CN109837343B

CN109837343B - Early lung adenocarcinoma specific exosome miRNA and application thereof

Info

Publication number: CN109837343B
Application number: CN201910133418.2A
Authority: CN
Inventors: 米双利; 李阳阳; 李蒙; 张健; 郭翀晔
Original assignee: Beijing Institute of Genomics of CAS
Current assignee: Beijing Institute of Genomics of CAS
Priority date: 2019-02-22
Filing date: 2019-02-22
Publication date: 2024-03-01
Anticipated expiration: 2039-02-22
Also published as: CN109837343A

Abstract

The invention provides early lung adenocarcinoma specific exosome miRNA and application thereof. The invention utilizes a new generation high throughput sequencing technology and combines a bioinformatics analysis method of a system to collect preoperative and postoperative peripheral blood samples of early lung adenocarcinoma patients and healthy human peripheral blood samples, and obtains the early lung adenocarcinoma specific exosome miRNA by taking intersection of the preoperative and healthy exosome miRNA and the preoperative and postoperative differential exosome miRNA in the normal samples, and performing expression verification in tumor tissues and paracancerous normal samples, wherein the RNA sequences of the early lung adenocarcinoma specific exoexosome miRNA are respectively shown as SEQ ID NO.1-2, and the early lung adenocarcinoma specific exosome miRNA can be used as an early lung adenocarcinoma diagnosis marker. By detecting the miRNA marker, the early lung adenocarcinoma can be subjected to auxiliary diagnosis or postoperative monitoring, the sensitivity reaches 71.9%, the specificity reaches 75.0%, and the miRNA marker has good clinical application value and wide application prospect.

Description

Early lung adenocarcinoma specific exosome miRNA and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an early lung adenocarcinoma specific exosome miRNA molecular marker and application thereof.

Background

The incidence and mortality of cancer is increasing, and has become one of the major diseases that are life threatening health today. Lung cancer is the cancer with the highest incidence and mortality among all cancers. Despite the continued development of diagnostic and therapeutic techniques, the five-year survival rate of lung cancer predictions is still only 15.9%. Lung cancer is classified into small cell cancer and non-small cell lung cancer, and lung adenocarcinoma and lung squamous carcinoma each account for 30% -50% of non-small cell lung cancer. Lung squamous carcinoma, also known as squamous lung carcinoma, is the most common type of lung cancer, and is closely related to smoking, mostly seen in older men. Slow growth, late transfer and high five-year survival rate; lung adenocarcinoma originates from bronchial epithelium or mucous glands, is prone to occur in women, is of small age, and most patients have no obvious clinical symptoms in early stages, and sometimes undergo metastasis in early stages. According to the TNM stage of the tumor, the early stage of the lung cancer is the stage I, which means that the diameter of the tumor is less than or equal to 2cm, the metastasis of lymph nodes or distant places is avoided, the surgical excision effect is good, and the prognosis is good; metaphase includes stage II and stage III, including tumor invasion of adjacent tissues or concomitant lymph node metastasis, surgical treatment coupled with chemotherapy or targeted drug treatment; when distant metastasis occurs in a tumor, it is designated as late stage, stage IV. Surgical treatment has not been suitable for advanced patients and can only extend patient survival by chemotherapy or targeted drug therapy. The current technology for clinical diagnosis of lung cancer mainly comprises puncture, X-ray, spiral CT and the like. However, most lung cancer patients (about 70%) are diagnosed at an advanced stage, delaying treatment. Existing serum protein diagnostic markers applied to clinic, such as carcinoembryonic antigen (CEA) and cytokeratin 19 fragment (CYFRA 21-1), lack sufficient sensitivity and specificity for diagnosing early lung cancer. Therefore, screening for early lung cancer diagnostic markers is quite urgent and of great significance.

mirnas are a class of endogenous, highly conserved, non-coding small molecule RNAs, typically 18-25nt in length. The primary way mirnas play regulatory functions is to mediate mRNA degradation or inhibit translation thereof. Tumor cells abnormally express some miRNA molecules, which lays a foundation for miRNA as a marker for tumor diagnosis and prognosis. mirnas are not only present in cells, but also some free miRNA molecules are present outside cells. In the past, studies have reported that free miRNA in blood can be used as a diagnostic marker for various diseases including cancers. In research reports about lung cancer markers, free miRNAs in plasma, including miR-19b-3p, miR-221-3p, miR-409-3p, miR-425-5p and miR-584-5p, can distinguish lung adenocarcinoma patients from healthy people. And miR-181a-5p, miR-106a-5p and miR-93-5p can distinguish lung squamous carcinoma patients from healthy people.

Recently, it has been discovered that mirnas can also exist in extracellular substructures, exosomes. Exosomes are a class of extracellular vesicles 30-150nm in diameter, containing lipids, proteins and nucleic acids. mirnas are abundant in exosomes and can be transported by exosomes into recipient cells to exert regulatory functions. The advantages of exosomes comprising mirnas as diagnostic markers include three aspects: first, exosomes are present in various body fluids, including blood, urine, saliva, milk, amniotic fluid, and the like. Most body fluids can be obtained in a minimally invasive or even non-invasive manner. Second, a large number of exosomes can be secreted early in the tumor. The exosomes comprise mirnas that are dependent on the parent cell, i.e. exosomes secreted by different tumor cells, and the mirnas contained therein are not identical. Third, the bilayer membrane structure of exosomes protects the stability of their contents, especially some single stranded RNA molecules that are relatively easily degraded. It follows that mirnas contained in plasma exosomes have higher stability than mirnas that are directly dissociated in plasma. Exosome miRNAs are a class of small molecules that are stable, easily detected, and reflect early tumor characteristics.

In research reports on lung cancer markers, serum-derived exosome miRNAs, including miR-106a-5p, miR-20a-5p and miR-93-5p, are found to be highly expressed in male lung squamous carcinoma patients; and miR-126 is highly expressed in early non-small cell lung cancer patients, and the results are obtained by comparing exosome miRNAs of lung cancer patients and healthy control peripheral blood samples. Since exosomes in blood can be derived from cells of various tissues and organs, direct comparison of different individual samples can cause noise interference in the screening. However, there is no technology for isolating tissue-organ specific exosomes.

Another study found that EpCAM positive exosome mirnas could be used as a molecule to distinguish lung cancer patients from healthy individuals. EpCAM is a transmembrane glycoprotein, often present on the surface of cancerous epithelial plasma membrane and its secreted exosomes, and various tumors such as lung cancer, prostate cancer, liver cancer and ovarian cancer secrete EpCAM-positive exosomes, whereas healthy people have extremely low EpCAM-positive exosomes. According to the study, epCAM positive exosomes in peripheral blood of lung cancer patients and healthy people are separated, and the content of the exosomes is analyzed to find that miR-181-5p, miR-30a-3p, miR-30e-3p and miR-361-5p can distinguish lung adenocarcinoma from healthy control, and miR-10b-5p, miR-15b-5p and miR-320b can distinguish lung squamous cell carcinoma from healthy control. The method requires special isolation of EpCAM positive exosomes, and the extremely low EpCAM positive exosomes content of healthy people makes isolation and analysis difficult, and the EpCAM positive exosomes are not only present in lung cancer patients, so the method has certain limitations.

Disclosure of Invention

The invention aims to provide an early lung adenocarcinoma specific exosome miRNA molecular marker and application thereof.

The invention utilizes a new generation high throughput sequencing technology and combines a bioinformatics analysis method of a system to collect a large number of early lung adenocarcinoma patients (IA or IB stage) preoperative and postoperative peripheral blood samples and healthy human peripheral blood samples, and obtains lung adenocarcinoma specific exosome miRNA by taking intersection of the differential exosome miRNA in the preoperative and healthy samples and the differential exosome miRNA in the preoperative and postoperative samples and carrying out expression verification in tumor tissues and paired cancer side normal samples, and screening to obtain lung adenocarcinoma specific exosome miRNA which is hsa-miR-342-5p and/or hsa-miR-574-5p, wherein the RNA sequence of hsa-miR-342-5p is shown as SEQ ID NO. 1; the RNA sequence of hsa-miR-574-5p is shown in SEQ ID NO. 2.

The biological material containing the molecular marker belongs to the protection scope of the invention, and the biological material is an expression cassette, a transposon, a vector, a host cell, a transgenic cell line and engineering bacteria.

The invention provides application of hsa-miR-342-5p and/or hsa-miR-574-5p in preparation of a lung adenocarcinoma detection diagnostic kit.

The invention further provides application of the method for detecting hsa-miR-342-5p and/or hsa-miR-574-5p in preparation of a lung adenocarcinoma detection diagnostic kit.

The invention provides application of a biological material containing hsa-miR-342-5p and/or hsa-miR-574-5p in preparation of a lung adenocarcinoma diagnosis kit, wherein the biological material is an expression cassette, a transposon, a vector, a host cell, a transgenic cell line and engineering bacteria.

The invention provides application of hsa-miR-342-5p and/or hsa-miR-574-5p in preparation of a lung adenocarcinoma therapeutic effect evaluation system.

The invention further provides application of a method for detecting hsa-miR-342-5p and/or hsa-miR-574-5p in preparation of a lung adenocarcinoma therapeutic effect evaluation system.

The invention provides application of a detection reagent of hsa-miR-342-5p and/or hsa-miR-574-5p in preparation of a lung adenocarcinoma diagnosis kit or a lung adenocarcinoma treatment drug effect evaluation system.

The detection reagent is a specific primer pair aiming at hsa-miR-342-5p and/or hsa-miR-574-5 p.

Preferably, the specific primer for detecting hsa-miR-342-5p contains a nucleotide sequence shown in SEQ ID NO. 6; the specific primer for detecting hsa-miR-574-5p contains a nucleotide sequence shown as SEQ ID NO. 7.

In one embodiment of the invention, the nucleotide sequence of the specific primer for detecting hsa-miR-342-5p is shown in SEQ ID NO. 3; the nucleotide sequence of the specific primer for detecting hsa-miR-574-5p is shown in SEQ ID NO. 4.

The invention provides a biological material containing hsa-miR-342-5p and/or hsa-miR-574-5p in preparation of a lung adenocarcinoma therapeutic effect evaluation system, wherein the biological material is an expression cassette, a transposon, a vector, a host cell, a transgenic cell line and engineering bacteria.

The above-mentioned applications of the present invention are all preferably applicable to lung adenocarcinoma, particularly preferably to early lung adenocarcinoma.

The invention also provides a diagnosis kit for lung adenocarcinoma, which contains a detection reagent for detecting hsa-miR-342-5p and/or hsa-miR-574-5p expression quantity. Further, the diagnosis kit for lung adenocarcinoma is a diagnosis kit for early lung adenocarcinoma.

Preferably, the diagnostic kit contains specific primers for detecting hsa-miR-342-5p and/or hsa-miR-574-5p expression levels.

More preferably, the diagnostic kit contains a nucleotide sequence comprising specific primers as shown in SEQ ID NO.6 and/or SEQ ID NO. 7.

Further, the nucleotide sequences of the forward primers of the specific primers for detecting the expression levels of hsa-miR-342-5p and hsa-miR-574-5p in the embodiment of the invention are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4.

The invention has the beneficial effects that the characteristic exosome molecules are screened aiming at early lung adenocarcinoma, the collected samples comprise preoperative and postoperative peripheral blood samples of early lung adenocarcinoma patients and peripheral blood samples of healthy people, and the intersection of the differential exosome miRNA in the preoperative and healthy samples and the differential exosome miRNA in the preoperative and postoperative samples is obtained, and the expression verification is carried out in normal samples beside tumor tissues and cancers. Noise interference of other tissue sources in exosomes of different individuals is reduced, meanwhile, influence of surgery on exosome miRNA composition is reduced, and finally obtained characteristic exosome miRNAs have tissue source specificity and sensitivity to early tumors. The two miRNAs can be independently used for carrying out auxiliary diagnosis or postoperative monitoring on lung adenocarcinoma, especially early lung adenocarcinoma, and the sensitivities of the miRNAs are respectively 70% (hsa-miR-342-5 p) and 62.5% (hsa-miR-574-5 p), and the specificities of the miRNAs are respectively 70.18% (hsa-miR-342-5 p) and 87.72% (hsa-miR-574-5 p); the method can also be used for carrying out auxiliary diagnosis or postoperative monitoring on the early lung adenocarcinoma, has sensitivity of 71.9 percent and specificity of 75.0 percent, is suitable for auxiliary screening of early tumors, and gains treatment opportunity for lung adenocarcinoma patients. The invention has better clinical application value and wide application prospect.

Drawings

FIG. 1 is a graph showing verification of exosome and exosome RNA characteristics. Panel a shows Flow Nano Analyzer the particle size distribution of exosome particles, 99.2nm at peak. Panel b shows the verification of exosome marker proteins CD63 and TSG101 by western blot. Panel c shows Agilent 2100 analysis of exosome total RNA length distribution.

FIG. 2 is an exosome small RNA sequencing analysis. Panel a shows the fractions and ratios of exosome small RNAs. And b is miR-342-5p sequencing expression quantity. And c, sequencing expression quantity of miR-574-5p, wherein a statistical analysis method between samples before and after operation is double-tail pairing t-test. The statistical analysis method between preoperative healthy samples was Mann-Whitney test. Data show mean ± SEM.

FIG. 3 shows RT-qPCR analysis of expression of 3 candidate miRNAs in enlarged samples, 57 preoperative samples, 52 paired post-operative samples, and 40 healthy samples. Panel a shows the relative expression levels of miR-342-5p in preoperative, postoperative and healthy human blood exosomes verified by RT-qPCR. Panel b shows the diagnostic ability of the subject working profile to analyze miR-342-5p in preoperative and healthy samples. Panel c shows the relative expression levels of miR-574-5p in preoperative, postoperative and healthy human blood exosomes verified by RT-qPCR. Panel d shows the diagnostic ability of the test subject working characteristic curve analysis miR-574-5p in preoperative and healthy samples.

FIG. 4 shows RT-qPCR analysis of 2 miRNA expression differences in the exosomes of 8 patients with phase III lung adenocarcinoma, and statistical analysis of Wilcoxon matched pairs test. P=0.0234 for miR-342-5p, p=0.38 for miR-574-5p, data demonstrate relative fold differences.

FIG. 5 shows the fold difference in expression of 2 miRNAs in 8 lung adenocarcinoma tissues and paired paracancerous tissues by RT-qPCR analysis. Statistical analysis was a Wilcoxon matched pairs test. P=0.0234 for miR-342-5p, p=0.0156 for miR-574-5p, data demonstrate relative fold differences.

FIG. 6 is a graph of the working characteristics of subjects combining miR-342-5p and miR-574-5 p.

Detailed Description

The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Modifications and substitutions to methods, procedures, or conditions of the present invention without departing from the spirit and nature of the invention are intended to be within the scope of the present invention.

Unless otherwise indicated, all chemical reagents used in the examples were conventional commercial reagents, and the technical means used in the examples were conventional means well known to those skilled in the art.

Example 1 screening of miRNAs of specific exosomes associated with early lung adenocarcinoma Using bioinformatics

1. And (3) separating and purifying the peripheral blood to obtain the characteristics of the exosomes and the exosome RNA.

The collected samples comprise preoperative and postoperative peripheral blood samples of patients with early lung adenocarcinoma and peripheral blood samples of healthy people, and the intersection of the preoperative and healthy samples and the preoperative and postoperative samples of the differential exosome miRNAs is obtained. The exosome-enriched particles were purified from the peripheral blood sample by conventional ultracentrifugation methods, the source of which is shown in Table 1.

Specifically, after thawing a blood sample frozen at-80℃on ice, filtering with a 0.22 μm filter membrane, centrifuging at 4℃for 10 hours to remove the supernatant, and dissolving the exosome particles in 250. Mu.l of phosphate buffer (PBS, pH 7.4). The particle size distribution of the exosome particles was measured using a Flow Nano Analyzer instrument and indicated that the collected exosome-enriched particles had a diameter of around 99.2nm (fig. 1 a). The exosome-enriched particles were detected by immunoblotting, indicating that the exosome-enriched particles collected in this example have the exosome markers CD63 and TSG101 (b of fig. 1). After the total exosome RNA is purified by TRIzol LS reagent, the length distribution of the total exosome RNA is detected by using Agilent 2100 chip, and the result shows that the length of the total exosome RNA is mostly less than 200nt (c of figure 1), which indicates that the purity of the exosome RNA obtained by the embodiment meets the requirement and no pollution of cell RNA exists.

TABLE 1 sample Source patient and health person information Table

2. Exosome small RNA sequencing.

In order to screen for lung adenocarcinoma early diagnosis markers in exosome mirnas, exosome microrna sequencing was performed in this example. The small RNA sequencing adopts an illuminea HiSeq 2500 system and single-ended 50bp sequencing. The sequencing samples included 7 pairs of preoperative and paired postoperative samples and 7 healthy human samples, totaling 21 samples. Each sample obtained no less than ten million sequenced sequences. These sequenced sequences were aligned to a database of mirnas (mirbase 21) at a percentage of 53.19% to 69.97% (table 2). These microRNA sequences also include ribosomal RNA, mRNA, micronuclear/micronucleolar RNA, miscRNA, and long non-coding RNA fragments (a of FIG. 2). Methods of miRNA expression levels (RPM) per million sequences were used to normalize the expression levels of mirnas.

By comparing the differential miRNAs of the early lung adenocarcinoma disease group (preoperative) and healthy group, respectively, the early lung adenocarcinoma preoperative group and the paired post-operative sample group, and then taking the intersection, 2 exosome miRNAs (miR-342-5 p and miR-574-5 p) were obtained with high content in the disease preoperative group and significantly reduced content in the paired post-operative sample, as well as significantly reduced content in the healthy group. They have the potential to aid in the diagnosis of early lung adenocarcinoma and prognosis monitoring (b, c of fig. 2).

TABLE 2 Small RNA sequencing and miRNA alignment duty cycle

TABLE 3 miRNA sequence information

miRNA name	Sequence(s)
		hsa-miR-342-5p	aggggugcuaucugugauuga(SEQ ID NO.1)
hsa-miR-574-5p	ugagugugugugugugagugugu(SEQ ID NO.2)

EXAMPLE 2RT-qPCR verification of miR-342-5p and miR-574-5p as early lung cancer diagnosis markers

The miR-342-5p and miR-574-5p are verified to be miRNAs with lung cancer early diagnosis marker potential in more samples by RT-qPCR. The total sample amount included 57 cases before the operation, wherein 52 cases are corresponding samples after the operation, and 40 cases are healthy control samples. The kit for Reverse Transcription (RT) was a QIAGEN reverse transcription kit (miScript II RT kit), and the procedure was carried out according to the instructions. qPCR was performed using QIAGEN fluorescent quantitation kit (miScript SYBR Green PCR Kit), and the procedure was as described. Fluorescent quantitative PCR was performed on Bio-rad CFX96 Real time PCR system. The microRNA RNU6 was used as an internal reference and the fold change calculation method was 2-. DELTA.CT. The forward primer sequences for quantitative detection are shown in Table 4, and AGGGGTGCTATCTG (SEQ ID NO. 6) in the sequence shown in SEQ ID NO.3 and TGAGTGTGTGTGTGTGAG (SEQ ID NO. 7) in the sequence shown in SEQ ID NO.4 in Table 4 are core sequences of the forward primer sequences of miR-342-5p and miR-574-5p respectively.

The results indicate that the 2 miRNAs described above are statistically different in both preoperative and healthy samples. The Mann-Whitney test gave p values of 0.0003 (miR-342-5 p) and <0.0001 (miR-574-5 p), respectively (a, c of FIG. 3). The results of the test of the working characteristics of the subjects were miR-342-5p area under the curve 0.7171 (95%CI:0.6146to 0.8196), miR-574-5p area under the curve 0.7671 (95%CI:0.6648to 0.8694), respectively (FIGS. 3b, d). Compared with a preoperative sample and a postoperative sample, the double-tail pairing t-test result shows that the p of miR-342-5p is less than 0.0001, the p=0.0140 of miR-574-5p, and the levels of miR-342-5p and miR-574-5p are obviously reduced after the operation. In addition, miR-342-5p was also significantly decreased post-operatively in 8 paired phase III lung adenocarcinoma patients (FIG. 4).

Table 4 forward primer sequences for quantitative detection of miRNAs (reverse primer is a Universal primer sequence, supplied by QIAGEN Co.)

Example 3 evaluation of miR-342-5p and miR-574-5p expression in cancer tissue and paracancerous tissue to further demonstrate that the difference between miR-342-5p and miR-574-5p contained in peripheral blood exosomes of early lung adenocarcinoma patients and healthy samples was derived from tumor tissue, this example analyzed three miRNAs expression in 8 pairs of cancer tissue and paired paracancerous normal tissue. The RT-qPCR method is the same as above. As a result, miR-342-5p and miR-574-5p were found to be significantly highly expressed in tumor tissues, and Wilcoxon matched pairs test examination revealed that p=0.0234 of miR-342-5p and p=0.0156 of miR-574-5p (FIG. 5).

Since miR-342-5p and miR-574-5p are different in peripheral blood exosomes, and are different in health, preoperative and postoperative comparison, and also are significantly different in cancer tissues and paracancerous tissues, it is considered that the two miRNAs or any one of them can be used as noninvasive lung cancer early diagnosis markers in peripheral blood exosomes. Its sensitivity was 70% (hsa-miR-342-5 p) and 62.5% (hsa-miR-574-5 p), respectively, and its specificity was 70.18% (hsa-miR-342-5 p) and 87.72% (hsa-miR-574-5 p), respectively.

In combination with these two miRNAs analyses, the area under the curve of the subject's working curve was 0.7728 (95%CI:0.6781to 0.8675), the sensitivity was 71.9% and the specificity was 75.0% (FIG. 6) indicating a higher degree of discrimination for the combined use of these two miRNAs (miR-342-5 p and miR-574-5 p).

While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Beijing genome research institute of China academy of sciences

<120> early lung adenocarcinoma specific exosome miRNA and application thereof

<130> KHP191110381.5

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

aggggugcua ucugugauug a 21

<210> 2

<211> 23

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ugagugugug ugugugagug ugu 23

<210> 3

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

acactccagc tgggaggggt gctatctg 28

<210> 4

<211> 32

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

acactccagc tgggtgagtg tgtgtgtgtg ag 32

<210> 5

<211> 17

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ctcgcttcgg cagcaca 17

<210> 6

<211> 14

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

aggggtgcta tctg 14

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

tgagtgtgtg tgtgtgag 18

Claims

1. Application of a reagent for detecting exosome miRNA molecular marker combination in preparation of a diagnostic kit for detecting early lung adenocarcinoma, wherein the molecular marker combination consists of hsa-miR-342-5p and hsa-miR-574-5p in exosome, wherein the RNA sequence of hsa-miR-342-5p is shown as SEQ ID NO.1, and the RNA sequence of hsa-miR-574-5p is shown as SEQ ID NO. 2; the reagents contain specific primer pairs for hsa-miR-342-5p and hsa-miR-574-5 p.

2. Application of a reagent for detecting exosome miRNA molecular marker combination in preparing an early lung adenocarcinoma treatment effect evaluation system, wherein the molecular marker combination consists of hsa-miR-342-5p and hsa-miR-574-5p in exosome, wherein the RNA sequence of hsa-miR-342-5p is shown as SEQ ID NO.1, and the RNA sequence of hsa-miR-574-5p is shown as SEQ ID NO. 2; the reagents contain specific primer pairs for hsa-miR-342-5p and hsa-miR-574-5 p.

3. The use according to claim 1 or 2, characterized in that the nucleotide sequence of the specific primer for detecting hsa-miR-342-5p is shown in SEQ ID No. 6; the nucleotide sequence of the specific primer for detecting hsa-miR-574-5p is shown in SEQ ID NO. 7.