwg, 3 tbl, 4 ex

Description

The invention relates to the field of microbiology and biotechnology, in particular to strains of lactobacilli used in medical and food biotechnology. The strain Lactobacillus fermentum TS3-06 has pronounced antagonistic properties against Klebsiella pneumoniae, E. coli, Pseudomonas aeruginosa. Genes encoding the synthesis of bacteriocins were found in the genome of the strain. The strain Lactobacillus fermentum TS3-06 is resistant to extreme factors, such as low acidity and bile content, and can be used in the medical, food and microbiological industries for the production of medicines and for the preparation of food products.

Human microflora is a system consisting of many microbiocenoses characterized by a specific composition and occupying the corresponding biotopes in the human body. The leading microbiocenoses are the intestines, urogenital tract, lungs and skin [1]. The microflora of the body is influenced by many factors, among them various diseases, antibiotics, stress, eating disorders, all this leads to the development of dysbiosis. Therefore, to restore and maintain the microbiota characteristic of each individual individual, it is relevant to use a new class of drugs - probiotics, which are based on certain types of bacteria that are non-pathogenic for humans [2]. So, probiotic bacteria used for the production of both lactic acid products and drugs are known today.

A known strain of Lactobacillus acidophilus 100Ash, which is part of the probiotic preparation "Acylact" [3]. The strain has a wide spectrum of antagonistic activity against opportunistic and pathogenic microorganisms due to the production of acids and antibiotic substances, and is used to restore the normal flora of the gastrointestinal and urogenital tract, however, there is no data on the survival of this strain under conditions of low acidity and the presence of bile, which can significantly reduce the effectiveness of the drug.

A known strain of lactobacilli Lactobacillus paracasei CNCM I-2116 (NCC 2461), used by the company "Nestle", has the ability to prevent colonization of the intestine by pathogenic bacteria that cause diarrhea, and to prevent infection of intestinal epithelial cells with rotaviruses [4], but there is also no data on this strain its survival under the influence of aggression factors, which can significantly reduce the effectiveness of the drug.

A known strain of Lactobacillus plantarum P-19, used for the production of probiotic bifin, used to treat diseases of the gastrointestinal tract of animals [5], however, this strain is used in veterinary medicine and is intended to treat the stomach and intestinal tract of calves and piglets.

Other strains of Lactobacillus fermentum are known to be used for the correction of dysbiosis. Along with other probiotic microorganisms, this species is effective against urogenital infections. So, the known strain of Lactobacillus fermentum 90-Ts-4 is a selected variant from Lactobacterin, which is characterized by high adhesive properties to the vaginal epithelium [6], however, the drawback of this strain is a narrow spectrum of application, limited only to solving gynecological problems.

Known for the closest to the technical result of the claimed strain of the strain Lactobacillus fermentum ME-3 DSM 14241, selected as a prototype. It is used to prepare a medicinal product for the prophylaxis and treatment of intestinal infections and uroinfections, and is also used to prepare functional food products [7].

The disadvantages of the strain selected as a prototype are lower growth rate compared to the proposed strain, the use of which can significantly reduce the cultivation time; the lack of data on the spectrum of antagonistic activity of the known strain and the lack of data on the stability of the strain under the influence of acids and bile.

The claimed new strain - Lactobacillus fermentum TS3-06, isolated from fermented milk sourdough used to obtain yogurt, has higher technological characteristics compared to the known strain, selected as a prototype.

The technical result of the claimed invention is a higher growth rate, high resistance to extreme factors, such as low acidity, bile content, antibiotic resistance.

The strain Lactobacillus fermentum TS3-06 was obtained by multiple reseeding of individual colonies of lactobacilli in solid nutrient media, followed by elucidation of the antagonistic activity, antibiotic resistance and molecular genetic characteristics of individual clones. As a result, a clone identified as Lactobacillus fermentum TS3-06 strain was selected.

The obtained strain of Lactobacillus fermentum TS3-06 was deposited at the State Research Institute of Experimental Medicine RAMS under registration number "No. 1073 GUNIIEM." Collection address of the Research Institute of Experimental Medicine: 197376, St. Petersburg, ul. Academician Pavlov, 12. The notice is attached to the materials of this application.

The strain Lactobacillus fermentum TS3-06 under "No. 1073 GUNIIEM" was repeatedly tested in the laboratory on the basis of the Scientific Research Institute of Experimental Medicine of the Russian Academy of Medical Sciences (NIIEM RAMS). As shown by the results of microbiological studies, the claimed strain has many qualitative characteristics that exceed the known world level.

1. Cultural and morphological characteristics of the strain Lactobacillus fermentum TS3-06 under "No. 1073 GUNIIEM"

The strain Lactobacillus fermentum TS3-06 under "No. 1073 GUNIIEM" belongs to the family Lactobacillaceae, a species of Lactobacillus, a subspecies of fermentum according to the determinant of the bacteria Burge [8]. The bacterial cells are rod-shaped, of regular shape, when grown in a liquid medium, are connected in short chains. Bacteria are gram-positive, do not form spores. The size of the cells depends on the growth medium: for example, on an agarized MPC medium, the size of the rods is 0.5 × 1.0 μm, on liquid media and on tryptose agar it is 0.5-1.0 × 2.0-8.0 μm.

Figure 1 presents the image of the strain of Lactobacillus fermentum TS3-06 (an increase of 1350 times) grown in 1.5% milk for 16 hours at 37 ° C.

When grown in 1.5% milk (sowing dose of 1%) at a temperature of 37 ° C, the fermentation of milk occurs at 8 hours of cultivation; when grown on MPC broth for 24 hours at a temperature of 37 ° C, uniform turbidity and sediment are formed at the bottom; when growing in a dense environment - beige colonies in the form of buckwheat grains 1.0-1.5 mm in diameter. On the surface of a dense agar medium, round drop-shaped beige colonies with a smooth edge are formed, the size is 1-2 mm, the surface is smooth and shiny. Stroke growth is moderate. The strain does not form pigments diffusing into the medium.

2. Physiological and biochemical characteristics of the strain Lactobacillus fermentum TS3-06 under "No. 1073 GUNIIEM"

Attitude to oxygen:

Optional anaerobic.

General biochemical properties:

Catalase-negative, does not contain cytochromes. Nitrate does not reduce; does not thin the gelatin. Fermentation type metabolism, sugar-plastic.

Growth pattern on media with milk:

Milk ferments without clot formation. When grown for 6 hours, the pH drops to 5.5; after 24 hours of cultivation, the pH drops to 4.5.

Growth Features:

Temperature optimum 37 ± 2 ° C. It grows at 42 ° C. Weak growth at 15 ° C. The optimum pH value is 5.5-6.0. It remains viable in the pH range from 2.5 to 10. It grows when the bile content in the medium is up to 2.5%.

Antibiotic Sensitivity:

The strain Lactobacillus fermentum TS3-06 under "No. 1073 GUNIIEM" is characterized by high sensitivity to gentamicin, oxacillin, cefazolin, amoxiclav and tetracycline. Severe resistance to ciprofloxacin, norfloxacin, vancomycin.

Antagonism to other bacteria:

The strain Lactobacillus fermentum TS3-06 under "No. 1073 GUNIIEM" exhibits pronounced antagonistic properties against Klebsiella pneumoniae, E. coli, Pseudomonas aeruginosa. The antagonistic activity of Lactobacillus fermentum TS3-06 in relation to the listed types of microorganisms is presented in figure 2, which shows the minimum inhibitory concentration of the antagonist at which the growth of indicator cultures is suppressed. As can be seen from figure 2, about 10 ⁸ in 1 ml of Lactobacillus fermentum TS3-06 cells is needed to suppress the growth of 10 ⁸ in 1 ml of Klebsiella pneumoniae cells and only 10 in 1 ml of Lactobacillus fermentum TS3-06 cells to suppress 10 ⁸ in 1 ml of E. coli or Pseudomonas aeruginosa cells.

The method, conditions and composition of the media for the propagation of the strain:

The strain Lactobacillus fermentum TS3-06 under "No. 1073 GUNIIEM" is grown at 37 ± 2 ° C in a medium based on soy protein (1.5%) "Supro Plus 2640" (Protein Technologies International) or in milk with 1.5% fat. To prepare a medium based on "Supro Plus 2640", 1 liter of water is added to 15 g of soy protein, the pH is adjusted to 7.0 and sterilized by autoclaving under a pressure of 1 atm for 20 minutes at 110-120 ° С. Commercially purchased milk with 1.5% fat is sterilized for 20 minutes by autoclaving at a pressure of 0.5 atm and a temperature of 110-120 ° C.

For the cultivation of individual colonies of the strain Lactobacillus fermentum TS3-06, 1% MPC-4 agar (Man, Rogoza, Sharp) is used (Research Center, Russia).

For analyzes requiring transparent growth media, MRS broth (Man, Rogoza, Sharp) (Hi Media, India) is used. Cultivation is carried out at 37 ± 2 ° C for 24-48 hours.

The method, conditions and composition of the media for storage of the strain:

The strain Lactobacillus fermentum TS3-06 under "No. 1073 GUNIIEM" is stored in sterile skim milk at 4 ° C with periodic reseeding 1 time in 15-20 days, or in freeze-dried form in sealed ampoules (storage duration 2 years or more). The protective environment during drying is sucrose 10%, pH 7.0. It can be stored frozen at -70 ° C for 6 months.

The properties of the strain Lactobacillus fermentum TS3-06 under "No. 1073 GUNIIEM" are stable and do not change during storage, during cultivation and when exposed to extreme factors, which allows us to judge its industrial applicability.

The stability of the preservation of useful properties during prolonged cultivation of the strain of Lactobacillus fermentum TS3-06:

The duration of cultivation of the Lactobacillus fermentum TS3-06 strain on liquid and agarized nutrient media (at least 20 transfers) was not accompanied by a change in the spectrum of antibiotic resistance, antagonistic activity against pathogenic microorganisms, and other characteristics of the Lactobacillus fermentum TS3-06 strain listed above.

3. Genetic characteristics of the strain Lactobacillus fermentum TS3-06:

To facilitate the species identification of the natural strain of Lactobacillus fermentum TS3-06 as a species of the Lactobacillaceae family - Lactobacillus fermentum, the chromosomal DNA site of the proposed strain was studied by molecular genetics and was subsequently identified and compared with similar sites of other types of microorganisms.

DNA of the strain Lactobacillus fermentum TS3-06 under "No. 1073 GUNIIEM" corresponding to the coding region of the ribosomal operon (16S RNA) was sequenced by the Sanger method. As a result, a nucleotide sequence was established that allows one to identify this strain in any preparations or products containing it.

TGCAAGTCGAACGCGTTGGCCCAATTGATTGATGGTGCTTGCACCTG

ATTGATTTTGGTCGCCAACGAGTGGCGGACGGGTGAGTAACACGTAG

GTAACCTGCCCAGAAGCGGGGGACAACATTTGGAAACAGATGCTAA

TACCGCATAACAACGTTGTTCGCATGAACAACGCTTAAAAGATGGCT

TCTCGCTATCACTTCTGGATGGACCTGCGGTGCATTAGCTTGTTGGTG

GGGTAA

This sequence, when compared with the GenBank database of nucleotide sequences, is characterized by 100% homology with other strains of Lactobacillus fermentum. These data confirm the belonging of this strain to the species Lactobacillus fermentum. This nucleotide sequence was deposited in the GenBank NCBI database of nucleotide sequences and assigned bankit1046290. A copy of the account from the original GenBank NCBI database is attached to the materials of this application.

4. Virulence:

The strain Lactobacillus fermentum TS3-06 was isolated from yogurt and is harmless to humans and animals. Lactic acid starter culture obtained by fermenting milk with this strain was consumed by volunteers from the staff of the Department of Molecular Microbiology of the State Research Institute of Medical Sciences, Russian Academy of Medical Sciences for a month. As a result of this study, no side effects were detected.

The invention is illustrated by the following specific examples of the use of the strain of Lactobacillus fermentum TS3-06.

Example 1

The results of the cultivation of a liquid culture of a strain of Lactobacillus fermentum TS3-06 in a microbiological laboratory

To obtain seed in a vial with a lyophilized culture containing 10 mg of dry matter, add 0.5 ml of a sterile solution of 0.9% sodium chloride. Inoculum is obtained by growing a microbial culture of the strain Lactobacillus fermentum TS3-06 on the surface of agarized medium MPC (Hi Media, India) by the method of exhausting bar in an incubator at 37 ° C for 18-20 hours.

Individual clones of the Lactobacillus fermentum TS3-06 strain grown on the surface of the agar are placed in bacteriological tubes containing 7 ml of Supro Plus 2640 medium or milk and grown in an incubator at 37 ° C for 14-16 hours. Lactobacilli grown in a liquid medium are caused by the fermentation of milk or Supro Plus 2640 medium. From aliquots taken from the resulting culture, smears stained with methylene blue are prepared. In smears, single and connected in short chains of sticks with a size of 0.5 × 3.0 μm should be detected. There should be no extraneous microflora in the preparations. The resulting seed is used to produce starting biomass. Seed is introduced into vials containing 300-500 ml of sterile milk in an amount of 5% and grown at 37 ° C for 14-16 hours. Starting biomass can be used to grow large volumes of biomass for the production of liquid lactic starter cultures based on the Lactobacillus fermentum TS3-06 strain or dry bacteria-containing products.

Example 2

The results of the study of the strain Lactobacillus fermentum TS3-06 on the nature of the antagonism of pathogenic bacteria

To determine the antagonistic activity of the strain Lactobacillus fermentum TS3-06, the two-layer agar method was used [9]. The studied cultures, which were preliminarily grown for 12–18 h, at various concentrations, were placed in an agarized MPC medium, forming the lower layer. For this, a series of serial dilutions of cultures was carried out in a sterile 0.5% aqueous NaCl solution. Then 1 ml of the cell suspension was placed in 9 ml of agar medium cooled to 45 ° C. After solidification, tryptose agar (10 g / L tryptone (Difco, USA), 5 g / L yeast extract, 5 g / L NaCl, pH 7.0) was applied in an amount of 10 ml. After 24 hours of incubation, 10 μl of indicator cultures were seeded (Klebsiella pneumoniae cl. Is., Enterococcus faecalis ATCC 29212, E. coli ATCC 25922, E.coli Ml5, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853, Pseudomonas aer. , Candida albicans ATCC 869) in an amount of 3 × 10 ⁸ CFU / ml. Inoculated media were incubated at 37 ° C for 24 hours.

The antagonistic activity of the studied cultures was expressed as the minimum inhibitory concentration of the antagonist (MICA) - this is the minimum amount of the antagonist that inhibits the reproduction of pathogenic bacteria and fungi. Indicators of the minimum inhibitory concentration of the strain of Lactobacillus fermentum TS3-06 are presented in table 2.

Table 1 Indicator culture MIKA, lg KOE / ml Klebsiella pneumoniae cl. is. 8.0 ± 0.4 E.coli Ml5 4.0 ± 0.4 Pseudomonas aeruginosa ATCC 27853 4.0 ± 0.4 Pseudomonas aeruginosa cl. is. 4.0 ± 0.4

The results of a study of the antagonistic activity of the strain of Lactobacillus fermentum TS3-06 indicate that this strain is characterized by a high level of antagonism to the indicated strains.

Example 3

The results of a study of the strain Lactobacillus fermentum TS3-06 on the ability to develop in an environment containing bile

In the growth medium — liquid medium of MRS containing from 0 to 10% bile, 1% (volume) of the studied culture was added in the stationary phase of growth. Inoculated media were incubated at 37 ° C for 24 hours. Growth was assessed by the optical density of the cell suspension on the SF at a wavelength of 600 nm. Table 3 presents the concentration of cells of the strain Lactobacillus fermentum TS3-06, grown on a medium with different bile contents.

table 2 The concentration of bile,% The optical density of the cell suspension (600 nm) 10 - 5 - 2.5 0.12 ± 0.02 1.25 0.16 ± 0.02 0.625 0.18 ± 0.02 0.3 0.18 ± 0.02 0.15 0.16 ± 0.02 0 2.45 ± 0.02

Thus, we can conclude that the culture of the strain Lactobacillus fermentum TS3-06 is able to grow on a medium with a bile content of 2.5% or less.

Example 4

The results of the study of the strain of Lactobacillus fermentum TS3-06 for survival at low pH

To determine the resistance of microorganisms at low pH, the method proposed by C. Dunne et al. [10] was used. A culture of the Lactobacillus fermentum TS3-06 strain pre-grown for 18 h was precipitated by centrifugation, then resuspended in MPC medium with pH 1.2 and 2.5. The acidity of the medium was adjusted to the required unimolar hydrochloric acid. Samples were taken from the moment the culture was added to the medium (0 min), then after 5, 30 and 60 minutes. To determine the number of cells in the medium, the method of seeding on solid nutrient media (Koch method) was used. The survival of the studied cultures at different pH values (logKOE / ml) are presented in table 3.

Table 3 Culture pH Incubation time, min 0 5 thirty 60 Lactobacillus strain 1,2 8.8 ± 0.1 0 0 0 fermentum TS3-06 2.5 8.9 ± 0.1 8.8 ± 0.1 8.8 ± 0.1 8.7 ± 0.1

From the above data, we can conclude that the culture of the strain Lactobacillus fermentum TS3-06 retains its viability at pH 2.5.

As the results of studies for more than two years have shown, the claimed new strain of lactic acid microorganisms Lactobacillus fermentum TS3-06 showed persistent qualitative characteristics, which are an advantage for use in industrial production, and can become the basis for the creation of new medicines and food products for therapeutic and prophylactic purposes. which will have therapeutic efficacy. This type of microorganism is especially useful for women, as it is a natural component of not only the gastrointestinal tract, but also the vaginal microbiocenosis. The claimed strain meets the specified technical result and has pronounced antagonistic properties in relation to gram-negative and gram-positive pathogenic microorganisms, resistant to antibiotics, stable under the influence of extreme factors.

Literature

1. Intestinal dysbiosis: a guide to diagnosis and treatment. / Ed. E.I. Tkachenko and A.N. Suvorov. - St. Petersburg: 2006 .-- 196 p.

2. Shenderov B.A. The microflora of humans and animals and its functions. -M.: Grant Publishing House, 1998, 416 p.

3. Bondarenko V. M., Vorobev A. A. Dysbiosis and drugs with probiotic function. - Journal. microbiol. 2004. No1. S.84-92.

4. RF patent 2247569 C2, published on March 10, 2005, priority from March 11, 1999.

5. RF patent 2000117915 A, published on 10/07/2002, priority from 05/07/2000.

6. RF patent 2133272 C1, published on July 20, 1999, priority from June 11, 1998.

7. RF patent 2003137810 A, published March 10, 2005, priority from March 11, 1999 (prototype).

8. The determinant of bacteria Bergey. - M.: Mir Publishing House, 1997, vol. 2, p. 544.

9. Ermolenko E.I., Isakov V.A., Zhdan-Pushkina S.Kh., Tets V.V. Quantification of the antagonistic activity of lactobacilli. // Journal. microbiol., epidemic., immunobiol. - 2004. - No. 5. - S. 94-98.

10. In vitro selection criteria for probiotic bacteria of human origin: correlation with in vivo findings. / Dunne C., O'Mahony L., Murphy L. et al. // The American Journal of Clinical Nutrition. - 2001. - V.7 (suppl) - P.386S-392S.

11. http://www.ncbi.nlm.nih.gov/BLAST.

Claims (1)

The strain Lactobacillus fermentum TS3-06 is deposited in the collection of microorganisms of the Department of Microbiology of the Biological Faculty of Moscow State University. MV Lomonosov under registration number 496 KM Moscow State University, used for the manufacture of bacterial preparations and the production of liquid lactic acid starter culture as a food product for therapeutic purposes.

Images