RU2319503C2 - Composition for immunization (variants), method for its preparing and using for treatment of allergic eosinophilic diseases - Google Patents

Abstract

FIELD: medicine, virology, immunology, molecular biology.

SUBSTANCE: invention proposes a composition containing virus-like particle and at least one protein or peptide IL-5, IL-13 or human eotaxine bound with its. Also, invention discloses method for preparing this composition and using, pharmaceutical composition and vaccine composition containing such composition. Proposed compositions can be used in treatment of allergic diseases with an eosinophilic component. Except for, proposed compositions are used especially for effective induction of responses specific for autoantigens.

EFFECT: valuable medicinal properties of composition.

40 cl, 1 tbl, 14 dwg, 11 ex

Description

BACKGROUND OF THE INVENTION

Field of Invention

This invention relates to the fields of molecular biology, virology, immunology and medicine. The invention relates to a composition comprising an ordered and repeating matrix of antigens or antigenic determinants, and in particular, a matrix containing an IL-5, IL-13 or eotaxin protein or peptide. More specifically, the invention relates to a composition comprising a virus-like particle and at least one protein or peptide of IL-5, IL-13 and / or eutaxin associated with it. The invention also relates to a method for producing conjugates and, accordingly, ordered and repeating matrices. The compositions of the invention are useful in the preparation of vaccines for the treatment of allergic diseases with an eosinophilic component and as a pharmaceutical vaccine for the prevention or treatment of allergic diseases with an eosinophilic component and for the effective induction of immune responses, in particular humoral responses. In addition, the compositions of the invention are particularly useful for the effective induction of autoantigen-specific immune responses in this context.

Linked Area

A number of allergic diseases, including asthma, nasal rhinitis, nasal polyps, eosinophilic syndromes and atopic dermatitis, have noticeable inflammatory components, characterized by pronounced eosinophil infiltration.

The most medically important group of these diseases, atopic asthma, is considered a chronic inflammatory disease of the respiratory tract, which is clinically characterized by episodic airflow obstruction, inflammation of the airways and increased bronchial reactivity to non-specific allergens. The degree of airway obstruction and hyperreactivity often correlates with the level of airway inflammation. These clinical signs are indicative of asthma severity (Kay, AB, J. Allergy Clin. Immunol., 1991, 87: 893; De Monchy, JG et al., Am. Rev. Respir. Dis., 1985, 131: 373; Beasley , R. et al., Am. Rev. Respir. Dis., 1989, 139: 806; Azzawi, M. et al., Am. Rev. Respir. Dis., 1990, 142: 1407; Ohashi, Y. et al., Am. Rev. Respir. Dis., 1992, 145: 1469; Nakajima, H. et al., Am. Rev. Respir. Dis., 1992, 146: 374; Broide, DH et al., Allergy Clin Immunol., 1991, 88: 637; Warlaw, AJ et al., Am. Rev. Respir. Dis., 1988, 137: 62). Cell infiltration correlates with disease progression and indicates airway inflammation, which is the main factor that contributes to pathogenesis and pathobiology. Inflammatory infiltrate in asthma is complex; however, it is now widely known that CD4 ⁺ Th lymphocytes with a Th2 cytokine expression profile (Th2 cells) play a central role in the clinical manifestation and pathogenesis of this disease (Robinson, DS et al., J. Allergy Clin. Immunol., 1993 92: 397; Walker, C. et al., J. Allergy Clin. Immunol., 1991, 88: 935). Th2 cells regulate disease progression and airway hypersensitivity (AHR) by controlling allergic inflammation by releasing a number of cytokines such as IL-4, -5, -9, -10, -13 (Robinson, DS et al., N. Eng. J. Med., 1992, 326: 298; Robinson, DS et al., J. Allergy Clin. Immunol., 1993, 92: 313; Walker, C. et al., Am. Rev. Respir. Dis., 1992 146: 109; Drazen, JM et al., J. Exp. Med., 1996, 183: 1). Like Th2 cells, levels of eosinophils and their lung inflammation products correlate with the severity of the disease, and the accumulation of these leukocytes in the airways is the main sign of bronchial dysfunction during the late phase of the asthmatic response (Bousquet, J. et al., N. Eng. J. Med., 1990, 323: 1033). Although Th2 cells control many aspects of the allergic response, it is believed that their role in the regulation of eosinophilia through the secretion of IL-5 is the main pro-inflammatory direction in asthma.

Interleukin-5 (IL-5) is a pro-inflammatory cytokine expressed in asthmatics at a high level. In addition, IL-5 is a cytokine primarily involved in the pathogenesis of atopic diseases. It specifically controls the production, activation and localization of eosinophils, the main cause of tissue damage in atopic diseases. In addition, IL-5 is an inducible cytokine produced by T cells with marked specificity for the eosinophil line. IL-5 is monitored at the transcription level, and gene regulation is a promising target for the treatment of eosinophil-dependent allergic diseases such as asthma, eczema, and rhinitis.

There is plenty of evidence that eosinophils are a key component of an allergic response in asthma. IL-5 is clearly involved in the production of eosinophils and, together with many other cytokines, such as IL-13, chemokines, such as eotaxin, and other factors, controls their activation, localization, and viability. Thus, IL-5 has become an important drug target for new anti-asthma drugs (Foster, PS et al., Pharmacol. Ther., 2002, 94 (3): 253; Foster, PS et al., Trends Mol. Med., 2002 , 8 (4): 162).

There is 71% homology between human and mouse proteins (a guide to cytokines). IL-5 does not show significant homology of the amino acid sequence with other cytokines, with the exception of short sections in proteins: mouse interleukin-3, mouse GM-CSF and mouse interferon-γ. The calculated molecular weight of the protein and human and mouse sequences is 13.1 kD. Biologically active IL-5 is a disulfide-bonded homodimer that is covalently coupled using highly conserved cysteine residues (44-86 'and 86-44') that orient monomers in a head-to-tail configuration (Takahashi T. et al. Mol. Immunol. 27: 911-920, 1990). Although wild-type monomeric IL-5 is inactive, the functional monomer IL-5 was constructed by insertional mutagenesis (Dickason R. R., et al., J. Mol. Med 74: 535-46 1996). Analysis of the crystal structure of human IL-5 revealed a new configuration consisting of two domains, with each domain requiring the participation of two chains, the folding of which is very similar to the folding of the cytokine found in GM-CSF, interleukin-3, and interleukin-4 (Milburn MV et al., Nature 363: 172-176). The C-terminal region of IL-5 appears to be necessary for binding to the IL-5 receptor and for biological activity (Proudfoot et al., J. Protein Chem. 15 (5): 491-9, 1996). It is believed that the binding of IL-5 to its receptor occurs in regions overlapping the A and D helices, with the A helix being mainly involved in the binding of the α-subunit of the receptor (Graber P. et al. J. Biol. Chem. 270: 15762- 15769, 1995). Native human IL-5 has 2 potential glycosylation sites, and mouse IL-5 has three. Human IL-5 is both N-glycosylated and O-glycosylated at Thr 3. Recombinant IL-5 expressed in eukaryotic systems has a wide molecular weight range of 45-60 kD due to differential glycosylation. Deglycosylated IL-5 and IL-5 expressed in prokaryotic cells fully retains biological activity (Tominaga A. et al., J. Immunol 144: 1345-1352, 1990).

Pathways for drug discovery are usually based on screening for IL-5 production inhibitors, ligand antagonists, control of receptor expression, and receptor activation. In particular, inhibition of the action of IL-5 may provide a treatment for asthma and other diseases associated with eosinophils. Immunotherapy is another and very attractive way to control the levels of IL-5 and pathological conditions associated with eosinophilia, such as asthma.

Currently, the most common treatment for preventing asthma symptoms is through inhalation of corticosteroids. Usually the use of these funds is quite safe and cheap. However, they function by inducing a general immunosuppressive effect, and there are adverse side effects associated with their prolonged use, including high blood pressure, osteoporosis, and the development of cataracts. Corticosteroids must be taken every day and therefore patient compliance with this requirement is another problem for the successful use of these drugs. In addition, there are patients who are not susceptible to the use of corticosteroids who require the use of alternative therapy. Selective targeting - eosinophils, using immunotherapeutic agents directed against IL-5, can overcome the adverse effects of using common immunosuppressive agents with pleiotropic effects.

In the future, a possible treatment for diseases such as asthma may include passive immunization and thus the use of monoclonal antibodies specific for IL-5. Clinical trials of humanized monoclonal antibodies against IL-5 are being conducted, aimed at reducing eosinophilia in patients with asthma. In particular, clinical trials have been reported using SCH55700 (eslizumab, Schering Plow), which is a humanized monoclonal antibody with activity against IL-5 from various species [Egan, RW et al., Arneimittel-Forschung, 1999, 49: 779], and SB240563 (mepolizumab, Glaxo Smith Kline), which is a humanized antibody with specificity for human interleukin-5 and primates [Hart, TK et al., Am. J. Respir. Crit. Care Med., 1998, 157: A744; Zia-Amirhosseini, P. et al., J. Pharmacol. Exp. Ther., 1999, 291: 1060]. Both monoclonal antibodies showed acceptable safety profiles in phase 1 trials and resulted in a decrease in eosinophil counts, but no decrease in airway hyperreactivity was observed. It is believed that the deleterious effect that eosinophils have on the respiratory tract of asthma patients is a chronic phenomenon involving tissue remodeling. Studies needing to be evaluated and developed are designed to test the effectiveness of anti-IL-5 therapy in this context.

However, treatment with mAbs entails several drawbacks. Monoclonal antibodies are expensive therapeutic agents that must be taken within a month or two months. An important problem is the problem of non-compliance with prescriptions by patients, which arises from repeated visits to the doctor for the introduction of an injectable drug. In addition, deviations in allotypes between the patient and the therapeutic antibody can lead to the fact that monoclonal antibody therapy will ultimately become ineffective. A high dose of mAbs and the possibility of the formation of immune complexes can also reduce the effectiveness of passive immunization. Active vaccination techniques limit these difficulties.

Another method providing therapeutic agents against chronic asthma and other pathological conditions in which eosinophilia or other conditions associated with IL-5 is manifested is described in WO 97/45448. This application proposes the use of "modified and variant forms of IL5 molecules capable of antagonizing the activity of IL5" to improve, weaken or reduce otherwise abnormal effects caused by native and mutant forms of IL5. The antagonizing effect has been reported to result from variant forms of IL5 binding to the low affinity IL5R chain, but not to high affinity receptors. Acting in this way, variants compete with IL5 for binding to its receptors, without affecting the physiological effects of IL5.

Eotaxin is a chemokine specific for the chemokine receptor 3 present on eosinophils, basophils and Th2 cells. However, eotaxin is highly specific for eosinophils (Zimmerman et al., J. Immunol. 165: 5839-46 (2000)). Eosinophil migration is reduced by 70% in mice "knocked out" by eotaxin-1, which, however, can still develop eosinophilia (Rothenberg et al., J. Exp. Med. 185: 785-90 (1997)). IL-5 appears to be responsible for the migration of eosinophils from the bone marrow to the blood, and eotaxin is responsible for local migration in the tissue (Humbles et al., J. Exp. Med. 186: 601-12 (1997). Thus, the use of eotaxin as a target in addition to IL-5 may enhance immunotherapy aimed at reducing eosinophilia.

The human genome contains 3 genes of eotaxin, eotaxins 1-3, which have 30% homology. Currently, 2 genes are known in mice: eotaxin 1 and eotaxin 2 (Zimmerman et al., J. Immunol. 165: 5839-46 (2000)). They have 38% homology. Mouse eotaxin 2 is 59% homologous to human eotaxin 2. Eotaxin 1 in mice appears to be expressed universally in the gastrointestinal tract, while eotaxin-2 appears to be predominantly expressed in the jejunum (Zimmerman et al., J. Immunol. 165: 5839-46 (2000) ) Eotaxin-1 is present in bronchoalveolar fluid (Teixeira et al., J. Clin. Invest. 100: 1657-66 (1997)). The human eotaxin-1 sequence is shown in SEQ ID No .: 242 (a / c 1-23 correspond to the signal peptide), the human eotaxin-2 sequence is shown in SEQ ID No .: 243 (a / c 1-26 correspond to the signal peptide), the sequence of human eotaxin-3 is shown in SEQ ID No .: 244 (a / c 1-23 correspond to a signal peptide), the sequence of mouse eotaxin-1 is shown in SEQ ID No .: 245 (a / c 1-23 correspond to a signal peptide) and the mouse eotaxin-2 sequence is shown in SEQ ID No .: 246 (a / c 1-23 correspond to the signal peptide).

The eotaxin monomer has a mass of 8.3 kDa and is in equilibrium with dimeric eotaxin over a wide range of conditions. The determined Kd is 1.3 mM at 37 ° C, but the monomer is the predominant form (Crump et al., J. Biol. Chem. 273: 22471-9 (1998). The structure of eotaxin was determined by NMR spectroscopy. The binding site to its receptor, CCR3, is located at the N-terminus and the region preceding the first cysteine is the most important (Crump et al., J. Biol. Chem. 273: 22471-9, 1998). Peptides derived from eotaxin-associated chemokine receptors, This observation confirmed that Eotaxin has four cysteines that form two disulfide bridges and can be chemically synthesized (Clark-Lewis et al. , Biochemistry 30: 3128-3135, 1991). Eotaxin 1 is differently O-glycosylated according to Thr71 (Noso, N. et al., Eur. J. Biochem. 253: 114-122). Expression of eotaxin 1 in cytosol is also described. E. coli (Crump et al., J. Biol. Chem. 273: 22471-9 (1998)). In the case of eotaxin-2, expression in E. coli was reported as inclusion bodies, followed by refolding (Mayer et al., Biochemistry 39: 8382-95 (2000)) and on expression in insect cells (Forssmann et al., J. Exp. Med. 185: 2171-6 (1997)).

Interleukin 13 (IL-13) is secreted as a biologically active monomeric Th2 cytokine. The mature form of IL-13 contains 112 amino acids in humans and 111 amino acids in mice. The calculated molecular weight of the protein is approximately 12.4 kDa. IL-13 may be N-glycosylated (Fitzgerald K. A. et al., The Cytokines Fact Book 2nd edition Academic Press). IL-13 is produced by Th2 cells, mast cells, basophils and natural killer cells (Brombacher F, 2000 Bioessays Jul; 22 (7): 646-56). A functional IL-13 receptor is a heterodimer consisting of an interleukin 4 receptor α chain (IL-4R α chain) and one of two IL IL 13 receptor binding proteins (Brombacher F, 2000 Bioassays Jul; 22 (7): 646- 56).

IL-13 plays an important role in asthma pathology. It has been shown that IL-13 is involved in the main symptoms of this disease. It has a direct effect on allergen-induced airway hypersensitivity (AHR) and mucus production and is implicated in eosinophilia (Kuperman D. A. 2002, Nature Medicine, in press). Selective neutralization of IL-13 in mice significantly attenuated the asthma phenotype. In addition, the administration of IL-13 conferred an asthma-like phenotype to unsensitized T-cell deficient mice or normal mice, respectively (Grünig G. et al., 1998, Science, 282 (5397): 2261-3; Wills-Karp, M. et al., 1998 Science, 282 (5397): 2258-61). In mice with a targeted deletion of IL-13, allergen-induced AHR could not develop, and a marked decrease in mucus production was observed (Walter, D. M. et al., 2001, J. Immunol. 167 (8): 4668-75). Since IL-13 also affects eosinophilia in a model of asthma in mice (Grünig G. et al., 1998, Science, 282 (5397): 2261-3), it is possible that IL-13 is involved in many other allergic diseases associated with with eosinophilia, and the neutralization of its activity can serve as a promising way to treat patients.

In addition, upregulation of IL-13 and IL-13 receptor has been detected in many types of tumors (for example, in all Hodgkin lymphoma cell lines studied to date). Thus, immunization against IL-13 can provide a method for treating patients with tumors overexpressing IL-13.

One way to increase the effectiveness of vaccination is to increase the degree of repeatability of the antigen used. Unlike isolated proteins, viruses induce immediate and effective immune responses in the absence of any adjuvants with or without T cells (Bachmann and Zinkernagel, Ann. Rev. Immunol. 15: 235-270 (1991)) . Although viruses often consist of a small amount of proteins, they are able to trigger much stronger immune responses than their isolated components. In the case of B cell responses, it is known that one key factor for the immunogenicity of viruses is the repeatability and order of surface epitopes. Many viruses have a quasicrystalline surface on which a regular epitope matrix is exposed that effectively cross-binds epitope-specific immunoglobulins on B cells (Bachmann and Zinkernagel, Immunol. Today 17: 553-558 (1996)). This cross-linking of surface immunoglobulins on B cells is a potent activation signal that directly induces cell cycle progression and production of IgM antibodies. In addition, such stimulated B cells are capable of activating helper T cells, which, in turn, induce a switch from production of IgM to production of IgG antibodies in B cells and the formation of long-lived memory B cells - the goal of any vaccination (Bachmann and Zinkernagel , Ann. Rev. Immunol. 15: 235-270 (1997)). The viral structure is even associated with the formation of anti-antibodies that occurs in autoimmune disease and is part of the natural response to pathogens (see Fehr, T., et al., J Exp. Med. 185: 1785-1792 (1997)). Thus, antibodies presented on a highly organized viral surface are capable of inducing potent responses in the form of anti-antibodies.

However, as indicated, usually the immune system cannot produce antibodies against the structures of its own body. In the case of soluble antigens present in low concentration, this is a consequence of tolerance at the level of Th cells. Under such conditions, the binding of autoantigen to a carrier that can provide T-assistance can impair tolerance. For soluble proteins present in high concentrations or membrane proteins in low concentrations, B and Th cells may be tolerant. However, B-cell tolerance may be reversible (anergy) and may be impaired by the administration of a highly organized antigen bound to a foreign carrier (Bachmann and Zinkernagel, Ann. Rev. Immunol. 15: 235-270 (1997)).

SUMMARY OF THE INVENTION

The authors found that a protein or peptide of IL-5, IL-13 or eotaxin, which are associated with a central particle having a structure with its inherent repetitive organization, and thus, in particular, with virus-like particles (VLP) and VLP subunits, respectively, leading to the formation of highly ordered and repeating conjugates, are effective immunogens for the induction of antibodies specific for IL-5, IL-13 or eotaxin. In addition, these autoreactive antibodies inhibit eosinophilia in a mouse model of asthma. Thus, this invention relates to a therapeutic method for treating an allergic eosinophilic disease, which is based on an ordered and repeating matrix of a protein or peptide of IL-5, IL-13 or eotaxin-central particle, and, in particular, to a conjugate or matrix of a VLP protein or peptide IL-5, IL-13 or eotaxin, respectively. The specified therapeutic agent is able to induce high titers of antibodies against IL-5, IL-13 or eotaxin in a vaccinated animal and inhibit eosinophilia in a mouse model of asthma.

Thus, this invention relates to a composition comprising (a) a central particle with at least one first binding site, and (b) at least one antigen or antigenic determinant with at least one second binding site, wherein said antigen or antigenic the determinant is an IL-5, IL-13 or eotaxin protein or peptide, and wherein said second binding site is selected from the group consisting of (i) a non-naturally occurring binding site with said antigen or antigenic determinant, and (ii) the site is linked I naturally occurring with said antigen or antigenic determinant, wherein said second attachment site is capable of association to said first attachment site and wherein said antigen or antigenic determinant and said core particle interact through said association to form an ordered and repetitive antigen array. Preferred variants of the central particles suitable for use in this invention are a virus, virus-like particle, bacteriophage, bacterial fimbria or flagellum, or any other central particle having an inherent repeating structure capable of forming an ordered and repeating antigenic matrix according to this invention.

More specifically, the invention relates to a composition comprising an ordered and repeating matrix of antigens or antigenic determinants, and thus, in particular, conjugates of an IL-5, IL-13 or eotaxin-VLP protein or peptide. More specifically, the invention relates to a composition comprising a virus-like particle and at least one protein or peptide of IL-5, IL-13 or eotaxin associated with it. The invention also relates to a method for producing conjugates and ordered and repeating matrices, respectively. The compositions of the invention are useful in the preparation of vaccines for the treatment of allergic diseases with an eosinophilic component and as pharmaceutical vaccines for the prevention or treatment of allergic diseases with an eosinophilic component and for the effective induction of immune responses, in particular humoral responses. In addition, the compositions of the invention are particularly useful for the effective induction of autoantigen-specific immune responses in this context.

In the present invention, the protein or peptide of IL-5, IL-13, or eotaxin is usually bound to the central particle and, accordingly, to the VLP in an oriented manner, forming an ordered and repeating matrix of antigens of the protein or peptide of IL-5, IL-13, or eotaxin. In addition, the highly repetitive and organized structure of the central particles and, accordingly, VLP mediates the exposure of the protein or peptide of IL-5, IL-13 or eotaxin in a highly ordered and repetitive manner, leading to the formation of a highly organized and repeating antigenic matrix. In addition, the binding of a protein or peptide of IL-5, IL-13, or eotaxin to the central particle and, accordingly, to VLP provides epitopes of helper T cells, since the central particle and VLP are foreign to the host immunized with the matrix of the central particle a protein or peptide of IL-5, IL-13 or eotaxin, and, accordingly, a matrix of a VLP protein or peptide of IL-5, IL-13 or eotaxin. These matrices differ from prior art conjugates in their highly organized structure, size and repeatability of antigen on the matrix surface.

In one aspect of the invention, an IL-5, IL-13 or eotaxin protein or peptide is expressed in a suitable expression host compatible with the correct folding of IL-5, IL-13 or eotaxin or IL-5, IL-13 or eotaxin peptide, or synthesized while the central particle and, accordingly, VLP are expressed and purified from an expression host suitable for laying and assembling the central particle and, accordingly, VLP. A protein or peptide of IL-5, IL-13, or eotaxin can be synthesized chemically. An IL-5, IL-13 or eotaxin protein or peptide matrix is then assembled by binding the IL-5, IL-13 or eotaxin protein or peptide to a central particle and, accordingly, to VLP.

In another aspect, the invention provides a composition comprising (a) a virus-like particle and (b) at least one antigen or antigenic determinant, wherein said antigen or said antigenic determinant is an IL-5, IL-13 or eotaxin protein or peptide, and to a pharmaceutical composition comprising (a) the composition of claim 1 or claim 22; and (b) an acceptable pharmaceutical carrier.

In yet another aspect, the invention provides a vaccine composition comprising a composition comprising (a) a central particle with at least one first binding site and (b) at least one antigen or antigenic determinant with at least one second binding site where the specified antigen or antigenic determinant is a protein or peptide of IL-5, IL-13 or eotaxin and where the specified second binding site is selected from the group consisting of (i) a binding site of non-natural origin with the specified antigen or ant a gene determinant and (ii) a naturally occurring binding site with said antigen or antigenic determinant, wherein said second binding site is capable of association with said first binding site and where said antigen or antigenic determinant and said central particle interact through said association to form an ordered and repeated antigenic matrix.

In a further aspect, this invention relates to a vaccine composition comprising a composition wherein said composition comprises (a) a virus-like particle and (b) at least one antigen or antigenic determinant, wherein said antigen or said antigenic determinant is an IL-5 protein or peptide, IL-13 or eotaxin and wherein said at least one antigen or antigenic determinant is associated with said virus-like particle.

In yet another aspect, the invention relates to a method for producing a composition according to claim 1, comprising (a) obtaining a virus-like particle and (b) obtaining at least one antigen or protein or peptide of IL-5, IL-13, or eotaxin; (c) combining said virus-like particle and said at least one antigen or antigenic determinant so that said at least one antigen or antigenic determinant is associated with said virus-like particle.

In yet another aspect, the invention relates to a method for producing a composition according to claim 22, comprising (a) obtaining a central particle with at least one first binding site; (b) obtaining at least one antigen or antigenic determinant with at least one second binding site, where the specified antigen or antigenic determinant is a protein or peptide of IL-5, IL-13 or eotaxin and where the specified second binding site is selected from the group consisting of (i) a binding site of non-natural origin with the specified antigen or antigenic determinant and (ii) a binding site of natural origin with the specified antigen or antigenic determinant, and where the specified second binding site is capable of association with the specified first binding site; and (c) combining said central particle and said at least one antigen or antigenic determinant, wherein said antigen or antigenic determinant and said central particle interact through said association to form an ordered and repeating antigenic matrix.

In another aspect, this invention relates to a method of immunization, comprising administering a composition according to claim 1 or claim 22 or according to claim 74 to an animal or human.

In a further aspect, the invention relates to the use of a composition according to claim 1 or claim 22 or claim 74 for the manufacture of a medicament for the treatment of allergic diseases with an eosinophilic component.

In another aspect, the invention relates to the use of a composition according to claim 1 or claim 22 or claim 74 for the manufacture of a medicament for the therapeutic or prophylactic treatment of allergic diseases with an eosinophilic component, preferably asthma. In addition, in yet another aspect, the invention relates to the use of a composition according to claim 1 or claim 22 or claim 74, either alone or in combination with other agents, for the manufacture of a composition, vaccine, drug or medicament for therapy or prevention allergic diseases with an eosinophilic component, in particular asthma.

Thus, the invention, in particular, relates to vaccine compositions that are suitable for the prophylaxis and / or attenuation of allergic diseases with an eosinophilic component or related conditions. The invention also relates to methods of immunization and vaccination, respectively, for the prevention and / or attenuation of allergic diseases with an eosinophilic component and related conditions in animals, in particular in cows, sheep and cattle, as well as in humans. The compositions of the invention can be used prophylactically or therapeutically.

In specific embodiments, the invention relates to methods for preventing and / or attenuating allergic diseases with an eosinophilic component or related conditions that are caused or exacerbated by products of “native” genes, i.e. as used herein, “autoantigens”. In related embodiments, the invention relates to methods for inducing immunological responses in animals and humans, respectively, which lead to the production of antibodies that prevent and / or attenuate allergic diseases with an eosinophilic component or related conditions that are caused or exacerbated by products of “native” genes.

As will be understood by one of skill in the art, when the compositions of the invention are administered to an animal or human, they can be in a composition that contains salts, buffers, adjuvants, or other substances that are required to increase the effectiveness of the composition. Examples of substances suitable for use in the manufacture of pharmaceutical compositions are provided in many sources, including Remington's Pharmaceutical Sciences (Osol, A, ed., Mack Publishing Co. (1990)).

The compositions of the invention are said to be “pharmacologically acceptable” if administration to a human recipient can be permissible. In addition, the compositions of the invention will be administered in a “therapeutically effective amount” (ie, in an amount that produces the desired physiological effect).

The compositions of the invention can be administered by various methods known in the art, but will usually be administered by injection, infusion, inhalation, oral administration, or other suitable physical methods. Alternatively, the compositions may be administered intramuscularly, intravenously or subcutaneously. The components of the compositions for administration include sterile aqueous (e.g., physiological saline) or non-aqueous solutions and suspensions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption.

Other variations of this invention will be apparent to those skilled in the art in light of what is known in the art, in light of the following drawings, description of the invention, and claims.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. Expression of His-C-IL5 mouse. Extracts from the insoluble cell fraction obtained after culturing pMODC6-IL5 / BL21-DE3 either in the presence or absence of IPTG were obtained as described above. Equivalent amounts of extracts were applied to a 16% SDS-polyacrylamide gel, electrophoresed and Coomassie blue. Lane M, mass marker (NEB, pre-stained broad-range marker), lane 1, non-induced culture extract; lane 2, extract from IPTG-induced culture for 4 hours.

Figure 2. SDS-PAGE analysis of His-C-IL-5 purification using Ni-NTA. Samples from various purification steps were applied to 16% SDS-PAGE and dispersed under reducing conditions. Squirrels painted Coomassie blue. M, marker; 1: dissolved inclusion bodies; 2: passing stream (unbound material); 3: flushing 1, pH 6.5; 4: flushing 2, pH 6.5; 5: washing 3, pH 5.9; 6-8: eluate, pH 4.5; 9: pure recombinant mouse IL-5.

Figure 3. SDS-PAGE showing purification of recombinant murine His-C-IL5. Aliquots of 5 μg of purified murine His-C-IL5 were separated in 16% SDS-polyacrylamide gel either in the presence (lane 2 on the left) or in the absence (3rd lane on the left) of dithiothreitol. The gel was stained with Coomassie squirrels blue R-250. Lane M contains a mass marker (NEB, a pre-stained broad-range marker).

Figure 4. The effect of His-C-IL-5 on BCL1 cell proliferation. BCL1 cells were incubated with ³ H-thymidine in the presence of the following additives: murine IL-5 (30 ng / ml), His-C-IL5, (30 ng / ml); Qβ (200 ng / ml); Qβ chemically cross-linked to an unrelated cytokine (200 ng / ml) or Qβ-His-C-IL5 (105 ng / ml). Undiluted starting concentrations are indicated in parentheses, and five-fold serial dilutions were prepared from the indicated starting concentrations. The incorporation of ³ H-thymidine was determined by scintillation counting.

Figure 5. Analysis of the binding reaction using SDS-PAGE stained with Coomassie blue. Lane M: pre-stained molecular weight marker; lane 1 purified by His-C-IL-5; lane 2, Qβ after derivatization with the SMPH chemical cross-linking agent. Lane 3, a reaction mixture for binding; lane 4, the reaction mixture for binding after dialysis. The identification of various molecular samples in the binding reaction mixture is shown in the figure to the right.

6. Western blot analysis of the binding reaction. Lane M: molecular weight marker; lane 1 purified by His-C-IL-5; lane 2, Qβ after derivatization with the SMPH chemical cross-linking agent. Lane 3, the reaction mixture for binding. The first antibody to detect His-C-IL5 was a rat anti-His antibody, which was then incubated with an anti-rat HRP conjugated antibody. Qβ was detected by staining using rabbit polyclonal anti-Qβ antiserum, then HRP conjugated anti-rabbit antibody. Identical blots were stained as indicated.

7. Four-time ELISA. A. Schematic representation of an ELISA with a trap. The various components of the assay are 1, a goat anti-rabbit IgG antibody; 2, rabbit anti-Qβ polyclonal antiserum; 3, either Qβ-His-C-IL5, Qβ, or PBS; 4, monoclonal Ab against IL5, TRFK 4 or 5; 5, anti-mouse IgG antibody-HRP. B. Fourth ELISA Results. The ability of neutralizing monoclonal antibodies to interact with His-C-IL5 covalently linked to an ordered antigenic matrix was determined in an ELISA.

Fig. 8. Serum ELISA against IL-5. ELISA plates were coated with His-C-IL5 and incubated with either serum collected prior to immunization or serum collected on day 21 from mice vaccinated with Qβ-His-C-IL5 (4 mice) or Qβ mixed with His-C -IL-5 (5 mice). The initial serum dilution was 1:50, and five-fold dilutions were performed. Binding of IL-5 specific antibodies was recorded using anti-mouse IgG antibodies conjugated to HRP and a chromogenic substrate.

Fig.9. Induction of expression of recombinant GST-EK-IL13-C1-His in BL21. Coloring 16% SDS-PAG Coomassie blue. The load corresponds to 0.1 OD _{600 of the} indicated bacterial lysates. Expression of IL-13 fusion protein was induced by 0.75 mM IPTG and samples were analyzed after 4 hours in SDS-PAGE. Note: there is significant expression of IL-13 fusion protein in bacteria that have been transformed with the corresponding plasmid (pMod-GST-EK-IL13-C1-His) and induced by IPTG (see arrow).

Figure 10. Purification of GST-EK-IL13-Cl-His during denaturation. Coloring two 16% SDS-PAG Coomassie blue. The load corresponds to 5 μl of the indicated fraction. IL-13 fusion protein was obtained from inclusion bodies, dissolved in guanidine-HCl-based denaturing buffer and loaded onto a Ni ²⁺ agarose column equilibrated with the same buffer. Bound proteins were eluted in two stages at different pH. The figure shows the analysis of precipitated TCA aliquots of these fractions (No. 5-No. 30), eluted with a second buffer at pH 4.5. Note: Due to the C-terminal His-tag, the IL-13 fusion protein efficiently binds to the Ni ²⁺ agarose column and elutes with decreasing pH.

11. Analysis of soluble IL-13 fusion protein after refolding. The GST-EK-IL13-C1-His-fusion protein was refolded as described in section 18D. After completion of the refolding reaction, an aliquot of the protein solution was analyzed in SDS-PAGE followed by Coomassie staining (A) or using Western blot (B). These first antibodies were purchased from R&D Systems (α-IL13, AF-413-NA), Qiagen (α-PentaHis, 34660) and Amersham Biosciences (α-GST, 24-4577), respectively. Antibodies were used in concentrations according to manufacturers instructions.

Fig. 12. Expression of mouse eotaxin-C1. The supernatants from BL21 / DE3 cell lysates transformed with pmEo-C1 9 hours after induction with 1 mM IPTG were run on 16% PAG, transferred by blotting onto a nitrocellulose membrane and reacted with goat antibody against mouse eotaxin (R&D system) . Lane 1: pre-stained protein marker (New England Biolabs). Lane 2: supernatant of cell lysates of BL21 / DE3 cells transformed with pmEo-C1, 9 hours after induction of 1 mM IPTG. Lane 3: pre-stained protein marker (New England Biolabs). Lane 4: Western blot of the same lysates as in lane 2 examined using anti-mouse eotaxin antibodies.

DETAILED DESCRIPTION OF THE INVENTION

Unless otherwise specified, all technical and scientific terms used in this description have the same meanings that are usually understood by a person skilled in the art to which this invention relates. Although any methods and substances similar or equivalent to the methods and substances described herein can be used in practice or in testing this invention, preferred methods and substances are described below.

1. Definitions.

Allergic diseases with an eosinophilic component. The term allergic diseases with an eosinophilic component as used in this description refers to pathological conditions or status in which there is an increase in the number of eosinophils in the circulating blood or tissues and body fluids. Diseases in which the number of eosinophils is increased and in which eosinophils have a direct or indirect effect on the condition of the disease include asthma, hay fever, nasal rhinitis, nasal polyps, idiopathic eosinophil syndromes, atopic dermatitis, skin diseases and skin rashes, lung diseases, such as Leffler's syndrome, chronic eosinophilic pneumonia, Charge-Strauss syndrome and hypereosinophilic syndromes of unknown nature. Specialists in this field can identify allergic diseases with an eosinophilic component.

Amino acid linker: an “amino acid linker”, also referred to herein as a “linker,” as used, either binds an antigen or antigenic determinant to a second binding site, or more preferably already contains or includes a second binding site, usually - but not necessarily - in as an amino acid residue, preferably as a cysteine residue. However, the term "amino acid linker" in the sense used in this description is not intended to mean that such an amino acid linker consists solely of amino acid residues, although an amino acid linker consisting of amino acid residues is the preferred embodiment in this invention. The amino acid residue of the amino acid linker is preferably composed of naturally occurring amino acids or unnatural amino acids known in the art, all L or all D, or mixtures thereof. However, an amino acid linker containing a molecule with a sulfhydryl group or a cysteine residue is also included in this invention. Such a molecule preferably contains a residue of C1-C6 alkyl, cycloalkyl (C5, C6), aryl or heteroaryl. However, in addition to the amino acid linker, it is also within the scope of this invention to include a linker, preferably containing a residue of C1-C6 alkyl, cycloalkyl (C5, C6), aryl or heteroaryl and having no amino acid (lot). The bond between the antigen or antigenic determinant or optionally the second binding site and the amino acid linker is preferably carried out using at least one covalent bond, more preferably using at least one peptide bond.

Animal. As used herein, the term "animal" is intended to include, for example, human, sheep, moose, deer, mule deer, mink, mammals, monkeys, horses, cattle, pigs, goats, dogs, cats , rats, mice, birds, chickens, reptiles, fish, insects and arachnids.

Antibody. As used herein, the term “antibody” refers to molecules that are capable of binding an epitope or antigenic determinant. The term is intended to include whole antibodies and antigen binding fragments thereof, including single chain antibodies. Most preferably, the antibodies are antigen binding fragments of human antibodies and include, but are not limited to, Fab, Fab 'and F (ab') 2, Fd, single chain Fv (scFv), single chain antibodies linked by Fv disulfide bonds (sdFv), and fragments containing either V _L - or V _H domain. The source of antibodies can be any animal, including birds and mammals. Preferably, the antibodies are from a human, mouse, rabbit, goat, guinea pig, camel, horse or chicken. As used herein, “human” antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic to one or more human immunoglobulins and which do not express endogenous immunoglobulins, such as described, for example, in US Pat. 5,939,598 to Kucherlapati et al.

Antigen. As used herein, “antigen” refers to a molecule capable of being bound by an antibody or T-cell receptor (TCR) if it is presented by MHC molecules. The term “antigen” as used herein also encompasses T-cell epitopes. In addition, the antigen can be recognized by the immune system and / or is capable of inducing a humoral immune response and / or a cellular immune response leading to activation of B and / or T lymphocytes. However, this may require, at least in some cases, that the antigen contain or be associated with a Th-cell epitope and administered in an adjuvant. An antigen may have one or more epitopes (B and T epitopes). It is understood that the above specific reaction indicates that the antigen will preferably react, usually in a highly selective manner, with its corresponding antibody or TCR and will not react with many other antibodies or TCR that may be caused by other antigens. As used herein, antigens can also be mixtures of several individual antigens.

Antigenic determinant. As used herein, the term "antigenic determinant" is intended to mean that part of the antigen that is specifically recognized by either B- or T-lymphocytes. B-lymphocytes that respond to antigenic determinants produce antibodies, while T-lymphocytes respond to antigenic determinants by proliferation and the establishment of effector functions necessary to mediate cellular and / or humoral immunity.

Association. As used herein, the term “association” as applied to the first and second binding sites refers to the binding of the first and second binding sites, which is preferably carried out through at least one non-peptide bond. The nature of the association may be covalent, ionic, hydrophobic, polar, or any combination thereof, preferably the nature of the association is covalent.

Linking site, first. As used herein, the phrase “first binding site” refers to an element of non-natural or natural origin with which a second binding site located on an antigen or antigenic determinant can associate. The first binding site may be a protein, polypeptide, amino acid, peptide, sugar, polynucleotide, natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxygenin, metal ions, phenylmethylsulfonyl fluoride) or a combination thereof or a chemically reactive group thereof. The first binding site is usually and preferably located on the surface of the central particle, such as preferably a virus-like particle. Numerous first binding sites are usually present on the surface of a central particle and, accordingly, a virus-like particle in a repeating configuration.

The binding site, the second. As used herein, the phrase “second binding site” refers to an element in association with an antigen or antigenic determinant with which a first binding site located on the surface of a central particle and, accordingly, a virus-like particle can associate. The second antigen or antigenic determinant binding site may be a protein, polypeptide, peptide, sugar, polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxygenin, metal ions, phenylmethylsulfonyl fluoride) or a combination thereof, or a combination thereof or their combination . At least one second binding site is present on the antigen or antigenic determinant. The term “antigen or antigenic determinant with at least one second binding site” thus refers to an antigen or antigenic construct comprising at least an antigen or antigenic determinant and a second binding site. However, in particular, in the case of the second binding site, which has a non-natural origin, i.e. did not naturally occur in an antigen or antigenic determinant, said antigen or antigenic constructs contain an “amino acid linker”.

Communication As used herein, the term “bond” refers to binding or attachment, which may be covalent, for example, by chemical bonding, or non-covalent, for example, ionic interactions, hydrophobic interactions, hydrogen bonds, etc. Covalent bonds, for example, can be ester, ether, phosphoether, amide, peptide, imide bonds, carbon-sulfur bonds, carbon-phosphorus bonds and the like. The term “connected” is broader and includes terms such as “connected”, “merged” and “attached”.

Coating protein (s). As used herein, the term “coating protein (s)” refers to a bacteriophage or RNA phage protein (s) that can be included in a bacteriophage or RNA phage capsid assembly. However, with respect to the specific gene product of the gene of the RNA phage coat protein, the term “CP” is used. For example, a specific gene product of the coat protein of the Qβ RNA phage gene is called “CP Qβ”, while the “cover proteins” of the bacteriophage Qβ contain “CP Qβ” as well as protein A1. The bacteriophage Qβ capsid mainly consists of CP Qβ with a small amount of A1 protein. Similarly, the coating protein VLP Qβ mainly contains CP Qβ with a small amount of protein A1.

Central particle. As used in this description, the term "central particle" refers to a rigid structure with its inherent repetitive organization. The central particle in the sense used in this description may be a product of a synthesis process or a product of a biological process.

Connected. The term “bound,” as used herein, refers to binding via covalent bonds or strong non-covalent interactions, usually and preferably to binding via covalent bonds. In this invention, you can use any method commonly used by specialists in this field for the binding of biologically active substances.

Effective amount. As used in this description, the term "effective amount" refers to the amount necessary or sufficient to carry out the desired biological effect. An effective amount of a composition may be an amount that is sufficient to achieve a given selected result, and determining such an amount may be common practice for one skilled in the art. For example, an effective amount for treating a deficiency of the immune system may be the amount necessary to cause activation of the immune system, leading to the development of an antigen-specific immune response when exposed to the antigen. The term is also synonymous with "enough."

The effective amount for any particular application may vary, depending on factors such as the disease or condition being treated, the particular composition administered, the weight of the subject and / or the severity of the disease or condition. One of skill in the art can empirically determine the effective amount of a particular composition according to this invention without the need for excessive experimentation.

Eotaxin protein. The term “eotaxin protein” as used herein refers to a protein encoded by the eotaxin gene. Different variants of the eotaxin protein may be due to point nucleotide mutations and polymorphisms, respectively, as well as insertions, deletions and / or substitutions of one or more nucleotides, and they should be specifically included in the scope of this invention. In addition, variability can be caused by post-translational modifications, namely, differentially glycosylated forms of eotaxin, as well as proteolytically cleaved forms of eotaxin. The term “eotaxin protein”, as used herein, should also include variants of the eotaxin protein, including, but not limited to the above preferred examples.

Eotaxin peptide. As used herein, the term “eotaxin peptide” is broadly defined as any peptide that is part of an eotaxin protein and contains at least two, preferably at least three, more preferably at least four, more preferably at least five, more preferably at least six consecutive amino acids of the original eotaxin protein, which is part of the eotaxin protein, most preferably is a packaged part eotaxin containing a B-cell epitope, and still more preferably - part of eotaxin containing neutralizable epitope.

The term "eotaxin peptide", in addition, preferably should cover any part of the specified eotaxin peptide, where the specified part can preferably be obtained by deletion of one or more amino acids at the N - and / or C-end of the eotaxin protein. The eotaxin peptide can be obtained by recombinant expression in eukaryotic or prokaryotic expression systems as a single eotaxin peptide or as a fusion with other amino acids or proteins, for example, to facilitate the folding, expression or solubility of the eotaxin peptide or to facilitate the purification of the eotaxin peptide. To enable the binding of eotaxin peptides and VLP subunit proteins or capsids, at least one second binding site can preferably be added to the eotaxin peptide. Alternatively, eotaxin peptides can be synthesized using methods known in the art. The term eotaxin peptide, as used herein, should also preferably include a peptide that mimics the three-dimensional surface structure of eotaxin. Such an eotaxin peptide is not necessarily derived from the continuous amino acid sequence of eotaxin, but can be formed by non-contiguous amino acid residues from eotaxin. Such peptides may even contain amino acids that are not present in the corresponding eotaxin protein.

Epitope. As used herein, an “epitope” refers to continuous or discontinuous portions of a polypeptide having antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably a human. An epitope is recognized by an antibody or T cell through its T cell receptor in the context of an MHC molecule. An “immunogenic epitope” as used herein is defined as the part of a polypeptide that elicits a humoral response or induces a T-cell response in an animal that is determined by any method known in the art (see, for example, Geysen et al., Proc. Natl. Acad. Sci. USA 81: 3998-4002 (1983)). The term “antigenic epitope” as used herein is defined as part of a protein by which an antibody can immunospecifically bind its antigen, as defined by any method well known in the art. Immunospecific binding excludes non-specific binding, but does not necessarily exclude cross-reactivity with other antigens. Antigenic epitopes do not have to be immunogenic. Antigenic epitopes can also be T-cell epitopes, in which case they can immunospecifically bind to the T-cell receptor in the context of the MHC molecule.

An epitope can contain 3 amino acids in a spatial conformation that is unique to the epitope. Typically, an epitope consists of at least about 5 such amino acids, and more often consists of at least about 8-10 such amino acids. If the epitope is an organic molecule, it may be small, such as nitrophenyl.

Merge. As used herein, the term “fusion” refers to a combination of amino acid sequences of different origin in one polypeptide chain by combining in the reading frame the nucleotide sequences encoding them. The term “merger” specifically includes internal mergers, i.e. the insertion of sequences of different origin in the polypeptide chain, except for merging with one of its ends.

The immune response. As used herein, the term “immune response” refers to a humoral immune response and / or cellular immune response leading to the activation or proliferation of B and / or T lymphocytes and / or antigen-presenting cells. However, in some cases, immune responses may be of low intensity, and they become detectable only when using at least one substance according to the invention. "Immunogenic" refers to an agent used to stimulate the immune system of a living organism in order to enhance and direct one or more functions of the immune system to an immunogenic agent. An “immunogenic polypeptide” is a polypeptide that elicits a cellular and / or humoral immune response, either alone or in a carrier bound form in the presence or absence of an adjuvant. Preferably, an antigen presenting cell can be activated.

A substance that "enhances" the immune response refers to a substance when an immune response is observed that becomes larger or amplifies or in some way deviates when a substance is added, compared with the same immune response measured without adding a substance. For example, the lytic activity of cytotoxic T cells can be measured, for example, using ⁵¹ Cr release analysis in samples obtained with and without a substance during immunization. It is said that the amount of a substance in which the lytic activity of CTL is enhanced compared to the lytic activity of CTL without a substance is an amount sufficient to enhance the animal's immune response to the antigen. In a preferred embodiment, the immune response is enhanced at least about 2 times, more preferably about 3 times or more. The amount or type of secreted cytokines may also be altered. Alternatively, the amount of inducible antibodies or their subclasses can be changed.

Immunization. As used herein, the terms “immunize” or “immunization” or related terms refer to imparting the ability to produce a sufficiently strong immune response (including humoral and / or cellular immunity, such as effector CTLs) against the target antigen or epitope. These terms do not require that complete immunity be formed, but rather, that an immune response is obtained that is significantly higher than the baseline. For example, a mammal can be considered immunized against a target antigen if, after application of the methods of the invention, a cellular and / or humoral immune response to the target antigen occurs.

Natural origin. As used in this description, the term "natural origin" means that the whole or part of the whole is not synthesized, but that it exists or is produced in nature.

Unnatural. In the sense used in this description, the term, in General, means obtained not from nature, more specifically, the term means obtained artificially by man.

Unnatural origin. As used in this description, the term "non-natural origin" generally means "synthesized or obtained not from nature"; more specifically, the term means "artificially obtained by man."

An ordered and repeating matrix of antigens or antigenic determinants. As used herein, the term “ordered and repeating matrix of antigens or antigenic determinants” generally refers to a repeating sample of antigens or antigenic determinants, usually and preferably characterized by a uniform spatial arrangement of antigens or antigenic determinants with respect to the central particle and, accordingly, virus-like particle . In one embodiment of the invention, the repeating pattern may have a geometric pattern. Typical and preferred examples of suitable ordered and repeating matrices of antigens or antigenic determinants are matrices that have strictly repeating paracrystalline orders of antigens or antigenic determinants, preferably with distances from 1 to 30 nanometers, preferably from 5 to 15 nanometers.

Fimbria. As used herein, the term “fimbriae” (the singular “fimbria”) refers to the extracellular structures of bacterial cells consisting of protein monomers (eg, pilin monomers) that are organized into ordered and repeating structures. In addition, fimbriae are structures that are involved in processes such as the binding of bacterial cells to the surface receptors of the host cell, intercellular genetic exchanges, and cell recognition by each other. Examples of fimbriae include type 1 fimbriae, P-fimbriae, F1C fimbriae, S-fimbriae, and 987P fimbriae. Additional examples of fimbriae are listed below.

Fimbria-like structures. As used herein, the phrase “structure similar to fimbriae” refers to structures having characteristics similar to those of fimbria and consisting of protein monomers. One example of a “fimbria-like structure” is a structure formed by a bacterial cell that expresses modified pilin proteins that do not form ordered and repeating matrices that are identical to those of natural fimbria.

Polypeptide. As used herein, the term “polypeptide” refers to a molecule consisting of monomers (amino acids) linearly linked by amide bonds (also called peptide bonds). The term refers to the molecular chain of amino acids and does not refer to the specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides and proteins are included in the definition of a polypeptide. It is understood that the term also refers to modifications of the polypeptide after expression, for example, glycosylations, acetylations, phosphorylations and the like. A recombinant or derivative polypeptide does not necessarily translate from a specific nucleic acid sequence. It can also be created in any way, including chemical synthesis.

Protein IL-5. The term “IL-5 protein,” as used herein, refers to a protein encoded by the IL-5 gene. Different variants of the IL-5 protein may be due to point mutations of the nucleotides and polymorphism, respectively, as well as insertions, deletions and / or substitutions of one or more nucleotides, and should be directly included in the scope of this invention. Additional variability may be due to post-translational modifications, namely, differentially glycosylated forms of IL-5, as well as proteolytically cleaved forms of IL-5. The term “IL-5 protein,” as used herein, should also encompass IL-5 protein variants, including, but not limited to, the above preferred examples.

Peptide IL-5. As used herein, the term “IL-5 peptide” is broadly defined as any peptide that is part of an IL-5 protein and contains at least two, preferably at least three, more preferably at least four, more preferably at least five, more preferably at least six consecutive amino acids of the original IL-5 protein, which is part of the IL-5 protein, most preferably is a packaged part of IL-5, containing B-cell epi top, and even more preferably a portion of IL-5 containing a neutralizable epitope.

The term "IL-5 peptide", in addition, preferably should cover any part of the specified peptide of IL-5, where the specified part can preferably be obtained by deletion of one or more amino acids at the N - and / or C-end of the protein IL-5. The IL-5 peptide can be obtained by recombinant expression in eukaryotic or prokaryotic expression systems as a single IL-5 peptide or as a fusion with other amino acids or proteins, for example, to facilitate folding, expression or solubility of the IL-5 peptide or to facilitate peptide purification IL-5. To enable the binding of IL-5 peptides and VLP subunit proteins or capsids, at least one second binding site may preferably be added to the IL-5 peptide. Alternatively, IL-5 peptides can be synthesized using methods known in the art. The term IL-5 peptide, as used herein, should also preferably include a peptide that mimics the three-dimensional surface structure of IL-5. Such an IL-5 peptide is not necessarily derived from the continuous amino acid sequence of IL-5, but may be formed by non-contiguous amino acid residues from IL-5. Such peptides may even contain amino acids that are not present in the corresponding IL-5 protein.

Protein IL-13. The term "IL-13 protein," as used herein, refers to a protein encoded by the IL-13 gene. Different variants of the IL-13 protein may be due to point mutations of the nucleotides and polymorphism, respectively, as well as insertions, deletions and / or substitutions of one or more nucleotides, and should be directly included in the scope of this invention. Additional variability may be due to post-translational modifications, namely, differentially glycosylated forms of IL-13, as well as proteolytically cleaved forms of IL-13. The term “IL-13 protein,” as used herein, should also encompass IL-13 protein variants, including, but not limited to, the above preferred examples.

IL-13 Peptide As used herein, the term “IL-13 peptide” is broadly defined as any peptide that is part of an IL-13 protein and contains at least two, preferably at least three, more preferably at least at least four, more preferably at least five, more preferably at least six consecutive amino acids of the original IL-13 protein, which is part of the IL-13 protein, most preferably is a packaged part of IL-13, containing B- letochny epitope, and still more preferably - part of IL-13 containing neutralizable epitope.

The term "IL-13 peptide", in addition, preferably should cover any part of the specified peptide of IL-13, where the specified part can preferably be obtained by deletion of one or more amino acids at the N - and / or C-end of the protein IL-13. The IL-13 peptide can be obtained by recombinant expression in eukaryotic or prokaryotic expression systems as a single IL-13 peptide or as a fusion with other amino acids or proteins, for example, to facilitate folding, expression or solubility of the IL-13 peptide or to facilitate peptide purification IL-13. In order to enable the binding of IL-13 peptides and VLP subunit proteins or capsids, at least one second binding site may preferably be added to the IL-13 peptide. Alternatively, IL-5 peptides can be synthesized using methods known in the art. The term IL-13 peptide, as used herein, should also preferably include a peptide that mimics the three-dimensional surface structure of IL-13. Such an IL-13 peptide is not necessarily derived from the continuous amino acid sequence of IL-13, but may be formed by non-contiguous amino acid residues from IL-13. Such peptides may even contain amino acids that are not present in the corresponding IL-13 protein.

The remainder. As used herein, the term “residue” is intended to mean a specific amino acid in a polypeptide backbone or side chain.

Autoantigen (own antigen). As used herein, the term “autoantigen” refers to proteins encoded by the host DNA, and products formed by proteins or RNA encoded by the host DNA are defined as intrinsic. In addition, proteins that are the result of a combination of two or more of their own molecules or which are part of their own molecules, and proteins that are highly homologous with two of their own molecules, as defined above (> 95%, preferably> 97%, more preferably> 99%) can also be considered own.

Treatment. As used herein, the terms “treating”, “treating”, “undergoing treatment” or “treatment process” refer to prophylaxis and / or therapy. For example, when used with respect to an infectious disease, the term refers to prophylactic treatment that increases the subject's resistance to a pathogen infection or, in other words, reduces the likelihood that the subject will become infected with a pathogen or exhibit symptoms of the disease that can be attributed to infection, and also to treatment after the subject has become infected in order to fight the infection, for example, to reduce or destroy the infection or to prevent the subject from getting worse. When used with respect to allergic diseases with an eosinophilic component, the term “treatment” refers to prophylactic or therapeutic treatment which, among other things, and preferably inhibits or reduces allergic inflammatory components associated with allergic eosinophilic diseases.

Vaccine. As used herein, the term “vaccine” refers to a preparation that contains a composition of the invention and which is in a form that can be administered to an animal. Typically, the vaccine contains the medium in the form of a normal saline solution or a buffered aqueous solution in which the composition according to this invention is suspended or dissolved. In this form, the composition according to this invention can easily be used in order to prevent, improve or otherwise affect the condition. When introduced into the host, the vaccine is capable of eliciting an immune response, including, but not limited to, production of antibodies and / or cytokines and / or activation of cytotoxic T cells, antigen-presenting cells, helper T cells, dendritic cells and / or other cellular responses.

Optionally, the vaccine according to this invention further comprises an adjuvant, which may be present in either a small or a large proportion relative to the compound of this invention. The term “adjuvant” as used in this description refers to non-specific stimulants of the immune response or substances that make it possible to create a depot in the host, which when combined with the vaccine according to this invention provide an even more enhanced immune response. You can use many adjuvants. Examples include Freund's complete and incomplete adjuvant, aluminum hydroxide, and a modified muramyl dipeptide.

Virus-like particle (VLP). As used herein, the term “virus-like particle” refers to a structure similar to a virus particle. In addition, the virus-like particle according to the invention is non-replicative and non-infectious, as it does not contain all or part of the viral genome, in particular the replicative and infectious components of the viral genome. The virus-like particle according to the invention may contain a nucleic acid different from its genome. A typical and preferred embodiment of a virus-like particle according to this invention is a virus capsid, such as a viral capsid of the corresponding virus, bacteriophage or RNA phage. The terms “viral capsid” or “capsid”, which are used interchangeably herein, refer to a macromolecular construct consisting of protein subunits of the virus. Usually and preferably, the protein subunits of the virus are assembled into a viral capsid and, accordingly, “capsid” having a structure with its inherent repetitive organization, where this structure is usually spherical or tubular. For example, capsid RNA phages or HBcAg have a spherical shape with icosahedral symmetry. The term “capsid-like structure” as used in this description refers to a macromolecule-assembled construct consisting of protein subunits of the virus, having a similar capsid morphology in the sense defined above, but deviating from a typical symmetrical assembly while maintaining a sufficient degree of order and repeatability.

Virus-like particle of a bacteriophage. As used herein, the term “virus-like particle of a bacteriophage” refers to a virus-like particle similar in structure to a bacteriophage, but non-replicative and non-infectious, and not containing at least a gene or genes encoding a bacteriophage replication apparatus, and usually also not containing a gene or genes encoding the protein or proteins responsible for the attachment of the virus or the penetration of the virus into the host. However, this definition should also encompass virus-like particles of bacteriophages in which the above gene or genes are still present but inactive and therefore also result in non-replicating and non-infectious virus-like particles of bacteriophages.

VLP coating protein of RNA phage. The capsid structure resulting from the self-assembly of 180 subunits of the RNA phage coat protein and optionally containing the host RNA is called the “VLP of the RNA phage coat protein”. A specific example is the VLP of the Qβ coat protein. In this particular case, the VLP of the Qβ coat protein can be assembled either exclusively from CP Qβ subunits (formed by expression of the CP Qβ gene containing, for example, the TAA stop codon that inhibits any expression of the longer A1 protein by suppression, see Kozlovska, TM et al., Intervirology 39: 9-15 (1996)), or further comprises subunits of protein A1 in the assembled capsid construct.

Viral particle. The term "viral particle" as used in this description refers to the morphological form of the virus. In some types of viruses, it contains a genome surrounded by a protein capsid; others have additional structures (e.g. shells, tails, etc.).

One or the singular form. When used in this description, the terms "one" or the singular, mean "at least" one or "one or more", unless otherwise indicated.

As will be appreciated by those skilled in the art, some embodiments of the invention relate to the use of recombinant nucleic acid-based techniques such as cloning, polymerase chain reaction, DNA and RNA purification, expression of recombinant proteins in prokaryotic and eukaryotic cells, etc. Such techniques are well known to those skilled in the art and can easily be found in published laboratory methods manuals (e.g., Sambrook, J. et al., Eds., Molecular Cloning, A Laboratory Manual, 2nd. Edition, Cold Spring Harbor Laboratory Press , Cold Spring Harbor, NY (1989); Ausubel, F. et al., Eds., Current Protocols in Molecular Biology, John H. Wiley and Sons, Inc. (1997)). Fundamental laboratory techniques for working with tissue culture cell lines (Celis, J., ed., Cell Biology, Academic Press, 2nd edition, (1998)) and antibody-based techniques (Harlow, E. and Lane, D., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1988); Deutscher, MP, Guide to Protein Purification, Meth. Enzymol. 128, Academic Press San Diego (1990); Scopes, RK, Protein Purification Principles and Practice, 3rd ed., Springer-Verlag, New York (1994)) are also adequately described in the literature, all of these publications are incorporated herein by reference.

2. Compositions and methods of enhancing the immune response

The claimed invention relates to compositions and methods for enhancing the immune response against an IL-5, IL-13 or eotaxin protein or peptide in an animal. The compositions of the invention comprise or - alternatively - consist of (a) a central particle with at least one first binding site and (b) at least one antigen or antigenic determinant with at least one second binding site, wherein said antigen or antigenic determinant is a protein or peptide of IL-5, IL-13 or eotaxin and where the specified second binding site is selected from the group consisting of (i) a binding site of non-natural origin with the specified antigen or antigenic determinant, and (ii) the site ulcers of natural origin with the indicated antigen or antigenic determinant, where the specified second binding site is able to associate with the specified first binding site and where the specified antigen or antigenic determinant and the specified central particle interact due to this association, forming an ordered and repeating antigenic matrix. More specifically, the compositions of the invention comprise or — alternatively — consist of a virus-like particle and at least one antigen or antigenic determinant, where the antigen or antigenic determinant is a protein or peptide of IL-5, IL-13 or eotaxin and where at least one antigen or the antigenic determinant is associated with a virus-like particle, so that an ordered and repeating antigen-VLP matrix is formed. In addition, the invention enables the practitioner to easily construct such a composition, among other things, for the treatment and / or prophylactic prevention of allergic diseases with an eosinophilic component.

In one embodiment, the central particle comprises a virus, fimbriae bacteria, a structure formed from bacterial pilin, a bacteriophage, a virus-like particle, a virus capsid particle, or a recombinant form thereof. Any virus known in the art having an ordered and repeating structure of a coating and / or core protein may be selected as the central particle of the invention; examples of suitable viruses include Sindbis virus and other alphaviruses, rhabdoviruses (e.g. vesicular stomatitis virus), picornaviruses (e.g. human rhinovirus, Aisha virus), togaviruses (e.g. rubella virus), orthomyxoviruses (e.g. Togoto virus, Batken virus, plague virus), polyoma viruses (e.g., BK poliomavirus, JC polyomavirus, BFDV bird polyoma virus), parvoviruses, rotaviruses, Norwalk virus, foot and mouth disease virus, retrovirus, hepatitis B virus, tobacco mosaic virus, sheep’s nightmare virus and human papillomavirus, and prefer specifically RNA phage, bacteriophage Qβ, bacteriophage R17, bacteriophage M11, bacteriophage MX1, bacteriophage NL95, bacteriophage fr, bacteriophage GA, bacteriophage SP, bacteriophage MS2, bacteriophage f2, bacteriophage PP7 (for example, see Table 1 in Bachmann, MF and Zinkernagel , RM, Immunol. Today 17: 553-558 (1996)).

In a further embodiment, the invention uses genetic engineering of the virus to create a fusion between the ordered and repeating viral coat protein and the first binding site containing a heterologous protein, peptide, antigenic determinant, or preferably a reactive amino acid residue. Other genetic manipulations known to those skilled in the art may be included in the design of the compositions of the invention; for example, it may be necessary to limit the ability of a recombinant virus to replicate through a genetic mutation. In addition, the virus used for this invention is incompetent for replication due to chemical or physical inactivation or, as indicated, due to the lack of a replication competent genome. The viral protein selected for fusion with the first binding site must have an organized and repeating structure. Such an organized and repeating structure includes paracrystalline organizations with distances of 5-30 nm, preferably 5-15 nm, on the surface of the virus. The result of creating a fusion protein of this type will be multiple, ordered and repeated first binding sites on the surface of the virus, reflecting the normal organization of the native viral protein. As will be appreciated by those skilled in the art, the first binding site may be part of or may be any suitable protein, polypeptide, sugar, polynucleotide, peptide (amino acid), natural or synthetic polymer, secondary metabolite, or a combination thereof, which can serve for specific antigen binding or an antigenic determinant, leading to the formation of an ordered and repeating matrix of antigen or antigenic determinant.

In another embodiment of the invention, the central particle is a recombinant alphavirus, and more particularly a recombinant Sindbis virus. Alphaviruses are positive RNA strand viruses that replicate their genomic RNA completely in the cytoplasm of an infected cell and without intermediate DNA products (Strauss, J. and Strauss, E., Microbiol. Rev. 58: 491-562 (1994)). Much attention was paid to several representatives of the alphavirus family, Sindbis (Xiong, C. et al., Science 243: 1188-1191 (1989); Schlesinger, S., Trends Biotechnol. 11: 18-22 (1993)), forest virus Semlic (SFV) (Liljeström, P. and Garoff, H., Bio / Technology 9: 1356-1361 (1991)) and others (Davis, NL et al., Virology 171: 189-204 (1989)) as based viruses expressing vectors for many different proteins (Lundstrom, K., Curr. Opin. Biotechnol. 8: 578-582 (1997); Liljeström, P., Curr. Opin. Biotechnol. 5: 495-500 (1994)) and as candidates for vaccine development. Recently, a number of patents have been issued aimed at the use of alphaviruses for the expression of heterologous proteins and the development of vaccines (see US Pat. Nos. 5,766,602, 5,792,462, 5,739,026, 5,789,245 and 5,814,482). The construction of the alphavirus core particles according to the invention can be carried out by methods well known in the art of recombinant DNA technology, which are described in the above articles, which are incorporated herein by reference.

Many different recombinant host cells can be used to obtain a virus-based central particle to bind an antigen or antigenic determinant. For example, it is known that alphaviruses have a wide range of hosts; Sindbis virus infects cultured mammalian, reptile and amphibian cells, as well as some insect cells (Clark, H., J. Natl. Cancer Inst. 51: 645 (1973); Leake, C., J. Gen. Virol. 35: 335 (1977); Stollar, V. in The Togaviruses, RW Schlesinger, Ed., Academic Press, (1980), pp. 583-621). Thus, in the practice of this invention, many recombinant host cells can be used. BHK, COS, Vero, HeLa, and CHO cells are particularly suitable for the production of heterologous proteins, as they have the ability to glycosylate heterologous proteins in a manner similar to human cells (Watson, E. et al., Glycobiology 4: 227, (1994)) and can be selected by selection (Zang, M. et al., Bio / Technology 13: 389 (1995)) or genetically engineered (Renner W. et al., Biotech. Bioeng. 4: 476 (1995); Lee K. et al. Biotech. Bioeng. 50: 336 (1996)), so that they grow in serum-free medium as well as in suspension.

The introduction of polynucleotide vectors into host cells can be accomplished by the methods described in standard laboratory manuals (see, for example, Sambrook, J. et al., Eds., Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989), Chapter 9; Ausubel, F. et al., Eds., Current Protocols in Molecular Biology, John H. Wiley and Sons, Inc. (1997), Chapter 16), including methods such as electroporation DEAE-dextran-mediated transfection, transfection, microinjection, cationic lipid-mediated transfection, transduction, scratch, ballistic, and infection. Methods for introducing exogenous DNA sequences into host cells are discussed in Felgner, P. et al., US Pat. 5580859.

Packed RNA sequences can also be used to infect host cells. These packaged RNA sequences can be introduced into host cells by adding them to the culture medium. For example, the preparation of non-infectious alphavirus particles has been described in a number of sources, including Sindbis Expression System, Version C (Invitrogen, catalog number K750-1).

When mammalian cells are used as recombinant host cells to obtain virus-based central particles, these cells are usually grown in tissue culture. Methods of growing cells in culture are well known in the art (see, for example, Celis, J., ed., Cell Biology, Academic Press, 2nd edition (1998); Sambrook, J. et al., Eds., Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989); Ausubel, F. et al., Eds., Current Protocols in Molecular Biology, John H. Wiley and Sons, Inc. (1997 ); Freshney, R., Culture of Animal Cells, Alan R. Liss, Inc. (1983)).

The following examples of RNA viruses suitable for use as central particles in this invention include, but are not limited to, the following viruses: members of the Reoviridae family, including the genus Orthoreovirus (multiple serotypes of mammalian and avian retroviruses), the genus Orbivirus (blue tongue virus , Eugenangi virus, Kemerovo virus, African horse disease virus and Colorado tick-borne fever virus), and the genus Rotavirus (human rotavirus, Nebraska calf diarrhea virus, mouse rotavirus, monkey rotavirus, bovine or sheep’s rotavir with rotavirus birds); Picomaviridae family, including the genus Enterovirus (poliovirus, Coxsackie virus A and B, intestinal cytopathic orphan human viruses (ECHO), hepatitis A, C, D, E and G viruses, monkey enteroviruses, mouse encephalomyelitis viruses (ME), Poliovirus muris , bovine enteroviruses, swine enteroviruses, genus Cardiovirus (encephalomyocarditis virus (EMC), Mengo virus), genus Rhinovirus (human rhinoviruses, including at least 113 subtypes; other rhinoviruses), genus Apthovirus (foot and mouth disease virus (FVDV)); family Calciviridae, including swine vesicular exanthema virus, San Miguel sea lion virus, feline picornavirus and Norwalk virus; the Togaviridae family, including the Alphavirus genus (equine eastern encephalitis virus, Semlica forest virus, Sindbis virus, Chikungunya virus, O'Nyong Nyong virus, Ross river virus, equine Venezuelan encephalitis virus, equine Western encephalitis virus), genus Flavirius (yellow mosquito virus, Dengue virus, Japanese encephalitis virus, San Louis encephalitis virus, Murray Valley encephalitis virus, West Nile virus, Kunzhin virus, Central European tick-borne encephalitis virus, Far Eastern tick-borne encephalitis virus, forest virus and Kiasanur, Louping III virus, Povassan virus, Omsk hemorrhagic fever virus), genus Rubivirus (rubella virus), genus Pestivirus (mucous membrane disease virus, swine cholera virus, border disease virus); the Bunyaviridae family, including the Bunyvirus genus (Bunyamver virus and related viruses, the California encephalitis virus group), the Phlebovirus genus (Sicilian mosquito fever virus, Rift Valley fever virus), the Nairovirus genus (Hemorrhagic fever virus, Nyme-Crimean and Syndrome disease) Uukuvirus (Uukuniemi virus and related viruses); the Orthomyxoviridae family, including the genus of the influenza virus (type A influenza virus, many serotypes in humans); swine flu virus and bird and horse flu viruses; type B influenza virus (many serotypes in humans) and type C influenza virus (possibly a separate genus); the Paramyxoviridae family, including the genus Paramyxovirus (parainfluenza virus type 1, Sendai virus, hemodisorption virus, parainfluenza viruses type 2-5, Newcastle disease virus, mumps virus), the genus Morbillivirus (measles virus, subacute sclerosing panencephalitis virus, distemper virus, plague virus cattle), the genus Pneumovirus (respiratory syncytial virus (RSV), bovine respiratory syncytial virus and mouse pneumonia virus); forest virus, the family Rhabdoviridae, including the genus Vesiculovirus (VSV), (Chandipur virus, Flanders-Hart Park virus), the genus Lyssavirus (rabies virus), fish rhabdoviruses and filoviruses (Marburg virus and Ebola virus); the Arenaviridae family, including lymphocytic choriomeningitis virus (LCM), Takaribe complex virus and Lassa virus; the Coronoaviridae family, including infectious bronchitis virus (IBV), mouse hepatitis virus, human intestinal coronavirus and infectious feline peritonitis virus (feline coronavirus).

Illustrative DNA viruses that can be used as central particles include, but are not limited to, the Poxviridae family, including the genus Orthopoxvirus (smallpox virus, smallpox virus, monkeypox virus, cowpox virus, buffalo smallpox virus, smallpox virus rabbits, ectromelia virus), genus Leporipoxvirus (myxoma, fibroma), genus Avipoxvirus (smallpox virus and smallpox virus of other birds), genus Capripoxvirus (smallpox sheep, smallpox goats), genus Suipoxvirus (smallpox pigs), genus Parapoxvirus (infectious virus pustular dermatitis, cow pseudo-virus virus ("nodules oyarok "), papular stomatitis virus in cattle); Iridoviridae family (swine fever virus, frog viruses 2 and 3, fish lymphocystosis virus); Herpesviridae family, including alpha herpes viruses (herpes simplex viruses type 1 and 2, Varicella-Zoster virus, horse abortion virus, horse herpes virus type 2 and 3, pseudorabies virus, infectious bovine keratoconjunctivitis virus, cattle infectious rhinotracheitis virus, feline virus rhinotracheitis, infectious laryngotracheitis virus), beta herpes viruses (human cytomegalovirus and cytomegalovirus pigs, monkeys and rodents); gamma herpes viruses (Epstein-Barr virus (EBV), Marek's disease virus, Herpes saimiri (squirrel monkey herpes), Herpesvirus ateles (herpes monkey virus herpes virus), Herpesvirus sylvilagus (forest rabbit herpes virus), guinea pig herpes virus, tumor ); and the Adenoviridae family, including the genus Mastadenovirus (subgroups A, B, C, D and E of humans and not belonging to subgroups; adenoviruses of monkeys (at least 23 serotypes), infectious hepatitis in dogs and adenoviruses of cattle, pigs, sheep, frogs and many other species, the genus Aviadenovirus (avian adenoviruses); and uncultivated adenoviruses; the Papoviridae family, including the genus Papillomavirus (human papillomaviruses, cattle papillomaviruses, Shope rabbit papillomaviruses and various other pathogenic papillomaviruses of other species), Polyom genus , at monkey aquuolizing virus (SV-40), rabbit vacuolizing virus (RKV), K virus, BK virus, JC virus and other primate polyoma viruses such as lymphotropic papilloma virus); Parvoviridae family, including the adeno-associated virus genus, the genus Parvovirus (cat panleukopenia virus, cattle parvovirus, dog parvovirus, Aleutian mink disease virus, etc.) Finally, DNA viruses can include viruses such as agents of chronic infectious neuropathy (CHINA virus).

In other embodiments, a bacterial pilin, a sub-fragment of a bacterial pilin, or a fusion protein that contains either a bacterial pilin or a sub-fragment thereof, is used to prepare compositions and, accordingly, vaccine compositions according to the invention. Examples of pilin proteins include pilins produced by Escherichia coli, Haemophilus influenzae, Neisseria meningitidis, Neisseria gonorrhoeae, Caulobacter crescentus, Pseudomonas stutzeri and Pseudomonas aeruginosa. Amino acid sequences of pilin proteins suitable for use in the case of this invention include those indicated in GenBank AJ000636 (SEQ ID NO: 1), AJ132364 (SEQ ID NO: 2), AF229646 (SEQ ID NO: 3), AF051814 (SEQ ID NO: 4), AF051815 (SEQ ID NO: 5) and X00981 (SEQ ID NO: 6), the full description of which is incorporated herein by reference.

Bacterial pilin proteins are usually processed to remove N-terminal leader sequences before exporting proteins to bacterial periplasm. In addition, as will be understood by a person skilled in the art, the bacterial pilin proteins used to prepare the compositions and, accordingly, the vaccine compositions of the invention will generally not have a leader sequence present in vivo.

One specific example of a pilin protein suitable for use in this invention is E. coli P-pilin (entry in GenBank AF237482 (SEQ ID NO: 7)). An example of an E. coli pilin of type 1 suitable for use in the invention is pilin having the amino acid sequence indicated in GenBank, entry P04128 (SEQ ID NO: 8), which is encoded by a nucleic acid having the nucleotide sequence specified in GenBank, entry M27603 (SEQ ID NO: 9). A full description of these GenBank data is incorporated herein by reference. And again, in most cases, the mature form of the above protein can be used to prepare the composition and, therefore, the vaccine composition according to the invention.

Bacterial pilins or pilin sub-fragments suitable for use in the practice of this invention will typically be able to associate to form ordered and repeating antigenic matrices.

Methods for producing fimbriae and fimbria-like structures in vitro are well known in the art. For example, Bullitt et al., Proc. Natl. Acad. Sci. USA 93: 12890-12895 (1996) described in vitro reconstruction of E. coli P-fimbria subunits. In addition, Eshdat et al., J. Bacteriol. 148: 308-314 (1981) described methods suitable for dissociating fimbriae type-1 E. coli and reconstructing fimbriae. Briefly, these methods are as follows: fimbriae are subjected to dissociation by incubation at 37 ° C in saturated guanidine hydrochloride. Pilin proteins are then purified by chromatography, after which the pilin dimers are formed during dialysis against 5 mM tris (hydroxymethyl) aminomethane hydrochloride (pH 8.0). Eshdat et al. they also found that pilin dimers reassembled to form fimbriae during dialysis against 5 mM Tris (hydroxymethyl) aminomethane (pH 8.0) containing 5 mM MgCl ₂ .

In addition, using, for example, conventional genetic engineering and protein modification methods, pilin proteins can be modified to contain a first binding site to which an antigen or antigenic determinant is bound via a second binding site. Alternatively, antigens or antigenic determinants can be directly linked via a second binding site to amino acid residues that are naturally occurring in these proteins. Then these modified pilin proteins can be used in vaccine compositions according to the invention.

The bacterial pilin proteins used to prepare the compositions and, accordingly, the vaccine compositions of the invention can be modified in a manner similar to the method described herein for HBcAg. For example, cysteine and lysine residues can either be deleted or replaced with other amino acid residues, and the first binding site can be added to the resulting proteins. In addition, pilin proteins can either be expressed in a modified form or chemically modified after expression. Similarly, intact fimbriae can be collected from bacteria and then chemically modified.

In another embodiment, fimbriae or fimbria-like structures are harvested from bacteria (e.g., E. coli) and used to form vaccine compositions and compositions of the invention. One example of fimbriae suitable for preparing compositions and vaccine compositions is E. coli type-1 fimbriae, which is formed from pilin monomers having the amino acid sequence shown in SEQ ID NO: 8.

A number of methods for collecting bacterial fimbriae are known in the art. For example, Bullitt and Makowski (Biophys. J. 74: 623-632 (1998)) described a method for purifying fimbriae in the case of collection of E. coli P-fimbriae. According to this method, fimbriae are cut off with E. coli having a hyperquantity of fimbria and containing a P-fimbria plasmid, and purified using dissolution and precipitation cycles with MgCl ₂ (1.0 M).

After collecting fimbriae or similar fimbria structures can be modified in many ways. For example, a first binding site can be added to fimbriae, to which antigens or antigenic determinants can be linked via a second binding site. In other words, bacterial fimbriae or fimbria-like structures can be assembled and modified, resulting in ordered and repeating antigenic matrices.

Antigens or antigenic determinants may be associated with cysteine residues or naturally occurring lysine residues present in fimbias or fimbria-like structures. In such cases, the high orderliness and repeatability of the naturally occurring amino acid residue may regulate the binding of antigens or antigenic determinants to fimbriae or fimbria-like structures. For example, fimbriae or fimbria-like structures can be linked to second binding sites of antigens or antigenic determinants using a heterobifunctional cross-linking agent.

When structures that are naturally synthesized by organisms (e.g., fimbriae) are used to prepare the compositions and vaccine compositions of the invention, the genetic design of these organisms will often be advantageous so that they produce structures that possess the desired characteristics. For example, when type-1 fimbriae are used, E. coli, E. coli, from which these fimbriae are assembled, can be modified so that they produce structures with specific characteristics. Examples of possible modifications to the pilin proteins include the insertion of one or more lysine residues, deletion or replacement of one or more naturally occurring lysine residues, and the deletion or replacement of one or more naturally occurring cysteine residues (e.g., cysteine residues at positions 44 and 84 in SEQ ID NO :8).

In addition, further modifications can be made to the pilin genes that result in expression products containing a different first binding site other than a lysine residue (eg, FOS or JUN domain). Of course, a suitable first binding site will generally be limited to sites that do not prevent the formation of fimbriae pilina or similar fimbriae structures from proteins suitable for use in vaccine compositions of the invention.

Pilin genes that are naturally found in bacterial cells can be modified in vivo (for example, by homologous recombination) or pilin genes with specific characteristics can be inserted into these cells. For example, pilin genes can be introduced into bacterial cells as a component of either a replicating cloning vector or a vector that integrates into the bacterial chromosome. The inserted pilin genes can also be linked to sequences that control the regulation of expression (for example, a lac operator).

In most cases, fimbriae or fimbria-like structures used in the compositions and, accordingly, in the vaccine compositions of the invention will be constructed from the same type pilin subunit. Typically, fimbriae or fimbria-like structures consisting of identical subunits will be used, since it is assumed that they form structures that are highly ordered and repeating antigenic matrices.

However, the compositions of the invention also include compositions and vaccines containing fimbriae and fimbria-like structures formed from heterogeneous pilin subunits. The pilin subunits that form these fimbriae or fimbria-like structures can be expressed from genes present in bacterial cells in nature, or can be introduced into cells. When both the genes and the naturally occurring pilin gene and the introduced gene are expressed in a cell that forms fimbriae or fimbria-like structures, the result will typically be structures formed from a mixture of these pilin proteins. In addition, when two or more pilin genes are expressed in a bacterial cell, the relative expression of each pilin gene will usually be a factor that determines the ratio of the different pilin subunits in fimbriae or fimbria-like structures.

In the case where fimbriae or fimbria-like structures having a specific composition of mixed pilin subunits are required, the expression of at least one of the pilin genes can be regulated by a heterologous inducible promoter. Such promoters, as well as other genetic elements, can be used to regulate the relative amounts of the various pilin subunits produced in the bacterial cell, and therefore the composition of the fimbriae or fimbria-like structures.

In addition, the antigen or antigenic determinant can be linked to bacterial fimbriae or fimbria-like structures by a bond that is not a peptide bond, bacterial cells that produce fimbriae or fimbria-like structures used in the compositions of the invention can be genetically engineered to create proteins pilin, which are fused with an antigen or antigenic determinant. Such fusion proteins that form fimbriae or fimbria-like structures are suitable for use in vaccine compositions of the invention.

Virus-like particles in the context of this application refer to structures similar to a virus particle, but which are non-pathogenic. In general, virus-like particles do not contain the viral genome and therefore are non-infectious. Also, virus-like particles can be produced in large quantities as a result of heterologous expression and can be easily purified.

In a preferred embodiment, the virus-like particle is a recombinant virus-like particle. One of skill in the art can obtain VLP using a recombinant DNA technique and viral coding sequences that are readily and generally available. For example, the coding sequence of a coat protein or virus cortex can be constructed for expression in a baculovirus expression vector using a commercially available baculovirus vector, under the regulatory control of a viral promoter with appropriate sequence modifications, to provide a functional link between the coding sequence and the regulatory sequence. The coding sequence of the envelope protein or virus core can also be constructed for expression, for example, in a bacterial expression vector.

Examples of VLP include, but are not limited to, hepatitis B virus capsid proteins (Ulrich et al., Virus Res. 50: 141-182 (1998)), measles virus (Warnes et al., Gene 160: 173-178 (1995 )), Sindbis virus, rotavirus (US patent 5071651 and US patent 5374426), foot and mouth disease virus (Twomey et al., Vaccine 13: 1603-1610, (1995)), Norwalk virus (Jiang, X. et al., Science 250 : 1580-1583 (1990); Matsui, SM et al., J. Clin. Invest. 87: 1456-1461 (1991)), GAG retroviral protein (WO 96/30523), Ty retrotransposon protein p1, hepatitis virus surface protein B (WO 92/11291), human papillomavirus (WO 98/15631), RNA phages, Ty, fr phage, GA phage and Qβ phage.

As will be readily apparent to those skilled in the art, the VLP of the invention is not limited to any particular form. The particle can be synthesized chemically or through a biological process, which may be natural or non-natural. As an example, this type of variant includes a virus-like particle or its recombinant form.

In a more specific embodiment, the VLP may contain or, alternatively, essentially consist of or, alternatively, consist of recombinant polypeptides or fragments thereof, selected from recombinant rotavirus polypeptides, recombinant Norwalk virus polypeptides, recombinant alphavirus polypeptides, recombinant polypeptides of the disease virus n , recombinant measles virus polypeptides, recombinant Sindbis virus polypeptides, recombinant polyoma virus polypeptides, recombinant retrovirus polypeptides, re recombinant hepatitis B virus polypeptides (e.g., HBcAg), recombinant tobacco mosaic virus polypeptides, recombinant sheep fowl virus polypeptides, recombinant human papilloma virus polypeptides, recombinant bacteriophage polypeptides, recombinant polypeptides of RNA recombinant polypeptides, recombinant polypeptides, RNA recombin peptides, recombinant polypeptides GA phage polypeptides and recombinant Qβ phage polypeptides. A virus-like particle may also contain or, alternatively, essentially consist, or alternatively, consist of one or more fragments of such polypeptides, as well as variants of such polypeptides. Variants of the polypeptides may have, for example, at least 80%, 85%, 90%, 95%, 97% or 99% amino acid identity with their wild-type counterparts.

In a preferred embodiment, the virus-like particle contains essentially consists or alternatively consists of recombinant proteins or fragments of RNA phage. Preferably, the RNA phage is selected from the group consisting of a) bacteriophage Qβ; b) bacteriophage R17; c) bacteriophage fr; d) bacteriophage GA; e) bacteriophage SP; f) bacteriophage MS2; g) bacteriophage M11; h) bacteriophage MX1; i) bacteriophage NL95; k) bacteriophage f2; and l) bacteriophage PP7.

In another preferred embodiment of the invention, the virus-like particle contains or, alternatively, essentially consists of or, alternatively, consists of recombinant proteins or fragments thereof, Qβ RNA bacteriophage or fr. RNA bacteriophage.

In another preferred embodiment of the present invention, the recombinant proteins contain or, alternatively, essentially consist or alternatively consist of covering RNA phage proteins.

Coating RNA phage proteins forming capsids or VLPs or fragments of bacteriophage coating proteins compatible with self-assembly into capsid or VLP are thus further preferred embodiments of the present invention. Bacteriophage Qβ coating proteins, for example, can be recombinantly expressed in E. coli. In addition, with such expression, these proteins spontaneously form capsids. In addition, these capsids form a structure with its inherent repetitive organization.

Specific preferred examples of bacteriophage coat proteins that can be used to prepare compositions of the invention include bacteriophage RNA coat proteins such as Qβ bacteriophage (SEQ ID NO: 10; PIR Database, Inventory No. VCBPQβ Relating to CP Qβ and SEQ ID NO: 11; Inventory No. AAA16663 related to Protein A1 Qβ), bacteriophage R17 (SEQ ID NO: 12; PIR, Inventory No. VCBPR7), bacteriophage fr (SEQ ID NO: 13; PIR, Inventory No. VCBPFR) bacteriophage GA (SEQ ID NO: 14; GenBank, Inventory No. NP-040754), bacteriophage SP (SEQ ID NO: 15; GenBank, Inventory No. CAA30374 relating to CP SP, and SEQ ID NO: 16; Inventory No. NP-695026 relating to Protein A1 SP), bacteriophage MS2 (SEQ ID NO: 17; PIR, Inventory No. VCBPM2), bacteriophage M11 (SEQ ID NO: 18; GenBank, Inventory No . AAC06250), bacteriophage MX1 (SEQ ID NO: 19; GenBank, inventory No. AAC14699), bacteriophage NL95 (SEQ ID NO: 20; GenBank, inventory No. AAC14704), bacteriophage f2 (SEQ ID NO: 21; GenBank, Inventory No. P03611), bacteriophage PP7 (SEQ ID NO: 22). In addition, protein A1 of the bacteriophage Qβ or C-terminal truncated forms in which up to 100, 150 or 180 amino acids from its C-terminus are absent can be included in the capsid assembly of the Qβ coat proteins. Typically, the percentage of A1 Qβ protein relative to CP Qβ in the assembled capsid construct will be limited to allow for capsid formation.

It was also found that the Qβ coating protein undergoes self-assembly into capsids when expressed in E. coli (Kozlovska TM. Et al., GENE 137: 133-137 (1993)). The resulting capsids or virus-like particles had an icosahedral capsid structure similar to that of a phage with a diameter of 25 nm and a quasi-symmetry of T = 3. In addition, the crystal structure of phage Qβ was determined. The capsid contains 180 copies of the coating protein, which are linked into covalent pentamers and hexamers by disulfide bridges (Golmohammadi, R. et al., Structure 4: 543-5554 (1996)), providing amazing stability of the capsid of the Qβ coating protein. However, capsids or VLPs derived from the recombinant Qβ coat protein may contain subunits that are not disulfide bonded to other subunits in the capsid, or are not fully bonded. Thus, when a recombinant Qβ capsid is loaded onto a non-reducing SDS-PAGE, bands corresponding to the monomeric Qβ coating protein are visible, as well as bands corresponding to the hexamer or pentamer of the Qβ coating protein. Subunits that are not fully linked by disulfide bonds can be seen as a dimer, trimer or even tetramer band in non-reducing SDS-PAGE. The Qβ capsid protein also exhibits unusual resistance to organic solvents and denaturing agents. Unexpectedly, the authors found that such high concentrations of DMSO and acetonitrile, such as 30%, and such high concentrations of guanidinium as 1 M did not affect the stability of the capsid. The high stability of the capsid from the Qβ coating protein is an advantage, in particular for its use in immunization and vaccination of mammals and humans according to this invention.

When expressed in E. coli, the N-terminal methionine of the Qβ coat protein is usually removed as found by Edman N-terminal sequencing as described by Stoll, E. et al. J. Biol. Chem. 252: 990-993 (1977). VLPs consisting of Qβ coating proteins where the N-terminal methionine has not been removed, or VLPs containing a mixture of Qβ coating proteins, where the N-terminal methionine is either cleaved or present, are also within the scope of this invention.

In addition, it has also been shown that RNA phage coat proteins self-assemble when expressed in a bacterial host (Kastelein, RA et al., Gene 23: 245-254 (1983), Kozlovskaya, TM et al., Dokl. Akad. Nauk SSSR 287: 452-455 (1986), Adhin, MR et al., Virology 170: 238-242 (1989), Ni, CZ, et al., Protein Sci. 5: 2485-2493 (1996), Priano, C. et al., J. Mol. Biol. 249: 283-297 (1995)). The phage Qβ capsid, in addition to the covering protein, contains the so-called fully readable protein A1 and maturation protein A2. A1 is formed as a result of suppression in the UGA stop codon and has a length of 329 a / c. The capsid of the recombinant phage Qβ coat protein used in this invention lacks the A2 lysis protein and contains RNA from the host. The covering RNA phage protein is an RNA binding protein and interacts with the stem loop of the replicase gene ribosome binding site, acting as a translation repressor during the virus life cycle. The sequence and structural elements of the interaction are known (Witherell, G.W. and Uhlenbeck, O.C. Biochemistry 28: 71-76 (1989); Lim F. et al., J. Biol. Chem. 271: 31839-31845 (1996)). The stem loop and RNA are known to be generally involved in the assembly of the virus (Golmohammadi, R. et al., Structure 4: 543-5554 (1996)).

In a further preferred embodiment of the invention, the virus-like particle contains or, alternatively, essentially consists of or, alternatively, consists of recombinant proteins or fragments of RNA phage, where the recombinant proteins contain, essentially consist or, alternatively, consist of mutant RNA-covering proteins phage, preferably mutant coat proteins of RNA phages mentioned above. In another preferred embodiment, the mutant RNA phage coat proteins are modified by removing at least one lysine residue by substitution or by adding at least one lysine residue by substitution; alternatively, mutant RNA phage coat proteins are modified by deletion of at least one lysine residue or addition of at least one lysine residue by insertion.

In another preferred embodiment, the virus-like particle contains or, alternatively, essentially consists of or, alternatively, consists of recombinant proteins or fragments of RNA bacteriophage Qβ, where the recombinant proteins contain or, alternatively, essentially consist or, alternatively, consist of covering proteins, having the amino acid sequence of SEQ ID NO: 10, or a mixture of coating proteins having the amino acid sequence of SEQ ID NO: 10 and SEQ ID NO: 11, or mutants of SEQ ID NO: 11, and where the N-terminal methionine is preferably cleaved.

In a further preferred embodiment of the present invention, the virus-like particle contains essentially consists or alternatively consists of recombinant Qβ proteins or fragments thereof, where the recombinant proteins contain or alternatively essentially consist or, alternatively, consist of mutant Qβ coating proteins. In another preferred embodiment, said mutant coating proteins are modified by removing at least one lysine residue by substitution or by adding at least one lysine residue by substitution. Alternatively, said mutant coating proteins are modified by deletion of at least one lysine residue or addition of at least one lysine residue by insertion.

Four lysine residues are exposed on the surface of the capsid from the Qβ coating protein. Qβ mutants, for which exposed lysine residues are replaced with arginines, can also be used for this invention. Thus, the following Qβ coating protein mutants and Qβ mutant VLPs can be used in the practice of the invention: “Qβ-240” (Lys13-Arg; SEQ ID NO: 23), “Qβ-243” (Asn 10-Lys; SEQ ID NO : 24), Qβ-250 (Lys 2-Arg, Lys13-Arg; SEQ ID NO: 25), Qβ-251 (SEQ ID NO: 26) and Qβ-259 (Lys 2-Arg, Lys16-Arg; SEQ ID NO: 27). Thus, in a further preferred embodiment of the invention, the virus-like particle contains essentially consists or alternatively consists of recombinant proteins of mutant Qβ coating proteins, which contain proteins having an amino acid sequence selected from the following group: a) amino acid sequence of SEQ ID NO: 23; b) the amino acid sequence of SEQ ID NO: 24; c) the amino acid sequence of SEQ ID NO: 25; d) the amino acid sequence of SEQ ID NO: 26; and e) the amino acid sequence of SEQ ID NO: 27. The construction, expression and purification of the aforementioned Qβ, VLP coating proteins and capsids from mutant Qβ coating proteins, respectively, are described in U.S. Patent Application Pending No. 10/050902, filed by this assignee on January 18, 2002. In particular, the reference refers to example 18 of the above application.

In a further preferred embodiment of the invention, the virus-like particle contains or, alternatively, essentially consists or alternatively consists of recombinant Qβ proteins or fragments thereof, where the recombinant proteins contain, essentially consist or, alternatively, consist of a mixture of any one of the above Qβ mutants and the corresponding protein A1.

In a further preferred embodiment of the invention, the virus-like particle contains or, alternatively, essentially consists of or, alternatively, consists of recombinant proteins or fragments of RNA phage AP205 thereof.

The AP205 genome consists of a maturation protein, a covering protein, a replicase, and two open reading frames not present in related phages; lysis gene and open reading frame, which plays a role in the translation of the maturation gene (Klovins, J. et al., J. Gen. Virol. 83: 1523-33 (2002)). The AP205 coating protein can be expressed from plasmid pAP283-58 (SEQ ID NO: 79), which is a derivative of pQb10 (Kozlovska, TM et al., Gene 137: 133-37 (1993)) and which contains the AP205 ribosome binding site. Alternatively, the AP205 coat protein can be cloned into pQb185 below the ribosome binding site present in the vector. Both methods result in protein expression and capsid formation, as described in the pending US patent application, entitled “Molecular Antigenic Matrices”, filed by this assignee on July 16, 2002, which is incorporated by reference in its entirety. The vectors pQb10 and pQb185 are vectors derived from the pGEM vector, and the expression of cloned genes in these vectors is controlled by the trp promoter (Kozlovska, TM et al., Gene 137: 133-37 (1993)). Plasmid pAP283-58 (SEQ ID NO: 79) contains the putative AP205 ribosome binding site in the following sequence, which is located below the XbaI site and immediately above the start codon ATG of the AP205 coat protein: tctagaATTTTCTGCGCACCCATCCCGGGTGGCGCCCAAAGT GAGGAA AATCatGATGatAATCat. Vector pQb185 contains the Shine-Dalgarno sequence below the XbaI site and above the start codon (tctagaTTAACCCAACGCGT AGGAG TCAGGCCatg, the Shine-Dalgarno sequence is underlined).

In a further preferred embodiment of the invention, the virus-like particle contains or, alternatively, essentially consists of or, alternatively, consists of recombinant coat proteins or fragments thereof of RNA phage AP205.

Thus, said preferred embodiment of the invention includes AP205 coat proteins that form capsids. Such proteins are expressed recombinantly or obtained from natural sources. The AP205 coating proteins produced in bacteria spontaneously form capsids, as evidenced by electron microscopy (EM) and immunodiffusion. The structural features of the capsid formed by the AP205 coat protein (SEQ ID NO: 80) and the features of the capsid formed by the AP205 RNA phage coat protein are almost the same when observed in EM. AP205 VLPs are highly immunogenic and can be associated with antigens and / or antigenic determinants to form vaccine constructs exposing antigens and / or antigenic determinants in a repetitive manner. High antibody titers are produced against antigens exposed in this way, which indicates that the associated antigens and / or antigenic determinants are available for interaction with antibody molecules and are immunogenic.

In a further preferred embodiment of the invention, the virus-like particle comprises or, alternatively, essentially consists of, or, alternatively, consists of recombinant mutant coat proteins or fragments thereof of RNA phage AP205.

Assembly-competent mutant forms of the VLP of AP205, including the AP205 coating protein with the substitution of proline at amino acid 5 for threonine (SEQ ID NO: 81), can also be used in the practice of the invention, and they constitute the following preferred embodiment of the invention. These VLPs, AP205 VLPs obtained from natural sources, or AP205 viral particles can be coupled to antigens to form ordered repeatable antigen matrices according to the invention.

The mutant P5-T AP205 coat protein can be expressed from plasmid pAP281-32 (SEQ ID No. 82), which is derived directly from pQb185 and which contains the AP205 mutant coat protein gene instead of the Qβ coat protein gene. Vectors for expression of the AP205 coat protein were transfected into E. coli to express the AP205 coat protein.

Methods for expressing a coating protein and, correspondingly, a mutant coating protein leading to self-assembly in the VLP are described in the co-pending provisional application for US Patent, entitled "Molecular Antigenic Matrices" and filed by this assignee on July 16, 2002, which is incorporated by reference in full volume. Suitable strains of E. coli include, but are not limited to, E. coli K802, JM 109, RR1. Suitable vectors and strains and their combinations can be identified by testing the expression of the coating protein and, accordingly, the mutant coating protein using SDS-PAGE and testing the formation and assembly of the capsid, first by optional purification of the capsids by gel filtration and then testing them in an immunodiffusion analysis ( Ouchterloni test) or by electron microscopy (Kozlovska, TM et al., Gene 137: 133-37 (1993)).

The AP205 coating proteins expressed from the vectors pAP283-58 and pAP281-32 may be deprived of the initial amino acid methionine due to processing in the E. coli cytoplasm. Cleaved, unsplit forms of VLP AP205 or mixtures thereof are further preferred embodiments of the invention.

In a further preferred embodiment of the invention, the virus-like particle contains or, alternatively, essentially consists of or, alternatively, consists of a mixture of recombinant coat proteins or fragments thereof of RNA phage AP205 and recombinant mutant coat proteins or fragments thereof of RNA phage AP205.

In a further preferred embodiment of the invention, the virus-like particle contains or, alternatively, essentially consists of or, alternatively, consists of fragments of recombinant coat proteins or recombinant mutant coat proteins of RNA phage AP205.

Fragments of the recombinant coating protein AP205, capable of collecting in VLP, and, accordingly, capsid, are also applicable in the practice of the invention. These fragments can be formed by deletion either internally or at the ends of the coating protein and mutant coating protein, respectively. Insertions into the sequence of a coating protein and a mutant coating protein, or fusion of antigenic sequences with a sequence of a coating protein and a mutant coating protein that are compatible with the assembly in the VLP, are further embodiments of the invention that result in AP205 chimeric coating proteins and particles, respectively. The effects of insertions, deletions and fusions with the sequence of the covering protein and whether it is compatible with the assembly in the VLP can be determined by electron microscopy.

Particles formed by a coating protein, coating protein fragments, or AP205 chimeric coating proteins described above can be isolated in pure form by combining the fractionation steps by precipitation and gel filtration purification steps using columns, for example, with Sepharose CL-4B, Sepharose CL -2B, Sepharose CL-6B, and combinations thereof, as described in the co-pending provisional application for a US patent, entitled "Molecular Antigenic Matrices" and filed by this assignee on July 16 I am 2002, which is incorporated by reference in its entirety. Other methods for isolating virus-like particles are known in the art and can be used to isolate virus-like particles (VLPs) of the bacteriophage AP205. For example, the use of ultracentrifugation to isolate the yeast retrotransposon Ty VLP is described in US Pat. 4918166, which is incorporated into this description by reference in full.

The crystal structure of several RNA bacteriophages has been determined (Golmohammadi, R. et al., Structure 4: 543-554 (1996)). Using this information, residues exposed on the surface can be identified, and thus, the covering proteins of the RNA phage can be modified so that one or more reactive amino acid residues can be inserted by insertion or substitution. As a result, these modified forms of bacteriophage coating proteins can also be used for this invention. Thus, variants of proteins that form capsids or capsid-like structures (e.g., covering proteins of the bacteriophage Qβ, bacteriophage R17, bacteriophage fr, bacteriophage GA, bacteriophage SP, and bacteriophage MS2) can also be used to prepare the compositions of this invention.

Although the sequence of protein variants discussed above will differ from their wild-type counterparts, these protein variants will typically retain the ability to form capsids or capsid-like structures. Thus, the invention also includes compositions and, accordingly, vaccine compositions, which, in addition, contain variants of proteins that form capsids or capsid-like structures, as well as methods for producing such compositions and, accordingly, vaccine compositions, individual subunits the protein used to prepare such compositions; and nucleic acid molecules that encode the protein subunits. Thus, variant forms of wild-type proteins that form capsids or capsid-like structures and retain the ability to associate and form capsids or capsid-like structures are included within the scope of the invention.

As a result, the invention further includes vaccine compositions and, accordingly, vaccine compositions containing proteins that contain or, alternatively, essentially consist or, alternatively, consist of amino acid sequences that are at least 80%, 85%, 90%, 95%, 97% or 99% are identical to wild-type proteins, which form ordered matrices and, accordingly, matrices having their inherent repeating structure.

In addition, nucleic acid molecules that encode proteins used to prepare the compositions of this invention are included within the scope of the invention.

In other embodiments, the invention also relates to compositions containing proteins that contain or, alternatively, essentially consist or, alternatively, consist of amino acid sequences that are at least 80%, 85%, 90%, 95%, 97% or 99% are identical to any of the amino acid sequences shown in SEQ ID NO: 10-27.

Proteins suitable for use in this invention also include C-terminally shortened protein mutants that form capsids or capsid-like structures or VLPs. Specific examples of such truncated mutants include proteins having the amino acid sequence shown in any of SEQ ID NOs: 10-27, where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from C-end. Typically, these shortened C-terminus mutants will retain the ability to form capsids or capsid-like structures.

The following proteins suitable for use in this invention also include N-terminally shortened protein mutants that form capsids or capsid-like structures. Specific examples of such truncated mutants include proteins having the amino acid sequence shown in any of SEQ ID NOs: 10-27, where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from N- the end. Typically, these N-terminally shortened mutants will retain the ability to form capsids or capsid-like structures.

Additional proteins suitable for use in this invention include N- and C-terminated shortened mutants that form capsids or capsid-like structures. Suitable truncated mutants contain proteins having the amino acid sequence shown in any SEQ ID NO: 10-27, where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N-terminus and 1 , 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids were deleted from the C-terminus. Typically, these mutants shortened at the N-terminus and C-terminus will retain the ability to form capsids or capsid-like structures.

The invention also relates to compositions containing proteins that contain or, alternatively, essentially consist or, alternatively, consist of amino acid sequences that are at least 80%, 85%, 90%, 95%, 97% or 99% are identical to the shortened mutants described above.

Thus, the invention relates to compositions and vaccine compositions obtained from proteins that form capsids or VLPs, methods for producing said compositions from individual protein subunits and VLPs or capsids, methods for producing said individual protein subunits, nucleic acid molecules that encode these subunits, and vaccination methods and / or methods that elicit immunological responses in individuals using said compositions of the invention.

As indicated previously, the invention includes virus-like particles or their recombinant forms. In one preferred embodiment, the particles used in the compositions of the invention are comprised of hepatitis B core protein (HBcAg) or an HBcAg fragment. In a further embodiment, the particles used in the compositions of the invention are comprised of hepatitis B core protein (HBcAg) or a HBcAg protein fragment that has been modified to either remove or reduce the amount of free cysteine residues. Zhou et al. (J. Virol. 66: 5393-5398 (1992)) showed that HBcAg, which were modified to remove naturally occurring cysteine residues, retain the ability to associate and form capsids. Thus, VLPs suitable for use in the compositions of the invention include VLPs containing modified HBcAg or fragments thereof in which one or more naturally occurring cysteine residues have been either deleted or replaced with another amino acid residue (e.g., a serine residue )

HBcAg is a protein formed by processing the hepatitis B core antigen precursor protein. A number of HBcAg isotypes have been identified and their amino acid sequences are readily available to those skilled in the art. In most cases, the compositions and, accordingly, the vaccine compositions of the invention can be prepared using a processed form of HBcAg (i.e., HBcAg from which the N-terminal leader sequence of the hepatitis B core antigen precursor protein has been removed).

In addition, in the case where HBcAg will be obtained under conditions under which processing does not occur, HBcAg, as a rule, will be expressed in "processed" form. For example, when an E. coli expression system directing protein expression into the cytoplasm is used to produce the HBcAg of the invention, said proteins will typically be expressed so that they lack the N-terminal leader sequence of the hepatitis B core antigen protein.

The preparation of hepatitis B virus-like particles that can be used for this invention is described, for example, in WO 00/32227 and in said application, in particular in Examples 17 to 19 and 21 to 24, as well as in WO 01/85208 and in it, in particular, in examples 17 to 19, 21 to 24, 31 to 41, and in the pending application for the grant of US patent No. 10/050902, filed by this assignee on January 18, 2002. In the case of the last application, this applies in particular to examples 23, 24, 31 and 51. All three documents are incorporated into this description by reference in full.

The invention also includes HBcAg variants that have been modified to remove or replace one or more additional cysteine residues. It is known in the art that free cysteine residues may be involved in a number of adverse chemical reactions. These adverse reactions include disulfide exchanges, reactions with chemicals or metabolites, which, for example, are injected or formed during combination therapy with other substances, or direct oxidation and reaction with nucleotides when exposed to UV light. Thus, toxic adducts can be formed, especially considering the fact that HBcAg have a steady tendency to nucleic acid binding. Thus, toxic adducts can be represented by many species, each of which may separately be present in low concentrations, but together they reach toxic levels.

From the point of view of the above, one of the advantages of using HBcAg vaccines in compositions that have been modified to remove naturally occurring cysteine residues is that the number of sites to which toxic elements can bind when antigens or antigenic determinants are associated may be reduced or they may be removed altogether.

A number of naturally occurring HBcAg variants have been identified that are suitable for use in the practice of this invention. Yuan et al. (J. Virol. 73: 10122-10128 (1999)), for example, describe variants in which the isoleucine residue at the position corresponding to position 97 in SEQ ID NO: 28 is replaced with either a leucine residue or a phenylalanine residue. The amino acid sequences of a number of HBcAg variants as well as several variants of the hepatitis B core antigen precursor are described in GenBank, entries AAF121240 (SEQ ID NO: 29), AF121239 (SEQ ID NO: 30), X85297 (SEQ ID NO: 31), X02496 (SEQ ID NO: 32), X85305 (SEQ ID NO: 33), X85303 (SEQ ID NO: 34), AF 151735 (SEQ ID NO: 35), X85259 (SEQ ID NO: 36), X85286 (SEQ ID NO: 37 ), X85260 (SEQ ID NO: 38), X85317 (SEQ ID NO: 39), X85298 (SEQ ID NO: 40), AF043593 (SEQ ID NO: 41), M20706 (SEQ ID NO: 42), X85295 (SEQ ID NO: 43), X80925 (SEQ ID NO: 44), X85284 (SEQ ID NO: 45), X85275 (SEQ ID NO: 46), X72702 (SEQ ID NO: 47), X85291 (SEQ ID NO: 48) , X65258 (SEQ ID NO: 49), X85302 (SEQ ID NO: 50), M32138 (SEQ ID NO: 51), X85293 (SEQ ID NO: 52), X85315 (SEQ ID NO: 53), U95551 (SEQ ID NO: 54), X85256 (SEQ ID NO: 55), X85316 (SEQ ID NO: 56), X85296 (SEQ ID NO: 57), AB033559 (SEQ ID NO: 58), X59795 (SEQ ID NO: 5 9), X85299 (SEQ ID NO: 60), X85307 (SEQ ID NO: 61), X65257 (SEQ ID NO: 62), X85311 (SEQ ID NO: 63), X85301 (SEQ ID NO: 64), X85314 ( SEQ ID NO: 65), X85287 (SEQ ID NO: 66), X85272 (SEQ ID NO: 67), X85319 (SEQ ID NO: 68), AB010289 (SEQ ID NO: 69), X85285 (SEQ ID NO: 70 ), AB010289 (SEQ ID NO: 71), AF121242 (SEQ ID NO: 72), M90520 (SEQ ID NO: 73), P03153 (SEQ ID NO: 74), AF 110999 (SEQ ID NO: 75) and M95589 ( SEQ ID NO: 76), descriptions of each of which are incorporated herein by reference. These HBcAg variants differ in amino acid sequence in a number of positions, including amino acid residues that correspond to amino acid residues located at positions 12, 13, 21, 22, 24, 29, 32, 33, 35, 38, 40, 42, 44, 45 , 49, 51, 57, 58, 59, 64, 66, 67, 69, 74, 77, 80, 81, 87, 92, 93, 97, 98, 100, 103, 105, 106, 109, 113, 116 , 121, 126, 130, 133, 135, 141, 147, 149, 157, 176, 178, 182 and 183 in SEQ ID NO: 77. The following HBcAg variants suitable for use in the compositions of the invention, which may be further modified as described herein, are described in WO 00/198333, WO 00/177158 and WO 00/214478.

As indicated above, as a rule, processed HBcAg (i.e., those in which there are no leader sequences) will be used in the compositions and, accordingly, the vaccine compositions of the invention. The present invention includes vaccine compositions as well as methods of using such compositions that use the HBcAg variants described above.

Whether the amino acid sequence of the polypeptide has an amino acid sequence that is at least 80%, 85%, 90%, 95%, 97% or 99% identical to one of the above wild-type amino acid sequences or part thereof, can be determined by a standard method using known computer programs such as Bestfit. When using Bestfit or any other sequence alignment program, in order to determine if a particular sequence is identical, for example, to 95% of the reference amino acid sequence, the parameters are set so that the percentage of identity is calculated over the entire length of the reference amino acid sequence and that gaps are resolved in homology, up to 5% of the total number of amino acid residues in the reference sequence.

HBcAg variants and precursors having the amino acid sequences indicated in SEQ ID NOS: 29-72 and 73-77 are relatively similar to each other. Thus, a reference to the amino acid residue of an HBcAg variant located at a position that corresponds to a particular position in SEQ ID NO: 77 refers to the amino acid residue that is present at that position in the amino acid sequence shown in SEQ ID NO: 77. The homology between these HBcAg variants among the hepatitis B viruses that infect mammals is in most cases quite high, so that a person skilled in the art will not have great difficulty viewing both sequences, the amino acid sequence shown in SEQ ID NO: 77, and the amino acid sequence a specific variant of HBcAg, and in the identification of “relevant” amino acid residues. In addition, the amino acid sequence of HBcAg shown in SEQ ID NO: 73, which shows the amino acid sequence of HBcAg derived from a virus that infects woodchucks, has a fairly high homology with HBcAg having the amino acid sequence shown in SEQ ID NO: 77, so it is easy to see that an insertion of three amino acid residues is present in SEQ ID NO: 64 between amino acid residues 155 and 156 of SEQ ID NO: 77.

The invention also includes vaccine compositions that contain HBcAg variants of hepatitis B viruses that infect birds, as well as vaccine compositions that contain fragments of these HBcAg variants. In the case of these HBcAg variants, one, two, three or more cysteine residues present in the indicated polypeptides under natural conditions can either be replaced with another amino acid residue or deleted before being included in the vaccine compositions of the invention.

As discussed above, the removal of free cysteine residues reduces the number of sites where toxic components can bind to HBcAg, and also removes sites where cross-linking of lysine and cysteine residues of the same or neighboring HBcAg molecules can occur. Thus, in another embodiment of the invention, one or more cysteine residues of the hepatitis B virus capsid protein is either deleted or replaced with another amino acid residue.

In other embodiments, the compositions and, accordingly, the vaccine compositions of the invention will contain HBcAg from which the C-terminal region has been removed (e.g., amino acid residues 145-185 or 150-185 of SEQ ID NO: 77). Thus, further modified HBcAg suitable for use in the practice of the present invention include C-terminated shortened mutants. Suitable truncated mutants include HBcAg in which 1, 5, 10, 15, 20, 25, 30, 34, 35 amino acids have been removed from the C-terminus.

HBcAg suitable for use in the practice of this invention also include N-terminally shortened mutants. Suitable truncated mutants include modified HBcAg in which 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N-terminus.

The following HBcAg suitable for use in the practice of this invention include shortened at the N - and C-ends of the mutants. Suitable truncated mutants include HBcAg in which 1, 2, 5, 7, 9, 10, 12, 14, 15, and 17 amino acids have been removed from the N-terminus and 1, 5, 10, 15, 20, 25, 30, 34 , 35 amino acids were deleted from the C-terminus.

The invention also includes vaccine compositions and, accordingly, vaccine compositions containing HBcAg polypeptides containing or, alternatively, essentially consisting of, or, alternatively, consisting of amino acid sequences that are at least 80%, 85%, 90% , 95%, 97% or 99% are identical to the shortened mutants described above.

In some embodiments of the invention, a lysine residue is introduced into the HBcAg polypeptide to mediate the binding of the protein or peptide of IL-5, IL-13, or eotaxin to the HBcAg VLP. In preferred embodiments, the compositions of the invention are prepared using HBcAg containing or alternatively consisting of amino acids 1-144 or 1-149, 1-185 of SEQ ID NO: 77, which is modified so that the amino acids corresponding to positions 79 and 80 are replaced by a peptide having the amino acid sequence Gly-Gly-Lys-Gly-Gly (SEQ ID NO: 78). In further preferred embodiments, cysteine residues at positions 48 and 107 of SEQ ID NO: 77 are mutated into serine. The invention also includes compositions containing the corresponding polypeptides having the amino acid sequences shown in any of SEQ ID NOS: 29-74, which also have the above amino acid changes. In addition, additional HBcAg variants that are capable of associating with capsid or VLP formation and have the above amino acid changes are included in the scope of the invention. Thus, the invention also includes compositions and, accordingly, vaccine compositions containing HBcAg polypeptides that contain or, alternatively, consist of amino acid sequences that are at least 80%, 85%, 90%, 95% , 97% or 99% are identical to any of the wild-type amino acid sequences, and the forms of these proteins, which were processed in suitable cases to remove the N-terminal leader sequence, and modified by the above changes.

Compositions or vaccine compositions according to the invention may contain mixtures of different HBcAg. Thus, these vaccine compositions may consist of HBcAg, which differ in amino acid sequence. For example, vaccine compositions containing wild-type HBcAg and modified HBcAg can be prepared in which one or more amino acid residues have been altered (eg, deleted, inserted, or replaced). In addition, preferred vaccine compositions according to the invention are compositions that are a highly ordered and repeating antigenic matrix in which the antigen is an IL-5, IL-13 or eotaxin protein or peptide.

In a further preferred embodiment of the invention, at least one protein or peptide of IL-5, IL-13, or eotaxin is bound to said central particle and, accordingly, a virus-like particle of at least one covalent bond. Preferably, at least one protein or peptide of IL-5, IL-13, or eotaxin is bound to a central particle and, accordingly, to a virus-like particle of at least one covalent bond, said covalent bond being a non-peptide bond, which leads to the formation of an ordered and a repeating matrix of a central particle-protein or peptide of IL-5, IL-13 or eotaxin and, respectively, of a matrix or conjugate of a protein or peptide of IL-5, IL-13 or eotaxin with VLP. This matrix or, accordingly, the conjugate protein or peptide of IL-5, IL-13 or eotaxin with VLP usually and preferably has a repeating and ordered structure, since at least one, but usually several proteins or peptides of IL-5, IL-13 or eotaxin are associated with VLP in an oriented manner. Preferably, more than 10, 20, 40, 80, 120 proteins or peptides of IL-5, IL-13, or eotaxin are associated with the VLP or VLP subunit. The formation of a repeating and ordered matrix or, accordingly, conjugate of a protein or peptide of IL-5, IL-13 or eotaxin is provided by oriented and directed, as well as certain binding and, accordingly, the addition of at least one protein or peptide of IL-5, IL-13 or eotaxin to VLP, as will be understood from the following. In addition, the usual inherent, highly repeating and organized structure of VLPs predominantly contributes to the exposure of the protein or peptide of IL-5, IL-13 or eotaxin in a highly ordered and repeating manner, leading to the formation of a highly organized and repeating matrix and, accordingly, conjugate of the protein or peptide IL-5, IL-13, or eotaxin.

Thus, preferred conjugates and, accordingly, matrices according to the invention differ from prior art conjugates in their highly organized structure, size and repeatability of the antigen on the matrix surface. A preferred embodiment of the invention furthermore allows the expression of both the particle and the antigen in the expression host, ensuring proper packaging of the antigen, i.e. at least one protein or peptide of IL-5, IL-13, or eotaxin, and proper packaging and assembly of the VLP.

The present invention provides methods for binding a protein or peptide of IL-5, IL-13, or eotaxin to central particles and, accordingly, to VLP. As indicated in one aspect of the invention, the protein or peptide of IL-5, IL-13, or eotaxin is bound to the central particle and, accordingly, to the VLP by chemical crosslinking, usually and preferably using a heterobifunctional crosslinking agent. Several heterobifunctional cross-linking agents are known in the art. In preferred embodiments, the heterobifunctional cross-linking agent contains a functional group that can interact with preferred first binding sites, i.e. with the amino group of the side chain of the lysine residues of the central particle and the VLP or at least one VLP subunit, respectively, and an additional functional group that can interact with a preferred second binding site, i.e. a naturally-occurring cysteine residue that is made available for reaction by reduction or engineered on a protein or peptide of IL-5, IL-13 or eotaxin and optionally also made available for reaction by reduction. The first step of the process, commonly called derivatization, is the interaction of a central particle or VLP with a cross-linking agent. The product of this reaction is an activated core particle or activated VLP, also called an activated carrier. In a second step, unreacted cross-linking agent is removed using conventional methods such as gel filtration or dialysis. In a third step, an IL-5, IL-13 or eotaxin protein or peptide is reacted with an activated carrier, and this step is commonly referred to as the binding step. Unreacted protein or peptide of IL-5, IL-13, or eotaxin can optionally be removed in a fourth step, for example, by dialysis. Several heterobifunctional cross-linking agents are known in the art. These agents include preferred cross-linking agents SMPH (Pierce), sulfo-MBS, sulfo-EMCS, sulfo-GMBS, sulfo-SIAB, sulfo-SMPB, sulfo-SMCC, SVSB, SIA and other cross-linking agents available, for example, from Pierce Chemical Company (Rockford, IL, USA), and having one functional group reactive with amino groups and one functional group reactive with cysteine residues. All of the above cross-linking agents lead to the formation of a thioether bond. Another class of cross-linking agents suitable for the practice of the invention is characterized by the introduction of a disulfide bond between the protein or peptide of IL-5, IL-13 or eotaxin and the central particle or VLP upon binding. Preferred cross-linking agents of this class include, for example, SPDP and sulfo-LC-SPDP (Pierce). The degree of derivatization of the central particle and, accordingly, the VLP cross-linking agent can be influenced by various experimental conditions, such as the concentration of each of the reaction partners, the excess of one reagent compared to another, pH, temperature and ionic strength. The degree of binding, i.e. the amount of protein or peptide IL-5, IL-13, or eotaxin per subunit of the central particle and, accordingly, VLP, can be adjusted by various experimental conditions described above to ensure compliance with vaccine requirements. The solubility of an IL-5, IL-13 or eotaxin protein or peptide may limit the amount of an IL-5, IL-13 or eotaxin protein or peptide that can be associated with each subunit, and in cases where the resulting vaccine may be insoluble, it may be beneficial to reduce the amount of protein or peptide of IL-5, IL-13, or eotaxin per subunit.

A particularly preferred method for binding a protein or peptide of IL-5, IL-13, or eotaxin to a central particle and, accordingly, to VLP is to bind a lysine residue on the surface of the central particle and, accordingly, VLP to a cysteine residue on a protein or peptide of IL-5, IL -13 or eotaxin. Thus, in a preferred embodiment of the invention, the first binding site is a lysine residue, and the second binding site is a cysteine residue. In some embodiments, it may be necessary to construct an amino acid linker containing a cysteine residue, as a second binding site or as part of it, to an IL-5, IL-13 or eotaxin protein or peptide for binding to a central particle and, accordingly, to VLP. Alternatively, cysteine can be introduced into the protein or peptide of IL-5, IL-13, or eotaxin, either by insertion or mutation. Alternatively, a cysteine residue or thiol group may be introduced by chemical coupling.

The choice of amino acid linker will depend on the nature of the antigen and, accordingly, autoantigen, i.e. from the nature of the protein or peptide IL-5, IL-13 or eotaxin, from its biochemical properties such as pI, charge distribution and glycosylation. In general, flexible amino acid linkers are preferred. Preferred amino acid linker variants are selected from the group consisting of (a) CGG; (b) N-terminal linker gamma 1; (c) an N-terminal gamma-3 linker; (d) hinge sections of Ig; (e) N-terminal glycine linkers; (f) (G) _k C (G) _n for n = 0-12 and k = 0-5; (g) N-terminal glycine-serine linkers; (h) (G) _k C (G) _m (S) _l (GGGGS) _n for n = 0-3, k = 0-5, m = 0-10, l = 0-2; (i) GGC; (k) GGC-NH2; (l) C-terminal linker gamma 1; (m) C-terminal linker gamma 3; (n) C-terminal glycine linkers; (o) (G) _n C (G) _k for n = 0-12 and k = 0-5; (p) C-terminal glycine-serine linkers; (q) (G) _m (S) _l (GGGGS) _n (G) _o C (G) _k at n = 0-3, k = 0-5, m = 0-10, l = 0-2 and o = 0-8.

Further preferred examples of amino acid linkers are the hinge region of immunoglobulins, glycine-serine linkers (GGGGS) _n and glycine linkers (G) _n , all of which, in addition, contain a cysteine residue as a second binding site and optionally additional glycine residues. Generally, preferred examples of said amino acid linkers are N-terminal gamma 1: CGDKTHTSPP; C-terminal gamma 1: DKTHTSPPCG; N-terminal gamma 3: CGGPKPSTPPGSSGGAP; C-terminal gamma 3: PKPSTPPGSSGGAPGGCG; N-terminal glycine linker: GCGGGG; C-terminal glycine linker: GGGGCG; C-terminal glycine-lysine linker: GGKKGC; N-terminal glycine-lysine linker: CGKKGG.

In a further preferred embodiment of the present invention, and in particular when the antigen is an IL-5, IL-13 or eotaxin peptide, GGCG, GGC or GGC-NH2 linkers are preferred as amino acid linkers (“NH2” means amidation) at the C-terminus of a peptide or CGG at its N-terminus. In general, glycine residues will be inserted between the bulk of the amino acids and the cysteine used as the second binding site in order to avoid possible steric interference from the bulk amino acids in the binding reaction.

The cysteine residue present on the protein or peptide of IL-5, IL-13 or eotaxin must be in its reduced state in order to react with a heterobifunctional cross-linking agent on the activated VLP, i.e. free cysteine or a cysteine residue with a free sulfhydryl group must be available . In the case where the cysteine residue to function as a binding site is in an oxidized form, for example, if it forms a disulfide bridge, restoration of the indicated disulfide bridge is required, for example, using DTT, TCEP or β-mercaptoethanol.

The binding of a protein or peptide of IL-5, IL-13 or eotaxin to a central particle or, respectively, to VLP using a heterobifunctional cross-linking agent according to the preferred methods described above allows the binding of a protein or peptide of IL-5, IL-13 or eotaxin to a central particle and, accordingly, with VLP in an oriented manner. Other methods for binding a protein or peptide of IL-5, IL-13 or eotaxin to a central particle and, accordingly, to VLP include methods in which the protein or peptide of IL-5, IL-13 or eotaxin is cross-linked with the central particle and, respectively, with VLP using carbodiimide, EDC and NHS. A protein or peptide of IL-5, IL-13, or eotaxin can also first be thiolated during the reaction, for example, with SATA, SATP, or iminothiolan. Then, the protein or peptide of IL-5, IL-13 or eotaxin, if necessary, after deprotection can be associated with the central particle and, accordingly, VLP as follows. After separation of the excess reagent for thiolation, the protein or peptide of IL-5, IL-13, or eotaxin interacts with the central particle and, accordingly, with VLP, pre-activated by a heterobifunctional cross-linking agent, containing a cysteine-reactive residue and, therefore, exhibiting at least one or more functional groups that react with cysteine residues with which a thiolated protein or peptide of IL-5, IL-13, or eotaxin, such as described above, can react neck. Optionally, small amounts of a reducing agent may be included in the reaction mixture. In the following methods, a protein or peptide of IL-5, IL-13, or eotaxin is bound to the central particle and, accordingly, to the VLP using a homobifunctional cross-linking agent such as glutaraldehyde, DSG, BM [PEO] ₄ , BS ³ (Pierce Chemical Company , Rockford, IL, USA) or other known homobifunctional cross-linking agents with functional groups reacting with amino groups or carboxyl groups of the central particle and, accordingly, VLP.

In a further embodiment, the protein or peptide of IL-5, IL-13 or eotaxin is bound to the central particle and, accordingly, to VLP by modifying the carbohydrate residues present on the glycosylated protein or peptide of IL-5, IL-13 or eotaxin, and subsequent interaction with central particle and, accordingly, with VLP. In one embodiment, a glycosylated protein or peptide of IL-5, IL-13, or eotaxin is reacted with sodium periodate under the conditions of a mild oxidation reaction of the carbohydrate residue to produce an activated protein or peptide of IL-5, IL-13, or eotaxin with one or more aldehyde functional groups . Thus activated protein or peptide of IL-5, IL-13 or eotaxin is separated from the excess sodium periodate and then subjected to interaction with the central particle and, accordingly, with VLP, in which the lysine residues of the central particle and, accordingly, VLP or at least one VLP subunits interact with a previously formed aldehyde functional group on an IL-5, IL-13 or eotaxin protein or peptide, for example, as described by Hermanson, GT at Bioconjugate Techniques, Academic Press Inc., San Diego, CA, USA. The self-polymerization of the activated protein or peptide of IL-5, IL-13, or eotaxin can be controlled by adjusting the pH as described in the above publication. The Schiff base formed is preferably further reduced with sodium cyanoborohydride, which is then removed by gel filtration or dialysis. Alternatively, the central particle and, accordingly, VLP and EDC can interact with the carboxyl groups of the central particle and, accordingly, VLP or at least one VLP subunit and a dihydrazide, such as adipic acid dihydrazide, to obtain a hydrazide residue available for interaction with one or more aldehyde functional groups present on an activated protein or peptide of IL-5, IL-13 or eotaxin. The hydrazone thus formed can then be reduced with sodium cyanoborohydride. Alternatively, an activated protein or peptide of IL-5, IL-13, or eotaxin with one or more aldehyde functional groups is reacted with cysteamine, resulting in the introduction of a cysteine group into a protein or peptide of IL-5, IL-13, or eotaxin. Additional cross-linking methods and cross-linking agents suitable for binding of a protein or peptide of IL-5, IL-13 or eotaxin to a central particle and, accordingly, to VLP, as well as guidance on the implementation of binding reactions and the use of chemical cross-linking agents and chemical methods cross stitching can be found in Hermanson, GT in Bioconjugate Techniques, Academic Press Inc., San Diego, CA, USA.

Other methods of binding VLP to a protein or peptide of IL-5, IL-13 or eotaxin include methods in which the central particle and, accordingly, VLP are biotinylated and the protein or peptide of IL-5, IL-13 or eotaxin is expressed as a protein fused with streptavidin, or methods in which biotinylate both a protein or peptide of IL-5, IL-13 or eotaxin, and a central particle and, accordingly, VLP, for example, as described in WO 00/23955. In this case, the protein or peptide of IL-5, IL-13, or eotaxin can first be bound to streptavidin or avidin, adjusting the ratio of the protein or peptide of IL-5, IL-13, or eotaxin to streptavidin so that free binding sites are still available for binding the central particle and, accordingly, the VLP, which is added in the next stage. Alternatively, all components may be mixed in a “single vessel” reaction. Other ligand-receptor pairs where there is a soluble form of the receptor and ligand and which are capable of crosslinking with the central particle and, accordingly, with the VLP or protein or peptide of IL-5, IL-13 or eotaxin, can be used as binding agents for binding protein or peptide IL-5, IL-13 or eotaxin with a central particle and, accordingly, with VLP. Alternatively, either the ligand or the receptor can be fused to a protein or peptide of IL-5, IL-13, or eotaxin and thus mediate binding to the central particle and, accordingly, to the VLP chemically bound or fused to either the receptor or the ligand, respectively . Merging can also be accomplished by insertion or replacement.

As already mentioned, in a preferred embodiment of the present invention, the VLP is the VLP of the RNA phage, and in a more preferred embodiment, the VLP is the VLP of the Qβ RNA phage coat protein.

One or more antigen molecules, i.e. a protein or peptide of IL-5, IL-13, or eotaxin, can be linked to a single subunit of the capsid or VLP of the RNA phage coat proteins, preferably via exposed lysine residues of the VLP RNA phages, if sterically permissible. Thus, a special feature of the VLP coat proteins of RNA phages and, in particular, the VLP coat protein Qβ is the ability to bind several antigens to the subunit. This allows the formation of a dense antigenic matrix.

In a preferred embodiment of the invention, the binding and, accordingly, the attachment of at least a protein or peptide of IL-5, IL-13 or eotaxin to the central particle and, accordingly, virus-like particle is carried out by interaction and, accordingly, association between at least one first site binding of a virus-like particle and at least one second binding site of an antigen or antigenic determinant.

VLP or capsids from the Qβ coating protein expose a certain amount of lysine residues on its surface with a specific topology, with three lysine residues directed inside the capsid and interact with RNA, and four other lysine residues exposed on the outside of the capsid. These specific properties are preferred for binding of antigens to the outside of the particle, rather than from the inside of the particle, where lysine residues interact with RNA. VLPs from other covering RNA phage proteins also have a certain amount of lysine residues on their surface and a specific topology of these lysine residues.

In further preferred embodiments of the invention, the first binding site is a lysine residue and / or the second binding site contains a sulfhydryl group or a cysteine residue. In a very preferred embodiment of the present invention, the first binding site is a lysine residue, and the second binding site is a cysteine residue.

In very preferred embodiments, the protein or peptide of IL-5, IL-13, or eotaxin is linked via a cysteine residue, either naturally occurring on the protein or peptide of IL-5, IL-13, or eotaxin, or constructed with the lysine residues of the VLP coat RNA- protein phage and, in particular, VLP of the Qβ coat protein.

Another advantage of VLPs derived from RNA phages is the high yield of their expression in bacteria, which allows large quantities of material to be obtained at an affordable cost.

As indicated, the conjugates and matrices, respectively, according to the invention differ from the prior art conjugates in their highly organized structure, size and repeatability of the antigen on the matrix surface. In addition, the use of VLP as carriers allows the formation of strong antigenic matrices and conjugates, respectively, with a variable density of antigens. In particular, the use of VLP of RNA phages, and thus, in particular, the use of VLP of the Qβ RNA phage coat protein, allows for a very high epitope density. Obtaining compositions of VLP coating proteins of RNA phages with a high density of epitopes can be carried out using the instructions provided in this application.

Either a natural or non-natural second binding site, as defined herein, may be present on an antigen or antigenic determinant. In the absence of a suitable second binding site of natural origin on the antigen or antigenic determinant, it is necessary to construct a non-natural second binding site on the antigen.

As described above, four lysine residues are exposed on the surface of the VLP of the Qβ coat protein. Typically, such residues are derivatized during a reaction with a cross-linking molecule. In the case where not all exposed lysine residues can be associated with an antigen, lysine residues that have reacted with a cross-linking agent remain with the cross-linking molecule bound to the ε-amino group after the derivatization step. This results in the disappearance of one or more positive charges, which may be undesirable for the solubility and stability of the VLP. By replacing some lysine residues with arginines, as in the claimed mutants of the Qβ coating protein described below, the authors prevented the positive charges from disappearing excessively, since the arginine residues do not interact with the cross-linking agent. In addition, replacing lysine residues with arginines can lead to a more specific antigenic matrix, since fewer sites are available for reaction with the antigen.

Thus, the exposed lysine residues were replaced with arginines in the following Qβ coating protein mutants and Qβ mutant VLPs described in this application: Qβ-240 (Lys13-Arg; SEQ ID NO: 23), Qβ-250 (Lys 2-Arg, Lys13- Arg; SEQ ID NO: 25) and Qβ-259 (Lys 2-Arg, Lys16-Arg; SEQ ID NO: 27). The constructs were cloned, proteins were expressed, VLP was purified and used to bind to peptide and protein antigens. Qβ-251 was also designed (SEQ ID NO: 26), and guidance on how to express, purify and bind the VLP of the Qβ-251 coat protein can be found throughout this application.

In a further embodiment, the authors proposed a mutant coating protein Qβ with one additional lysine residue, suitable for obtaining an antigen matrix with an even higher density. This mutant Qβ coating protein, Qβ-243 (Asn 10-Lys; SEQ ID NO: 24) was cloned, the protein was expressed, and the capsid or VLP was isolated and purified, showing that the addition of an additional lysine residue was compatible with self-assembly of the subunits in capsid or VLP. Thus, matrices and, accordingly, conjugates of a protein or peptide of IL-5, IL-13, or eotaxin can be obtained using VLP mutants of the Qβ coat protein. A particularly preferred method for binding antigens to VLPs, and in particular to VLPs of RNA phage coat proteins, is to bind a lysine residue present on the surface of the VLPs of RNA phage coat proteins with a cysteine residue naturally present or engineered on an antigen, i.e. a protein or peptide of IL-5, IL-13, or eotaxin. In order for the cysteine residue to be effective as a second binding site, the sulfhydryl group must be available for binding. Thus, the cysteine residue must be in its reduced state, that is, free cysteine or a cysteine residue with a free sulfhydryl group must be available. In the case where the cysteine residue for functioning as the second binding site is in an oxidized form, for example, if it forms a disulfide bridge, the indicated disulfide bridge must be restored, for example, using DTT, TCEP or β-mercaptoethanol. The concentration of the reducing agent and the molar excess of the reducing agent compared to the antigen should be specified for each antigen. If necessary, test the titration limits, starting from such low concentrations of the reducing agent as 10 μM or lower, to 10-20 mm or higher and evaluate the binding of antigen to the carrier. Although low concentrations of reducing agent are compatible with the binding reaction, as described in pending U.S. Patent Application No. 10/050902, filed by this assignee on January 18, 2002, higher concentrations inhibit the binding reaction, as will be understood by a person skilled in the art, in which case the reducing agent must be removed by dialysis or gel filtration. Advantageously, the pH of the dialysis or equilibration buffer is below 7, preferably 6. The compatibility of the low pH buffer with antigen activity and stability should be checked.

The density of the epitope on the VLP of the coating proteins of the RNA phage can be modulated by choosing a cross-linking agent and other reaction conditions. For example, cross-linking agents sulfo-GMBS and SMPH usually provide high epitope densities. Derivatization is positively affected by a high concentration of reactants, and manipulation of the reaction conditions can be used to control the amount of antigens associated with the VLP of the RNA phage coat proteins and, in particular, with the Vβ coat protein Qβ.

Before constructing a non-natural second binding site, it is necessary to choose the position in which it should be merged, integrated, or, in general, constructed. The selection of the position of the second binding site as an example may be based on the crystal structure of the antigen. Such a crystal structure of the antigen can provide information on the availability of the C- or N-ends of the molecule (determined, for example, based on their availability to the solvent) or on exposure to the solvent of residues suitable for use as second binding sites, such as cysteine residues . Exposed disulfide bridges, as in the case of Fab fragments, can also be a source of a second binding site, since they can usually be converted into individual cysteine residues through moderate recovery. Moderate recovery conditions will be selected that do not affect the immunogenicity of the protein or peptide of IL-5, IL-13, or eotaxin. In general, when the goal of immunization with an autoantigen is to inhibit the interaction of a given autoantigen with its natural ligands, a second binding site will be added so that it allows the formation of antibodies against the interaction site with natural ligands. Thus, the position of the second binding site will be chosen so as to avoid steric interference from the second binding site or any amino acid linker containing it. In the following embodiments, a humoral response is required directed to a site other than the site of interaction of the autoantigen with its natural ligand. In such embodiments, the second binding site can be chosen so that it prevents the formation of antibodies against the site of interaction of the autoantigen with its natural ligands.

Other criteria for choosing the position of the second binding site include the antigen oligomerization state, the oligomerization site, the presence of a cofactor, and the presence of experimental evidence for the detection of sites in the antigen structure and the sequence in which the modification of the antigen is compatible with the function of autoantigen or with the formation of antibodies that recognize autoantigen.

In most preferred embodiments, the IL-5, IL-13 or eotaxin protein or peptide contains a single second binding site or a single reactive binding site capable of association with the first binding sites on the central particle and VLP or VLP subunits, respectively. This provides a certain and uniform binding and, accordingly, the association of at least one, but usually several, preferably more than 10, 20, 40, 80, 120, antigens with the central particle and VLP, respectively. Thus, providing one second binding site or one reactive antigen binding site provides one type of uniform binding and association, respectively, resulting in a very highly ordered and repeating matrix. For example, if the binding and association, respectively, is carried out through the interaction of lysine (as the first binding site) and cysteine (as the second binding site), then, according to this preferred embodiment of the invention, it is guaranteed that only one cysteine residue per antigen, regardless whether a given cysteine residue of natural or non-natural origin is present on the antigen is able to bind and associate, respectively, with VLP and the first binding site of the central particle, respectively governmental.

In some embodiments, the construction of a second binding site on an antigen requires the fusion of an amino acid linker containing an amino acid suitable as a second binding site according to the descriptions of this invention. Thus, in a preferred embodiment of the invention, the amino acid linker is coupled to an antigen or antigenic determinant via at least one covalent bond. Preferably, the amino acid linker contains or, alternatively, consists of a second binding site. In a further preferred embodiment, the amino acid linker contains a sulfhydryl group or a cysteine residue. In another preferred embodiment, the amino acid linker is cysteine. Some criteria for the selection of the amino acid linker, as well as additional preferred variants of the amino acid linker according to the invention are already indicated above.

In a further preferred embodiment of the invention, at least one antigen or antigenic determinant, i.e. a protein or peptide of IL-5, IL-13, or eotaxin is fused to a central particle and a virus-like particle, respectively. As indicated above, a VLP typically consists of at least one subunit assembled in a VLP. Thus, again in a further preferred embodiment of the invention, the antigen or antigenic determinant, preferably at least one protein or peptide of IL-5, IL-13 or eotaxin, is fused to at least one subunit of the virus-like particle or protein that can be included in the VLP, with the formation of the chimeric fusion of the VLP-subunit-protein or peptide of IL-5, IL-13 or eotaxin.

The fusion of a protein or peptide of IL-5, IL-13, or eotaxin can be accomplished by insertion into the sequence of the VLP subunit or by fusion with either the N- or C-terminus of the VLP subunit or protein that can be incorporated into the VLP. Hereinafter, when referring to fusion proteins of a peptide with a VLP subunit, it is meant to merge either at the ends of the subunit sequence, or internal insertion of the peptide into the subunit sequence.

Merging can also be accomplished by inserting the sequences of a protein or peptide of IL-5, IL-13, or eotaxin into a variant of the VLP subunit, where part of the subunit sequence has been deleted, the resulting products are hereinafter referred to as truncated mutants. The truncated mutants may have N- or C-terminal or internal deletions of part of the VLP subunit sequence. For example, a particular HBcAg VLP, for example, with a deletion of amino acid residues 79 to 81, is a truncated mutant with an internal deletion. The fusion of a protein or peptide of IL-5, IL-13, or eotaxin with either the N- or C-terminus of the truncated VLP subunit mutants also leads to the formation of variants according to this invention. Similarly, fusion of an epitope with a VLP subunit sequence can also be accomplished by substitution, in which, for example, for a particular HBcAg VLP, amino acids 79-81 are replaced with a foreign epitope. Thus, the fusion, which is mentioned later, can be accomplished by inserting the sequence of a protein or peptide of IL-5, IL-13 or eotaxin into the sequence of the VLP subunit by replacing part of the sequence of the VLP subunit with the sequence of the protein or peptide of IL-5, IL-13 or eotaxin or by combining a deletion, replacement or insertion.

Chimeric constructs of a protein or peptide of IL-5, IL-13, or an eotaxin subunit will typically be capable of self-assembly in VLP. VLPs exhibiting epitopes fused to their subunits are also referred to herein as chimeric VLPs. As indicated, a virus-like particle contains or, alternatively, consists of at least one VLP subunit. In a further embodiment of the invention, the virus-like particle contains or, alternatively, consists of a mixture of chimeric VLP subunits and non-chimeric VLP subunits, i.e. VLP subunits lacking antigen fused with them, resulting in the so-called mosaic particles. This may have advantages for providing education and assembly in VLP. In these embodiments, the proportion of chimeric VLP subunits can be 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95% or more.

Flanking amino acid residues can be added to either end of the sequence of the peptide or epitope that needs to be fused to either end of the VLP subunit sequence, or for internal insertion of such a peptide sequence into the VLP subunit sequence. Glycine and serine residues are particularly preferred amino acids for use in flanking sequences added to the protein or peptide of IL-5, IL-13, or eotaxin to be fused. Glycine residues give additional flexibility, which can reduce the possible destabilizing effect of the fusion of a foreign sequence into the sequence of the VLP subunit.

In a specific embodiment, the VLP is the VLP of hepatitis B core antigen. Fusion proteins are described either with the N-terminus of HBcAg (Neyrinck, S. et al., Nature Med. 5: 1157-1163 (1999)), or insertion into the so-called basic immunodominant region (MIR) (Pumpens, P. and Grens, E., Intervirology 44: 98-114 (2001)), WO 01/98333), and these mergers are preferred variants of the invention. Also described are variants of naturally occurring HBcAgs with deletions in MIR (Pumpens, P. and Grens, E., Intervirology 44: 98-114 (2001), the publication is specifically incorporated by reference in full), and mergers with N- or C- end, as well as insertion at the MIR position corresponding to the deletion site compared to wild-type HBcAg, are further embodiments of the invention. C-terminal fusions are also described (Pumpens, P. and Grens, E., Intervirology 44: 98-114 (2001)). One skilled in the art will easily find guidance on how to construct fusion proteins using classical molecular biology techniques (Sambrook, J. et al., Eds., Molecular Cloning, A Laboratory Manual, 2nd. Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989), Ho et al., Gene 77:51 (1989)). Vectors and plasmids encoding HBcAg and HBcAg fusion proteins and useful for the expression of HBcAg and HBcAg fusion proteins are described (Pumpens, P. and Grens, E. Intervirology 44: 98-114 (2001), Neyrinck, S. et al., Nature Med 5: 1157-1163 (1999)), which can be used in the practice of the invention. The authors also described, by way of example (Example 6), the insertion of an epitope into HBcAg MIR, resulting in a chimeric self-assembly of HBcAg. An important factor for optimizing the efficiency of self-assembly and exposure of the epitope embedded in HBcAg MIR is the choice of insertion site, as well as the number of amino acids that must be deleted from the HBcAg sequence in MIR (Pumpens, P. and Grens, E., Intervirology 44: 98-114 (2001); EP 421635; US patent 6231864) at insertion, in other words, which amino acids from HBcAg need to be replaced with a new epitope. For example, the replacement of HBcAg amino acids 76-80, 79-81, 79-80, 75-85 or 80-81 with foreign epitopes is described (Pumpens, P. and Grens, E., Intervirology 44: 98-114 (2001); EP 0421635 ; US patent 6231864). HBcAg contains a long arginine tail (Pumpens, P. and Grens, E., Intervirology 44: 98-114 (2001)), which is not essential for capsid assembly and is capable of binding nucleic acids (Pumpens, P. and Grens, E ., Intervirology 44: 98-114 (2001)). HBcAg, either containing arginine tail or not having one, are variants of the invention.

In a further preferred embodiment of the invention, the VLP is the VLP of an RNA phage. The main covering proteins of RNA phages spontaneously assemble in VLP when expressed in bacteria and, in particular, in E. coli. Specific examples of bacteriophage coat proteins that can be used to make compositions of the invention include bacteriophage RNA coat proteins such as the Qβ bacteriophage (SEQ ID NO: 10; PIR Database, Inventory No. VCBPQβ Relating to CP Qβ, and SEQ ID NO: 11; Inventory No. AAA16663 relating to Qβ Protein A1) and bacteriophage fr (SEQ ID NO: 4; PIR, Inventory No. VCBPFR).

In a more preferred embodiment, at least one protein or peptide of IL-5, IL-13, or eotaxin is fused to the Qβ coat protein. Fusion protein constructs are described in which epitopes are fused to the C-terminus of the shortened form of A1 Qβ protein or inserted into A1 protein (Kozlovska, T. M. et al., Intervirology, 39: 9-15 (1996)). Protein A1 is formed by suppression in the UGA stop codon and has a length of 329 a / k or 328 a / k, if we take into account the cleavage of the N-terminal methionine. Cleavage of the N-terminal methionine in front of alanine (the second amino acid encoded by the CP Qβ gene) usually occurs in E. coli, and this is the case for the N-terminus of the covering protein Q Qβ. The portion of the A1 gene on the 3 ′ side of the UGA amber codon encodes a CP extension that is 195 amino acids in length. The insertion of at least one protein or peptide of IL-5, IL-13, or eotaxin between positions 72 and 73 of the CP extension leads to the formation of the following variants according to the invention (Kozlovska, T. M. et al., Intervirology 39: 9-15 (1996)). The fusion of a protein or peptide of IL-5, IL-13, or eotaxin with the C-terminus of a Qβ protein shortened at the C-terminus leads to the formation of the following preferred variants according to the invention. For example, Kozlovska et al. (Intervirology, 39: 9-15 (1996)) described fusion of A1 Qβ protein in which the epitope is fused to the C-terminus of CP Qβ extension shortened at position 19.

As described by Kozlovska et al. (Intervirology, 39: 9-15 (1996)), the assembly of particles exhibiting fused epitopes typically requires the presence of both fusion protein A1-protein or peptide IL-5, IL-13 or eotaxin, and wild-type CP to form a mosaic particle. However, variants containing virus-like particles, and thus, in particular, the VLP of the Qβ RNA phage coat protein, which consist exclusively of VLP subunits having at least one protein or IL-5, IL-13 or eotaxin peptide fused to them are also included in the scope of this invention.

Obtaining mosaic particles can be carried out in a number of ways. Kozlovska et al., Intervirolog., 39: 9-15 (1996) describe two methods that can both be used in the practice of the invention. In the first method, efficient exposure of the fused epitope to VLP is mediated by expression of a plasmid encoding the fusion of A1 Qβ protein having a UGA stop codon between CP and CP extension in an E. coli strain carrying a plasmid encoding a cloned UGA suppressor tRNA that translates UGA codon in Trp (plasmid pISM3001 (Smiley BK et al., Gene 134: 33-40 (1993))). In another method, the stop codon of the CP gene is modified in UAA and cotransfected with a second plasmid expressing the fusion of protein A1 with protein or peptide IL-5, IL-13 or eotaxin. The second plasmid encodes resistance to various antibiotics, and the onset of replication is compatible with the first plasmid (Kozlovska, T. M. et al., Intervirology 39: 9-15 (1996)). In a third method, CP and fusion of protein A1 with a protein or peptide of IL-5, IL-13, or eotaxin are encoded in a bicistronic manner when operatively linked to a promoter such as a Trp promoter, as described in FIG. 1 in Kozlovska et al., Intervirology, 39 : 9-15 (1996).

In a further embodiment, a protein or peptide of IL-5, IL-13, or eotaxin is inserted between amino acids 2 and 3 (CP numbering after cleavage, that is, when the N-terminal methionine is cleaved) CP fr, thereby obtaining a protein fusion protein or peptide IL-5, IL-13 or eotaxin-CP fr. Vectors and expression systems for the construction and expression of CP fr fusion proteins self-assembled in VLP and applicable in the practice of the invention are described (Pushko P. et al., Prot. Eng. 6: 883-891 (1993)). In a specific embodiment, the sequence of a protein or peptide of IL-5, IL-13, or eotaxin is inserted into the deletion variant CP fr after amino acid 2 when residues 3 and 4 of CP fr are removed (Pushko P. et al., Prot. Eng. 6: 883- 891 (1993)).

The fusion of epitopes with the N-terminal protruding β-hairpin of the covering RNA phage MS-2 protein and the subsequent presentation of the fusion epitope on the self-assembled VLP RNA phage MS-2 are also described (WO 92/13081), and the fusion of the protein or peptide IL- 5, IL-13 or eotaxin by insertion or substitution in the coating protein of the MS-2 RNA phage also falls within the scope of the invention.

In another embodiment, the protein or peptide of IL-5, IL-13, or eotaxin is fused to the papilloma virus capsid protein. In a more specific embodiment, the protein or peptide of IL-5, IL-13, or eotaxin is fused to the major protein of cattle papilloma virus L1 capsid L1 (BPV-1). Vectors and expression systems have been described for the construction and expression of BPV-1 fusion proteins in baculovirus / insect cell systems (Chackerian, B. et al., Proc. Natl. Acad. Sci. USA 96: 2373-2378 (1999), WO 00 / 23955). Substitution of amino acids 130-136 L1 BPV-1 protein or peptide IL-5, IL-13 or eotaxin leads to a fused protein L1 BPV-1 protein or peptide IL-5, IL-13 or eotaxin, which is a preferred embodiment of the invention. Cloning in a baculovirus vector and expression in baculovirus-infected Sf9 cells that can be used in the practice of the invention are described (Chackerian, B. et al., Proc. Natl. Acad. Sci. USA 96: 2373-2378 (1999), WO 00 / 23955). Purification of collected particles exhibiting an IL-5, IL-13, or eotaxin fusion protein or peptide can be accomplished in a number of ways, such as, for example, gel filtration or sucrose gradient ultracentrifugation (Chackerian, B. et al., Proc. Natl. Acad. Sci. USA 96: 2373-2378 (1999), WO 00/23955).

In a further embodiment of the invention, the protein or peptide of IL-5, IL-13, or eotaxin is fused to a Ty protein capable of being incorporated into Ty VLP. In a more specific embodiment, the protein or peptide of IL-5, IL-13, or eotaxin is fused to p1 or the capsid protein encoded by the TYA gene (Roth, J.F., Yeast 16: 785-795 (2000)). The yeast retrotransposons Ty1, 2, 3, and 4 are isolated from Saccharomyces cerevisiae, while the retrotransposon Tf1 is isolated from Schizosaccharomyces pombae (Boeke, JD and Sandmeyer, SB, “Yeast Transposable elements” in The molecular and Cellular Biology of the Yeast Saccharomyces: Protein Synthesis, and Energetics., P. 193, Cold Spring Harbor Laboratory Press (1991)). Retrotransposons Ty1 and 2 are related to the copia class of plant and animal elements, while Ty3 belongs to the gypsy family of retrotransposons that are related to plant and animal retroviruses. In the Ty1 retrotransposon, the p1 protein, also called Gag or capsid protein, has a length of 440 amino acids. P1 is cleaved during VLP maturation at position 408, giving p2 protein, an important component of VLP.

Protein fusion proteins and vectors for expressing said fusion proteins in yeast are described (Adams, S.E. et al., Nature 329: 68-70 (1987)). Thus, for example, a protein or peptide of IL-5, IL-13, or eotaxin can be fused to p1 by inserting a sequence encoding a protein or peptide of IL-5, IL-13, or eotaxin to the BamH1 site of pMA5620 plasmid (Adams, SE et al., Nature 329: 68-70 (1987)). Cloning of sequences encoding foreign epitopes in the pMA5620 vector results in the expression of fusion proteins containing amino acids 1-381 p1 Ty1-15 fused C-terminally with the N-terminus of the foreign epitope. Similarly, it is understood that the N-terminal fusion of an IL-5, IL-13 or eotaxin protein or peptide, or internal insertion into the p1 sequence or replacement of part of the p1 sequence is also within the scope of the invention. In particular, the insertion of an IL-5, IL-13 or eotaxin protein or peptide into the Ty sequence between amino acids 30-31, 67-68, 113-114 and 132-133 of the Ty p1 protein (EP0677111) gives preferred variants according to the invention.

Further VLPs suitable for fusion of a protein or peptide of IL-5, IL-13 or eotaxin are, for example, particles like retroviruses (WO 9630523), HIV Gag (Kang, YC et al, Biol. Chem. 380: 353-364 (1999)), Vigna mosaic virus (Taylor, KM et al., Biol. Chem. 380: 387-392 (1999)), VLP of parvovirus VP2 (Rueda, P. et al., Virology 263: 89-99 (1999 )), HBsAg (U.S. Patent 4,722,840, EP0020416B1).

Examples of chimeric VLPs suitable for practicing the invention are also the VLPs described in Intervirology 39: 1 (1996). The following examples of VLP proposed for use in the invention are HPV-1, HPV-6, HPV-11, HPV-16, HPV-18, HPV-33, HPV-45, CRPV, COPV, HIV GAG, tobacco mosaic virus. Virus-like particles of SV-40, polyoma virus, adenovirus, herpes simplex virus, rotavirus and Norwalk virus were also obtained, and chimeric VLPs based on these VLPs are also included in the scope of this invention.

In a further preferred embodiment of the invention, the antigen or antigenic determinant is an IL-5, IL-13 or eotaxin protein or peptide.

In a further preferred embodiment, the antigen or antigenic determinant is a variant of an IL-5, IL-13 or eotaxin protein or peptide, for example, in particular, containing amino acid substitutions or insertions of peptides or polymorphisms. As already indicated, compositions and, accordingly, vaccine compositions containing variants of a protein or peptide of IL-5, IL-13 or eotaxin are included in the scope of this invention.

A protein or peptide of IL-5, IL-13 or eotaxin can be obtained by expression of cDNA of IL-5, IL-13 or eotaxin in prokaryotic or eukaryotic expression systems. Various examples thereof are described in the literature and can be used, possibly after modifications, to express any protein or peptide of IL-5, IL-13 or eotaxin of any desired type. A description of how to obtain the protein or peptide of IL-5 is also given in WO 900/65058 and in the references cited therein.

In a further preferred embodiment, the antigen or antigenic determinant is an IL-5, IL-13, or eotaxin peptide. Such IL-5, IL-13, or eotaxin peptides or fragments thereof can be obtained using standard molecular biology techniques in which the nucleotide sequence encoding the fragment of interest is amplified by PCR and cloned into a fusion with a polypeptide tag such as GST- tag, MBP tag, histidine tag, Flag tag, myc tag or constant region of the antibody (Fc region). By introducing a protease cleavage site between an IL-5, IL-13 or eotaxin fragment and a label, the peptide of IL-5, IL-13 or eotaxin can be separated from the label after purification by digesting with the appropriate protease. In another method, an IL-5, IL-13, or eotaxin protein or peptide can be synthesized in vitro using standard peptide synthesis reactions known to one skilled in the art. In the following method, the peptides of IL-5, IL-13 or eotaxin can be obtained by protease cleavage or chemical cleavage of the full-length protein IL-5, IL-13 or eotaxin, both methods are well known to specialists in this field.

In a further preferred embodiment of the invention, the antigen or antigenic determinant further comprises at least one second binding site selected from the group consisting of (i) a binding site of non-natural origin with said antigen or antigenic determinant and (ii) a natural binding site origin with the specified antigen or antigenic determinant. Guidance on how to modify a protein or peptide of IL-5, IL-13, or eotaxin for binding to a virus-like particle is given throughout this application. Preferred second binding sites contain a cysteine residue for binding to a derivatized VLP, and examples are given in the description above and in examples 12 and 13.

The authors conducted an analysis of the model of the 3-dimensional structure of IL-5 to determine the availability of the selected second binding site (NH ₂ end) to ensure binding to the first binding site on the VLP according to this invention. The N-terminus is preferred for binding of a second binding site containing an amino acid linker to an additional cysteine residue. However, an amino acid linker containing a cysteine residue as a second binding site and fused to the C-terminus of the IL-5 construct leads to the formation of the following preferred embodiment according to the invention. The construction of human IL-5 with an N-terminal amino acid linker containing fused to a cysteine L residue is a very preferred embodiment of the invention.

Similar methods can be used by one skilled in the art to model the availability of binding sites on IL-13 and eotaxin to optimize the binding of the first VLP binding site.

Designs of murine protein or peptide IL-5, IL-13 or eotaxin are described, but constructs of fragments of a protein or peptide of IL-5, IL-13 or human eotaxin can also be created. The following preferred constructs comprise a complete human IL-5, IL-13 or human eotaxin protein, IL-5, IL-13 or human eotaxin peptide. Immunization against a protein or peptide of IL-5, IL-13, or eotaxin using compositions of the invention, preferably containing a protein or peptide of IL-5, IL-13, or eotaxin, associated with VLP, can provide a method of treating or preventing allergic diseases with an eosinophilic component .

In a further preferred embodiment of the present invention, an IL-5, IL-13 or eotaxin protein or peptide contains at least one antigenic site of an IL-5, IL-13 or eotaxin protein. One skilled in the art knows how to identify the corresponding peptides and amino acid sequences, respectively.

A further preferred embodiment of the invention includes intermittent or continuous IL-5, IL-13 or eotaxin peptides, such as peptides determined by neutralizing monoclonal antibodies (Dickason, R. R. et al J. Immunol. 156 (3): 1030-7 1996).

A further preferred embodiment of the invention includes intermittent or continuous IL-5, IL-13, or eotaxin peptides, presumably involved in the interaction with the receptor and which are key for interaction with the receptor, such as peptides from the COO end of IL-5.

The following peptides of IL-5, IL-13 or eotaxin, suitable for use in this invention, can be determined experimentally by their inherent characteristic to induce a T-cell or humoral response. This is mainly accomplished by immunizing an experimental animal with individually selected peptides in an immunologically suitable composition and measuring T-cell and B-cell, i.e. a humoral response using methods known to one skilled in the art. In the case where the antigen is a protein or peptide, this region may be formed by a continuous amino acid sequence. Alternatively, an antibody epitope may be formed by a discontinuous amino acid sequence in which, after three-dimensional folding of a protein, polypeptide or peptide, the amino acids are arranged so that they spatially become closer to each other and form an epitope. Continuous peptide fragments of interest can be identified using the immunization experiments described above.

The following preferred peptides of IL-5, IL-13 or eotaxin, suitable for use in this invention, can be identified using existing or future monoclonal or polyclonal antibodies, methods for which this is known to specialists in this field.

The following peptides of IL-5, IL-13 or eotaxin suitable for use in this invention can be identified by screening peptide libraries in phage display using antibodies specific for the protein or peptide of IL-5, IL-13 or eotaxin, by the method well-known specialist in this field.

In a further preferred embodiment, the antigen or antigenic determinant is the isolated protein of IL-5, IL-13 or eotaxin of any animal, as well as any antigenic peptides of IL-5, IL-13 or eotaxin of any animal. Specialists in this field know how to obtain peptides from these selected proteins or peptides of IL-5, IL-13 or eotaxin.

In another preferred embodiment of the invention, the antigenic determinant is interleukin-13 (IL-13). IL-13 is a cytokine that is secreted by activated T-lymphocytes and mainly affects monocytes, macrophages and B-cells. The amino acid sequence of the human IL-13 precursor is shown in SEQ ID NO: 230, and the amino acid sequence of the processed human IL-13 is shown in SEQ ID NO: 231. The first 20 amino acids of the precursor protein correspond to the signal peptide and are absent in the processed protein. A murine sequence is described, and the processed amino acid sequence is shown in SEQ ID NO: 232 (Brown K. D. et al., J. Immunol. 142: 679-687 (1989)). Depending on the expression host, the IL-13 construct will contain a precursor protein sequence, for example, for expression and secretion in eukaryotic hosts, or consist of a mature protein, for example, for cytoplasmic expression in E. coli. For expression in the periplasm of E. coli, the IL-13 signal peptide is replaced with a bacterial signal peptide.

IL-13 is a cytokine produced by T-helpers 2 (like IL-4, IL-5), which has recently been shown to participate in allergic airway responses (asthma). Over-regulation of IL-13 and IL-13 receptor has been found in many types of tumors (e.g., Hodgkin lymphoma). Interleukin 13 is secreted and stimulates the growth of Hodgkin and Reed-Sternberg cells (Kapp U et al., J. Exp. Med. 189: 1939-46 (1999)). Thus, immunization against IL-13 provides a method of treating, among other things, the conditions described above, such as asthma or Hodgkin's lymphoma.

Preferably, the composition comprises an amino acid linker containing a free cysteine residue and fused to the N- or C-terminus of the mature IL-13 sequence in order to introduce a second binding site into the protein. In further preferred embodiments, an amino acid linker containing free cysteine is added to the N-terminus of the mature form of IL-13, as it is freely available according to the NMR structure of IL-13 (Eisenmesser, EZ et al., J. Mol. Biol. 310: 231 (2001)). In still further preferred embodiments, the amino acid linker containing free cysteine is fused to the N-terminus of the sequence corresponding to the sequence of the processed protein, or inserted into the N-terminus of the mature protein form of the C-terminal to the signal peptide. In further preferred embodiments, an amino acid linker containing a free cysteine residue is added to the C-terminus of the protein.

IL-13 can be expressed in E. coli (Eisenmesser EZ et al., Protein Expr. Purif 20: 186-95 (2000)) or in NS-0 cells (eukaryotic cell line) (Cannon-Carlson S. et al., Protein Expr. Purif. 12: 239-48 (1998)). Example 8 shows cloning and expression of constructs and purification of murine IL-13 fused to an amino acid linker containing a cysteine residue in bacteria. The example also describes the preparation and testing of the eotaxin-VLP vaccine. IL-13 constructs can be created according to the instructions of Example 8 and collecting human C-IL-13-F proteins (SEQ ID NO: 330) and human C-IL-13-S (SEQ ID NO: 331) after expression of fusion proteins and cleavage factor Xa and enterokinase, respectively. Proteins thus formed can be coupled to VLP and fimbriae, obtaining preferred variants according to the invention.

In yet another embodiment, the antigenic determinant is interleukin-5 (IL-5). IL-5 is a specific cytokine for the eosinophil production line and plays an important role in diseases associated with an increased number of eosinophils, such as asthma. The sequence of the precursor and the processed human IL-5 is shown in SEQ ID NO: 233 and SEQ ID NO: 234, respectively, and the processed mouse amino acid sequence is shown in SEQ ID NO: 235.

The biological function of IL-5 has been shown in several studies (Coffman RL et al., Science 245: 308-10 (1989); Kopf et al., Immunity 4: 15-24 (1996)), which draw attention to the beneficial effects of inhibition. IL-5 function in eosinophil-mediated diseases. Inhibition of the effects of IL-5 provides a treatment for asthma and other diseases associated with eosinophils.

IL-5 forms a dimer covalently linked by a disulfide bridge. A single chain (sc) construct has been reported in which two IL-5 monomers are linked by a peptide linker.

In preferred embodiments of the invention, a peptide linker containing free cysteine is added at the N-terminus of the sequence of the processed form of IL-5. It is also contemplated that a linker containing free cysteine is added to the N-terminus of the scIL-5 processed form sequence. In further preferred embodiments, the amino acid linker containing free cysteine is fused to the N-terminus of the sequence corresponding to the sequence of the processed protein, or inserted into the N-terminus of the mature form of the protein, C-terminal to the signal peptide.

In further preferred embodiments, the cysteine-free linker is fused to the C-terminus of the IL-5 sequence or the C-terminus of the scIL-5 sequence.

A number of expression systems for IL-5 have been described and can be used to prepare compositions of the invention. A bacterial expression system using E. coli is described by Proudfoot et al. (Biochem J. 270: 357-61 (1990)). When IL-5 is expressed in the E. coli cytoplasm, the IL-5 construct does not have a signal peptide. Insect cells can also be used to produce IL-5 constructs to create compositions of the invention (Pierrot C. et al., Biochem. Biophys. Res. Commun. 253: 756-60 (1998)). Baculovirus expression systems (sf9 cells; Ingley E. et al., Eur. J. Biochem. 196: 623-9 (1991), and Brown PM et al., Protein Expr. Purif. 6: 63- can also be used in a similar manner. 71 (1995)). Finally, mammalian expression systems (CHO cells) have been reported and can be used to prepare compositions of the invention (Kodama S et al., J. Biochem. (Tokyo) 110: 693-701 (1991)).

Baculovirus expression systems (Mitchell et al., Biochem. Soc. Trans. 21: 332S (1993); Kunimoto DY et al. Cytokine 3: 224-30 (1991)) and expression systems in mammalian cells using CHO cells (Kodama S . et al., Glycobiology 2: 419-27 (1992)) are also described for murine IL-5.

Examples 7 and 10 describe the expression, purification, binding to VLP, immunization and testing in a mouse model of experimental asthma the mouse IL-5 construct in which the mouse IL-5 sequence is fused with its N-terminus to amino acid linkers containing a cysteine residue to bind to VLP and Fimbriae. Human constructs can be created according to the instructions of examples 7 and 10 and collect proteins C-IL-5-E person (SEQ ID NO: 335), C-IL-5-F person (SEQ ID NO: 336) and C-IL-5 -S human (SEQ ID NO: 337), suitable for binding to VLP and fimbriae and leading to the obtaining of preferred variants of the invention.

In another specific embodiment, the antigenic determinant is eotaxin. Eotaxin is a chemokine specific for the chemokine 3 receptor present on eosinophils, basophils and Th2 cells. However, eotaxin appears to be highly specific for eosinophils (Zimmerman et al., J. Immunol. 165: 5839-46 (2000)). Eosinophil migration is reduced by 70% in eotaxin-1 knockout mice, which, however, still develop eosinophilia (Rothenberg et al., J. Exp. Med. 185: 785-90 (1997)). IL-5 appears to be responsible for the migration of eosinophils from the bone marrow to the blood, and eotaxin is responsible for local migration into the tissue (Humbles et al., J. Exp. Med. 186: 601-12 (1997).

Thus, in a preferred embodiment, the composition according to the invention comprises an amino acid linker containing a cysteine residue as a second binding site and preferably fused to the C-terminus of the eotaxin sequence. In other preferred embodiments, an amino acid linker containing free cysteine is fused to the N-terminus of the sequence corresponding to the sequence of the processed protein, or inserted into the N-terminus of the mature protein sequence is C-terminal to the signal peptide. Genes encoding these particular constructs are cloned in a suitable expression vector.

Examples 9 and 11 describe the cloning and expression of a mouse eotaxin construct in which the eotaxin sequence is fused at its C-terminus to amino acid linkers containing a cysteine residue for binding to VLP or fimbriae. Human constructs can be created according to the instructions of example 9 and assemble proteins suitable for binding to VLP and fimbriae and leading to the creation of preferred variants according to the invention. Eotaxin can be synthesized chemically (Clark-Lewis et al., Biochemistry 30: 3128-3135 (1991)). Also described is the expression of eotaxin-1 in the cytoplasm of E. coli (Crump et al., J. Biol. Chem. 273: 22471-9 (1998)). Describes the expression of eotaxin-2 in E. coli in the form of inclusion bodies followed by refolding (Mayer et al., Biochemistry 39: 8382-95 (2000)) and expression in insect cells (Forssmann et al., J. Exp. Med. 185 : 2171-6 (1997)), and this, in addition, can be used to obtain specific variants of the invention.

It will be understood by those skilled in the art that it is easy to assume other suitable modifications and adaptations of the methods and applications described in this application, and they can be carried out without departing from the scope of the invention and any variant thereof. Now, after a detailed description of the present invention, the same will be more clearly understood when referring to the following examples, which are thus included for purposes of illustration only and are not intended to limit the invention.

EXAMPLES

EXAMPLE 1

Construction and expression of mutant Qβ coat proteins and purification of VLP or capsids from mutant Qβ coat proteins

Plasmid Construction and Cloning of Mutant Coating Proteins

Construction of pQβ-240:

Plasmid pQβ10 (Kozlovska, T.M., et al., Gene 137: 133-137) was used as the starting plasmid for constructing pQβ-240. The Lys13 → Arg mutation was generated by reverse PCR. Reverse primers were designed in the reverse tail-to-tail directions:

and

The products of the first PCR were used as templates for the second PCR reaction in which the top primer was used

and lower primer

The second PCR product was digested with XbaI and Mph1103I and cloned in the pQβ10 expression vector, which was digested with the same restriction enzymes. PCR reactions were carried out using reagents from the PCR kit and according to the manufacturer's protocol (MBI Fermentas, Vilnius, Lithuania).

Sequencing using the direct tag labeling method confirmed the required mutations. E. coli cells carrying pQβ-240 supported efficient synthesis of 14 kDa protein migrating to SDS-PAGE together with a control Qβ coat protein isolated from Qβ phage particles.

The resulting amino acid sequence: (SEQ ID NO: 23)

Construction of pQβ-243:

Plasmid pQβ10 was used as the starting plasmid for the construction of pQβ-243. The Asn10 → Lys mutation was generated by reverse PCR. Reverse primers were designed in the reverse tail-to-tail directions:

and

The products of the first PCR were used as templates for the second PCR reaction in which the top primer was used

and lower primer

The second PCR product was digested with XbaI and Mph1103I and cloned in the pQβ10 expression vector, which was digested with the same restriction enzymes. PCR reactions were carried out using reagents from the PCR kit and according to the manufacturer's protocol (MBI Fermentas, Vilnius, Lithuania).

Sequencing using the direct tag labeling method confirmed the required mutations. E. coli cells bearing pQβ-243 supported efficient synthesis of 14 kDa protein migrating to SDS-PAGE together with a control coating protein Qβ isolated from particles of phage Qβ.

The resulting amino acid sequence: (SEQ ID NO: 24)

Construction of pQβ-250:

Plasmid pQβ-240 was used as the starting plasmid for the construction of pQβ-250. The Lys2 → Arg mutation was created by site-specific mutagenesis. Top primer

and lower primer

used for the synthesis of a mutant PCR fragment, which was introduced into the expression vector pQβ-185 at the unique restriction sites NcoI and HindIII. PCR reactions were carried out using reagents from the PCR kit and according to the manufacturer's protocol (MBI Fermentas, Vilnius, Lithuania).

Sequencing using the direct tag labeling method confirmed the required mutations. E. coli cells carrying pQβ-250 supported efficient synthesis of 14 kDa protein migrating to PAGE together with a control Qβ coat protein isolated from Qβ phage particles.

The resulting amino acid sequence: (SEQ ID NO: 25)

Construction of pQβ-251:

Plasmid pQβ10 was used as the starting plasmid for the construction of pQβ-251. The Lys16 → Arg mutation was generated by reverse PCR. Reverse primers were designed in the reverse tail-to-tail directions:

and

The products of the first PCR were used as templates for the second PCR reaction in which the top primer was used

and lower primer

The second PCR product was digested with XbaI and Mph1103I and cloned in the pQβ10 expression vector, which was digested with the same restriction enzymes. PCR reactions were carried out using reagents from the PCR kit and according to the manufacturer's protocol (MBI Fermentas, Vilnius, Lithuania).

Sequencing using the direct tag labeling method confirmed the required mutations. E. coli cells carrying pQβ-251 supported efficient synthesis of 14 kDa protein migrating to SDS-PAGE together with a control Qβ coat protein isolated from Qβ phage particles. The resulting amino acid sequence encoded by this construct is shown in SEQ ID NO: 26.

Construction of pQβ-259:

Plasmid pQβ-251 was used as the starting plasmid for the construction of pQβ-259. The Lys2 → Arg mutation was created by site-specific mutagenesis. Top primer

and lower primer

used for the synthesis of a mutant PCR fragment, which was introduced into the expression vector pQβ-185 at the unique restriction sites NcoI and HindIII. PCR reactions were carried out using reagents from the PCR kit and according to the manufacturer's protocol (MBI Fermentas, Vilnius, Lithuania).

Sequencing using the direct tag labeling method confirmed the required mutations. E. coli cells carrying pQβ-259 supported efficient synthesis of 14 kDa protein migrating to SDS-PAGE together with a control Qβ coat protein isolated from Qβ phage particles.

The resulting amino acid sequence: (SEQ ID NO: 27)

General methods for the expression and purification of Qβ and Qβ mutants

Expression

E. coli JM109 was transformed with plasmids expressing the Qβ coat protein. In 5 ml of LB liquid medium containing 20 μg / ml ampicillin, clones transformed with plasmids expressing the Qβ coat protein were inoculated. The inoculated culture was incubated at 37 ° C for 16-24 hours without shaking. Then, the resulting inoculum was diluted 1: 100 in 100-300 ml of fresh LB medium containing 20 μg / ml ampicillin and incubated at 37 ° C overnight without shaking. The resulting second inoculum was diluted 1:50 in M9 medium containing 1% casamino acids and 0.2% glucose in flasks and incubated at 37 ° C overnight with shaking.

Cleaning

Solutions and buffers for the cleaning method

1. Lysing buffer LB

50 mM Tris-HCl, pH 8.0, with 5 mM EDTA; 0.1% Triton X100 and freshly prepared PMSF at a concentration of 5 micrograms per 1 ml, without lysozyme and DNase.

2. SAS

A saturated solution of ammonium sulfate in water.

3. NET buffer

20 mM Tris-HCl, pH 7.8, with 5 mM EDTA and 150 mM NaCl.

4. PEG

40% (w / v) polyethylene glycol 6000 in NET.

Destruction and lysis

Frozen cells were resuspended in LB at the rate of 2 ml / g cells. The mixture was sonicated at 22 kHz five times for 15 seconds at intervals of 1 min to cool the solution on ice. The lysate was then centrifuged at 14,000 rpm for 1 hour using a Janecki K 60 rotor. All centrifugation steps described below were carried out using the same rotor, unless otherwise noted. The supernatant was stored at 4 ° C, while cell debris was washed twice in LB. After centrifugation, the supernatants and wash fractions were combined.

Fractionation

To the combined lysate described above, a saturated solution of ammonium sulfate was added dropwise with stirring. The SAS volume was adjusted to one fifth of the total volume to obtain 20% saturation. The solution was allowed to stand overnight and centrifuged the next day at 14,000 rpm for 20 minutes. The precipitate was washed with a small amount of 20% ammonium sulfate and centrifuged again. The resulting supernatants were combined and SAS was added dropwise to obtain 40% saturation. The solution was allowed to stand overnight, and the next day was centrifuged at 14,000 rpm for 20 minutes. The resulting precipitate was dissolved in NET buffer.

Chromatography

The capsid or VLP protein redissolved in NET buffer was applied to a CL-4B Sepharose column. Three peaks were eluted during chromatography. The first peak mainly contained membranes and membrane fragments, and it was not collected. Capsids were in the second peak, while the third peak contained other E. coli proteins.

The peak fractions were combined, and the NaCl concentration was adjusted to a final concentration of 0.65 M. A volume of PEG solution corresponding to half of the combined peak fraction was added dropwise with stirring. The solution was left to stand overnight without stirring. The capsid protein was precipitated by centrifugation at 14,000 rpm for 20 minutes. Then it was dissolved in a minimal volume of NET and again loaded onto a CL-4B Sepharose column. Peak fractions were combined and precipitated with ammonium sulfate at 60% saturation (w / v). After centrifugation and reconstitution in NET buffer, the capsid protein was loaded onto a CL-6B Sepharose column for rechromatography.

Dialysis and drying

The peak fractions obtained as described above were pooled and dialyzed against a large volume of sterile water and lyophilized for storage.

Expression and purification of Qβ-240

Cells (E. coli JM 109, transformed with pQβ-240 plasmid) were resuspended in LB, sonicated five times for 15 seconds (shirt containing ice water) and centrifuged at 13,000 rpm for one hour. The supernatant was stored at 4 ° C until further processing, while cell debris was washed 2 times, 9 ml LB and finally 9 ml 0.7 M urea in LB. All supernatants were combined and loaded onto a CL-4B Sepharose column. The combined peak fractions were precipitated with ammonium sulfate and centrifuged. Then the redissolved protein was again purified on a column with Sepharose 2B and, finally, on a column with Sepharose 6B. Finally, the capsid peak was dialyzed against a large volume of water and lyophilized as described above. The assembly of the coating protein into a capsid was confirmed by electron microscopy.

Expression and purification of Qβ-243

Cells (E. coli RR1) were resuspended in LB and processed as described in the general method. The protein was purified by two successive gel filtration steps on a CL-4B Sepharose column and finally on a CL-2B Sepharose column. Peak fractions were combined and lyophilized as described above. The assembly of the coating protein into a capsid was confirmed by electron microscopy.

Expression and purification of Qβ-250

Cells (E. coli JM 109 transformed with pOβ-250) were resuspended in LB and processed as described above. The protein was purified by gel filtration on a CL-4B Sepharose column and finally on a CL-2B Sepharose column and lyophilized as described above. The assembly of the coating protein into a capsid was confirmed by electron microscopy.

Expression and purification of Qβ-259

Cells (E. coli JM 109 transformed with pQβ-259) were resuspended in LB and sonicated. Cell debris was washed once with 10 ml LB and a second time with 10 ml 0.7 M urea in LB. The protein was purified by two gel chromatography-based chromatography steps on a CL-4B Sepharose column. The protein was dialyzed and lyophilized as described above. The assembly of the coating protein into a capsid was confirmed by electron microscopy.

EXAMPLE 2

Insertion of a peptide containing a lysine residue into the HBcAg c / e1 epitope (1-149)

Epitope c / e1 (residues 72 to 88) of HBcAg is located in the apical region on the surface of the hepatitis B virus capsid (HBcAg). Part of this region (proline 79 and alanine 80) was genetically replaced with the Gly-Gly-Lys-Gly-Gly peptide (HBcAg-Lys construct). The lysine residue introduced contains a reactive amino group in its side chain, which can be used for intermolecular chemical crosslinking of HBcAg particles with any antigen containing a free cysteine group.

DNA encoding HBcAg-Lys encoding the amino acid sequence shown in SEQ ID NO: 78 was generated by PCR: two fragments encoding HBcAg fragments (amino acid residues 1 to 78 and 81 to 149) were amplified separately in PCR. The primers used for these PCRs also introduced a DNA sequence encoding a Gly-Gly-Lys-Gly-Gly peptide. The HBcAg fragment (1 to 78) was amplified with pEco63 using EcoRIHBcAg (s) and Lys-HBcAg (as) primers. The HBcAg fragment (81 to 149) was amplified with pEco63 using Lys-HBcAg (s) and HBcAg (1-149) Hind (as) primers. Primers Lys-HBcAg (as) and Lys-HBcAg (s) introduced complementary DNA sequences at the ends of two PCR products, allowing fusion of the two PCR products in a subsequent PCR assembly. The blocked fragments were amplified by PCR using EcoRIHBcAg (s) and HbcAg (1-149) Hind (as) primers.

For PCR, 100 pmol of each oligonucleotide and 50 ng of DNA templates in 50 ml of reaction mixtures containing 2 units of Pwo polymerase, 0.1 mM dNTP and 2 mM MgSO _{4 were used} . In both reactions, temperature cycles were carried out as follows: 94 ° C for 2 minutes; 30 cycles of 94 ° C (1 minute), 50 ° C (1 minute), 72 ° C (2 minutes).

Primer Sequences:

To fuse the two PCR fragments by PCR, 100 pmol of EcoRIHBcAg (s) and HBcAg (1-149) Hind (as) primers with 100 ng of two purified PCR fragments in 50 ml of the reaction mixture containing 2 units of Pwo polymerase, 0, 1 mM dNTP and 2 mM MgSO ₄ . The conditions of the PCR cycles were: 94 ° C for 2 minutes; 30 cycles of 94 ° C (1 minute), 50 ° C (1 minute), 72 ° C (2 minutes). The product obtained by PCR assembly was analyzed by agarose gel electrophoresis, purified and digested for 19 hours in an appropriate buffer with restriction enzymes EcoRI and HindIII. The cleavage DNA fragment was ligated into an EcoRI / HindIII-digested pKK vector to obtain the pKK-HBcAg-Lys expression vector. The insertion of the PCR product into the vector was analyzed by restriction analysis with EcoRI / HindIII enzymes and DNA sequencing of the insert.

EXAMPLE 3

Expression and purification of HBcAg-Lys

Strains of E. coli K802 or JM109 were transformed with the pKK-HBcAg-Lys vector. 1 ml of overnight bacterial culture was used to inoculate 100 ml of LB medium containing 100 μg / ml ampicillin. The specified culture was grown for 4 hours at 37 ° C until reaching an OD at 600 nm, approximately equal to 0.8. The synthesis of HBcAg-Lys was induced by the addition of IPTG to a final concentration of 1 mM. After induction, the bacteria were additionally shaken at 37 ° C for 4 hours. Bacteria were collected by centrifugation at 5000 xg for 15 minutes. The precipitate was frozen at -80 ° C. The pellet was thawed and resuspended in bacterial lysis buffer (10 mM Na ₂ HPO ₄ , pH 7.0; 30 mM NaCl; 0.25% tween-20; 10 mM EDTA) supplemented with 200 μg / ml lysozyme and 10 μg benzonase ( Merck). Cells were incubated for 30 minutes at room temperature and destroyed by sonication. E. coli cells bearing the pKK-HBcAg-Lys expression plasmid or control plasmid were used to induce the expression of HBcAg-Lys using IPTG. Before IPTG was added, a sample was taken from a culture of bacteria carrying the pKK-HBcAg-Lys plasmid and from a culture of bacteria carrying the control plasmid. Four hours after the addition of IPTG, samples were again taken from a culture containing pKK-HBcAg-Lys and from a control culture. Protein expression was monitored using SDS-PAGE followed by Coomassie staining.

The lysate was then centrifuged for 30 minutes at 12,000 x g to remove insoluble cell debris. The supernatant and sediment were analyzed by Western blotting using a monoclonal antibody against HBcAg (YVS1841, purchased from Accurate Chemical and Scientific Corp., Westbury, NY, USA), showing that a significant amount of the HBcAg-Lys protein is soluble. Briefly, lysates of E. coli cells expressing HBcAg-Lys and control cell lysates were centrifuged at 14,000 x g for 30 minutes. The supernatant (soluble fraction) and the precipitate (insoluble fraction) were separated and diluted in SDS sample buffer to equal volumes. Samples were analyzed in SDS-PAGE followed by Western blotting with monoclonal antibody YVS 1841.

The clarified cell lysates were used for centrifugation in a stepwise gradient using a stepwise sucrose gradient consisting of 4 ml of a 65% sucrose solution, onto which 3 ml of a 15% sucrose solution was layered, and then 4 ml of a bacterial lysate. The sample was centrifuged for 3 hours at 100,000 x g at 4 ° C. After centrifugation, 1 ml fractions were collected from the top of the gradient and analyzed in SDS-PAGE followed by Coomassie staining. The HBcAg-Lys protein was detected by Coomassie staining.

The enriched HBcAg-Lys protein fraction was located at the border between 15 and 65% sucrose, which indicates that the protein formed a capsid particle. Most bacterial proteins remained in the sucrose-free upper layer of the gradient, thus centrifuging HBcAg-Lys particles in a stepwise gradient resulted in both enrichment and partial purification of the particles.

The expression and purification of HBcAg-Lys on a large scale was carried out as follows. An overnight culture was obtained by plating a single colony in 100 ml LB, 100 μg / ml ampicillin and growing the culture overnight at 37 ° C. The next day, 25 ml of the preliminary culture was diluted in 800 ml of LB medium with ampicillin and the culture was grown to an optical density of OD ⁶⁰⁰ equal to 0.6-0.8. The culture was then induced with 1 mM IPTG and allowed to grow for another 4 hours. Cells were harvested and lysed essentially as described above.

Then, HBcAg-Lys was purified by first precipitating the protein with ammonium sulfate (30% saturation) from the clarified cell lysate, then depositing the re-dissolved pellet on a gel filtration column (Sephacryl S-400, Pharmacia). The combined fractions were again precipitated with ammonium sulfate, the precipitate was redissolved and applied a second time on the same gel filtration column. Finally, the fractions were combined and concentrated, and the concentration was evaluated using the Bradford test (BioRad).

EXAMPLE 4

Construction of HBcAg, devoid of free cysteine residues and containing a built-in lysine residue

Hepatitis Cortical Antigen (HBcAg), referred to herein as HBcAg-lys-2cys-Mut, lacking cysteine residues at positions corresponding to 48 and 107 in SEQ ID NO: 77, and containing an integrated lysine residue, was constructed using the following methods.

Two mutations were first introduced by separate amplification of three fragments of the HBcAg-Lys gene, obtained as described above in Example 2, with the following combinations of PCR primers. PCR methods and conventional cloning methods were used to obtain the HBcAg-lys-2cys-Mut gene.

Briefly, to obtain fragment 1, the following primers were used.

Primer 1: EcoRIHBcAg (s)

Primer 2: 48as

To obtain fragment 2, the following primers were used.

Primer 3: 48s

Primer 4: 107as

To obtain fragment 3, the following primers were used.

Primer 5: HBcAg149hind-as

Primer 6: 107s

Then fragments 1 and 2 were combined using EcoRIHBcAg (s) and 107as PCR primers to give fragment 4. Then, fragment 4 and fragment 3 were combined using EcoRIHBcAg (s) and HBcAg149hind-as primers to give the full gene. The full-sized gene was then digested with EcoRI (GAATTC) and HindIII (AAGCTT) enzymes and cloned into pKK vector (Pharmacia), cut at the same restriction sites. Expression and purification of HBcAg-lys-2cys-Mut was carried out as described in example 3.

EXAMPLE 5

Construction of HBcAg1-185-Lys

Hepatitis measles antigen (HBcAg) 1-185 was modified as described in Example 2. Part of the c / e1 epitope region (residues 72 to 88) (proline 79 and alanine 80) was genetically replaced with the Gly-Gly-Lys-Gly-Gly peptide (construct HBcAg1-185-Lys). The lysine residue introduced contains a reactive amino group in its side chain, which can be used for intermolecular chemical crosslinking of HBcAg particles with any antigen containing a free cysteine group. To obtain the HBcAg1-185-Lys gene, PCR methods and conventional cloning methods were used.

The Gly-Gly-Lys-Gly-Gly sequence was inserted by amplification of two separate fragments of the HBcAg gene from pEco63, as described above in Example 2, and then by fusion of the two fragments using PCR to collect the full-sized gene. Used the following combinations of PCR primers:

fragment 1:

primer 1: EcoRIHBcAg (s) (see example 2)

primer 2: Lys-HBcAg (as) (see example 2)

fragment 2:

primer 3: Lys-HBcAg (s) (see example 2)

primer 4: HBcAgwtHindIIII

Assembly:

primer 1: EcoRIHBcAg (s) (see example 2)

primer 2: HBcAgwtHindIIII

Then, the assembled full-sized gene was digested with the EcoRI (GAATTC) and HindIII (AAGCTT) enzymes and cloned into the pKK vector (Pharmacia), cut at the same restriction sites.

EXAMPLE 6

Fusion of the peptide epitope in the MIR region of HbcAg

Residues 79 and 80 of HBcAg1-185 were replaced by the CεH3 epitope of the VNLTWSRASG sequence. The CεH3 sequence is derived from the sequence of the third constant domain of the human IgE heavy chain. The epitope was inserted into the HBcAg1-185 sequence using the PCR assembly method. In the first PCR step, the HBcAg1-185 gene, derived from the ATCC clone pEco63 and amplified with HBcAg-wt EcoRI fwd and HBcAg-wt Hind III rev primers, was used as a template in two separate reactions to amplify two fragments containing sequence elements, encoding the sequence CεH3. Then, the two fragments were assembled in a second PCR step in a PCR assembly reaction.

The combinations of primers in the first stage of PCR: CεH3fwd with HBcAg-wt Hind III rev and HBcAg-wt EcoRI fwd with CεH3rev. In the PCR assembly reaction, two fragments isolated in the first PCR step were first assembled for 3 PCR cycles without external primers, which were added to the reaction mixture later for the next 25 cycles. External primers: HBcAg-wt EcoRI fwd and HBcAg-wt Hind III rev.

The PCR product was cloned into pKK223.3 using EcoRI and HindIII sites for expression in E. coli (see Example 2). The chimeric VLP was expressed in E. coli and purified as described in Example 2. In the elution volume in which HBcAg1-185-CεH3 was eluted by gel filtration, the assembly of fusion proteins into the chimeric VLP is shown.

Primer Sequences:

EXAMPLE 7

Cloning, expression and purification of IL-5 with an N-terminal amino acid linker containing a cysteine residue. VLP binding, immunization and demonstration of efficacy in an experimental model of allergic asthma with an eosinophilic component

A. Cloning of Mouse His-C-IL-5 and Expression as Inclusion Taurus in E. coli

IL-5 was amplified from the ATCC clone (pmIL5-4G; ATCC number: 37562) in PCR using the following two primers: Spelinker3-F1 (SEQ ID NO: 340) and Il5StopXho-R (SEQ ID NO: 342). The product of this PCR was used as a template for the second PCR with SpeNlinker3-F2 primers (SEQ ID NO: 341) and Il5StopXho-R. The insert was cut out with SpeI and NotI. The resulting insert was ligated into a vector derived from pET (vector pMODEC3-8), pre-digested with NheI and NotI, and E. coli TG1 cells were transformed with it. The construct obtained by cloning IL5 into pMODEC3-8 contains, starting from its N-terminus, a hexahistidine tag (to facilitate purification), an enterokinase cleavage site, an amino acid linker derived from gamma 3 (flanked from the N-terminus of amino acids ALV and C- amino acid terminus AS) containing a cysteine residue and DNA encoding the mature form of the IL-5 protein. The correctness of the cloning method was confirmed by DNA sequencing.

The construct described above containing IL-5 was called pMODC6-IL5.2 (also called pMODC6-IL5) and it transformed E. coli, strain BL21-DE3. The recombinant protein expressed in E. Coli is named His-C-IL5.

BL21-DE3 clonal cells bearing pMODC6-IL5 were grown overnight in 5 ml LB containing 1 mg / L ampicillin. A 2.0 ml aliquot of this culture was diluted in 100 ml of a suitable broth (TB) containing 1 mg / L ampicillin. The culture was grown to an optical density of OD ₆₀₀ of 0.7-1.0, and expression was induced for 4 hours by adding 0.1 ml of a 1.0 M isopropyl-β-D-thiogalactopyranoside mother liquor (IPTG). Recombinant His-C-IL5 was expressed in insoluble form and was in the fraction of inclusion cells of induced cells. The expression of His-C-IL5 was confirmed as follows. 4 hours after induction, a 10 ml culture sample was taken and centrifuged for 10 min at 4000 x g. The pellet was resuspended in 0.5 ml of lysis buffer consisting of 50 mM Tris-HCl, 2 mM EDTA, 0.1% Triton X-100 (pH 8.0). 20 μl of lysozyme (40 mg / ml) was added to the suspension, and after 30 minutes at 4 ° C, they were sonicated for 2 minutes. An aliquot of 1.0 ml benzonase and an aliquot of 50 mM MgCl ₂ with a volume of 100 μl were added and incubated for 30 min at room temperature. After centrifugation for 15 min at 13,000 xg, the supernatant was discarded and the precipitate was heated for 5 min at 98 ° C in 100 μl SDS application buffer. Then, 10 μl aliquots were analyzed in SDS-PAGE under reducing conditions. SDS-PAGE analysis revealed a band of 17 kD protein, corresponding to the mass of IL-5. As a control, BL21-DE2 cells containing pMODC6-IL5 were grown in the absence of IPTG and extracts were prepared from the insoluble cell fraction as described above.

B. Purification and refolding of mouse His-C-IL5

Large-scale expression of IL-5 from clone pMODC6-IL5 was carried out in BL21-DE3 cells in order to obtain sufficient quantities of pure IL-5 to obtain a vaccine. Night cultures were grown and diluted in a volume equal to either 100 ml or 1 l of TB medium containing 1.0 mg / l of ampicillin. Thus, a total of 3 liters of culture was obtained and grown at 37 ° C until an OD ₆₀₀ of 0.7 was reached, and IPTG was added at this time, resulting in a final concentration of 1.0 mM. After 4 hours of incubation, cells were harvested by centrifugation for 30 minutes at 10,000 x g. After collection, the pellet was resuspended in PBS (5.0 ml / g wet weight) and centrifuged for 15 minutes at 10,000 x g. The washed precipitate was stored at -20 ° C until use.

The bacterial pellet was suspended in PBS (2.0 ml / g wet cell mass) using a Downes homogenizer. Lysozyme (0.8 mg / ml) was added to the suspension and incubated for 30 minutes at room temperature. The suspension was sonicated 3 times for 1 minute on ice, then benzonase and MgCl ₂ (final concentration 10 mM) were added and incubated for 30 minutes at room temperature. Triton X-100 was added to a final concentration of 1% (w / v), the mixture was gently stirred at room temperature for 30 minutes. The solution was centrifuged for 20 minutes at 20,000 xg (SS34 tubes) and the supernatant discarded. The pellet containing inclusion bodies was suspended (5.0 ml / g wet weight) in wash buffer (PBS containing 2 M urea and 1% (w / v) Triton X-100) using a Downes homogenizer and shaking for 5 minutes. The solution was centrifuged for 20 minutes at 20,000 xg and the supernatant discarded. The precipitate was washed and centrifuged, as described above, 2 more times. The final washing of the inclusion bodies was carried out in the washing buffer in the absence of X-100 newt.

His-C-IL-5, present in the inclusion bodies in the pellet, was dissolved (5.0 ml / g of wet cell mass) in denaturing buffer (100 mM NaH ₂ PO ₄ , 10 mM Tris-HCl, 6.0 M guanidine hydrochloride, pH 8.0) and gently stirred for 1 hour at 25 ° C. The suspension was centrifuged for 20 minutes at 20,000 xg and the supernatant was mixed with a Ni-NTA resin (QIAgen equilibrated with dissolution buffer). After 3 hours of gentle shaking at 4 ° C, the suspension was poured into a glass column (C10 / 10) and the resin was washed with 100 ml of 100 mM NaH ₂ PO ₄ , 10 mM Tris, 6.0 M guanidine hydrochloride (pH 6.3). An additional washing step was carried out with 15 ml of 100 mM NaH ₂ PO ₄ , 10 mM Tris, 6.0 M guanidine hydrochloride (pH 5.9). Mouse His-C-IL5 was eluted from the resin by application of 20 ml of 100 mM NaH ₂ PO ₄ , 10 mM Tris, 6.0 M guanidine hydrochloride (pH 4.5). Purification was analyzed in SDS-PAGE.

Fractions from the elution step containing His-C-IL-5 were pooled and dialyzed against a buffer containing 8.0 M urea, 100 mM NaH ₂ PO ₄ , 10 mM Tris-HCl (pH 8.0), at 4 ° C using a membrane with a cutoff limit of 10 kD. After dialysis, the protein concentration was determined spectrophotometrically using the following formula: protein (mg / ml) = (1.55 x A _{280 nm} ) - (0.76 x A _{260 nm} ). Protein concentration was adjusted by dilution in dialysis buffer to 0.2 mg / ml. The solution was then dialyzed using a 3.5 kD cut-off membrane for 24 hours at 4 ° C against a refolding buffer 1 containing 2.0 M urea, 50 mM NaH ₂ PO ₄ , 5 mM reduced glutathione, 0.5 mM oxidized glutathione, 0.5 M arginine, 10% (v / v) glycerin (pH 8.5), and for another 24 hours against another refolding buffer 2 containing 50 mM NaH ₂ PO ₄ , 5 mM reduced glutathione , 0.5 mM oxidized glutathione, 0.5 M arginine, 10% (v / v) glycerin (pH 8.5). At the end, the protein was dialyzed for 24 hours at 4 ° C against PBS pH 8.0, then centrifuged at 10,000 xg for 30 minutes. The protein content in the supernatant was determined by Bradford analysis.

For further purification of His-C-IL5, anion exchange was carried out using Hitrap Q resin (Amersham Pharmacia, Uppsala Sweden). His-C-IL5 was concentrated to 1 mg / ml using centrifuge filters (Ultrafree-15 Millipore, 10 kD cut-off limit) and dialyzed for 14 hours against 50 mM phosphate buffer, pH 8.4. The solution was applied to a Hitrap Q column and washed with 50 mM phosphate buffer at pH 8.4. His-C-IL-5 was eluted from the column using a NaCl gradient from 0 to 1 M. His-C-IL5 was eluted from the column at 100 mM NaCl. The purification analysis was performed in SDS-PAGE and the concentration was measured by Bradford analysis. The quaternary structure of the protein was evaluated by electrophoresis in SDS-PAGE, carried out in non-reducing conditions.

C. Vaccine preparation: binding of His-C-IL5 to Qβ

A number of conditions were investigated to optimize the efficiency of the binding reaction. The conditions included the addition of a reducing agent (TCEP) to His-C-IL5 and the variation of the molar ratios of the monomer Qβ and His-C-IL5 in the binding reaction, the conditions are summarized in the table. A vaccine for efficacy studies was prepared as follows. Purified His-C-IL-5 (40 μM) was recovered for 1 hour using an equimolar amount of TCEP in PBS, pH 8.0. Reduced IL-5 (80 μM) was incubated for 4 hours at 22 ° C with 40 μM Qβ derivatized with SMPH in a total volume of 700 μl. The reaction mixture was dialyzed for 12 hours against PBS, pH 8.0, using a 300 kD cut-off dialysis membrane. The binding reaction was analyzed on SDS-PAGE and Western blot using anti-His and anti-Qβ antibodies. Protein concentration was measured by Bradford. Binding Efficiency [i.e. mole Qβ-IL5 / mole of monomer Qβ (total)] was evaluated by densitometric analysis of Coomassie blue stained SDS-PAGE.

Various binding conditions used to optimize the chemical crosslinking of His-C-IL5 to Qβ The concentration of derivatized Qβ (μm) The concentration of His-C-IL5 (μm) The ratio of TCEP / IL5 (μm) 70 40 without tsper 70 40 1: 2 70 40 1: 1 70 40 1.5: 1 70 40 2: 1 70 40 16.6: 1 twenty thirty without tsper twenty thirty 1: 2 twenty thirty 1: 1 twenty thirty 1.5: 1 twenty thirty 2: 1 twenty thirty 16.6: 1

D. ELISA for vaccine evaluation

The binding of mouse His-C-IL5 to Qβ was evaluated using a "quadruple" ELISA, which is shown in Fig.7. A 96-well ELISA plate was coated with 100 μl of 1 mg / L goat anti-rabbit IgG antibody per well overnight. The tablet was washed four times with PBS-Tween 0.1% (v / v) (PBST), then blocked for 2 hours at 37 ° C. with 2% (w / v) bovine serum albumin (BSA) in PBST. After washing in PBST, rabbit polyclonal anti-Qβ serum (1: 5000 dilution) was added and incubated for 1 hour. The tablet was washed twice with PBST and either varying amounts of Qβ-His-C-IL5 or control (Fig. 5) was added and incubated for 1 hour at 25 ° C. Two different third antibodies were used in the analysis; rat anti-mouse IL5 antibody (TRFK4) or rat anti-mouse IL5 antibody (TRFK5), both of which are neutralizing monoclonal antibodies. All antibodies were used at concentrations of 1 μg / ml. Registration antibodies are conjugated to horseradish peroxidase (HRP) and are specific for a particular Fc fragment of a third antibody. Binding in a sandwich assay was measured by chemiluminescence (ECL) at 450 nm.

F. Analysis of the activity of IL-5

The ability of the BCL1 B-cell lymphoma line to proliferate in response to murine IL-5 was used to test the bioactivity of refolded recombinant His-C-IL-5 (Harriman GR (1991) Current Protocols in Immunology 6.5.1-6.5.5 John Wiley and Sons Inc). The proliferative activity of His-C-IL5 covalently linked to Qβ was also evaluated. Recombinant murine IL-5 (R&D systems, Minneapolis USA) was used as a control. Various forms of recombinant IL-5 were incubated in 96-well flat bottom plates with 2 x 10 ⁴ BCL1 cells per well and incubated for 24 hours at 37 ° C, 5% CO ₂ . 1 μcurie ³ H-thymidine (Hartmann Analytic, Switzerland) was added to each well, and the plates were incubated for another 6 hours at 37 ° C, 5% CO ₂ . Cells were harvested, washed, and thymidine incorporation was determined by counting β radiation in a liquid scintillation counter.

G. Immunization Protocol

To obtain autoreactive anti-mouse IL-5 antibodies, four BalbC mice were injected subcutaneously on day 0 and day 14 with 25 μg of Qβ-His-C-IL5 vaccine in 200 μl of PBS. Five mice were used as a negative control, which were immunized on day 0 and day 14 with a mixture of samples of 6.4 μg Qβ and 16 μg IL5, i.e. not covalently bound (Qβ + His-C-IL-5) in PBS. Mice were bled prior to immunization and for 21 days according to the immunization protocol. Sera were analyzed in ELISA.

H. Serum analysis

ELISA Maxisorp ELISA plates (Nunc) were coated with 50 μl of purified His-C-IL-5 (3 μg / ml) for 14 hours at 4 ° C. The plates were washed 3 times with PBS and blocked with 2% BSA in PBS for 2 hours at 37 ° C, then washed twice with PBS. Five-fold dilutions of serum were added in 2% BSA, 0.1% FCS in PBS and incubated at room temperature for 1 hour. Then the plates were washed 3 times with PBS and incubated with anti-mouse IgG antibody conjugated to HRP (1: 1000 dilution) at room temperature for 1 hour. The plates were washed again 3 times in PBS and 100 μl / well of the developing solution was added (0.066 M Na ₂ HPO ₄ ; 0.035 M citric acid; 0.032% H ₂ O ₂ ; 0.4% 1,2-phenylenediamine dihydrochloride). After 2 minutes of the reaction at room temperature, the ELISA was stopped with 50 μl per well of 5% H ₂ SO ₄ . The absorption was measured at 450 nm on a Spectramax spectrophotometer (Molecular Devices).

Western blot staining with serum from mice immunized with Qβ-IL5 .

His-C-IL5, Qβ and controls were separated into SDS-PAGE and electro-blotted onto a nitrocellulose membrane. The membrane was blocked for 1 hour with 5% (w / v) milk powder in PBS, then incubated with 20 μl of serum obtained on day 21 from vaccinated mice in 10 ml of 1% (w / v) milk powder in PBS The membrane was washed with PBS for 15 minutes and then incubated for 1 hour with 10 ml of 1% (w / v) milk powder in PBS containing anti-mouse IgG antibody conjugated to horseradish peroxidase (HRP) in a 1: 1000 dilution . The membrane was washed for 15 minutes in PBS and developed ECL (Amersham Pharmacia, Sweden) and exposed with photographic film.

I. Model of eosinophilia

An experimental model of asthma with allergic airway inflammation was used to evaluate the effect of vaccination on eosinophilia. Balb / c mice (4 per group) were immunized with any Qβ-His-C-IL-5, as described above. On day 23, according to the vaccination program, mice were injected intraperitoneally with 50 μg of ovalbumin (OVA) in aluminum-based adjuvant (Alu-Gel-S). Injections were also given to the third group of 4 mice that were not immunized. After 10 days (i.e., on day 33), the mice received 100 μg of OVA in PBS, which was administered intranasally every day for 4 days. 24 hours after the last antigenic stimulation, the mice were sacrificed and the lungs washed in PBS. Cells in bronchoalveolar lavage (BAL) were stained according to May-Grunwald-Giemsa and counted (Trifilieff A. et al. Clin. Exp. Allergy. 2001 Jun; 31 (6): 934-42).

RESULTS AND DISCUSSION

Expression . Expression of the pMODC6-IL5 construct in BL21-DE2 cells was analyzed in SDS-PAGE (FIG. 1). Coomassie blue stained gel shows IPTG-induced expression of a 17 kD protein corresponding to the weight of IL-5. As a control, BL21-DE2 cells containing pMODC6-IL5 were grown in the absence of IPTG, and extracts were obtained from the insoluble cell fraction as described above. As expected, under these conditions there was no induction of 17 kD protein. His-C-IL5 was in the insoluble fraction of inclusion bodies.

Extraction, purification and refolding . Insoluble His-C-IL5 was extracted from detergent-washed inclusion bodies using 6 M guanidine hydrochloride. The dissolved protein was purified by metal chelate affinity chromatography and analyzed in SDS-PAGE (FIG. 2). It was found that by this method a high enrichment of the recombinant His-C-IL5 fraction was achieved. The denatured protein was subjected to urea refolding as described above, and then purified by anion exchange chromatography. These steps gave soluble highly purified His-C-IL5, judging by SDS-PAGE (FIG. 5, lane 1) with a 23% recovery and a yield of 6.9 mg.

Since biologically active native IL-5 is a homodimer bound disulfide bond, the ability of purified recombinant His-C-IL5 to form dimers using SDS-PAGE electrophoresis performed under non-reducing conditions was evaluated (Fig. 3). Judging by the molecular weight of 37 kD, His-C-IL5 was dimeric in nature, which indicates the preservation of the native Quaternary structure.

The biological activity of recombinant His-C-IL5 was evaluated by determining its ability to stimulate the proliferation of the mouse B-cell line (Figure 4). BCL1 cells cultured in the presence of His-C-IL5 have been shown to have increased proliferation rates compared to cultivation only in medium or with other proteins. In addition, enhanced proliferation was similar to the proliferation observed in the case of commercially obtained murine IL-5. The ability of His-C-IL5 to stimulate the proliferation of B cells, probably due to interaction with its sister receptor and to take a dimeric structure, indicates that the recombinant protein accepts the native conformation.

Getting the vaccine and analytics . The covalent chemical binding of His-C-IL5 to the virus-like Qβ particle was evaluated using SDS-PAGE and Western blot analysis. Coomassie blue stained gels in the case of a binding reaction showed the appearance of bands with molecular weights corresponding to those calculated for His-C-IL5 covalently linked to Qβ (FIG. 5). In addition, Western analyzes showed the joint localization of these bands when stained with either anti-His- or anti-Qβ antibodies (Fig.6). Binding Efficiency [i.e. mole Qβ-IL5 / mole of monomer Qβ (total)], estimated by densitometric analysis of Coomassie blue SDS-PAGE, was 40.6%.

The ability of His-C-IL-5, covalently cross-linked to Qβ, to stimulate the proliferation of B cells was evaluated as described previously. Figure 5 shows that Qβ-His-C-IL5 is capable of inducing enhanced proliferation compared to Qβ associated with an unrelated cytokine.

Then, the conformation of His-C-IL5 bound to Qβ was analyzed using a four-fold ELISA (Fig. 7A). FIG. 7B shows that His-C-IL5 is recognized by neutralizing monoclonal antibodies to IL-5 — TRFK 4 and TRFK 5. When the reaction was carried out with Qβ rather than Qβ-His-C-IL-5, the signal was not detected. The TRFK4 monoclonal antibody recognizes a neutralizable epitope in IL-5. The ability of IL-5-specific monoclonal antibodies to recognize covalently linked His-C-IL-5 indicates that neutralizable epitopes are retained in the vaccine preparation.

Serum analysis . Sera collected before immunization and on day 21 from mice vaccinated with Qβ-His-C-IL5 were collected and analyzed in an ELISA (Fig. 8). The result shows that immunological tolerance to the autoantigen IL-5 was overcome in the absence of adjuvant and without exception in 4/4 vaccinated mice. It was estimated that half of the maximum titers ranged from 1: 2000 to 1: 6000. In the control group that received Qβ mixed with His-C-IL5, no significant titers of anti-IL-5 antibodies were recorded. However, 3 out of 5 mice produced a low titer of antibodies <1:50. Then, immune sera from mice vaccinated with Qβ-His-C-IL5 were tested using Western blot analysis. In all cases, immune sera specifically recognized murine IL-5.

The effectiveness of the vaccine in a model of experimental asthma in animals . The effect of Qβ-His-C-IL-5 vaccination on eosinophilia was evaluated in a mouse model of allergic airway inflammation, which mimics key pathological events in asthma. In this experiment, we tested the ability of anti-IL5 antibodies formed by Qβ-His-C-IL-5 vaccination to inhibit the action of endogenous IL-5 in vivo. In a control experiment, mice were vaccinated with PBS before sensitization and antigenic stimulation of OVA. In this case, a large number of eosinophils in the BAL were counted. The average number of eosinophils / 200 cells counted was 96 ± 14 SD. In contrast, the average eosinophils in BAL in four mice vaccinated with Qβ-His-C-IL-5 was 27.5 ± 11 SD / 200 cells counted. This decrease is 71.4% and is evidence that autoantibodies formed by immunization with His-C-IL-5, presented as a highly ordered immune matrix, recognize an endogenous target molecule and thus suppress eosinophilia in an experimental model of asthma.

EXAMPLE 8

Molecular cloning, expression, refolding and purification of mouse mIL-13 with a C-terminal amino acid linker containing a cysteine residue for binding to VLP and fimbriae. The binding of mouse interleukin-13 to VPL and fimbriae

A. Cloning of IL-13 for prokaryotic expression

DNA for cloning IL-13 was isolated by RT-PCR from in vitro activated splenocytes, which were prepared as follows: CD4 + T cells were isolated from mouse spleen cells and incubated for 3 days in IMDM (+ 5% FCS + 10 ng / ml IL4) in 6 well plates precoated with anti-CD3 and anti-CD28 antibodies. RNA from these cells was used to amplify cDNA encoding IL13 in one-step RT-PCR (Qiagen single-step PCR kit). Primer XhoIL13-R was used for reverse transcription of RNA, primers NheIL13-F (SEQ ID NO: 338) and XhoIL13-R (SEQ ID NO: 339) were used for PCR amplification of IL13 cDNA. The amplified IL13 cDNA was ligated into the pMOD vector using the NheI / XhoI restriction sites (producing the pMODB1-IL13 vector). The identity of the resulting cDNA sequence was determined by nucleotide sequencing.

Using the same primers NheIL13-F (SEQ ID NO: 338) and XhoIL13-R (SEQ ID NO: 339), IL-13 cDNA was amplified from plasmid pModB1-IL13 and ligated into pMODGST-EK-C1 vector, resulting in a plasmid pModGST-EK-IL13-C1. The cDNA sequence of the indicated plasmid was determined by nucleotide sequencing. The cDNA containing the coding sequence for glutathione S-transferase fused to the enterokinase cleavage site, followed by the sequence of IL-13 with the C-terminal linker 1, was amplified by PCR with GST-BamHIss and C1-BsmBI / XhoI primers using Matrix plasmid pModGST-EK-IL13-C1. Said cDNA was digested with BamHI and BsmBI restriction enzymes and ligated into the pModB-N1 vector using the BamHI / XhoI restriction site. The resulting plasmid pMod-GST-EK-IL13-C1-His encodes a fusion protein consisting of glutathione-S-transferase, enterokinase cleavage site, IL-13, a cysteine linker, and a polyhistidine tag (GST-EK-IL13- C1-His). The identity of the cDNA encoding this fusion protein was confirmed by nucleotide sequencing.

The sequence of oligonucleotides

B. Expression of IL-13 in E. coli

The plasmid pMod-GST-EK-IL13-C1-His transformed the host bacterial strain BL 21 (DE3). After 90 minutes of reconstitution in LB medium containing 2% glucose (pre-culture) in 250 ml of MOPS-buffered SB medium containing 0.2% glucose and 100 μg / L ampicillin, 250 μl of the preliminary culture were inoculated and incubated on a shaker at 37 ° C during the night. The next morning, the seeded culture was diluted with 750 ml of pre-heated MOPS buffered SB medium containing 100 μg / L ampicillin and incubated on a shaker at 125 rpm at 37 ° C for another 90 minutes until an OD ₆₀₀ of 4 was reached. 5. 1000 ml of the culture was diluted with 500 ml of MOPS-buffered SB medium containing 100 μg / L ampicillin and transferred to a 24 ° C incubator, where it was incubated on a shaker for 30 minutes until an OD ₆₀₀ of 3.75 was reached. GST-EK-IL13-C1-His fusion protein expression was induced by the addition of 0.75 mM IPTG. After 4 hours, the bacteria were collected by centrifugation and destroyed by sonication.

C. Purification of IL-13 from inclusion bodies under denaturing conditions

After lysis of the body, the inclusions were precipitated by low-speed centrifugation (10000 g, 60 min, at 4 ° C). The supernatant was collected and centrifuged again under the same conditions. Precipitation was stored as a crude fraction of inclusion bodies. Inclusion bodies were washed 4 times with the following washing buffer: 50 mM Tris-HCl, pH 7.6, 250 mM NaCl, 5 mM MgCl ₂ , 2 M urea, 2% Triton X-100 and 10 units. benzonases / ml. Inclusion bodies were collected by centrifugation and resuspended in denaturing buffer containing 100 mM NaH ₂ PO ₄ , 10 mM Tris-HCl and 6 M guanidine-HCl, pH 8.0. Inclusion bodies were sonicated in the presence of 10 units. benzonases / ml and incubated for 2 hours on a rotating stand at room temperature. After centrifugation, the supernatant was retained, and the sediment was again resuspended in denaturing buffer and processed as described above. The supernatants were pooled and applied onto a Ni ²⁺ agarose column equilibrated with denaturing buffer. Bound protein was eluted in two stages with denaturing buffer at pH 6.3 and pH 4.5. Aliquots of the fractions were analyzed by staining with amide black and after precipitation of TCA in SDS-PAGE (figure 10).

D. Refolding GST-EK-IL13-C1-His

Β-mercaptoethanol was added to the eluted protein to a final concentration of 10 mM and dialyzed overnight against 2 liters of buffer containing 8.0 M urea, 100 mM NaH ₂ PO ₄ , 10 mM Tris-HCl, 10 mM β-mercaptoethanol (pH 8 , 0), at 4 ° C, using a membrane with a cutoff limit of 10 kD. After dialysis, the protein concentration was determined and the protein was diluted with dialysis buffer to a concentration of 0.2 mg / ml. The solution was dialyzed for 24 hours at 4 ° C against refolding buffer 1 containing 2.0 M urea, 50 mM NaH ₂ PO ₄ , 5 mM reduced glutathione, 0.5 mM oxidized glutathione, 0.5 M arginine, 10% (v / v) glycerin (pH 8.5). The next day, refolding buffer 1 was replaced by refolding buffer 2 containing 50 mM NaH ₂ PO ₄ , 2.5 mM reduced glutathione, 0.25 mM oxidized glutathione, 0.25 M arginine, 10% (v / v) ) glycerol (pH 8.5) and dialyzed at 4 ° C for another 24 hours. Finally, the solution was dialyzed at 4 ° C. against refolding buffer 3 containing 20 mM ethanolamine, 150 mM NaCl and 10% (v / v) glycerol (pH 9.0). Refolding buffer 3 was replaced once after 2 hours and dialysis continued for the next 14 hours. The dialysate was centrifuged at 4 ° C and 20,000 g for 15 minutes. The supernatant was retained and the protein was concentrated by centrifugation in a “biomax filter centrifuge” with 5 kD molecular weight cut-off (Millipore) to a final protein concentration of 2 mg / ml. Protein was analyzed using SDS-PAGE and Western blot with monospecific antibodies against GST, mouse IL-13 and His-tags, respectively.

E. Cleavage of the fusion protein GST-EK-IL13-C1-His enterokinase

The GST-EK-IL13-C1-His fusion protein was incubated with 1x enterokinase buffer (50 mM Tris-HCl, pH 8.0, 10 mM CaCl ₂ and 1% tween-20) and 1 unit. enterokinase (Invitrogene) per 12.5 μg fusion protein for 24 hours at 4 ° C.

F. Purification of IL13-C1-His

After treatment with enterokinase, cleaved GST was separated by combining ion exchange chromatography, gel filtration, and affinity chromatography. Protein IL-13-C1-His was concentrated to a final protein concentration of 2 mg / ml.

G. Preparation of IL-13-C1-His Protein for the Binding Reaction

In order to determine the optimal binding conditions, the IL-13-C1-His protein was treated under moderate reduction conditions with various concentrations (from 0 to 500 μM) of a reducing reagent (DTT or TCEP). The recovered IL-13-C1-His protein was tested for effective binding to derivatized VLPs and fimbriae.

H. Binding of IL-13-C1-His to Qβ Capsids

A solution of 120 μM Qβ capsid in 20 mM Hepes, 150 mM NaCl, pH 7.2, was reacted for 30 minutes with a 25-fold molar excess of a heterobifunctional cross-linking agent like SMPH (Pierce) diluted from the mother liquor in DMSO, at 25 ° C on a rocking shaker. Then, the reaction solution was dialyzed twice for 2 hours against 1 L of 20 mM Hepes, 150 mM NaCl, pH 7.2, at 4 ° C. Then the dialyzed reaction mixture of derivatized Qβ was mixed with IL-13-C1-His protein. In the binding reaction, IL-13-C1-His protein was present in a twofold molar excess compared to the derivatized Qβ capsid. The binding reaction was continued for four hours at 25 ° C. on a shaking shaker. Binding products were analyzed on SDS-PAGE and, in addition, on Western blot.

The binding of IL-13-C1-His protein capsid fr

A solution of 120 μM fr-capsid in 20 mM Hepes, 150 mM NaCl, pH 7.2, was reacted for 30 minutes with a 25-fold molar excess of SMPH (Pierce) diluted from the mother liquor in DMSO at 25 ° C on a shaking shaker. Then, the reaction solution was dialyzed twice for 2 hours against 1 L of 20 mM Hepes, 150 mM NaCl, pH 7.2, at 4 ° C. Then, the dialyzed fr capsid protein reaction mixture was reacted with the prepared IL-13-C1-His protein. In the binding reaction, IL-13-C1-His protein was present in a twofold molar excess compared to the derivatized fr capsid. The binding reaction was continued for four hours at 25 ° C. on a shaking shaker. Binding products were analyzed on SDS-PAGE and, in addition, on Western blot.

Binding of IL-13-C1-His to HBcAg-Lys-2cys-Mut

A solution of 120 μM HBcAg-Lys-2cys-Mut capsid in 20 mM Hepes, 150 mM NaCl, pH 7.2, was reacted for 30 minutes with a 25-fold molar excess of SMPH (Pierce) diluted from the mother liquor in DMSO at 25 ° C on the swinging shaker. Then, the reaction solution was dialyzed twice for 2 hours against 1 L of 20 mM Hepes, 150 mM NaCl, pH 7.2, at 4 ° C. Then, the HBcAg-Lys-2cys-Mut dialyzed reaction mixture was reacted with the prepared IL-13-C1-His protein. In the binding reaction, the IL-13-C1-His protein was present in a twofold molar excess compared to the derivatized HBcAg-Lys-2cys-Mut capsid. The binding reaction was continued for four hours at 25 ° C. on a shaking shaker. Binding products were analyzed on SDS-PAGE and, in addition, on Western blot.

The binding of protein IL-13-C1-His with fimbriae

A solution of 125 μM E. coli type-1 fimbriae in 20 mM Hepes, pH 7.4, was reacted for 60 minutes with a 50-fold molar excess of cross-linking agent SMPH diluted from the mother liquor in DMSO under CT on a shaking shaker. The reaction mixture was desalted on a PD-10 column (Amersham-Pharmacia Biotech). Protein-containing fractions eluted from the column were combined and the desalted derivatized fimbriae protein was reacted with the prepared IL-13-C1-His protein. In the binding reaction, IL-13-C1-His protein was present in a twofold molar excess compared to E. coli type-1 derivatized fimbriae. The binding reaction was continued for four hours at 25 ° C. on a shaking shaker. Binding products were analyzed on SDS-PAGE and, in addition, on Western blot.

Immunization of IL-13-C1-His Mice with Qβ Capsid Protein

Female Balb / c mice were vaccinated with VLP-linked IL-13-C1-His without the addition of adjuvants. 25 μg of total protein in each sample was diluted in PBS to 200 μl and injected subcutaneously (100 μl on both sides of the abdomen) on day 0 and day 14. Mice were bled from the retroorbital region on day 31 and their serum was analyzed using an IL-13 specific ELISA.

EXAMPLE 9

Cloning, expression, purification and binding of eotaxin to the cys-containing amino acid linker sequence

Mouse eotaxin was recombinantly expressed with the C1 amino acid linker fused to its C-terminus. The specified linker contained one cysteine residue for binding to VLP.

Constructing pmEo-C1 and pmHisEo-C1

MCS pET22b (+) (Novagen, Inc.) was changed to GTTTAACTTTAAGAAGGAGATATACACATATGGATCCGGCTAGCGCTCGAGGGTTTAAACGGCGGCCGCATGCACC by replacing the original sequence from the NdeI site to the XhoI site with annealed HMMCmer-1 primer M-clmer. The resulting plasmid was named pMod00 and it had the restriction sites NdeI, BamHI, NheI, XhoI, PmeI and NotI in its MCS. The annealed pair of Bamhis6-EK-Nhe-F and Bamhis6-EKNhe-R oligonucleotides and the annealed pair of oligo1F-C-glycine linker and oligo1R-C-glycine linker were ligated together into the BamHI-NotI digested pMod1 plasmid to obtain pMod1 to An N-terminal hexahistidine tag, an enterokinase cleavage site, and a C-terminal amino acid glycine linker containing one cysteine residue. Mouse eotaxin was amplified from the ATCC clone (ATCC number 3148394) into PCR using the following primers: mEotaxin-F, Nhe-mEotaxin-F and mEotaxin-Xho-R. mEotaxin-F had an internal NdeI site, Nhe-mEotaxin-F had an internal NheI site, and mEotaxin-Xho-R had an internal XhoI site. The PCR product with the mEotaxin-F and mEotaxin-Xho-R primer pair was digested with NdeI and XhoI and ligated into pModEC1 digested with the same enzymes. The resulting plasmid was called pmEo-C1, and it encodes a fusion protein consisting of eotaxin and a cysteine-containing linker at its C-terminus. The PCR product with a pair of Nhe-mEotaxin-F and mEotaxin-Xho-R primers was digested with NheI and XhoI and ligated into pModEC1 digested with the same enzymes. The resulting plasmid was called pHismEo-C1, and it encodes a fusion protein consisting of an N-terminal His tag, followed by an enterokinase cleavage site, eotaxin and a cysteine linker.

For the PCR reaction, 15 pmol of each oligonucleotide and 1 ng of the DNA template were used in 50 μl of the reaction mixture (2 units of PFX polymerase, 0.3 mM dNTP and 2 mM MgSO ₄ ). The temperature cycles were as follows: 94 ° C for 2 minutes; then 30 cycles of 94 ° C (30 seconds), 60 ° C (30 seconds), 68 ° C (30 seconds) and then 68 ° C for 2 minutes. All other steps were carried out according to standard molecular biology protocols.

Oligonucleotide Sequences:

Expression pmEo-C1

Competent E. coli BL21 cells (DE3) were transformed with pmEo-C1 plasmid. Separate colonies from ampicillin (Amp) agar plates were propagated in liquid culture (SB with 150 mM MOPS, pH 7.0, 100 μg / ml Amp, 0.5% glucose) and incubated at 30 ° C. overnight and shaking 220 rpm. Then, overnight culture at a dilution of 1:50 v / v was seeded in 1 L SB (150 mM MOPS; pH 7.0; 100 μg / ml Amp). and grown at 30 ° C and shaking 150 rpm to OD ₆₀₀ = 1.7. Expression was induced with 1 mM IPTG. Cells were harvested after 9 hours of induction by centrifugation at 6,000 rpm for 5 minutes. The cell pellet was suspended in lysis buffer (10 mM Na ₂ HPO ₄ , 30 mM NaCl, 10 mM EDTA and 0.25% tween-20) with 0.8 mg / ml lysozyme, sonicated and treated with benzonase. After centrifugation using RCF 48000 for 20 minutes, the supernatant was separated in 16% PAG and gel expression of eotaxin was confirmed using anti-mouse eotaxin antibody (R&D system) on a Western blot (FIG. 12). The results clearly indicate the expression of eotaxin-C1, which accelerates at an expected molecular weight of 8.8 kD.

The mouse eotaxin-C1 and mouse His-eotaxin-C1 protein sequences were translated from cDNA sequences.

Mouse eotaxin-C1:

Mouse His-eotaxin-C1:

Binding of Mouse Eotaxin-C1 to Qβ Capsid Protein

A solution of 1.48 ml of Qβ capsid protein at a concentration of 6 mg / ml in 20 mM Hepes, 150 mM NaCl, pH 7.2, was reacted with 14.8 μl SMPH (Pierce) for 60 minutes at 25 ° C (from 100 mM stock solution dissolved in DMSO). Then, the reaction solution was dialyzed twice for 3 hours against 2 L of 20 mM Hepes, 150 mM NaCl, pH 7.0 at 4 ° C. 1.3 ml of a solution of mouse protein eotaxin-C1 at a concentration of 3.6 mg / ml in 20 mm Hepes, 150 mm NaCl, pH 7.2, for 1 hour at 25 ° C was subjected to interaction with 9.6 μl TCEP (Pierce ) (from 36 mM stock solution dissolved in H ₂ O). Then 130 μl of derivatized and dialyzed Qβ was reacted with 129 μl of reduced eotaxin-C1 in 241 μl of 20 mM Hepes, 150 mM NaCl, pH 7.0, overnight at 25 ° C. Western blot analysis using anti-Qβ antibody and anti-eotaxin antibody showed covalent binding of eotaxin to Qβ.

B. Immunization of mice with mouse eotaxin-C1 bound to Qβ capsid protein

Female Balb / c mice were vaccinated with murine eotaxin-C1 bound to Qβ capsid protein without the addition of adjuvants. 25 μg of total protein from each sample was diluted in PBS to 200 μl and injected subcutaneously (100 μl on both sides of the abdomen) on day 0 and day 14. Mice were bled from the retroorbital region on day 31, and their serum was analyzed using an eotaxin-specific ELISA.

C. ELISA

5 ELISA plates were coated with mouse eotaxin-C1 at a concentration of 5 μg / ml. The plates were blocked and then incubated with serial dilutions of mouse serum. Bound antibodies were detected using enzyme-labeled anti-mouse IgG antibodies. As a control, the sera of the same mice obtained before immunization were also tested.

EXAMPLE 10

Cloning and expression of interleukin 5 (IL-5) with an N-terminal amino acid linker containing a cysteine residue for binding to VLP and fimbriae

A. Cloning of IL-5 for expression as inclusion bodies in E. coli

IL-5 was amplified from an ATCC clone (pmIL5-4G; ATCC number: 37562) in PCR using the following two primers: Spelinker3-F1 (SEQ ID NO: 340) and Il5StopXho-R (SEQ ID NO: 342). The product of this PCR was used as a template for the second PCR with SpeNlinker3-F2 primers (SEQ ID NO: 341) and Il5StopXho-R. The insert was molded by SpeI and NotI. The insert was ligated into a vector derived from the pET vector (pMODEC3-8 vector), pre-digested with NheI and NotI (not dephosphorylated), and E. coli TG1 cells were transformed. The IL5 construct, created by cloning in the pMODEC3-8 vector, contains a hexahistidine tag at its N-terminus, followed by an enterokinase site, an N-terminal amino acid linker gamma 3 containing a cysteine residue flanked at the C-terminus of AS, and with the end with the ALV sequence, and the mature form of the IL-5 gene. The protein released by enterokinase cleavage is termed “murine C-IL-5-E” (SEQ ID NO: 332). The plasmid DNA of the resulting clone pMODC6-IL5.2 (also called pMODC6-IL5), the sequence of which is confirmed by DNA sequencing, was transformed with E. coli, strain BL21.

Clone pMODC6-IL5 / BL21 was grown overnight in 5 ml LB containing 1 mg / L ampicillin. 2 ml of this culture was diluted in 100 ml of a suitable broth (TB) containing 1 mg / l ampicillin. The culture was induced by adding 0.1 ml of a 1.0 M solution of isopropyl-β-D-thiogalactopyranoside (IPTG) when the culture reached an optical density of OD ₆₀₀ = 0.7. 10 ml samples were taken every 2 hours. Samples were centrifuged for 10 min at 4000 x g. The pellet was resuspended in 0.5 ml of lysis buffer containing 50 mM Tris-HCl, 2 mM EDTA, 0.1% Triton X-100 (pH 8). After adding 20 μl of lysozyme (40 mg / ml) and after incubation of the tube for 30 min at 4 ° C, the cells were sonicated for 2 min. 100 μl of a 50 mM MgCl ₂ solution and 1 ml of benzonase were added. Then the cells were incubated for 30 min at room temperature and centrifuged for 15 min at 13000 x g.

The supernatant was discarded and the precipitate was boiled for 5 min at 98 ° C in 100 μl SDS application buffer. 10 μl of samples in the application buffer was analyzed in SDS-PAGE under reducing conditions. The expression of the IL-5 construct is clearly visible on the gel. Samples were applied to the gel as follows: lane M: marker (NEB, pre-stained marker for a wide range). Lane 1: cell extract of 1 ml culture before induction. Lane 2: cell extract of 1 ml of culture 4 hours after induction.

B. Cloning of IL-5 for expression in mammalian cells (HEK-293T)

a) IL-5 fused at its N-terminus to an amino acid linker containing a cysteine residue and fused at its C-terminus to an Fc fragment

The matrix described in (A) (ATCC clone 37562) was used to clone the following construct. Plasmid pMODB1-IL5 (a derivative of pET) was digested with BamHI / XhoI to obtain a small fragment encoding IL5 fused to the N-terminal amino acid linker containing cysteine. The resulting fragment was ligated into the vector pCEP-SP-XA-Fc * (Δho), which was previously digested with BamHI and XhoI. The ligation product was introduced by electroporation into E. coli strain TG1 and the plasmid DNA of the resulting clone pCEP-SP-IL5-Fc.2, the sequence of which was confirmed by DNA sequencing, was used to transfect HEK-293T cells. The resulting IL-5 construct encoded by this plasmid had the amino acid sequence ADPGCGGGGGGLA fused to the N-terminus of mature IL-5. The specified sequence contains the sequence of the amino acid linker GCGGGGG containing cysteine and flanked by amino acids introduced during the cloning procedure. The IL-5 protein released upon cleavage of the fusion protein with factor Xa is hereinafter referred to as “murine C-IL-5-F” (SEQ ID NO: 333).

After transfection and selection on pyromycin, the culture supernatant was analyzed on a Western blot using an anti-His antibody (mouse) and an anti-mouse IgG antibody conjugated to horseradish peroxidase. The anti-mouse IgG antibody conjugated to horseradish peroxidase also detected Fc fusion proteins. Protein purification was performed by protein A-affinity chromatography. The results clearly indicate expression of the IL-5 construct.

The following samples were applied to the Western blot: lane 1: supernatant of a HEK culture expressing IL5-Fc (20 μl). SDS-PAGE electrophoresis was performed under reducing conditions. Lane 2: supernatant of a HEK culture expressing IL13-Fc (20 μl). SDS-PAGE electrophoresis was performed under non-reducing conditions. Lane 3: supernatant of a HEK culture expressing IL5-Fc (20 μl). SDS-PAGE electrophoresis was performed under non-reducing conditions.

B. IL-5 cloned with GST (glutathione-S-transferase) and an amino acid linker containing a cysteine residue fused to its N-terminus

IL-5 (ATCC 37562) was amplified with Nhe-link1-IL13-F and IL5StopXho-R primers. After cleavage of NheI and XhoI, the insert was ligated into pCEP-SP-GST-EK, which was previously cleaved by NheI and XhoI. The resulting plasmid pCEP-SP-GST-IL5 was sequenced and used to transfect HEK-293T cells. The resulting IL-5 construct encoded by this plasmid had the amino acid sequence LACGGGGG fused to the N-terminus of mature IL-5. The specified sequence contains the sequence of the amino acid linker ACGGGGG containing the cysteine residue and flanked by additional amino acids introduced during the cloning procedure. The protein released upon enterokinase cleavage is hereinafter referred to as “murine C-IL-5-S” (SEQ ID NO: 334). Purification of the resulting protein was carried out by affinity chromatography on glutathione affinity resin.

C. Binding of Mouse C-IL-5-F or Mouse C-IL-5-S to Qβ Capsid Protein

A solution of 120 μM Qβ capsid protein in 20 mM Hepes, 150 mM NaCl, pH 7.2, was reacted for 30 minutes at 25 ° C with a 25-fold molar excess of SMPH (Pierce), diluted from the mother liquor in DMSO, on a swing shaker. Then, the reaction solution was dialyzed twice for 2 hours against 1 L of 20 mM Hepes, 150 mM NaCl, pH 7.2, at 4 ° C. Then, after dialysis, the Qβ reaction mixture was reacted with a solution of mouse C-IL-5-F or mouse C-IL-5-S (final concentrations: 60 μM Qβ capsid protein, 60 μM mouse C-IL-5-F or mouse C -IL-5-S) for four hours at 25 ° C on a rocking shaker. Binding products were analyzed in SDS-PAGE.

D. Binding of mouse C-IL-5-F or mouse C-IL-5-S to capsid protein fr

A solution of 120 μM fr capsid protein in 20 mM Hepes, 150 mM NaCl, pH 7.2, was reacted for 30 minutes at 25 ° C with a 25-fold molar excess of SMPH (Pierce), diluted from the mother liquor in DMSO, on a shaker shaker. Then, the reaction solution was dialyzed twice for 2 hours against 1 L of 20 mM Hepes, 150 mM NaCl, pH 7.2, at 4 ° C. Then, after dialysis, the reaction mixture fr was reacted with a solution of mouse C-IL-5-F or mouse C-IL-5-S (final concentrations: 60 μM protein capsid fr, 60 μM mouse C-IL-5-F or mouse C -IL-5-S) for four hours at 25 ° C on a rocking shaker. Binding products were analyzed in SDS-PAGE.

E. Binding of Mouse C-IL-5-F or Mouse C-IL-5-S in Solution to HBcAg-Lys-2cys-Mut

A solution of 120 μM HBcAg-Lys-2cys-Mut capsid in 20 mM Hepes, 150 mM NaCl, pH 7.2, was reacted for 30 minutes at 25 ° C with a 25-fold molar excess of SMPH (Pierce) diluted from the mother liquor in DMSO, on a rocking shaker. Then, the reaction solution was dialyzed twice for 2 hours against 1 L of 20 mM Hepes, 150 mM NaCl, pH 7.2, at 4 ° C. Then, after dialysis, the HBcAg-Lys-2cys-Mut reaction mixture was reacted with a solution of mouse C-IL-5-F or mouse C-IL-5-S (final concentrations: 60 μM HBcAg-Lys-2cys-Mut, 60 μM mouse C-IL-5-F or murine C-IL-5-S) for four hours at 25 ° C on a shaking shaker. Binding products were analyzed in SDS-PAGE.

F. Binding of mouse C-IL-5-F or mouse C-IL-5-S in solution to fimbriae

A solution of 125 μM E. coli type-1 fimbriae in 20 mM Hepes, pH 7.4, was reacted for 60 minutes with a 50-fold molar excess of cross-linking agent SMPH diluted from the mother liquor in DMSO under CT on a shaking shaker. The reaction mixture was desalted on a PD-10 column (Amersham-Pharmacia Biotech). Protein-containing fractions eluted from the column were pooled and the desalted derivatized fimbriae protein was reacted with mouse C-IL-5-F or mouse C-IL-5-S solution (final concentrations: 60 μM fimbriae, 60 μM mouse C-IL- 5-F or mouse C-IL-5-S) for four hours at 25 ° C on a shaking shaker. Binding products were analyzed in SDS-PAGE.

EXAMPLE 11

Cloning, expression and purification of IL-13 for binding to VLP and fimbriae

A. Cloning and expression of interleukin 13 (IL-13) with an N-terminal amino acid linker containing a cysteine residue for binding to VLP and fimbriae

a) Cloning of mouse IL-13 (HEK-293T) for expression in mammalian cells as an Fc fusion protein

DNA for cloning IL-13 was isolated by RT-PCR from in vitro activated splenocytes, which were prepared as follows: CD4 + T cells were isolated from mouse spleen cells and incubated for 3 days in IMDM (+ 5% FCS + 10 ng / ml IL4) in 6 well plates precoated with anti-CD3 and anti-CD28 antibodies. RNA from these cells was used to amplify IL-13 in one-step RT-PCR (Qiagen single-step PCR kit). Primer XhoIL13-R was used for reverse transcription of RNA, primers NheIL13-F (SEQ ID NO: 338) and XhoIL13-R (SEQ ID NO: 339) were used for PCR amplification of IL13 cDNA. The amplified IL13 cDNA was ligated into the pMOD vector using the NheI / XhoI restriction sites (producing the pMODB1-IL13 vector). pMODB1-IL13 was digested with BamHI / XhoI and the fragment containing IL13 was ligated into the vector pCEP-SP-XA-Fc * (Δho), an analogue of pCEP-SP-XA-Fc *, where the XhoI site at the end of the Fc sequence was deleted, which was previously was split BamHI / XhoI. The plasmid obtained by this ligation (pCEP-SP-IL13-Fc) was sequenced and used to transfect HEK-293T cells. The resulting IL-13 construct encoded by this plasmid had the amino acid sequence ADPGCGGGGGGLA fused to the N-terminus of mature IL-13. The sequence contains the amino acid linker sequence GCGGGGG flanked by additional amino acids introduced during the cloning procedure. IL13-Fc can be purified using protein-A-resin from the supernatant of cells transfected with pCEP-SP-IL13-Fc. The expression result is shown in example 10 in relation to the description of the samples. Mature IL-13 fused at its N-terminus with the above amino acid sequence is released by cleavage of the fusion protein with factor Xa to give a protein, hereinafter referred to as “murine C-IL-13-F” and having the sequence of SEQ ID NO: 328. The result clearly indicates expression of the IL-13 construct.

b) Cloning of murine IL-13 (HEK-293T) for expression in mammalian cells with GST (glutathione-S-transferase) fused to its N-terminus

The cDNA used to clone IL-13 with an N-terminal GST was obtained from cDNA of activated TH2 T cells, as described above in (a). IL-13 was amplified from the indicated cDNA using Nhelink1IL13-F and IL13StopXhoNot-R primers. The PCR product was digested with NheI and XhoI and ligated into the vector pCEP-SP-GST-EK, pre-digested with NheI / XhoI. A plasmid that could be isolated by ligation (pCEP-SP-GST-IL13) was used to transfect HEK-293T cells. The resulting IL-13 construct encoded by this plasmid had the amino acid sequence LACGGGGG fused to the N-terminus of mature IL-13. Said sequence comprises the amino acid linker sequence ACGGGGG flanked by additional amino acids introduced during the cloning procedure. The supernatant of the cell culture transfected with pCEP-SP-GST-IL13 contained the GST-IL-13 fusion protein, which can be purified by glutathione affinity chromatography according to standard protocols. Mature IL-13 fused at its N-terminus with the above amino acid sequence is released by cleaving the fusion protein with enterokinase to give a protein, hereinafter referred to as “murine C-IL-13-S” and having the sequence of SEQ ID NO: 329.

B. Binding of mouse C-IL-13-F, mouse C-IL-13-S to Qβ capsid protein

A solution of 120 μM Qβ capsid in 20 mM Hepes, 150 mM NaCl, pH 7.2, was reacted for 30 minutes at 25 ° C with a 25-fold molar excess of SMPH (Pierce), diluted from the mother liquor in DMSO, on a shaking shaker . Then, the reaction solution was dialyzed twice for 2 hours against 1 L of 20 mM Hepes, 150 mM NaCl, pH 7.2, at 4 ° C. After dialysis, the Qβ reaction mixture was reacted with a solution of mouse C-IL-13-F or mouse C-IL-13-S (final concentrations: 60 μM Qβ capsid protein, 60 μM mouse C-IL-13-F or mouse C- IL-13-S) for four hours at 25 ° C on a shaking shaker. Binding products were analyzed in SDS-PAGE.

C. Binding of mouse C-IL-13-F or mouse C-IL-13-S to fr capsid protein

A solution of 120 μM fr capsid protein in 20 mM Hepes, 150 mM NaCl, pH 7.2, was reacted for 30 minutes at 25 ° C with a 25-fold molar excess of SMPH (Pierce), diluted from the mother liquor in DMSO, on a shaker shaker. Then, the reaction solution was dialyzed twice for 2 hours against 1 L of 20 mM Hepes, 150 mM NaCl, pH 7.2, at 4 ° C. After dialysis, the reaction mixture fr was reacted with a solution of mouse C-IL-13-F or mouse C-IL-13-S (final concentrations: 60 μM protein capsid fr, 60 μM mouse C-IL-13-F or mouse C- IL-13-S) for four hours at 25 ° C on a shaking shaker. Binding products were analyzed in SDS-PAGE.

D. Binding of Mouse C-IL-13-F or Mouse C-IL-13-S in Solution to HBcAg-Lys-2cys-Mut

A solution of 120 μM HBcAg-Lys-2cys-Mut capsid in 20 mM Hepes, 150 mM NaCl, pH 7.2, was reacted for 30 minutes at 25 ° C with a 25-fold molar excess of SMPH (Pierce) diluted from the mother liquor in DMSO, on a rocking shaker. Then, the reaction solution was dialyzed twice for 2 hours against 1 L of 20 mM Hepes, 150 mM NaCl, pH 7.2, at 4 ° C. After dialysis, the HBcAg-Lys-2cys-Mut reaction mixture was reacted with a solution of mouse C-IL-13-F or mouse C-IL-13-S (final concentrations: 60 μM HBcAg-Lys-2cys-Mut, 60 μM mouse C -IL-13-F or mouse C-IL-13-S) for four hours at 25 ° C on a shaking shaker. Binding products were analyzed in SDS-PAGE.

E. Binding of mouse C-IL-13-F or mouse C-IL-13-S in solution to fimbriae

A solution of 125 μM E. coli type-1 fimbriae in 20 mM Hepes, pH 7.4, was reacted for 60 minutes with a 50-fold molar excess of cross-linking agent SMPH diluted from the mother liquor in DMSO under CT on a shaking shaker. The reaction mixture was desalted on a PD-10 column (Amersham-Pharmacia Biotech). Protein-containing fractions eluted from the column were combined and the desalted derivatized fimbriae protein was reacted with a solution of mouse C-IL-13-F or mouse C-IL-13-S (final concentrations: 60 μM fimbriae, 60 μM mouse C-IL- 13-F or mouse C-IL-13-S) for four hours at 25 ° C on a shaking shaker. Binding products were analyzed in SDS-PAGE.

Now, based on a full description of the present invention with some details, using illustrations and examples for the purposes of a clear understanding for a person skilled in the art, it will be obvious that the same can be done by modifying or modifying the invention within wide and equivalent ranges of conditions, compositions and other parameters, without affecting the scope of the invention or any particular variant thereof, and that it is intended that such modifications or changes fall within the scope of the appended claims.

All publications, patents and patent applications referred to in this description are an indicator of the level of specialist in the field to which this invention relates, and are incorporated by reference to the same extent as in the case when it is separately indicated that each individual the publication, patent, or patent application is incorporated by reference.

Claims (44)

1. The composition intended for immunization, containing (a) a virus-like particle; and (b) at least one antigen or antigenic determinant, wherein said antigen or said antigenic determinant is a protein or peptide of IL-13 or eotaxin and wherein said at least one antigen or antigenic determinant is associated with said virus-like particle. 2. The composition according to claim 1, where the specified virus-like particle contains recombinant proteins or their fragments selected from the group consisting of (a) recombinant hepatitis B virus proteins; (b) recombinant measles virus proteins; (c) recombinant Sindbis virus proteins; (d) recombinant rotavirus proteins; (e) recombinant FMD virus proteins; (f) recombinant retrovirus proteins; (g) recombinant Norwalk virus proteins; (h) recombinant alpha virus viruses; (i) recombinant human papillomavirus proteins; (j) recombinant polyoma virus proteins; (k) recombinant bacteriophage proteins; (l) recombinant proteins of RNA phages; (m) recombinant Tu proteins; (n) fragments of any of the recombinant proteins from (a) to (m). 3. The composition according to claim 1, where the specified virus-like particle contains recombinant proteins or their fragments selected from the group consisting of (a) recombinant hepatitis B virus proteins; (b) recombinant proteins of RNA phages. 4. The composition according to claim 1, where the specified virus-like particle is a core antigen of hepatitis B. 5. The composition of claim 1, wherein said virus-like particle is a virus-like particle of an RNA phage. 6. The composition according to claim 1, where the specified virus-like particle contains recombinant proteins of RNA phage or fragments thereof, where the specified RNA phage is preferably selected from the group consisting of (a) bacteriophage Qβ; (b) bacteriophage R17; (c) bacteriophage fr; (d) bacteriophage GA; (e) bacteriophage SP; (f) bacteriophage MS2; (g) bacteriophage M11; (h) bacteriophage MX1; (i) bacteriophage NL95; (j) bacteriophage f2; (k) bacteriophage PP7; and (l) bacteriophage AP205. 7. The composition according to claim 1, where the specified virus-like particle contains recombinant proteins or fragments of RNA phage Qβ, RNA phage fr or RNA phage AP205 and where the specified virus-like particle preferably contains recombinant proteins of the RNA phage Qβ or fragments thereof. 8. The composition according to claim 1, wherein said at least one antigen or antigenic determinant is associated with said virus-like particle of at least one covalent bond, said covalent bond being preferably a non-peptide bond. 9. The composition according to claim 1, where the specified antigen or antigenic determinant is a protein or peptide of IL-13 and where the specified protein or peptide of IL-13 preferably contains or alternatively consists of an amino acid sequence selected from the group consisting of (a) the amino acid sequence of SEQ ID NO: 230; (b) the amino acid sequence of SEQ ID NO: 231; and (c) the amino acid sequence of a fragment of any of the sequences of SEQ ID NO: 230 or 231. 10. The composition according to claim 1, where the specified antigen or antigenic determinant is a protein or peptide of eotaxin, and where the specified protein or peptide of eotoxin preferably contains or alternatively consists of an amino acid sequence selected from the group consisting of (a) the amino acid sequence of SEQ ID NO: 242; (b) the amino acid sequence of SEQ ID NO: 243; (c) the amino acid sequence of SEQ ID NO: 244; and (d) the amino acid sequence of a fragment of any of the sequences of SEQ ID NO: 242, 243 or 244. 11. The composition according to claim 1, where the specified antigen or antigenic determinant is a protein or peptide of IL-13 or eotaxin containing at least one antigenic site of a protein or peptide of IL-13 or eotoxin. 12. The composition according to claim 1, where the specified virus-like particle contains at least one first binding site and where the specified antigen or antigenic determinant further comprises at least one second binding site selected from the group consisting of (i) a non-naturally occurring binding site to said antigen or antigenic determinant; and (ii) a naturally occurring binding site with said antigen or antigenic determinant, wherein said second binding site is capable of association with said first binding site and where said antigen or antigenic determinant and said virus-like particle interact through said association to form an ordered and repeating antigenic matrix. 13. The composition of claim 12, wherein said antigen or antigenic determinant is an IL-13 protein or peptide and where said antigen or antigenic determinant with said at least second binding site comprises or alternatively consists of an amino acid sequence selected from the group consisting of (a) the amino acid sequence of SEQ ID NO: 330; (b) the amino acid sequence of SEQ ID NO: 331; and (c) the amino acid sequence of a fragment of any of the sequences of SEQ ID NO: 330 or 331. 14. The composition of claim 12, wherein said first binding site is a lysine residue. 15. The composition of claim 12, wherein said second binding site contains a sulfhydryl group or a cysteine residue. 16. The composition of claim 12, wherein said first binding site is a lysine residue and said second binding site is a cysteine residue. 17. The composition intended for immunization, containing (a) a virus-like particle of an RNA phage; and (b) at least one antigen or antigenic determinant, wherein said antigen or said antigenic determinant is an IL-5 protein or peptide, and where the specified at least one antigen or antigenic determinant is associated with the specified virus-like particle of at least one non-peptide covalent bond. 18. The composition of claim 17, wherein said virus-like particle comprises recombinant RNA phage proteins or fragments thereof, wherein said RNA phage is preferably selected from the group consisting of (a) bacteriophage Qβ; (b) bacteriophage R17; (c) bacteriophage fr; (d) bacteriophage GA; (e) bacteriophage SP; (f) bacteriophage MS2; (g) bacteriophage M11; (h) bacteriophage MX1; (i) bacteriophage NL95; (j) bacteriophage f2; (k) bacteriophage PP7; and (l) bacteriophage AP205. 19. The composition of claim 17, wherein said virus-like particle contains recombinant proteins or fragments thereof of RNA phage Qβ, RNA phage fr or RNA phage AP205, and wherein said virus-like particle preferably contains recombinant proteins of RNA phage Qβ or fragments thereof. 20. The composition of claim 17, wherein said at least one antigen or antigenic determinant is coupled to said virus-like particle of at least one covalent bond, said covalent bond being preferably a non-peptide bond. 21. The composition of claim 17, wherein said antigen or antigenic determinant is an IL-5 protein or peptide and wherein said IL-5 protein or peptide preferably contains or alternatively consists of an amino acid sequence selected from the group consisting of (a) the amino acid sequence of SEQ ID NO: 233; (b) the amino acid sequence of SEQ ID NO: 234; and (c) the amino acid sequence of a fragment of any of the sequences of SEQ ID NO: 233 or 234. 22. The composition of claim 17, wherein said antigen or antigenic determinant is an IL-5 protein or peptide comprising at least one antigenic site of an IL-5 protein or peptide. 23. The composition of claim 17, wherein said virus-like particle comprises at least one first binding site and wherein said antigen or antigenic determinant further comprises at least one second binding site selected from the group consisting of (i) a non-naturally occurring binding site to said antigen or antigenic determinant; and (ii) a naturally occurring binding site with said antigen or antigenic determinant, wherein said second binding site is capable of association with said first binding site and where said antigen or antigenic determinant and said virus-like particle interact through said association to form an ordered and repeating antigenic matrix. 24. The composition according to item 23, where the specified antigen or antigenic determinant is a protein or peptide of IL-5 and where the specified antigen or antigenic determinant with the specified at least the second binding site contains or alternatively consists of an amino acid sequence selected from the group consisting of (a) the amino acid sequence of SEQ ID NO: 335; (b) the amino acid sequence of SEQ ID NO: 336; and (c) the amino acid sequence of SEQ ID NO: 337; (d) the amino acid sequence of a fragment of any of the sequences of SEQ ID NO: 335-337. 25. The composition of claim 23, wherein said first binding site is a lysine residue. 26. The composition according to item 23, where the specified second binding site contains a sulfhydryl group or a cysteine residue. 27. The composition of claim 23, wherein said first binding site is a lysine residue and said second binding site is a cysteine residue. 28. The pharmaceutical composition intended for immunization, containing (a) the composition according to claim 1 or 17; and (b) a pharmaceutically acceptable carrier. 29. A vaccine composition for immunization, containing the composition, where the specified composition contains (a) a virus-like particle; and (b) at least one antigen or antigenic determinant, wherein said antigen or said antigenic determinant is a protein or peptide of IL-13 or eotaxin and wherein said at least one antigen or antigenic determinant is associated with said virus-like particle, preferably said vaccine composition additionally contains adjuvant. 30. The vaccine composition according to clause 29, wherein said virus-like particle contains recombinant RNA phage proteins or fragments thereof, said virus-like particle preferably contains recombinant proteins or fragments thereof of Qβ RNA phage, fr RNA phage or AP205 RNA phage. 31. The vaccine composition according to clause 29, where the specified at least one antigen or the specified antigenic determinant is associated with the specified virus-like particle of at least one covalent bond and where the specified covalent bond is a non-peptide bond. 32. A vaccine composition for immunization containing a composition, wherein said composition contains (a) a virus-like particle of an RNA phage; and (b) at least one antigen or antigenic determinant, wherein said antigen or said antigenic determinant is an IL-5 protein or peptide and wherein said at least one antigen or antigenic determinant is associated with said at least one non-peptide covalent bond, where preferably the specified vaccine composition further comprises an adjuvant. 33. The vaccine composition of claim 32, wherein said virus-like particle comprises recombinant RNA phage proteins or fragments thereof, said virus-like particle preferably contains recombinant proteins or fragments thereof of Qβ RNA phage, fr RNA phage or AP205 RNA phage. 34. The vaccine composition of claim 32, wherein said at least one antigen or said antigenic determinant is coupled to said virus-like particle of at least one covalent bond and wherein said covalent bond is a non-peptide bond. 35. A method of obtaining a composition according to claim 1, including (a) obtaining a virus-like particle; and (b) obtaining at least one antigen or antigenic determinant, wherein said antigen or antigenic determinant is a protein or peptide of IL-13 or eotaxin; (c) combining said virus-like particle and said at least one antigen or antigenic determinant so that said at least one antigen or antigenic determinant is associated with said virus-like particle. 36. The composition intended for immunization, containing (a) at least one first core particle and at least one second core particle, each of which contains at least one first binding site; and (b) at least one first antigen or antigenic determinant and at least one second antigen or antigenic determinant, of which contains at least one second binding site, wherein said at least one first antigen or antigenic determinant and at least one one second antigen or antigenic determinant selected from a protein or peptide of IL-5, IL-13 or eotaxin and where the specified second binding site is selected from the group consisting of (i) a non-naturally occurring binding site to said antigen or antigenic determinant; and (ii) a naturally occurring binding site with said antigen or antigenic determinant, wherein said second binding site is capable of association with said first binding site and wherein said at least one first and said at least one second antigen or antigenic determinant and said at least one first and said at least one second core particle interact by the specified association, forming ordered and repeating antigenic matrices. 37. The composition according to clause 36, where the specified at least one first antigen or antigenic determinant is a protein or peptide of IL-5 and where the specified at least one second antigen or antigenic determinant is a protein or peptide of IL-13. 38. The composition of claim 36, wherein said at least one first core particle and said at least one second core particle is a recombinant virus-like particle, and wherein said at least one first core particle and said at least one second core particle preferably it is the same recombinant virus-like particle, and even more preferably, if the specified virus-like particle contains recombinant RNA phage proteins or fragments thereof, where the specified RNA phage is preferred but selected from the group consisting of (a) bacteriophage Qβ; (b) bacteriophage R17; (c) bacteriophage fr; (d) bacteriophage GA; (e) bacteriophage SP; (t) bacteriophage MS2; (g) bacteriophage M11; (h) bacteriophage MX1; (i) bacteriophage NL95; (j) bacteriophage f2; (k) bacteriophage PP7; and (l) bacteriophage AP205. 39. An immunization method comprising administering a composition according to any one of claim 1, 17 or 36 to an animal or human, wherein said antigen or antigenic determinant is preferably an autoantigen and wherein said antigen or antigenic determinant is a protein or peptide of human IL-5, human IL -13 or human eotaxin. 40. The use of a composition according to any one of claims 1, 17 or 36 for the manufacture of a medicament for the treatment of allergic eosinophilic diseases. Priority on points: 11/07/2001 according to claims 1-5, 6 (a-j), 7-10, 12, 14-17, 18 (a-j), 19-21, 23, 25-35, 39, 40; 01/18/2002 according to claims 6 (k), 13, 18 (k), 24; 01/21/2002 according to claims 6 (k), 13, 18 (k), 24; 07/19/2002 according to claims 6 (l), 7, 11, 18 (b), 19, 22, 30, 33, 36-40.

Images