RU2372405C1 - Method of extracting extracellular deoxyribonucleic acid from blood - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: invention relates to clinical biochemistry and pertains to a method of extracting extracellular DNA from blood. Nonidet P-40 or triton X-100 is added to the analysed blood sample until final concentration of 0.5 to 1.5%. The mixture is incubated in ice for 1 to 15 minutes. Lysed blood is divided into supernatant and a nuclear fraction of cells by centrifuging. The supernatant is then treated with a RNA-hydrolysing enzyme and extracellular DNA is extracted from the obtained fraction using a fibre-glass sorbent.

EFFECT: use of the method simplifies the procedure of extracting extracellular DNA, simultaneously extract extracellular DNA, which is free and which is bonded to the surface of blood cells, from blood lysate, which allows for significantly increasing reliability and sensitivity of further amplification analysis for early detection of oncological and other diseases.

2 cl, 4 tbl, 4 ex

Description

The invention relates to medicine, more specifically to clinical biochemistry, namely the development of methods for the extraction of extracellular DNA (extra DNA) from the blood, which can be used in amplification analysis for early diagnosis of precancerous conditions and early stages of cancer, fetal conditions during pregnancy, and monitoring the effectiveness of anti-cancer therapy.

Today, the urgent problem of medicine is the detection of cancer in the early stages of development (precancer and early cancer). Modern methods of instrumental analysis, such as radiology, endoscopy, ultrasound, mammography, not only are not sufficiently effective in the early stages of the disease, but also give a large number of false-negative results. The use of tumor tissues as biological material is possible only with a formed tumor and is not applicable for early diagnosis and monitoring of the effectiveness of antitumor therapy. Based on the foregoing, the use for the diagnosis of markers present in such readily available biological material as peripheral blood is very promising. Immunochemical analysis of tumor markers is currently widely used, but does not have sufficient specificity and sensitivity, since a sufficient amount of protein antigen for measurement can be secreted into the blood only by a formed tumor of a certain size. The analysis of DNA markers in the composition of extracellular blood DNA seems to be promising, since it is highly sensitive and can detect tumor transformation in the early stages of tumor development (precancer, cancer in situ).

Currently, various methods are used to study the genetic material of blood, such as determining the concentration of nucleic acids [1], analyzing gene changes (point mutations and methylation status of promoter regions) and analyzing gene doses (loss of heterozygosity, microsatellite instability) [2, 3].

A known method of DNA extraction from blood for subsequent early diagnosis of lung cancer by determining the concentration of DNA in the blood plasma of cancer patients [4], including collecting blood by gravity, followed by separation of the collected blood into plasma and blood cell fraction and determining the concentration of DNA in the blood plasma of cancer patients . DNA from the blood plasma of patients with lung cancer was isolated using the QIAamp DNA Mini Kit (Qiagen, Canada), and the concentration of DNA was determined using the DNA DipStick TM Kit (Invitrogen, Carlsbad, CA). The plasma DNA concentration in healthy donors (n = 43) was 18 ng / ml, in patients with primary squamous cell lung cancer of stage I (n = 46) - 320-344 ng / ml, in patients of stage II and III (n = 15 and n = 23) - 304 and 290 ng / ml, respectively. It was shown that with successful surgery, the level of cancerous DNA in the plasma decreases several times compared with the level before surgery (n = 35).

The disadvantages of this method are the high probability of obtaining false negative results, since this method does not allow to detect tumors localized in various organs. Another disadvantage is the high probability of obtaining false-positive results, since an increase in the concentration of DNA in the blood plasma is observed not only for oncological, but also for non-oncological diseases (trauma [5], autoimmune diseases [6], etc.).

A known method of RNA isolation for subsequent diagnosis of prostate cancer by identifying mutant cancer cell genes by PCR analysis [7]. It is known that in the advanced stages of cancer, metastatic cells circulate in the blood, therefore, for analysis, the cellular fraction of blood is used, from which RNA is isolated by one of the known methods, and then multiplex RT-PCR is performed. Significant amounts (3800 copies / 0.5 ml of blood) of PSA and hK2 mRNA were detected in 84% of patients with malignant tumor in prostate cancer, while only one out of 19 patients (5%) with benign tumor were detected the presence of fragments of PSA and hK2 mRNA in the amount of 1500 and 3100 copies / 0.5 ml of blood. The main disadvantage of this method is that it requires the presence of metastatic cancer cells circulating in the patient’s blood (for non-hematologic tumors), which limits the use of amplification analysis for patients in a precancerous state and with cancer at the initial stage.

A known method of DNA extraction for subsequent diagnosis of cancer by detecting mutant ras oncogenes in plasma of peripheral blood using allele-specific PCR followed by sequencing of the obtained DNA fragments [8]. The disadvantages of this method are the high complexity and duration of DNA isolation, as well as the low reliability of the results of the diagnosis of cancer and especially precancerous conditions due to the small specific content of specific sequences of NK, which complicates the clinical use of this method.

A known method of isolation of extracellular DNA for the subsequent diagnosis of preeclampsia by estimating the amount of extracellular NK circulating in the plasma of pregnant women, amplification methods [9]. The disadvantage of this method is the low reliability of the results of the diagnosis of early pregnancy pathology.

The closest to the claimed method, the prototype is a method for isolating vDNA from blood for the subsequent diagnosis of cancer by identifying cancer-specific markers in plasma and eluates from the surfaces of blood cells [10]. This method includes the following stages: separation of blood into formed elements and plasma, separation of blood cells into red blood cells and white blood cells, processing of these PBS cells with a buffer containing EDTA (for elution of nucleic acids bound to cells due to ionic interactions), then processing of cells with trypsin ( for elution of nucleic acids associated with cells due to protein interactions) and the isolation of extracellular circulating DNA from all of the above fractions (5 pieces) by sorption on fine glass (MMS). After isolation, the DNA is subjected to bisulfite modification followed by polymerase chain reaction to detect changes in methylation status of the RAR / 32, RASSF1A and HIC-1 genes.

The disadvantage of the prototype is the high complexity and multi-stage method and, in this regard, the insufficient sensitivity of the subsequent detection of cancer-specific markers.

An object of the invention is to simplify the method and increase the sensitivity of the analysis.

The problem is achieved by the proposed method, which consists in the following.

Blood is collected by gravity using a needle for transfusion of blood into an anticoagulant solution containing PBS buffer (10 mM phosphate buffer, pH 7.5, 0.15 M NaCl) and 8-15 mM EDTA. Next, Nonidet P-40 (NP-40) or Triton X-100 is added to the blood to a final concentration of 0.5-1.5%, the mixture is incubated in ice for 1-15 minutes, lysed blood is separated into a supernatant containing a plasma fraction and a cytosolic membrane a fraction of blood cells containing extracellular nucleic acids adsorbed on the surface of cell membranes and a nuclear fraction of cells by centrifugation for 15 min at 2000 g. The nuclear fraction of the cells is discarded. Next, the supernatant is treated with an RNA-hydrolyzing enzyme, mainly RNase A with a concentration of 5-100 U at 37 ° C for 20-120 minutes to hydrolyze both cellular and extracellular RNA. From the supernatant treated with the enzyme, a total pool of vnDNA (free and surface-bound blood cells) is extracted using glass fiber sorbents (mainly produced by Biosilica) and known specific nucleic acid sequences are detected by amplification analysis followed by PCR analysis and the conclusion on the presence or absence of detectable nucleotide sequences.

The use of not only free, but also surface-bound blood cells for analysis of vDNA is especially effective for diagnosing the early stages of pathogenesis, in particular cancer, when the bulk of blood vDNA is associated with the cell surface.

The defining hallmarks of the proposed method, compared with the prototype, are:

1. The cells of the test blood are lysed by the addition of Nonidet P-40 (NP-40) or Triton X-100 to a final concentration of these reagents 0.5-1.5%, which ensures the simultaneous release of free and surface-bound vDNA from the blood, which can significantly increase the reliability of identifying specific DNA sequences in the early stages of diseases associated with impaired functioning of the cell’s genetic apparatus.

2. Lysed blood is separated into the supernatant and the nuclear fraction of the cells by centrifugation, which allows to reduce the number of ballast nucleic acids from normal blood cells and increase the specific content of detected specific sequences for further amplification analysis.

3. The supernatant is treated with an RNA-hydrolyzing enzyme and vNDNA is isolated from the obtained fraction using glass fiber sorbents, which allows to simplify the method by reducing the time for sample preparation and, accordingly, the time of the entire analysis (from blood sampling to delivery of the finished result), whereas the prototype use separately free and associated with the cell surface of vDNA.

The simultaneous use of such a diagnostic object as free and associated with the surface of blood cells vDNA allows you to increase the sensitivity of detection of specific sequences due to their increased specific content in the early stages of pathogenesis.

The invention is illustrated by the following examples of specific performance of the method.

Example 1

Blood was drawn from 20 women who first arrived at the Novosibirsk Regional Oncology Center with a primary diagnosis of breast cancer and 20 healthy donors who came to the blood transfusion department of the Central Clinical Hospital of the SB RAS.

Blood was collected by gravity using a blood transfusion needle in an anticoagulant solution containing PBS, 8 mM EDTA. The collected blood was lysed by the addition of NP-40 to a final concentration of 0.5%. After incubation in ice for 15 minutes, the cores were precipitated by centrifugation for 15 minutes at 2000 g. Next, the supernatant of 5 U RNase A was treated at 37 ° C for 120 minutes to hydrolyze both cellular and extracellular PHK. VDNA was isolated from the obtained fraction using a Biosilica commercial DNA isolation kit.

The obtained DNA was modified by treatment with sodium bisulfite, in which unmethylated cytosines at 5 position are converted to uracils (20 minutes at 75 ° C in the presence of 3M NaOH; 4 hours at 56 ° C in the presence of Na ₂ S ₂ O ₅ ; 30 minutes at 37 ° C in the presence of 3M NaOH).

Further, to study the concentration and methylation status of the promoter region of the RARβ2 gene, a real-time polymerase chain reaction was performed using fluorescent dyes SYBR Green I and fluorescein. After initial denaturation of 1.5 minutes at 95 ° C, 38 cycles were performed in the following mode: DNA denaturation at 95 ° C - 15 seconds; primer annealing at 64.5 ° С - 20 seconds; elongation at 72 ° C - 40 seconds; fluorescence detection after 87 ° C - 12 seconds.

The following primers were used:

(direct) 5'-GGT TAG TAG TTC GGG TAG GGT TTA TC-3 '

(reverse) 5'-CCG AAT CCT ACC CCG ACG-3 '

The data obtained for 10 patients are presented in table 1 (The number of copies of the RARbeta gene (methylated form) in the blood supernatant per 1 ml of blood).

This example illustrates that the vDNA isolated by the developed method can be used for early diagnosis of cancer by analyzing the methylation status of vDNA isolated from blood supernatant.

Example 2

During the annual examination of workers (plutonium production and, as a consequence, the risk of cancer of the respiratory tract) in 2006 and 2007, blood samples were taken. The purpose of the survey was to identify among workers with undetermined chronic lung diseases (risk group) the profile of gene hypermethylation (APC and RASSF1A) involved in the regulation of cancer.

Blood was collected by gravity using a blood transfusion needle in an anticoagulant solution containing PBS, 15 mM EDTA. The collected blood was lysed by adding NP-40 to its final concentration of 1.5% for 1 minute in ice, followed by separation by centrifugation for 15 minutes at 2000 g into the supernatant and nuclear fraction. Next, the supernatant was treated with 100 U RNase A for 20 minutes at 37 ° C, and the vDNA was isolated from the obtained fraction using glass fiber sorbents manufactured by Biosilica.

After DNA modification, as described in example 1, real-time PCR was performed using fluorescent dyes SYBR Green I and fluorescein: initial denaturation 1.5 minutes at 95 ° C, then 38 cycles in the following mode:

- for the APC gene - DNA denaturation at 95 ° C - 25 seconds; primer annealing at 64 ° C for 30 seconds; elongation at 72 ° C for 30 seconds; fluorescence detection after 85 ° C - 12 seconds; primers were used [11]:

methylated steam - 5'-TATTGCGGAGTGCGGGTC-3 '(Pr1),

5'-TCGACGAACTCCCGACGA-3 '(Pr2);

unmethylated pair - 5'-GTGTTATTGTGGAGTGTGGGTT-3 '(Pr1),

5'-CCAATSAAAAASTSSSSAAA-3 '(Pr2);

- for the RASSF1A gene - 20 seconds at 95.5 ° C, 25 seconds at 64 ° C (for a labeled pair of primers), 25 seconds at 59 ° C (for an unmethylated pair of primers), 30 seconds at 72 ° C; fluorescence detection after 86 ° C - 15 seconds; primers were used [12]:

methylated pair - 5'-GGGTTTTGCGAGAGCGCG-3 '(Pr1),

5'-GCTAACAAACGCGAACCG-3 '(Pr2);

unmethylated pair - 5'-GGTTTTGTGAGAGTGTGTTTAG-3 '(Pr1),

5'-CACTAACAAACACAAACCAAAC-3 '(Pr2);

The data obtained are presented in table 2, from which it can be seen that the methylated markers APC and RASSF1A associated with pulmonary carcinogenesis are detected with a frequency of up to 63% in the vDNA isolated from blood lysate at an early stage of the disease (2006 survey), which allowed make a preliminary diagnosis. After a year at repeated examination, the percentage of hypermethylated markers in the risk group remained practically unchanged. Within 4 years of the first blood collection, lung cancer was clinically confirmed in 62% of patients at risk. All patients who showed a positive hypermethylation profile were diagnosed with lung cancer.

This example illustrates the suitability of using vDNA isolated from a blood lysate of the claimed method for the early diagnosis of lung cancer, which contributes to the timely selection of the right treatment strategy.

Example 3

A group of women (N = 25), successfully operated on two years ago for a breast cancer and undergoing chemotherapy, received blood samples for prophylactic purposes, as patients with breast cancer are included in the group of cancer patients with a high risk of recurrent neoplasms.

The collected blood was lysed by the addition of Triton X-100 to its final concentration of 0.5% for 15 minutes in ice, followed by centrifugation for 15 minutes at 2000 g into a supernatant and a nuclear fraction. Processing of the supernatant, isolation and study of vDNA circulating in the blood was carried out analogously to example 1 (isolation from blood lysate).

To evaluate the expression of oncogenes, which are of great prognostic value in breast cancer, real-time PCR analysis was performed using primers specific for the c-myc and c-erbB2 genes.

The reaction conditions after one and a half minute DNA denaturation at 95 ° C were as follows:

- for the c-myc gene - 30 cycles: 40 seconds at 94 ° C, 40 seconds at 65 ° C, 50 seconds at 72 ° C; fluorescence detection after 88 ° C - 15 seconds; primers were used [13]:

5'-CTCGAATTCCTTCCAGATATCCTCGCTG-3 '(Pr1);

5'-CACTGCGCGCTGCGCCAGGTTT-3 '(Pr2);

- for the c-erbB2 gene - 35 cycles: 35 seconds at 94 ° C, 30 seconds at 56 ° C, 40 seconds at 72 ° C; fluorescence detection after 85 ° C - 12 seconds; primers were used [14]:

5'-CAGGTAGTTTTGGCGTAAAAAAAA-3 '(Pr1);

5'-CAAAATCCAGGGTTTTTTAAGAGGT-3 '(Pr2).

The percentage revealed in patients (N = 30) overexpression of the studied genes is presented in table 3.

Table 3 shows that analysis of the vDNA isolated from blood lysate revealed overexpression of the studied genes in 23% of women (7/30). Over the next two years, 23% of patients were clinically diagnosed with repeated metastases to regional lymph nodes.

This example illustrates that the developed method can be used to evaluate the effectiveness of surgical intervention and postoperative therapy.

Example 4

Blood samples were taken from a group of women (N = 30) from the pregnancy pathology department of maternity hospital No. 7 to substantiate the possibility of registering women with X and Y linked with hereditary diseases in order to determine the sex of the unborn child.

Isolation of vDNA circulating in the blood was carried out analogously to Example 1 (isolation from blood supernatant). Further, the obtained DNA was used as a matrix for real-time PCR analysis.

As a control, to determine the amount of total vnDNA, DNA with a known concentration diluted from 50 to 5000 copies was used, based on the assumption that 6.6 pg of DNA per cell corresponds to 1 genomic equivalent. Quantitative determination (genome equivalent per 1 ml of blood) of total vnDNA was performed by real-time PCR analysis. The reaction mixture was denatured for 10 minutes at 95 ° C, after which 40 cycles of the polymerase chain reaction were carried out in the following mode: 1 minute at 60 ° C and 15 seconds at 95 ° C; the following primers and a fluorescently-labeled probe were used:

direct 5'-GGGAACTAATGACAAAAGAATTGAC-3 '(Ex. 1),

reverse 5'-AAGAAATAACTTCTGGGTGTGAATAAG-3 '(Ex 2),

straight 5'-GGGAAGAAATGACAAAAGAATTGAC-3 '(Ex 3),

reverse 5'-AAGAAATAACGTCTGGGTGTGAATACG-3 '(Ex 4),

5 '- (6-carboxyfluorescein; FAM) ATTTCACCAAAGTTTACCTTATACTGTG (6-carboxytetramethylrhodamine; TAMPA) -3' (probe).

The data obtained are presented in table 4.

From table 4 it can be seen that in no sample of cDNA isolated from the blood lysate of pregnant women in whom the birth of a girl was confirmed after childbirth, this sequence was not detected. This example illustrates the suitability of vDNA isolated from blood lysate for early diagnosis of fetal sex, which is necessary when pregnancy is weighed down by diseases linked to the floor.

Using the proposed method will allow, in comparison with the prototype:

- to simplify the method and reduce the time of allocation of vDNA from the blood to 40-180 minutes;

- increase the reliability of the subsequent diagnosis of non-cancer and oncological diseases due to the additional use of a more specific diagnostic indicator (vDNA associated with the surface of blood cells);

- exclude the receipt of false positive or false negative results of the analysis by increasing the number of specific nucleic acids in the sample;

- increase the sensitivity of detection of specific (marker) DNA sequences associated with the surface of blood cells, which is especially important in the early stages of the development of pathologies, when the bulk of extracellular nucleic acids is associated with the surface of the cells.

Information sources

1. Shapiro B., Chakrabarty M., Cohn E., Leon S. Determination of circulating DNA levels in patients with benign or malignant gastrointestinal disease // Cancer. 1983. V. 51. P.2116-2120.

2. Sorenson GD, Pribish DM, Valone FH, Memoli VA, Bzik DJ, Yao SL. Soluble normal and mutated DNA sequences from single-copy genes in human blood // Cancer Epidemiology, Biomarkers & Prevention, 1994, V.3: 67-71.

3. Bryzgunova O.E., Vlasov VV, Laktionov P.P. Modern methods for diagnosing prostate cancer // Biomedical chemistry. 2007.V.2. S.128-139.

4. Sozzi G, Conte D., Mariani L., Vullo S., Roz L., Lombargo C., Pierotti M., Tavecchio L. Analysis of circulating tumor DNA in plasma at diagnosis and during follow-up of lung cancer patients // Cancer Res. 2001. V.61. P. 4675-4678.

5. Rainer T., Lo D., Chan L., Lam N., Lit L., Cocks R. Derivation of a prediction rule for posttraumatic organ failure using plasma DNA and other variables. Annals of the New York Academy of Sciences. 2001. V.945. P.211-220.

6. Raptis L., Menard H. Quantitation and characterization of plasma DNA in normals and patients with systemic lupus erythematosus // J. Clin. Invest. 1980. V.66. No. 12. P.1391-1399.

7. Ylikoski A, Pettersson K, Nurmi J, Irjala K, Karp M, Lilja H, Lovgren T, Nurmi M. Simultaneous quantification of prostate-specific antigen and human glandular kallikrein 2 mRNA in blood samples from patients with prostate cancer and benign disease // Clin. Chem. 2002, V. 48 (8): 1265-71.

8. Sorenson GD, Pribish DM, Valone FH, Memoli VA, Bzik DJ, Yao SL. Soluble normal and mutated DNA sequences from single-copy genes in human blood // Cancer Epidemiology, Biomarkers & Prevention, 1994, V.3: 67-71.

9. Zhong XZ, Lavuori H, Livingston JC, Ylikorkala O, Sibai BM, Holzgreve W, Hahn S. Elevation of maternal and fetal extracellular circulating deoxyribonucleic acid concentration in the plasma of pregnant women with preeclampsia // Am. J. Obstet. Gynecol. 2001, V.184 (3): 414-419.

10. Skvortsova T.E., Rykova E.Y., Tamkovich S.N., Bryzgunova O.E., Starikov A.V., Kuznetsova N.P., Vlassov V.V., Laktionov P.P. Cell-free and cell-bound circulating DNA in breast tumors: DNA quantification and analysis of tumor-related gene methylation // British Journal of Cancer. 2006. V.94. P.1492-1495.

11. Virmani AK, Rathi A, Sathyanarayana UG, Padar A, Huang CX, Cunnigham HT, Farinas AJ, Milchgrub S, Euhus DM, Gilcrease M, Herman J, Minna JD, Gazdar AF. Aberrant methylation of the adenomatous polyposis coli (APC) gene promoter 1A in breast and lung carcinomas // Clin. Canc. Res. 2001, V.7 (7): 1998-2004.

12. Burbee D.G .; Forgacs E .; Zochbauer-Muller S .; Shivakumar L .; Fong K .; Gao W .; Randle D .; Kondo M .; Virniani A .; Bader S .; Sekido Y; Latif F .; Milchgrub S .; Toyooka S, Gazdar AF, Lerman MI, Zabarovsky E, White M, Minna JD. Epigenetic inactivation of RASSF 1A in lung and breast cancers and malignant phenotype suppression // J. Natl. Cane. Inst. 2001, V.93 (9): 691-699.

13. Kowara R, Golebiowski F, Chrzan P, Skokowski J, Karmolinski A, awelczyk T. Abnormal FHIT gene transcript and c-myc and c-erbB2 amplification in breast cancer // Acta Biochimica Polonica, 2002, V.49 (2) : 341-350.

14. Lonn U, Lonn S, Nilsson B, Stenkvist B. Prognostic value of erb-B2 and myc amplification in breast cancer imprints. Cancer, 1995, V.75 (11): 2681-2687.

Table 1 Norm Mammary cancer Patient No. one 2 3 four 5 6 7 8 9 10 The number of copies / ml of blood 108 399 193 193 n / a 947 380 396 1148 914 * n / a - the number of DNA copies in the sample is below the detection level of the method used

table 2 Survey groups Gene Year blood vnDNA Risk group, N = 30 ARS 2006 63% 2007 62% RASSF1A 2006 64% 2007 66% In 2006-2007, lung sarcoma was detected in 62% of patients at risk, despite the fact that this group included all patients with an increased level of vDNA hypermethylation Healthy donors, N = 25 ARS 2006 one% 2007 2% RASSF1A 2006 0 2007 0

Table 3 Genes blood vnDNA c-myc 23% c-erbB2 23%

Table 4 Number of samples The number of fetal vDNA in the blood lysate (number of copies / ml of blood) Number of pregnant males twenty 1405.5 * (50-2837) Number of pregnant women with a female fetus 10 0 * - average value

Claims (2)

1. The method of extraction of extracellular deoxyribonucleic acids (vDNA) from the blood to detect specific nucleic acid sequences by amplification methods, characterized in that Nonidet P-40 or Triton X-100 is added to the test blood to a final concentration of 0.5-1.5%, the mixture is incubated in ice for 1-15 minutes, the lysed blood is separated into the supernatant and the nuclear fraction of the cells by centrifugation, the supernatant is treated with 5-100 U of RNase A, and vDNA is isolated from the obtained fraction using a glass fiber sorbent . 2. The method according to claim 1, characterized in that they use fiberglass sorbents produced by "Biosilica".