RU2328531C2

RU2328531C2 - Method for diagnosing alleles t30n, s52g, i199v and r200q of prkag3 gene

Info

Publication number: RU2328531C2
Application number: RU2006120129/13A
Authority: RU
Inventors: Ольга Васильевна Костюнина (RU); Ольга Васильевна Костюнина; Натали Анатольевна Зиновьева (RU); Наталия Анатольевна Зиновьева
Original assignee: Всероссийский государственный научно-исследовательский институт животноводства (ВИЖ)
Priority date: 2006-06-09
Filing date: 2006-06-09
Publication date: 2008-07-10
Also published as: RU2006120129A

Abstract

FIELD: molecular genetics.

SUBSTANCE: method for determining the polymorphism of the PRKAG3 gene - meat productivity marker in pigs, is invented.

EFFECT: invention is applicable in molecular genetics for diagnosing alleles which can be used in animal selection.

5 dwg, 1 ex

Description

Изобретение относится к молекулярной генетике, в частности к способам определения полиморфизма генов - маркеров мясной продуктивности свиней.The invention relates to molecular genetics, in particular to methods for determining gene polymorphism - markers of pig meat productivity.

Ген гамма-субъединицы протеинкиназы А (PRKAG3, RN-ген) впервые был открыт у свиней породы гемпшир. Он локализован на хромосоме 15 и имеет размер 5888 п.о., состоит из 11 экзонов и 10 интронов и кодирует пропептид длиной 464 аминокислоты (Milan, D., Jeon, J.T., Looft, C., Amarger, V., Robic, A., Thelander, M., Rogel-Gaillard, C., Paul, S., Iannuccelli, N., Rask, L., Ronne, H., Lundstrom, K., Reinsch,N., Gellin, J., Kalm, E., Roy, P.L., Chardon, P. and Andersson, L. A mutation in PRKAG3 associated with excess glycogen content in pig skeletal muscle. // Science, 2000, 288, 1248-1251). В настоящее время известно 8 генетически обусловленных аллельных вариантов гена PRKAG3 - T30N, S52G, P53L, молчащие мутации в позиции 193 (GCT→GCC) и в позиции 194 (TTG→CTG), I199V, R200Q и молчащая мутация в позиции 372 (ТСС→ТСТ). Наиболее значимые с точки зрения селекции свиней мутации T30N, S52G, I199V, R200Q.The protein kinase A gamma subunit gene (PRKAG3, RN gene) was first discovered in hampshire pigs. It is localized on chromosome 15 and has a size of 5888 bp, consists of 11 exons and 10 introns and encodes a 464 amino acid propeptide (Milan, D., Jeon, JT, Looft, C., Amarger, V., Robic, A ., Thelander, M., Rogel-Gaillard, C., Paul, S., Iannuccelli, N., Rask, L., Ronne, H., Lundstrom, K., Reinsch, N., Gellin, J., Kalm , E., Roy, PL, Chardon, P. and Andersson, L. A mutation in PRKAG3 associated with excess glycogen content in pig skeletal muscle. // Science, 2000, 288, 1248-1251). Currently, 8 genetically determined allelic variants of the PRKAG3 gene are known - T30N, S52G, P53L, silent mutations at position 193 (GCT → GCC) and at position 194 (TTG → CTG), I199V, R200Q and silent mutation at position 372 (TCC → TST). The mutations T30N, S52G, I199V, R200Q most significant from the point of view of selection of pigs.

Известен способ определения полиморфизма PRKAG3 методом прямого секвенирования продуктов ПЦР (Cheung, Р.С.F., Salt, I.P., Davies, S.P., Hardie, D.G., Carling, D. Characterization of AMP-activated protein kinase gamma-subunit isoforms and their role in AMP binding. // Biochem. J., 2000, 346, 659-669), однако данный способ характеризуется большими временными и материальными затратами и, кроме того, требует использования дорогостоящего оборудования (ДНК-секвенаторов). Все это делает его непригодным для рутинного практического применения.A known method for determining PRKAG3 polymorphism by direct sequencing of PCR products (Cheung, P.C. F., Salt, IP, Davies, SP, Hardie, DG, Carling, D. Characterization of AMP-activated protein kinase gamma-subunit isoforms and their role in AMP binding. // Biochem. J., 2000, 346, 659-669), however, this method is characterized by high time and material costs and, in addition, requires the use of expensive equipment (DNA sequencers). All this makes it unsuitable for routine practical use.

Известен способ определения полиморфизма гена PRKAG3 методом ПЦР в режиме реального времени, однако наряду с необходимостью использования дорогостоящего оборудования данный метод характеризуется высокими материальными затратами, требует проведения реакций в особых оптически прозрачных пробирках, а также использования праймеров и зондов, меченных флуоресцентными метками (Milan, D., Jeon, J. - T., Looft, С., Amarger, V., Robic, A., Thelander, M., Rogel-Gaillard, C., Paul, S., Iannuccelli, N., Rask, L., Ronne, H., Lundstrom, K., Reinsch, N., Gellin, J., Kalm, E., Le Roy, P., Chardon, P., Andersson, L.: A mutation in PRKAG3 associated with excess glycogen content in pig skeletal muscle. // Science, 2000, 288, 1248-1251). Все это ограничивает возможность рутинного использования метода как в исследованиях, так и в практике.There is a method for determining the PRKAG3 gene polymorphism by real-time PCR, but along with the need to use expensive equipment, this method is characterized by high material costs, requires reactions in special optically transparent tubes, and the use of primers and probes labeled with fluorescent labels (Milan, D ., Jeon, J. - T., Looft, C., Amarger, V., Robic, A., Thelander, M., Rogel-Gaillard, C., Paul, S., Iannuccelli, N., Rask, L ., Ronne, H., Lundstrom, K., Reinsch, N., Gellin, J., Kalm, E., Le Roy, P., Chardon, P., Andersson, L .: A mutation in PRKAG3 associated with excess glycogen content in pig skel etal muscle. // Science, 2000, 288, 1248-1251). All this limits the possibility of routine use of the method both in research and in practice.

Известен способ определения вариантов гена PRKAG3 методом ПЦР-ПДРФ-анализа, взятый в качестве прототипа (Meadus W.J., MacInnis R., Dugan M.E. R., Aalhus J.L. A PCR-RFLP method to identify the RN - gene in retailed pork chops. // Can J. Anim. Sci, 2002, 82, 449-51). Данный способ основан на амплификации двух фрагментов гена PRKAG3, содержащих исследуемые мутации и последующим гидролизе этих фрагментов эндонуклезами рестрикции и дальнейшим разделением фрагментов в 3%-агарозном геле. Это позволяет проводить генотипирование животных с относительно невысокими материальными затратами. Однако данный способ характеризуется трудоемкостью, сложностью интерпретации результатов и большими временными затратами.A known method for determining variants of the PRKAG3 gene by PCR-RFLP analysis, taken as a prototype (Meadus WJ, MacInnis R., Dugan MER, Aalhus JL A PCR-RFLP method to identify the RN - gene in retailed pork chops. // Can J . Anim. Sci, 2002, 82, 449-51). This method is based on the amplification of two fragments of the PRKAG3 gene containing the studied mutations and the subsequent hydrolysis of these fragments with restriction endonucleoses and further separation of the fragments in a 3% agarose gel. This allows genotyping of animals with relatively low material costs. However, this method is characterized by the complexity, the complexity of the interpretation of the results and high time costs.

Задача изобретения заключалась в расширении арсенала способов диагностики мутаций T30N, S52G, I199V и R200Q гена PRKAG3 для определения генотипов животных по данному гену, снижении трудоемкости и временных затрат предлагаемого способа.The objective of the invention was to expand the arsenal of methods for diagnosing mutations T30N, S52G, I199V and R200Q of the PRKAG3 gene to determine animal genotypes for this gene, reducing the complexity and time costs of the proposed method.

Технический результат изобретения достигается тем, что предложен способ диагностики аллелей T30N, S52G, I199V и R200Q гена PRKAG3, включающий амплификацию двух фрагментов - фрагмента 1 гена PRKAG3 длиной 270 п.о., включающего часть экзона 1 и содержащего специфические мутации в позиции 30 и 52 аминокислотной последовательности, и фрагмента 2 гена PRKAG3 длиной 118 п.о., включающего часть экзона 3 и специфические точковые мутации в позиции 199 и 200 аминокислотной последовательности, с использованием биотинилированных реверсивных праймеров:The technical result of the invention is achieved by the fact that the proposed method for the diagnosis of T30N, S52G, I199V and R200Q alleles of the PRKAG3 gene, including amplification of two fragments - fragment 1 of the PRKAG3 gene with a length of 270 bp, including part of exon 1 and containing specific mutations at positions 30 and 52 amino acid sequence, and PRKAG3 gene fragment 2 of 118 bp length, including a portion of exon 3 and specific point mutations at positions 199 and 200 of the amino acid sequence using biotinylated reverse primers:

270 F (позиции 8242 до 8266) AGCTTCCTAGAGCAAGGAGAGAGCC270 F (positions 8242 to 8266) AGCTTCCTAGAGCAAGGAGAGAGCC

270 R bio (позиции 8321 до 8342) ACTGGCTGCATGATGTTATGTGC270 R bio (positions 8321 to 8342) ACTGGCTGCATGATGTTATGTGC

264 F (позиция 8196 до 8218) ATTCACCCTCAACTGTTCTCTCC264 F (position 8196 to 8218) ATTCACCCTCAACTGTTCTCTCC

264 R bio (позиция 8376 до 8396) TCACCCACGAAGCTCTGCTTC264 R bio (item 8376 to 8396) TCACCCACGAAGCTCTGCTTC

Особенностью которого является то, что последующее генотипирование продуктов реакции проводят посредством пиросеквенирования с использованием генетических зондов:The peculiarity of which is that subsequent genotyping of the reaction products is carried out by pyrosequencing using genetic probes:

30 Seq (позиция 69 до 85) AAGCCATGGGGACCAGG30 Seq (position 69 to 85) AAGCCATGGGGACCAGG

52 Seq (позиция 135 до 150) GCCTCCGGGCCCGAGG52 Seq (Position 135 to 150) GCCTCCGGGCCCGAGG

199/200 Seq (позиция 1831 до 1843) TGGTGGCCAACGG199/200 Seq (Position 1831 to 1843) TGGTGGCCAACGG

зондов 30 Seq и 52 Seq в мультиплексной системе генотипирования для фрагмента 1 и зонда 199/200 Seq в симплексной системе анализа для фрагмента 2.30 Seq and 52 Seq probes in the multiplex genotyping system for fragment 1 and 199/200 Seq probes in the simplex analysis system for fragment 2.

Нами были подобраны две пары специфических праймеров и 3 секвенирующих зонда (генный банк №АF214521, www.ncbi.nlm.nih.gov) фиг.1:We selected two pairs of specific primers and 3 sequencing probes (gene bank No. AF214521, www.ncbi.nlm.nih.gov) figure 1:

Теоретические выкладки определения полиморфизма гена PRKAG3 в позициях T30N, S52G и I199V, R200Q методом пиросеквенирования в виде гистограмм представлены на фиг.2 и 3.Theoretical calculations of the determination of PRKAG3 gene polymorphism at positions T30N, S52G and I199V, R200Q by pyrosequencing in the form of histograms are presented in Figs. 2 and 3.

Пример. Контрольное использование предложенного способа для идентификации генотипов гена PRKAG3 было проведено на 100 свиньях пород йоркшир, ландрас и дюрок («Троснянский бекона. Орловская обл.). ДНК выделяли из ткани методом Кавасаки по ранее опубликованной методике (Зиновьева Н.А., Попов А.Н., Эрнст Л.К. и др. Методические рекомендации по использованию метода полимеразной цепной реакции в животноводстве. Дубровицы, 1998, 47 с.).Example. The control use of the proposed method for identifying PRKAG3 gene genotypes was carried out on 100 pigs of Yorkshire, Landrace and Duroc pigs (Trosnyansky Bacon. Oryol Region). DNA was isolated from tissue by the Kawasaki method according to a previously published technique (Zinovieva N.A., Popov A.N., Ernst L.K. et al. Guidelines for the use of the polymerase chain reaction method in animal husbandry. Dubrovitsy, 1998, 47 pp.) .

1. ПЦР1 и ПЦР2 проводили в конечном объеме 40 мкл с использованием праймеров 270 F и 270 R Bio в ПЦР1 и 264 F и 264 R Bio в ПЦР2 в количестве по 10 пкмоль каждого в стандартном температурно-временном режиме.1. PCR1 and PCR2 were carried out in a final volume of 40 μl using primers 270 F and 270 R Bio in PCR1 and 264 F and 264 R Bio in PCR2 in an amount of 10 pmol each in a standard temperature-time regime.

2. В продукты ПЦР1 и ПЦР2 вносили секвенирующие зонды 30 Seq 52 Seq и 199/200seq и проводили денатурацию в течение 2 мин при 90°С.2. Sequencing probes 30 Seq 52 Seq and 199 / 200seq were added to the PCR1 and PCR2 products and denatured for 2 min at 90 ° С.

3. Проводили пиросеквенирование денатурированных ПНР-продуктов на PSQ 96 МА.3. Conducted pyrosequencing of denatured PNR products on PSQ 96 MA.

4. Генетические профили полиморфизма гена PRKAG3 в виде результирующих пирограмм представлены на фиг.4 и 5.4. Genetic profiles of the polymorphism of the PRKAG3 gene in the form of the resulting pyrograms are presented in FIGS. 4 and 5.

Таким образом, предложенный способ позволил осуществить одновременную диагностику аллелей T30N, S52G, I199V и R200Q гена PRKAG3 и определить соответствующие генотипы животных. При этом обеспечивалось сокращение затрат времени на выполнение генотипирования. Если при использовании ПЦР-ПДРФ-анализа требуется 12 часов, то пост-ПЦР-анализ-96 проб в предлагаемом нами способе диагностики длится 14 мин, пробоподготовка занимает 20 мин.Thus, the proposed method allowed the simultaneous diagnosis of the T30N, S52G, I199V and R200Q alleles of the PRKAG3 gene and to determine the corresponding animal genotypes. At the same time, the time spent on genotyping was reduced. If using PCR-RFLP analysis requires 12 hours, then post-PCR analysis of 96 samples in our diagnostic method lasts 14 minutes, sample preparation takes 20 minutes.

Изобретение применимо в молекулярной генетике животных для диагностики аллелей T30N, S52G, I199V и R200Q и определения генотипов гена PRKAG3 с целью последующего использования результатов в популяционной генетике, разведении и селекции свиней.The invention is applicable in animal molecular genetics for the diagnosis of T30N, S52G, I199V and R200Q alleles and determination of PRKAG3 gene genotypes for the subsequent use of results in population genetics, breeding and selection of pigs.

Claims

A method for the diagnosis of the T30N, S52G, I199V and R200Q alleles of the PRKAG3 gene, comprising the amplification of two fragments of the PRKAG3 gene fragment 1 of the 270 bp PRKAG3 gene, including part of exon 1 and containing specific mutations at positions 30 and 52 of the amino acid sequence, and fragment 2 of the gene 118 bp PRKAG3 including a portion of exon 3 and specific point mutations at positions 199 and 200 of the amino acid sequence using biotinylated reverse primers

270F (items 8242 to 8266) AGCTTCCTAGAGCAAGGAGAGAGCC

270R bio (items 8321 to 8342) ACTGGCTGCATGATGTTATGTGC

264F (item 8196 to 8218) ATTCACCCTCAACTGTTCTCTCC

264R bio (item 8376 to 8396) TCACCCACGAAGCTCTGCTTC

characterized in that subsequent genotyping of the reaction products is carried out by pyrosequencing using genetic probes:

30 Seq (position 69 to 85) AAGCCATGGGGACCAGG

52 Seq (Position 135 to 150) GCCTCCGGGCCCGAGG

199/200 Seq (Position 181 to 1843) TGGTGGCCAACGG

30 Seq and 52 Seq probes in the multiplex genotyping system for fragment 1 and 199/200 Seq probes in the simplex analysis system for fragment 2.