RU2322258C2 - Antigen matrix for treatment of bone disease - Google Patents

Abstract

FIELD: medicine, virology, immunology, molecular biology.

SUBSTANCE: invention involves a composition comprising a regulated and repeated matrix of antigens or antigen determinants and, in particular, matrix comprising RANKL protein, RANKL fragment or RANKL-VLP peptide. Invention relates to a composition comprising viral-like particle and at least one RANKL protein, RANKL fragment or RANKL peptide bound with its, and to a method for preparing conjugates and regulated and repeated matrices, respectively. Proposed compositions can be used for preparing vaccines used in treatment of bone diseases and as a pharmaceutical vaccine used for prophylaxis or treatment of bone diseases, and for effective induction of immune responses, in particular, humoral responses. The advantage of invention involves enhancing induction of immune responses to RANKL protein.

EFFECT: valuable biological and medicinal properties of matrices.

28 cl, 7 dwg, 20 ex

Description

BACKGROUND OF THE INVENTION

Field of Invention

This invention relates to the fields of molecular biology, virology, immunology and medicine. The invention relates to a composition comprising an ordered and repeating matrix of antigens or antigenic determinants, and in particular, a matrix of a RANKL protein, RANKL fragment or RANKL peptide. More specifically, the invention relates to a composition comprising a virus-like particle and at least one RANKL protein, a RANKL fragment, or a RANKL peptide associated with it. The invention also relates to a method for producing conjugates and, accordingly, ordered and repeating matrices. The compositions of the invention are useful in the preparation of vaccines for the treatment of bone diseases and as a pharmaceutical vaccine for the prevention or treatment of bone diseases and for the effective induction of immune responses, in particular humoral responses. In addition, the compositions of the invention are particularly useful for the effective induction of autoantigen-specific immune responses in this context.

Linked Area

Live bone is constantly being updated as a result of balanced and coordinated remodeling processes. Basically, two types of cells contribute to this remodeling: osteoblasts are necessary for bone formation, while osteoclasts stimulate the breakdown of the bone matrix and the solubilization of hydroxyapatite. In young people with growing bones, the rate of bone formation exceeds the rate of bone resorption, while in older people, the rate of resorption may exceed formation and lead to a net loss of bone mineral density and / or bone mass. In the latter case, bone strength weakens, and this leads to an increased risk of fractures, as well as a slow and incomplete restoration of broken bones. It is known that many conditions in humans are associated with an imbalance in bone remodeling.

Recently, three proteins have been described, which are key proteins involved in the formation of osteoclasts from hematopoietic progenitor cells and in the regulation of bone remodeling. RANKL (NFkB receptor activator ligand), also called TNFSF11 (representative of the 11th tumor necrosis factor superfamily), TRANCE (TNF-related inducible cytokine activation), ODF (osteoclast differentiation factor) or OPGL (osteoprotegerin ligand), is a transmembrane protein of 24 amino acids that forms homotrimers. Part of the extracellular region of RANKL can be removed by a TACE-like protease. In addition, splicing options are described in which there is no transmembrane region. The deleted portion of RANKL contains a domain that is highly homologous to TNF-α (Lum, L., et al., J. Biol. Chem. 274: 13613-13618 (2000)).

Methods for producing RANKL protein and RANKL fragments are described in WO 9846751, US 5843678, WO 98259958, US 6242586, WO 9828426, US 6242213, WO 9929865, JP 2000102390 and WO 0015807.

RANKL interacts with a transmembrane molecule on osteoclasts called RANK (NFkB receptor activator). This interaction leads to the activation of the osteoclast precursor and ends with the formation of active bone resorbing osteoclasts. In vivo, a soluble trap receptor called osteoprotegerin is involved in the regulation of osteoclastogenesis due to its ability to bind to RANKL and inhibit the interaction of RANKL with its RANK receptor. Said inhibition results in suppression of osteoclastogenesis and, thus, provides a method for stopping excessive bone resorption. The interaction of RANKL with its receptor RANK can be suppressed by recombinant osteoprotegerin and soluble RANK-Fc fusion protein. According to observations, RANKL- and RANK-deficient mice develop osteopetrosis, while overexpressing RANKL transgenic mice, as well as osteoprotegerin deficient mice, develop osteoporosis (Kong YY., Et al., Nature 397: 315-322 ( 1999), Kim, N., et al., Proc. Natl. Acad. Sci USA 97: 10905-10910 (2000), Dougall, B., et al., Proc. Natl. Acad. Sci USA 97: 1566- 1571 (1999), Bucay, N., et al., Genes Dev. 12: 1260-1268 (1998)).

The importance of the RANKL-RANK-osteoprotegerin system is furthermore confirmed in an animal model of rodent-induced osteoporosis induced by estrogen deficiency. Recombinant osteoprotegerin completely abolished ovariectomy-induced bone loss (Simonet, W. S., et al. Cell 89: 309-319 (1997).

In the adjuvant-induced arthritis model, osteoprotegerin injection could prevent bone loss and cartilage destruction, but not inflammation (paw swelling). In addition to expression on stromal cells, RANKL is also expressed on T cells, and RANK is detected on antigen-presenting cells. During an arthritic reaction, activated T cells with increased RANKL expression are thought to mediate increased osteoclastogenesis and subsequent bone loss. The interaction of RANKL with RANK also increases the longevity and adjuvant properties of dendritic cells (Kong Y. Y., et al., Nature 402: 304-309 (1999)).

Destruction of the alveolar bone and subsequent loss of teeth is observed with periodontal infections. In vivo inhibition of osteoprotegerin function reduces the destruction of the alveolar bone and reduces the number of periodontal osteoclasts after infection by microbes (Teng, Y.T.A., et al., J. Clin. Invest. 106: R59-R67 (2000).

Bone tumors and some tumor metastases are characterized by increased bone resorption due to increased osteoclastogenesis (Hofbauer, LC and Heufelder AE, J. Clin. Endocrin. Met. 85: 2355-2363 (2000). Osteoprotegerin has been shown to inhibit prostate cancer-induced osteoclastogenesis and prevent growth prostate tumors in mouse bones (Zhang Y., et al., J. Clin. Invest. 107: 1219-1220 (2001). It also reduces pain in advanced bone cancer in mice (Luger NM, et al., Cancer Res 61: 4038-4047 (2001)). Multiple myeloma is a malignant B-cell disease characterized by by plasma plasma cells in the bone marrow and the development of osteolytic bone disease In the mouse models of multiple myeloma, injection of osteoprotegerin or RANK-Fc fusion protein prevented the development of lytic bone damage and prevented the progression of myeloma (Pearse RN., et al., Proc. Natl. Acad. Sci. USA 98: 11581-11586 (2001).

Central to the etiology of aseptic weakening of prostate implants is periprostatic osteolysis at the bone-implant border, which is caused by inflammation induced by wear particles. Fibroblast-like synoviocytes transfected with osteoprotegerin were able to prevent particle-induced osteoclastogenesis in a mouse model (Gouter J.J., et al., J. Orthop. Res. 202: 169-173 (2002)).

Vascular calcification is observed with a high clinical frequency in the population of patients with osteoporosis. The involvement of the RANKL-RANK-osteoprotegerin system has been shown by detecting that calcification of arteries was observed in mice with osteoprotegerin deficiency, which could be reversible using recombinant osteoprotegerin (Min, H., et al., J. Exp. Med. 192: 463- 474 (2000)).

All these data indicate the key importance of the RANKL-RANK-osteoprotegerin system in the regulation of bone resorption in various pathological conditions. To date, inhibition of bone loss is mainly indicated by injection of recombinant osteoprotegerin or RANK-Fc fusion protein. Theoretically, immunization of an animal with RANKL should provide for the production of RANKL-specific antibodies that, by binding to the RANK binding site or steric inhibition, should prevent osteoclastogenesis.

However, to date, nothing has been reported about vaccination with the RANKL protein or peptide. Moreover, there is no evidence that vaccines can be effective in protecting against bone diseases, since, in particular, it is usually difficult to induce humoral responses to own molecules as a result of routine vaccination.

One way to increase the effectiveness of vaccination is to increase the degree of repeatability of the antigen used. Unlike isolated proteins, viruses induce immediate and effective immune responses in the absence of any adjuvants, either with or without T cells (Bachmann and Zinkernagel, Ann. Rev. Immunol. 15: 235-270 (1991)) . Although viruses often consist of a small amount of proteins, they are able to trigger much stronger immune responses than their isolated components. In the case of B-cell responses, it is known that one of the key factors for the immunogenicity of viruses is the frequency and order of surface epitopes. Many viruses have a quasicrystalline surface on which a regular epitope matrix is exposed that effectively cross-binds epitope-specific immunoglobulins on B cells (Bachmann and Zinkernagel, Immunol. Today 17: 553-558 (1996)). This cross-linking of surface immunoglobulins on B cells is a potent activation signal that directly induces cell cycle progression and production of IgM antibodies. In addition, such stimulated B cells are capable of activating helper T cells, which, in turn, induce a switch from production of IgM-antibodies to production of IgG-antibodies in B-cells and the formation of long-lived memory B-cells - the goal of any vaccination (Bachmann and Zinkernagel, Ann. Rev. Immunol. 15: 235-270 (1997)). The viral structure is even associated with the formation of anti-antibodies that occur in autoimmune disease and are part of the natural response to pathogens (see Fehr, T., et al., J Exp. Med. 185: 1785-1792 (1997)). Thus, antibodies presented on a highly organized viral surface are capable of inducing potent responses in the form of anti-antibodies.

However, as indicated, usually the immune system cannot produce antibodies against the structures of its own body. In the case of soluble antigens present in low concentration, this is a consequence of tolerance at the level of Th cells. Under such conditions, the binding of autoantigen to a carrier that can provide T-assistance can impair tolerance. For soluble proteins present in high concentrations or membrane proteins in low concentrations, B and Th cells may be tolerant. However, B-cell tolerance may be reversible (anergy) and may be impaired by the administration of a highly organized antigen bound to a foreign carrier (Bachmann and Zinkernagel, Ann. Rev. Immunol. 15: 235-270 (1997)).

SUMMARY OF THE INVENTION

The authors found that RANKL proteins, RANKL fragments, or RANKL peptides that bind to a central particle having a structure with its inherent repetitive organization and, in particular, to virus-like particles (VLPs) and VLP subunits, respectively, leading to the formation of highly ordered and repeated conjugates are effective immunogens for the induction of antibodies specific for RANKL. Antibodies are able, respectively, to block and neutralize the interaction of RANKL with its receptor RANK. Thus, this invention relates to a therapeutic method for treating bone diseases, which is based on an ordered and repeating matrix of a RANKL-central particle, and, in particular, to a VLP-RANKL-conjugate and a matrix, respectively. Said therapeutic agent is capable of inducing high titers of anti-RANKL antibodies in a vaccinated animal.

Thus, the present invention relates to a composition comprising (a) a central particle with at least one first binding site; and (b) at least one antigen or antigenic determinant with at least one second binding site, wherein said antigen or antigenic determinant is a RANKL protein, a RANKL fragment, or a RANKL peptide and where said second binding site is selected from the group consisting of (i ) a binding site of non-natural origin with the specified antigen or antigenic determinant; and (ii) a naturally occurring binding site with said antigen or antigenic determinant, wherein said second binding site is capable of association with said first binding site; and wherein said antigen or antigenic determinant and said central particle interact through said association to form an ordered and repeating antigenic matrix. Preferred variants of the central particles suitable for use in this invention are a virus, virus-like particle, bacteriophage, bacterial fimbria or flagellum, or any other central particle having an inherent repeating structure capable of forming an ordered and repeating antigenic matrix according to this invention.

More specifically, the invention relates to a composition comprising an ordered and repeating matrix of antigens or antigenic determinants, and thus, in particular, RANKL-protein conjugates, RANKL-fragment or RANKL-VLP peptide. More specifically, the invention relates to a composition comprising a virus-like particle and at least one RANKL protein, a RANKL fragment, or a RANKL peptide associated with it. The invention also relates to a method for producing conjugates and ordered and repeating matrices, respectively. The compositions of the invention are useful in the preparation of vaccines for the treatment of bone diseases and as pharmaceutical vaccines for the prevention or treatment of bone diseases and for the effective induction of immune responses, in particular humoral responses. In addition, the compositions of the invention are particularly useful for the effective induction of autoantigen-specific immune responses in this context.

In the present invention, the RANKL protein, RANKL fragment, or RANKL peptide is usually bound to the central particle and, accordingly, to the VLP in an oriented manner, forming an ordered and repeating matrix of antigens of the RANKL protein, RANKL fragment, or RANKL peptide. In addition, the highly repetitive and organized structure of the central particles and, accordingly, VLP mediates the exposure of the RANKL protein, RANKL fragment or RANKL peptide in a highly ordered and repetitive manner, leading to the formation of a highly organized and repeating antigenic matrix. In addition, the binding of the RANKL protein, RANKL fragment, or RANKL peptide to the central particle and, accordingly, to VLP provides epitopes of helper T cells, since the central particle and VLP are foreign to the host immunized with the central particle-protein RANKL matrix, RANKL fragment or RANKL peptide and, accordingly, RANKL VLP protein, RANKL fragment or RANKL peptide. These matrices differ from prior art conjugates in their highly organized structure, size and repeatability of antigen on the matrix surface.

In one aspect of the invention, the RANKL protein, RANKL fragment or RANKL peptide is expressed in a suitable expression host compatible with the proper folding of the RANKL protein or RANKL fragment, or synthesized, while the central particle and, accordingly, VLP are expressed and purified from an expression host suitable for laying and assembling the central particle and, accordingly, VLP. The RANKL protein, RANKL fragment, or RANKL peptide can also be synthesized chemically. A matrix of the RANKL protein, RANKL fragment or RANKL peptide is then assembled by binding the RANKL protein, RANKL fragment or RANKL peptide to the central particle and, accordingly, to VLP.

In another aspect, the invention relates to a composition comprising (a) a virus-like particle and (b) at least one antigen or antigenic determinant, wherein said antigen or said antigenic determinant is a RANKL protein, RANKL fragment or RANKL peptide and where at least one antigen or antigenic determinant is associated with a virus-like particle.

In a further aspect, the invention relates to a pharmaceutical composition comprising (a) the composition according to claim 1 or claim 22 and (b) an acceptable pharmaceutical carrier.

In yet another aspect, the invention provides a vaccine composition comprising a composition comprising (a) a central particle with at least one first binding site; and (b) at least one antigen or antigenic determinant with at least one second binding site, wherein said antigen or antigenic determinant is a RANKL protein, a RANKL fragment, or a RANKL peptide and where said second binding site is selected from the group consisting of (i ) a binding site of non-natural origin with the specified antigen or antigenic determinant; and (ii) a naturally occurring binding site with said antigen or antigenic determinant, wherein said second binding site is capable of association with said first binding site; and wherein said antigen or antigenic determinant and said central particle interact through said association to form an ordered and repeating antigenic matrix.

In a further aspect, the invention relates to a vaccine composition comprising a composition, wherein said composition comprises (a) a virus-like particle; and (b) at least one antigen or antigenic determinant, wherein said antigen or said antigenic determinant is a RANKL protein, a RANKL fragment, or a RANKL peptide; and wherein said at least one antigen or antigenic determinant is associated with said virus-like particle.

In another aspect, this invention relates to a method for producing a composition according to claim 1, including (a) obtaining a virus-like particle; and (b) obtaining at least one antigen or antigenic determinant, wherein said antigen or said antigenic determinant is a RANKL protein, a RANKL fragment, or a RANKL peptide; (c) combining said virus-like particle and said at least one antigen or antigenic determinant such that said at least one antigen or antigenic determinant is associated with said virus-like particle.

In another aspect, this invention relates to a method for producing a composition according to item 22, including (a) obtaining a central particle with at least one first binding site; (b) obtaining at least one antigen or antigenic determinant with at least one second binding site, wherein said antigen or antigenic determinant is a RANKL protein, a RANKL fragment or a RANKL peptide and where said second binding site is selected from the group consisting of (i ) a binding site of non-natural origin with the specified antigen or antigenic determinant; and (ii) a binding site of natural origin with the specified antigen or antigenic determinant; and wherein said second binding site is capable of associating with said first binding site; and (c) combining said central particle and said at least one antigen or antigenic determinant, wherein said antigen or antigenic determinant and said central particle interact by said association to form an ordered and repeating antigenic matrix.

In another aspect, the invention relates to a method of immunization, comprising administering a composition according to claim 1 or claim 22 to an animal or human.

In a further aspect, the invention relates to the use of a composition according to claim 1 or claim 22 for the manufacture of a medicament for the treatment of bone diseases.

In another aspect, this invention relates to the use of a composition according to claim 1 or claim 22 for the manufacture of a medicament for the therapeutic or prophylactic treatment of bone diseases, preferably mammalian encephalopathies. In addition, in another aspect, the invention relates to the use of a composition according to claim 1 or claim 22, either alone or in combination with other agents, for the manufacture of a composition, vaccine, drug or medicament for the treatment or prevention of bone diseases, in particularly mammalian encephalopathies, and / or for stimulating the mammalian immune system.

Thus, the invention, in particular, relates to vaccine compositions that are suitable for the prevention and / or weakening of bone diseases or related conditions. The invention also relates to methods of immunization and vaccination, respectively, for the prevention and / or weakening of bone diseases and related conditions in animals, in particular in cows, sheep and cattle, as well as in humans. The compositions of the invention can be used prophylactically or therapeutically.

In specific embodiments, the invention relates to methods for preventing and / or attenuating bone diseases or related conditions that are caused or exacerbated by the products of “native” genes, i.e. as used herein, “autoantigens”. In related embodiments, the invention relates to methods for inducing immunological responses in animals and humans, respectively, which lead to the production of antibodies that prevent and / or weaken bone diseases or related conditions that are caused or exacerbated by the products of “native” genes.

As will be understood by one of skill in the art, when the compositions of the invention are administered to an animal or human, they can be in a composition that contains salts, buffers, adjuvants, or other substances that are required to increase the effectiveness of the composition. Examples of substances suitable for use in the manufacture of pharmaceutical compositions are provided in many sources, including Remington's Pharmaceutical Sciences (Osol, A, ed., Mack Publishing Co. (1990)).

The compositions of the invention are said to be “pharmacologically acceptable” if administration to a human recipient can be permissible. In addition, the compositions of the invention will be administered in a “therapeutically effective amount” (ie, in an amount that produces the desired physiological effect).

The compositions of the invention can be administered by various methods known in the art, but will usually be administered by injection, infusion, inhalation, oral administration, or other suitable physical methods. Alternatively, the compositions may be administered intramuscularly, intravenously or subcutaneously. The components of the compositions for administration include sterile aqueous solutions (e.g., physiological saline) or non-aqueous solutions and suspensions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption.

Other variations of the present invention will be apparent to those skilled in the art in light of what is known in the art, of the following drawings and description of the invention and claims.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the expression and purification of C-RANKL. Purification of C-RANKL was analyzed on an SDS gel under reducing conditions. The gel was stained with Coomassie brilliant blue. The molecular weights of marker proteins are shown in the left margin. Lane 1: low molecular weight marker. Lane 2 and 3: supernatant of cell lysates of BL21 / DE3 cells transformed with the empty vector pGEX6p1 and pGEX-RANKL, respectively, after sixteen hours of induction with IPTG 0.4 mM. Lane 4: purified GST-PS-C-RANKL protein after the GF capture column FF. Lane 5: Fraction not associated with the FF column capturing the GST. Lane 6: purified GST-PS-C-RANKL protein after digestion with PreScission protease. Lane 7: an unbound fraction from a GF trap FF column onto which a GST-RANKL cleavage product that contains purified C-RANKL was applied. Lane 8: the bound fraction from a GF-trapping FF column onto which a GST-PS-C-RANKL cleavage product was applied and eluted with GSH.

Figure 2 shows the expression and purification of RANKL-C.

2A shows the purification of GST-EK-RANKL-C. Protein samples were analyzed in SDS-PAGE under reducing conditions. The gel was stained with Coomassie brilliant blue. The molecular weights of marker proteins are shown in the left margin. Lane 1: pre-stained protein marker for a wide range (New England Biolabs). Lane 2: clarified cell lysate of BL21 / DE3 cells transformed with plasmid pMod-GST-EK-mRANKL-C1 after induction overnight using 0.1 mM IPTG. Lane 3: flow through a GF-trapping column FF loaded with a clarified lysate from lane 2. Lane 4: first flushing of a GF-trapping column FF. Lane 5: second flushing of the FF column capturing the GST. Lane 6: third wash of the FF column capturing the GST. Lanes 7-15: Eluted fractions 1-9 from the GF trapping FF column containing purified GST-EK-RANKL-C fusion protein and a small amount of GST-EK protein.

FIG. 2B shows the cleavage of GST-EK-RANKL-C with EnterTM kinase Max ^™ .

The cleavage of GST-EK-RANKL-C was analyzed in SDS-PAGE under reducing conditions. The gel was stained with Coomassie brilliant blue. The molecular weights of marker proteins are shown in the left margin. Lane 1: pre-stained protein marker for a wide range (New England Biolabs). Lane 2: Purified GST-EK-RANKL-C Fusion Protein. Lane 3: cleavage products after 16 hours of incubation at 4 ° C with Max ^TM enterokinase.

2C shows the purification of RANKL-C.

Purification of RANKL-C after removal of GST-EK by affinity chromatography on glutathione-sepharose was analyzed in SDS-PAGE under reducing conditions. The gel was stained with Coomassie brilliant blue. The molecular weights of marker proteins are shown in the left margin. Lane 1: pre-stained protein marker for a wide range (New England Biolabs). Lane 2 and 3: GST-EK and RANKL-C cleavage products after 16 hours of incubation of GST-EK-RANKL-C at 4 ° C with Max ^TM enterokinase. Lane 4 and 5: various amounts of an unbound fraction from a GF trap FF column that contains high purity RANKL-C protein.

Figure 3 shows the binding of C-RANKL to the Qβ capsid protein.

FIG. 3A shows SDS-PAGE analysis of binding products: proteins were analyzed on 16% SDS gels under reducing conditions. The gel was stained with Coomassie brilliant blue. The molecular weights of marker proteins are shown in the left margin. The identity of the protein bands is shown in the right margin. Lane 1: pre-stained protein marker for a wide range (New England Biolabs). Lane 2: derivatized Qβ capsid protein. Lane 3: purified C-RANKL protein. Lane 4: C-RANKL / Qβ binding reaction.

FIG. 3B and FIG. 3C: Western blot analysis of binding products. Proteins were dispersed in 16% SDS gels under reducing conditions, blotted onto nitrocellulose membranes and recorded using anti-Qβ antiserum (Figure 3B) or anti-RANKL antibody (Figure 3C). The molecular weights of marker proteins are shown in the left margin. The identity of the protein bands is indicated on the right margin. Lane 1: pre-stained protein marker for a wide range (New England Biolabs). Lane 2: derivatized Qβ capsid protein. Lane 3: purified C-RANKL protein. Lane 4: C-RANKL / Qβ binding reaction.

4 shows an ELISA for RANKL-specific IgG in mice immunized with C-RANKL linked to Qβ.

Female Balb / c mice were vaccinated subcutaneously with 25 μg C-RANKL bound to Qβ in PBS on day 0, day 16 and day 64 with or without alum. Serum obtained on days 0, 16, 23, 64, and 78 was assayed for antibodies specific for RANKL. ELISA titers were expressed as mean for those dilutions of sera that gave half the maximum OD ₄₂₀ in the ELISA assay.

Figure 5 shows the neutralizing activity of antibodies induced in mice immunized with C-RANKL bound to Qβ.

5A shows a binding analysis of C-RANKL and its related ligand, RANK. ELISA plates were coated with 10 μg / ml C-RANKL and incubated with serial dilutions of a RANK-Fc fusion protein or an unrelated Fc protein fusion. Registration of bound RANK was performed using HRP conjugated anti-Fc antibodies.

FIG. 5B shows the inhibition of the binding of C-RANKL / RANK-Fc to the serum antibodies of mice vaccinated with C-RANKL bound to Qβ. Elisa plates were coated with 10 μg / ml C-RANKL and co-incubated with serial dilutions of mouse sera obtained on day 78 and 1 nM RANK-Fc fusion protein. The binding of the fusion protein to C-RANKL was recorded using horseradish peroxidase conjugated anti-Fc antibody.

6A-C depict AP205 protein purification for use in VLP, which was analyzed by SDS-PAGE and Western blotting.

7A-B are electron micrographs of a comparison of phage particles of AP205 with virus-like particles of AP205 spontaneously assembled from a recombinant protein expressed in E. coli and purified.

DETAILED DESCRIPTION OF THE INVENTION

Unless otherwise specified, all technical and scientific terms used in this description have the same meanings that are usually implied by specialists in the field to which this invention relates. Although any methods and substances similar or equivalent to the methods and substances described herein can be used in practice or in testing this invention, preferred methods and substances are described below.

1. Definitions:

Amino acid linker: an "amino acid linker" or also referred to as a "linker" in the sense used either binds an antigen or antigenic determinant to a second binding site, or - more preferably - already contains or includes a second binding site, usually - but not necessarily - in the form of an amino acid residue, preferably in the form of a cysteine residue. However, the term "amino acid linker" in the sense used in this description is not intended to mean that such an amino acid linker consists solely of amino acid residues, although an amino acid linker consisting of amino acid residues is a preferred embodiment according to this invention. The amino acid residue of the amino acid linker is preferably composed of naturally occurring amino acids or unnatural amino acids known in the art, all L or all D, or mixtures thereof. However, an amino acid linker containing a molecule with a sulfhydryl group or a cysteine residue is also included in this invention. Such a molecule preferably contains a residue of C1-C6 alkyl, cycloalkyl (C5, C6), aryl or heteroaryl. However? in addition to the amino acid linker, a linker, preferably containing the remainder of C1-C6 alkyl, cycloalkyl (C5, C6), aryl or heteroaryl and having no amino acid (s), should also be included in the scope of the present invention. The bond between the antigen or antigenic determinant or optionally the second binding site and the amino acid linker is preferably carried out using at least one covalent bond, more preferably using at least one peptide bond.

Animals: As used in this description, it is understood that the term "animal" includes, for example, humans, sheep, moose, deer, mule deer, mink, mammals, monkeys, horses, cattle, pigs, goats, dogs , cats, rats, mice, birds, chickens, reptiles, fish, insects and arachnids.

Antibody: As used herein, the term “antibody” refers to molecules that are capable of binding an epitope or antigenic determinant. The term is intended to include whole antibodies and antigen binding fragments thereof, including single chain antibodies. Most preferably, the antibodies are antigen binding fragments of human antibodies and include, but are not limited to, Fab, Fab 'and F (ab') 2, Fd, single chain Fv (scFv), single chain antibodies linked by Fv disulfide bonds (sdFv), and fragments containing either V _L - or V _H domain. The source of antibodies can be any animal, including birds and mammals. Preferably, the antibodies are from a human, mouse, rabbit, goat, guinea pig, camel, horse or chicken. As used herein, “human” antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic to one or more human immunoglobulins and which do not express endogenous immunoglobulins, as described for example, in US patent No. 5939598 Kucherlapati et al.

Antigen: As used herein, “antigen” refers to a molecule capable of being bound by an antibody or T-cell receptor (TCR) if it is presented by MHC molecules. The term “antigen” as used herein also encompasses T-cell epitopes. In addition, the antigen can be recognized by the immune system and / or is capable of inducing a humoral immune response and / or a cellular immune response leading to activation of B and / or T lymphocytes. However, this may require, at least in some cases, that the antigen contain or be associated with a Th-cell epitope and be administered in an adjuvant. An antigen may have one or more epitopes (B and T epitopes). It is understood that the above specific reaction indicates that the antigen will preferably react, usually in a highly selective manner, with its corresponding antibody or TCR and will not react with many other antibodies or TCR that may be caused by other antigens. As used herein, antigens can also be mixtures of several individual antigens.

Antigenic determinant: As used in this description, it is understood that the term "antigenic determinant" refers to that part of the antigen that is specifically recognized by either B- or T-lymphocytes. B-lymphocytes that respond to antigenic determinants produce antibodies, while T-lymphocytes respond to antigenic determinants by proliferation and the establishment of effector functions necessary to mediate cellular and / or humoral immunity.

Association: As used herein, the term “association” as applied to the first and second binding sites refers to the binding of the first and second binding sites, which is preferably carried out through at least one non-peptide bond. The nature of the association may be covalent, ionic, hydrophobic, polar, or any combination thereof, preferably the nature of the association is covalent.

Binding site, first: As used herein, the phrase “first binding site” refers to an element of non-natural or natural origin with which a second binding site located on an antigen or antigenic determinant can associate. The first binding site may be a protein, polypeptide, amino acid, peptide, sugar, polynucleotide, natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxygenin, metal ions, phenylmethylsulfonyl fluoride) or a combination thereof or a chemically reactive group thereof . The first binding site is usually and preferably located on the surface of the central particle, such as preferably a virus-like particle. Numerous first binding sites are usually present on the surface of a central particle and, accordingly, a virus-like particle in a repeating configuration.

Binding site, second: In the sense used in this description, the phrase “second binding site” refers to an element in association with an antigen or antigenic determinant, with which the first binding site located on the surface of the central particle and, accordingly, virus-like can come into association particles. The second antigen or antigenic determinant binding site may be a protein, polypeptide, peptide, sugar, polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxygenin, metal ions, phenylmethylsulfonyl fluoride) or a combination thereof, or a combination thereof or capable group. At least one second binding site is present on the antigen or antigenic determinant. The term “antigen or antigenic determinant with at least one second binding site”, therefore, refers to an antigen or antigenic construct containing at least an antigen or antigenic determinant and a second binding site. However, in particular, in the case of the second binding site, which has a non-natural origin, i.e. did not naturally occur in an antigen or antigenic determinant, said antigen or antigenic constructs contain an “amino acid linker”.

Diseases of the bone: The term "bone disease" as used in this description, includes, in particular, conditions characterized by increased bone resorption. The term "bone disease" includes, but is not limited to, osteoporosis in its various forms, such as primary osteoporosis (such as idiopathic, postmenopausal, involutional or senile osteoporosis) and secondary osteoporosis. The latter includes osteoporosis caused by an excess of glucocorticoids, hyperparathyroidism, hyperthyroidism, hypergonadism, hyperprolactinemia, diabetes mellitus, drug-induced osteoporosis, such as osteoporosis caused by glucocorticosteroids, ethanol, tablantiomyelitis, dileantomy, baritomyrtosis, dilantomy, baritomyrtosis, dilantomy, and drugs, and various conditions associated with increased bone resorption, such as chronic renal failure, pain zn liver malabsorption syndromes, chronic obstructive pulmonary disease, sarcoidosis. The following conditions with increased bone resorption include Paget's disease, familial spreading osteolysis, spontaneous osteolysis, bone loss associated with rheumatoid arthritis, bone resorption and tooth loss in periodontal disease, osteomyelitis, hypercalcemia in malignant tumors, bone tumors, related malignant tumors with bone metastases, and bone loss caused by the loss of mass found during space flight. Specialists in this field can identify other conditions characterized by increased bone resorption.

Communication: In the sense used in this description, the term “communication” refers to the binding or attachment, which may be covalent, for example by chemical bonding, or non-covalent, for example, ionic interactions, hydrophobic interactions, hydrogen bonds, etc. Covalent bonds, for example, can be ester, ether, phosphoether, amide, peptide, imide bonds, carbon-sulfur bonds, carbon-phosphorus bonds and the like. The term “connected” is broader and includes terms such as “connected”, “merged” and “attached”.

Coating protein (s): As used herein, the term “coating protein (s)” refers to a bacteriophage or RNA phage protein (s) that can be included in a bacteriophage or RNA phage capsid assembly. However, with respect to the specific gene product of the gene of the RNA phage coat protein, the term “CP” is used. For example, a specific gene product of the coat protein of the Qβ RNA phage gene is called “CP Qβ”, while the “cover proteins” of the bacteriophage Qβ contain “CP Qβ” as well as protein A1. The bacteriophage Qβ capsid mainly consists of CP Qβ with a small amount of A1 protein. Similarly, the VLP Qβ coating protein mainly contains CP Qβ with a low A1 protein content.

Central particle: In the sense used in this description, the term "central particle" refers to a rigid structure with its inherent repetitive organization. The central particle in the sense used in this description may be a product of a synthesis process or a product of a biological process.

Bound: The term “bound,” as used herein, refers to binding via covalent bonds or strong non-covalent interactions, usually and preferably to binding via covalent bonds. In this invention, you can use any method commonly used by specialists in this field for the binding of biologically active substances.

Effective amount: As used herein, the term “effective amount” refers to the amount necessary or sufficient to carry out the desired biological effect. An effective amount of a composition may be an amount that makes it possible to achieve a given selected result, and determining such an amount may be common practice for one skilled in the art. For example, an effective amount for treating a deficiency of the immune system may be the amount necessary to cause activation of the immune system, leading to the development of an antigen-specific immune response when exposed to the antigen. This term is also synonymous with "enough."

The effective amount for any particular application may vary depending on factors such as the disease or condition being treated, the particular composition administered, the weight of the subject and / or the severity of the disease or condition. One of skill in the art can empirically determine the effective amount of a particular composition according to this invention without the need for excessive experimentation.

Epitope: As used herein, an “epitope” refers to the continuous or discontinuous portions of a polypeptide having antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably a human. An epitope is recognized by an antibody or T cell through its T cell receptor in the context of an MHC molecule. An “immunogenic epitope” as used herein is defined as the part of a polypeptide that elicits a humoral response or induces a T-cell response in an animal that is determined by any method known in the art (see, for example, Geysen et al., Proc. Natl. Acad. Sci. USA 81: 3998-4002 (1983)). The term “antigenic epitope” as used herein is defined as part of a protein by which an antibody can immunospecifically bind its antigen, as determined by any method well known in the art. Immunospecific binding excludes non-specific binding, but does not necessarily exclude cross-reactivity with other antigens. Antigenic epitopes do not have to be immunogenic. Antigenic epitopes can also be T-cell epitopes, in which case they can immunospecifically bind to the T-cell receptor in the context of the MHC molecule.

An epitope can contain 3 amino acids in a spatial conformation that is unique to the epitope. Typically, an epitope consists of at least about 5 such amino acids and more usually consists of at least about 8-10 such amino acids. If the epitope is an organic molecule, it may be small, such as nitrophenyl.

Fusion: As used herein, the term “fusion” refers to a combination of amino acid sequences of different origin in one polypeptide chain by combining in the reading frame the nucleotide sequences encoding them. The term “merger” specifically includes internal mergers, i.e. the insertion of sequences of different origin in the polypeptide chain, except for merging with one of its ends.

Immune response: As used herein, the term "immune response" refers to a humoral immune response and / or a cellular immune response leading to the activation or proliferation of B and / or T lymphocytes and / or antigen presenting cells. However, in some cases, immune responses may be of low intensity, and they become detectable only when using at least one substance according to the invention. "Immunogenic" refers to an agent used to stimulate the immune system of a living organism in order to enhance and direct one or more functions of the immune system to the immunogenic agent. An “immunogenic polypeptide” is a polypeptide that elicits a cellular and / or humoral immune response, either alone or in a carrier bound form in the presence or absence of an adjuvant. Preferably, an antigen presenting cell can be activated.

A substance that "enhances" the immune response refers to a substance when an immune response is observed that becomes larger or amplifies or in some way deviates when a substance is added, compared with the same immune response measured without adding a substance. For example, the lytic activity of cytotoxic T cells can be measured, for example, using ⁵¹ Cr release analysis in samples obtained with and without a substance during immunization. It is said that the amount of a substance in which the lytic activity of CTL is enhanced compared to the lytic activity of CTL without a substance is an amount sufficient to enhance the animal's immune response to the antigen. In a preferred embodiment, the immune response is enhanced at least about 2 times, more preferably about 3 times or more. The amount or type of secreted cytokines may also be altered. Alternatively, the amount of inducible antibodies or their subclasses can be changed.

Immunization: As used herein, the terms “immunize” or “immunization” or related terms refer to imparting the ability to generate a sufficiently strong immune response (including humoral and / or cellular immunity, such as effector CTLs) against an antigen or epitope that is a target. These terms do not require that complete immunity be formed, but rather, that an immune response is obtained that is significantly higher than the baseline. For example, a mammal can be considered immunized against a target antigen if, after application of the methods of the invention, a cellular and / or humoral immune response to the target antigen occurs.

Natural origin: In the sense used in this description, the term "natural origin" means that the whole or part of the whole is not synthesized, but that it exists or is produced in nature.

Unnatural: In the sense used in this description, the term, in general, means obtained not from nature, more specifically, the term means obtained artificially by man.

Unnatural origin: In the sense used in this description, the term “non-natural origin” generally means “synthesized or obtained not from nature”; more specifically, the term means "artificially obtained by man."

An ordered and repeating matrix of antigens or antigenic determinants: As used herein, the term “ordered and repeating matrix of antigens or antigenic determinants” generally refers to a repeating sample of antigens or antigenic determinants, usually and preferably characterized by a uniform spatial arrangement of antigens or antigenic determinants with respect to to the central particle and, accordingly, the virus-like particle. In one embodiment of the invention, the repeating pattern may have a geometric pattern. Typical and preferred examples of suitable ordered and repeating matrices of antigens or antigenic determinants are matrices that have strictly repeating paracrystalline orders of antigens or antigenic determinants, preferably with distances from 1 to 30 nanometers, preferably from 5 to 15 nanometers.

Fimbriae: As used in this description, the term “fimbriae” (in the singular “fimbriae”) refers to the extracellular structures of bacterial cells consisting of protein monomers (eg, pilin monomers) that are organized into ordered and repeating structures. In addition, fimbriae are structures that are involved in processes such as the binding of bacterial cells to the surface receptors of the host cell, intercellular genetic exchanges, and cell recognition by each other. Examples of fimbriae include type 1 fimbriae, P-fimbriae, F1C fimbriae, S-fimbriae, and 987P fimbriae. Additional examples of fimbriae are listed below.

Structures similar to fimbriae: As used in this description, the phrase “structure similar to fimbriae” refers to structures having characteristics similar to those of fimbriae and consisting of protein monomers. One example of a “fimbria-like structure” is a structure formed by a bacterial cell that expresses modified pilin proteins that do not form ordered and repeating matrices that are identical to those of natural fimbria.

Polypeptide: As used herein, the term “polypeptide” refers to a molecule consisting of monomers (amino acids) linearly linked by amide bonds (also called peptide bonds). The term refers to the molecular chain of amino acids and does not refer to the specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides and proteins are included in the definition of a polypeptide. It is understood that this term also refers to modifications of the polypeptide after expression, for example, glycosylation, acetylation, phosphorylation and the like. A recombinant or derivative polypeptide is optionally translated from a specific nucleic acid sequence. It can also be created in any way, including chemical synthesis.

RANKL protein: The term "RANKL protein" as used herein refers to a protein encoded by the RANKL gene. Different variants of the RANKL protein may be due to point mutations of the nucleotides and polymorphism, respectively, as well as insertions, deletions and / or substitutions of one or more nucleotides and should be included in the scope of this invention. Additional variability may be due to post-translational modifications, such as differentially glycosylated forms of RANKL, as well as proteolytically cleaved forms of RANKL (Lum, L., et al., J. Biol. Chem. 274: 13613-13618 (2000). presently, splicing variants of the human RANKL gene and other types of RANKL gene, which, together with the possible variants mentioned above, are also included in the scope of the invention. Thus, the term "RANKL protein" as used in this description should also cover variants of the RANKL protein, including I, but not limited to, the above preferred examples.

As used herein, the term “RANKL fragment” is broadly defined as any polypeptide of at least 50 amino acids in length, which is part of a RANKL protein, most preferably a folding part of RANKL and most preferably an extracellular part of RANKL, even more preferably a region homologous TNF-α. The term RANKL fragment also encompasses recombinantly produced proteins and, accordingly, polypeptides corresponding to splicing isoforms and proteolytically cleaved RANKL forms and all its variants described above.

As used herein, the term "RANKL peptide" is broadly defined as any peptide that is part of a RANKL protein or RANKL fragment and contains at least two, preferably at least three, more preferably at least four, more preferably at least five, more preferably at least six, successive amino acids of the parent RANKL protein or RANKL fragment, most preferably the extracellular portion of RANKL. In addition, the term “RANKL peptide” should preferably encompass any portion of said RANKL peptide, wherein said portion can preferably be obtained by deletion of one or more amino acids at the N- and / or C-terminus. The RANKL peptide can be obtained by recombinant expression in eukaryotic or prokaryotic expression systems as a single RANKL peptide or as a fusion with other amino acids or proteins, for example, to facilitate the folding, expression or solubility of the RANKL peptide or to facilitate the purification of the RANKL peptide. To enable the binding of RANKL peptides and proteins of VLP subunits or capsids, at least one second binding site can be added to the RANKL peptide. Alternatively, RANKL peptides can be synthesized using methods known in the art. The term RANKL peptide, as used herein, should also preferably include a peptide that mimics the three-dimensional surface structure of RANKL. Such a RANKL peptide is not necessarily derived from the continuous amino acid sequence of RANKL, but may be formed by non-contiguous amino acid residues from RANKL. Such peptides may even contain amino acids that are not present in the corresponding RANKL protein.

Residue: As used herein, the term “residue” is intended to mean a specific amino acid in a polypeptide backbone or side chain.

Autoantigen (intrinsic antigen): As used herein, the term “autoantigen” refers to proteins encoded by the host DNA, and products formed by proteins or RNA encoded by the host DNA are defined as intrinsic. In addition, proteins that are the result of a combination of two or more of their own molecules or which are part of their own molecules, and proteins that are highly homologous with two of their own molecules, as defined above (> 95%, preferably> 97%, more preferably> 99%) can also be considered own.

Treatment: As used herein, the terms “treatment”, “treat”, “treated” or “treatment process” refer to prophylaxis and / or therapy. For example, when used with respect to an infectious disease, the term refers to prophylactic treatment that increases the subject's resistance to a pathogen infection or, in other words, reduces the likelihood that the subject will become infected with a pathogen or exhibit symptoms of the disease that can be attributed to infection, and also to treatment, after the subject has become infected in order to fight the infection, for example, to reduce or destroy the infection or to prevent the subject from getting worse. When used with respect to bone disease, the term "treatment" refers to prophylactic or therapeutic treatment that inhibits or reduces the increased bone resorption that is associated with bone diseases.

Vaccine: In the sense used in this description, the term "vaccine" refers to a preparation that contains a composition according to this invention and which is in a form that can be administered to an animal. Typically, the vaccine contains the medium in the form of a normal saline solution or a buffered aqueous solution in which the composition according to this invention is suspended or dissolved. In this form, the composition according to this invention can easily be used in order to prevent, improve or otherwise affect the condition. When introduced into the host, the vaccine is capable of eliciting an immune response, including, but not limited to, production of antibodies and / or cytokines and / or activation of cytotoxic T cells, antigen-presenting cells, helper T cells, dendritic cells and / or other cellular responses.

Optionally, the vaccine according to this invention further comprises an adjuvant, which may be present in either a small or a large proportion relative to the compound of this invention. The term “adjuvant” as used in this description refers to non-specific stimulants of the immune response or substances that make it possible to create a depot in the host, which when combined with the vaccine according to this invention provide an even more enhanced immune response. You can use many adjuvants. Examples include Freund's complete and incomplete adjuvant, aluminum hydroxide, and a modified muramyl dipeptide.

Virus-like particle (VLP): As used herein, the term “virus-like particle” refers to a structure similar to a virus particle. In addition, the virus-like particle according to the invention is non-replicative and non-infectious, as it does not contain all or part of the viral genome, in particular the replicative and infectious components of the viral genome. The virus-like particle according to the invention may contain a nucleic acid different from its genome. A typical and preferred embodiment of a virus-like particle according to this invention is a virus capsid, such as a viral capsid of the corresponding virus, bacteriophage or RNA phage. The terms “viral capsid” or “capsid”, as used herein, interchangeably refer to a macromolecular construct consisting of protein subunits of the virus. Usually and preferably, the protein subunits of the virus are assembled into a viral capsid and, accordingly, a “capsid" having a structure with its inherent repetitive organization, where this structure is usually spherical or tubular. For example, capsid RNA phages or HBcAg have a spherical shape with icosahedral symmetry. The term “capsid-like structure” as used herein refers to a macromolecule-assembled construct consisting of protein subunits of the virus, having a similar capsid morphology in the sense defined above, but deviating from a typical symmetrical assembly while maintaining a sufficient degree of order and repeatability.

Virus-like particle of a bacteriophage: In the sense used in this description, the term “virus-like particle of a bacteriophage” refers to a virus-like particle similar in structure to a bacteriophage, but which is non-replicative and non-infectious, and does not contain at least the gene or genes encoding the bacteriophage replication apparatus, and usually also not containing a gene or genes encoding a protein or proteins responsible for the attachment of a virus or the penetration of a virus into a host. However, this definition should also encompass virus-like particles of bacteriophages in which the above gene or genes are still present but inactive and therefore also lead to non-replicating and non-infectious virus-like particles of bacteriophages.

VLP of the RNA phage coat protein: The capsid structure resulting from the self-assembly of 180 subunits of the RNA phage coat protein and optionally containing the host RNA is called the “VLP of the RNA phage coat protein”. A specific example is the VLP of the Qβ coat protein. In this particular case, the VLP of the Qβ coat protein can be assembled either exclusively from CP Qβ subunits (formed by expression of the CP Qβ gene containing, for example, the TAA stop codon that inhibits any expression of the longer A1 protein by suppression, see Kozlovska, TM, et al., Intervirology 39: 9-15 (1996)), or further comprises subunits of protein A1 in the assembled capsid construct.

Viral particle: The term "viral particle" as used in this description refers to the morphological form of the virus. In some types of viruses, it contains a genome surrounded by a protein capsid; others have additional structures (e.g. shells, tails, etc.).

One or the singular: When used in this description, the terms “one” or the singular, they mean “at least” one or “one or more”, unless otherwise specified.

As will be appreciated by those skilled in the art, some embodiments of the invention relate to the use of recombinant nucleic acid-based techniques such as cloning, polymerase chain reaction, DNA and RNA purification, expression of recombinant proteins in prokaryotic and eukaryotic cells, etc. Such techniques are well known to those skilled in the art and can easily be found in published laboratory methods manuals (e.g., Sambrook, J. et al., Eds., Molecular Cloning, A Laboratory Manual, 2nd. Edition, Cold Spring Harbor Laboratory Press , Cold Spring Harbor, NY (1989); Ausubel, F. et al., Eds., Current Protocols in Molecular Biology, John H. Wiley and Sons, Inc. (1997)). Fundamental laboratory techniques for working with tissue culture cell lines (Celis, J., ed., Cell Biology, Academic Press, 2nd edition, (1998)) and antibody-based techniques (Harlow, E. and Lane, D., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1988); Deutscher, MP, Guide to Protein Purification, Meth. Enzymol. 128, Academic Press San Diego (1990); Scopes, RK, Protein Purification Principles and Practice, 3rd ed., Springer-Verlag, New York (1994)) are also adequately described in the literature, all of these publications are incorporated herein by reference.

2. Compositions and methods of enhancing the immune response

The claimed invention relates to compositions and methods for enhancing the immune response against RANKL protein, RANKL fragment or RANKL peptide in an animal. The compositions of the invention comprise or alternatively consist of (a) a central particle with at least one first binding site; and (b) at least one antigen or antigenic determinant with at least one second binding site, wherein said antigen or antigenic determinant is a RANKL protein, a RANKL fragment, or a RANKL peptide and where said second binding site is selected from the group consisting of (i ) a binding site of non-natural origin with the specified antigen or antigenic determinant; and (ii) a naturally occurring binding site with said antigen or antigenic determinant, wherein said second binding site is capable of associating with said first binding site; and wherein said antigen or antigenic determinant and said central particle interact due to said association to form an ordered and repeating antigenic matrix. More specifically, the compositions of the invention comprise — or alternatively — consist of a virus-like particle and at least one antigen or antigenic determinant, wherein the antigen or antigenic determinant is a RANKL protein, RANKL fragment or RANKL peptide and where at least one antigen or antigenic determinant is associated with a virus-like particle, so that an ordered and repeating VLP antigen matrix is formed. In addition, the invention enables a practitioner to easily design such a composition, among other things, for the treatment and / or prophylactic prevention of bone diseases characterized by increased bone resorption.

In one embodiment, the central particle comprises a virus, fimbriae bacteria, a structure formed from bacterial pilin, a bacteriophage, a virus-like particle, a virus capsid particle, or a recombinant form thereof. Any virus known in the art having an ordered and repeating structure of a coating and / or core protein may be selected as the central particle of the invention; examples of suitable viruses include Sindbis virus and other alphaviruses, rhabdoviruses (e.g. vesicular stomatitis virus), picornaviruses (e.g. human rhinovirus, Aisha virus), togaviruses (e.g. rubella virus), orthomyxoviruses (e.g. Togoto virus, Batken virus, plague virus), polyoma viruses (e.g., BK poliomavirus, JC polyomavirus, BFDV bird polyoma virus), parvoviruses, rotaviruses, Norwalk virus, foot and mouth disease virus, retrovirus, hepatitis B virus, tobacco mosaic virus, sheep’s nightmare virus and human papillomavirus, and prefer specifically RNA phage, bacteriophage Qβ, bacteriophage R17, bacteriophage M11, bacteriophage MX1, bacteriophage NL95, bacteriophage fr, bacteriophage GA, bacteriophage SP, bacteriophage MS2, bacteriophage f2, bacteriophage PP7 (for example, see Table 1 in Bachmann, MF and Zinkernagel , RM, Immunol. Today 17: 553-558 (1996)).

In a further embodiment, the invention uses genetic engineering of the virus to create a fusion between the ordered and repeating viral coat protein and the first binding site containing a heterologous protein, peptide, antigenic determinant, or preferably a reactive amino acid residue. Other genetic manipulations known to those skilled in the art may be included in the design of the compositions of the invention; for example, it may be necessary to limit the ability of a recombinant virus to replicate through a genetic mutation. In addition, the virus used for this invention is incompetent for replication due to chemical or physical inactivation or, as indicated, due to the lack of a replication competent genome. The viral protein selected for fusion with the first binding site must have an organized and repeating structure. Such an organized and repeating structure includes paracrystalline organizations with distances of 5-30 nm, preferably 5-15 nm, on the surface of the virus. The result of creating a fusion protein of this type will be multiple, ordered and repeated first binding sites on the surface of the virus, reflecting the normal organization of the native viral protein. As will be appreciated by those skilled in the art, the first binding site may be part or may be any suitable protein, polypeptide, sugar, polynucleotide, peptide (amino acid), natural or synthetic polymer, secondary metabolite, or a combination thereof, which may serve to specifically bind antigen or an antigenic determinant, leading to the formation of an ordered and repeating matrix of antigen or antigenic determinant.

In another embodiment of the invention, the central particle is a recombinant alphavirus, and more particularly a recombinant Sindbis virus. Alphaviruses are positive RNA strand viruses that replicate their genomic RNA completely in the cytoplasm of an infected cell and without intermediate DNA products (Strauss, J. and Strauss, E., Microbiol. Rev. 58: 491-562 (1994)). Much attention was paid to several representatives of the alphavirus family, Sindbis (Xiong, C. et al., Science 243: 1188-1191 (1989); Schlesinger, S., Trends Biotechnol. 11: 18-22 (1993)), forest virus Semlic (SFV) (Liljeström, P. and Garoff, H., Bio / Technology 9: 1356-1361 (1991)) and others (Davis, NL et al., Virology 171: 189-204 (1989)) as based viruses expressing vectors for many different proteins (Lundstrom, K., Curr. Opin. Biotechnol. 8: 578-582 (1997); Liljeström, P., Curr. Opin. Biotechnol. 5: 495-500 (1994)) and as candidates for vaccine development. Recently, a number of patents have been issued aimed at the use of alphaviruses for the expression of heterologous proteins and the development of vaccines (see US patents No. 5766602, 5792462, 5739026, 5789245 and 5814482). The construction of the alphavirus core particles according to the invention can be carried out by methods well known in the art of recombinant DNA technology, which are described in the above articles, which are incorporated herein by reference.

Many different recombinant host cells can be used to obtain a virus-based central particle to bind an antigen or antigenic determinant. For example, it is known that alphaviruses have a wide range of hosts; Sindbis virus infects cultured mammalian, reptile and amphibian cells, as well as some insect cells (Clark, H., J. Natl. Cancer Inst. 51: 645 (1973); Leake, C., J. Gen. Virol. 35: 335 (1977); Stollar, V. in The Togaviruses, RW Schlesinger, Ed., Academic Press, (1980), pp. 583-621). Thus, in the practice of this invention, many recombinant host cells can be used. BHK, COS, Vero, HeLa, and CHO cells are particularly suitable for the production of heterologous proteins, as they have the ability to glycosylate heterologous proteins in a manner similar to human cells (Watson, E. et al., Glycobiology 4: 227, (1994)) and can be selected by selection (Zang, M. et al., Bio / Technology 13: 389 (1995)) or genetically engineered (Renner W. et al., Biotech. Bioeng. 4: 476 (1995); Lee K. et al. Biotech. Bioeng. 50: 336 (1996)), so that they grow in serum-free medium as well as in suspension.

The introduction of polynucleotide vectors into host cells can be accomplished by the methods described in standard laboratory manuals (see, for example, Sambrook, J. et al., Eds., Molecular Cloning, A Laboratory Manual, 2nd. Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989), Chapter 9; Ausubel, F. et al., Eds., Current Protocols in Molecular Biology, John H. Wiley and Sons, Inc. (1997), Chapter 16), including methods such as DEAE-dextran-mediated electroporation transfection, transfection, microinjection, cationic lipid-mediated transfection, transduction, scratching, ballistic administration and infection. Methods for introducing exogenous DNA sequences into host cells are discussed in Felgner, P. et al., US Pat. No. 5,580,859.

Packed RNA sequences can also be used to infect host cells. These packaged RNA sequences can be introduced into host cells by adding them to the culture medium. For example, the preparation of non-infectious alphavirus particles has been described in a number of sources, including the Sindbis Expression System, Version C (Invitrogen, catalog number K750-1).

When mammalian cells are used as recombinant host cells to obtain virus-based central particles, these cells are usually grown in tissue culture. Methods of growing cells in culture are well known in the art (see, for example, Celis, J., ed., Cell Biology, Academic Press, 2nd edition, (1998); Sambrook, J. et al., Eds., Molecular Cloning , A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989); Ausubel, F. et al., Eds., Current Protocols in Molecular Biology, John H. Wiley and Sons, Inc. (1997); Freshney, R., Culture of Animal Cells, Alan R. Liss, Inc. (1983)).

The following examples of RNA viruses suitable for use as central particles in this invention include, but are not limited to, the following viruses: representatives of the Reoviridae family, including the genus Orthoreovirus (multiple serotypes of mammalian and avian retroviruses), the genus Orbivirus (blue tongue virus, Eugenangi virus, Kemerovo virus, African horse disease virus and Colorado tick-borne fever virus) and the genus Rotavirus (human rotavirus, Nebraska calf diarrhea virus, mouse rotavirus, monkey rotavirus, bovine or sheep’s rotavirus, company Irus birds); Picomaviridae family, including the genus Enterovirus (poliovirus, Coxsackie virus A and B, intestinal cytopathic orphan human viruses (ECHO), hepatitis A, C, D, E and G viruses, monkey enteroviruses, mouse encephalomyelitis viruses (ME), Poliovirus muris , bovine enteroviruses, swine enteroviruses, genus Cardiovirus (encephalomyocarditis virus (EMC), Mengo virus), genus Rhinovirus (human rhinoviruses, including at least 113 subtypes; other rhinoviruses, genus Apthovirus (FMD virus), family Calciviridae, including swine vesicular exanthema virus, San Miguel sea lion virus, feline picornavirus Norwalk virus; Togaviridae family, including the genus Alphavirus (horse eastern encephalitis virus, Semlica forest virus, Sindbis virus, Chikungunya virus, O'Nyong Nyong virus, Ross river virus, equine Venezuelan encephalitis virus, horse western encephalitis virus), genus Flavirius ( yellow fever mosquito virus, Dengue virus, Japanese encephalitis virus, San Louis encephalitis virus, Murray Valley encephalitis virus, West Nile virus, Kunzhin virus, tick-borne tick-borne encephalitis virus, Far Eastern tick-borne encephalitis virus, forest virus Kiasanur, Louping III virus, Povassan virus, Omsk hemorrhagic fever virus), genus Rubivirus (rubella virus), genus Pestivirus (mucous membrane disease virus, swine cholera virus, border disease virus); the Bunyaviridae family, including the Bunyvirus genus (Bunyamver virus and related viruses, the California encephalitis virus group), the Phlebovirus genus (Sicilian mosquito fever virus, Rift Valley fever virus), the Nairovirus genus (Hemorrhagic fever virus, Nyme-Crimean and Syndrome disease) Uukuvirus (Uukuniemi virus and related viruses); the Orthomyxoviridae family, including the genus of the influenza virus (type A influenza virus, many serotypes in humans); swine flu virus and bird and horse flu viruses; type B influenza virus (many serotypes in humans) and type C influenza virus (possibly a separate genus); the Paramyxoviridae family, including the genus Paramyxovirus (parainfluenza virus type 1, Sendai virus, hemodisorption virus, parainfluenza viruses type 2-5, Newcastle disease virus, mumps virus), the genus Morbillivirus (measles virus, subacute sclerosing panencephalitis virus, distemper virus, plague virus cattle), the genus Pneumovirus (respiratory syncytial virus (RSV), bovine respiratory syncytial virus and mouse pneumonia virus); forest virus, the Rhabdoviridae family, including the genus Vesiculovirus (VSV), Chandipur virus, Flanders-Hart Park virus), the genus Lyssavirus (rabies virus), fish rhabdoviruses and filoviruses (Marburg virus and Ebola virus); the Arenaviridae family, including lymphocytic choriomeningitis virus (LCM), Takaribe complex virus and Lassa virus; the Coronoaviridae family, including infectious bronchitis virus (IBV), mouse hepatitis virus, human intestinal coronavirus and infectious feline peritonitis virus (feline coronavirus).

Illustrative DNA viruses that can be used as central particles include, but are not limited to: the Poxviridae family, including the genus Orthopoxvirus (smallpox virus, smallpox virus, monkeypox virus, cowpox virus, buffalo smallpox virus, rabbit smallpox virus , ectromelia virus), genus Leporipoxvirus (myxoma, fibroma), genus Avipoxvirus (smallpox virus and smallpox virus of other birds), genus Capripoxvirus (smallpox sheep, smallpox goats), genus Suipoxvirus (smallpox pigs), genus Parapoxvirus (infectious papular virus dermatitis, cow pseudo-virus virus (“milkmaids nodules” ), the virus of papular stomatitis in cattle); family Iridoviridae (African swine fever virus, frog viruses 2 and 3, fish lymphocystosis virus); Herpesviridae family, including alpha herpes viruses (herpes simplex viruses type 1 and 2, Varicella-Zoster virus, horse abortion virus, horse herpes simplex virus type 2 and 3, pseudorabies virus, infectious bovine keratoconjunctivitis virus, cattle infectious rhinotracheitis virus, feline virus rhinotracheitis, infectious laryngotracheitis virus), beta herpes viruses (human cytomegalovirus and cytomegalovirus pigs, monkeys and rodents); gamma herpes viruses (Epstein-Barr virus (EBV), Marek’s disease virus, Herpes saimiri (squirrel monkey herpes), Herpesvirus ateles (herpes monkey virus herpes virus), Herpesvirus sylvilagus (forest rabbit herpes virus), Guinea pig herpes virus, ); and the Adenoviridae family, including the genus Mastadenovirus (subgroups A, B, C, D and E of humans and not belonging to subgroups; monkey adenoviruses (at least 23 serotypes), infectious hepatitis in dogs and adenoviruses in cattle, pigs, sheep, frogs and many other species, the genus Aviadenovirus (avian adenoviruses); and uncultivated adenoviruses; the Papoviridae family, including the genus Papillomavirus (human papillomaviruses, cattle papillomaviruses, Shope rabbit papillomaviruses and various other pathogenic papillomaviruses of other species), polyomav at monkey monkey virus (SV-40), rabbit vacuolating virus (RKV), K virus, BK virus, JC virus and other primate polyoma viruses such as lymphotropic papilloma virus); Parvoviridae family, including the adeno-associated virus genus, the genus Parvovirus (feline panleukopenia virus, cattle parvovirus, dog parvovirus, mink disease Aleut virus, etc.) Finally, DNA viruses can include viruses such as agents of chronic infectious neuropathy (CHINA virus).

In other embodiments, a bacterial pilin, a sub-fragment of a bacterial pilin, or a fusion protein that contains either a bacterial pilin or a sub-fragment thereof, is used to prepare compositions and, accordingly, vaccine compositions according to the invention. Examples of pilin proteins include pilins produced by Escherichia coli, Haemophilus influenzae, Neisseria meningitidis, Neisseria gonorrhoeae, Caulobacter crescentus, Pseudomonas stutzeri and Pseudomonas aeruginosa. Amino acid sequences of pilin proteins suitable for use in the case of this invention include those indicated in GenBank AJ000636 (SEQ ID NO: 1), AJ132364 (SEQ ID NO: 2), AF229646 (SEQ ID NO: 3), AF051814 (SEQ ID NO: 4), AF051815 (SEQ ID NO: 5) and X00981 (SEQ ID NO: 6), the full description of which is incorporated herein by reference.

Bacterial pilin proteins are usually processed to remove N-terminal leader sequences before exporting proteins to bacterial periplasm. In addition, as will be understood by a person skilled in the art, the bacterial pilin proteins used to prepare the compositions and, accordingly, the vaccine compositions of the invention will generally not have a leader sequence present in vivo.

One specific example of a pilin protein suitable for use in this invention is E. coli P-pilin (entry in GenBank AF237482 (SEQ ID NO: 7)). An example of an E. coli pilin of type 1 suitable for use in the invention is pilin having the amino acid sequence indicated in GenBank, entry P04128 (SEQ ID NO: 8), which is encoded by a nucleic acid having the nucleotide sequence specified in GenBank, entry M27603 (SEQ ID NO: 9). A full description of these GenBank data is incorporated herein by reference. Again, in most cases, the mature form of the above protein can be used to prepare the composition and, therefore, the vaccine composition of the invention.

Bacterial pilins or pilin sub-fragments suitable for use in the practice of this invention will typically be able to associate to form ordered and repeating antigenic matrices.

Methods for producing fimbriae and fimbria-like structures in vitro are well known in the art. For example, Bullitt et al., Proc. Natl. Acad. Sci. USA 93: 12890-12895 (1996) described in vitro reconstruction of E. coli P-fimbria subunits. In addition, Eshdat et al., J. Bacteriol. 148: 308-314 (1981) described methods suitable for dissociating fimbriae type-1 E. coli and reconstructing fimbriae. Briefly, these methods are as follows: fimbriae are subjected to dissociation by incubation at 37 ° C in saturated guanidine hydrochloride. Then, the pilin proteins are purified by chromatography, after which the pilin dimers form during dialysis against 5 mM tris (hydroxymethyl) aminomethane hydrochloride (pH 8.0). Eshdat et al. they also found that pilin dimers reassembled to form fimbriae during dialysis against 5 mM Tris (hydroxymethyl) aminomethane (pH 8.0) containing 5 mM MgCl ₂ .

In addition, using, for example, conventional genetic engineering and protein modification methods, pilin proteins can be modified to contain a first binding site to which an antigen or antigenic determinant is bound via a second binding site. Alternatively, antigens or antigenic determinants can be directly linked via a second binding site to amino acid residues that are naturally occurring in these proteins. Then these modified pilin proteins can be used in vaccine compositions according to the invention.

The bacterial pilin proteins used to prepare the compositions and, accordingly, the vaccine compositions of the invention can be modified in a manner similar to the method described herein for HBcAg. For example, cysteine and lysine residues can either be deleted or replaced with other amino acid residues, and the first binding site can be added to the resulting proteins. In addition, pilin proteins can either be expressed in a modified form or chemically modified after expression. Similarly, intact fimbriae can be collected from bacteria and then chemically modified.

In another embodiment, fimbriae or fimbria-like structures are harvested from bacteria (e.g., E. coli) and used to form vaccine compositions and compositions of the invention. One example of fimbriae suitable for preparing compositions and vaccine compositions is E. coli type-1 fimbriae, which is formed from pilin monomers having the amino acid sequence shown in SEQ ID NO: 8.

A number of methods for collecting bacterial fimbriae are known in the art. For example, Bullitt and Makowski (Biophys. J. 74: 623-632 (1998)) described a method for purifying fimbriae in the case of collection of E. coli P-fimbriae. According to this method, fimbriae are cut off with E. coli having a hyperquantity of fimbria and containing a P-fimbria plasmid, and purified using dissolution and precipitation cycles with MgCl ₂ (1.0 M).

After collecting fimbriae or similar fimbria structures can be modified in many ways. For example, a first binding site can be added to fimbriae, to which antigens or antigenic determinants can be linked via a second binding site. In other words, bacterial fimbriae or fimbria-like structures can be assembled and modified, resulting in ordered and repeating antigenic matrices.

Antigens or antigenic determinants may be associated with cysteine residues or naturally occurring lysine residues present in fimbias or fimbria-like structures. In such cases, the high orderliness and repeatability of the naturally occurring amino acid residue may regulate the binding of antigens or antigenic determinants to fimbriae or fimbria-like structures. For example, fimbriae or fimbria-like structures can be linked to second binding sites of antigens or antigenic determinants using a heterobifunctional cross-linking agent.

When structures that are naturally synthesized by organisms (e.g., fimbriae) are used to prepare the compositions and vaccine compositions of the invention, the genetic design of these organisms will often be advantageous so that they produce structures that possess the desired characteristics. For example, when type-1 fimbriae are used, E. coli, E. coli, from which these fimbriae are collected, can be modified to produce structures with specific characteristics. Examples of possible modifications of pilin proteins include the insertion of one or more lysine residues, deletion or replacement of one or more naturally occurring lysine residues, and the deletion or replacement of one or more naturally occurring cysteine residues (e.g., cysteine residues at positions 44 and 84 in SEQ ID NO: 8 )

In addition, further modifications can be made to the pilin genes that result in expression products containing a different first binding site other than a lysine residue (eg, FOS or JUN domain). Of course, a suitable first binding site will generally be limited to sites that do not prevent the formation of fimbriae pilina or similar fimbriae structures from proteins suitable for use in vaccine compositions of the invention.

Pilin genes that are naturally found in bacterial cells can be modified in vivo (for example, by homologous recombination), or pilin genes with specific characteristics can be inserted into these cells. For example, pilin genes can be introduced into bacterial cells as a component of either a replicating cloning vector or a vector that integrates into the bacterial chromosome. The inserted pilin genes can also be linked to sequences that control the regulation of expression (for example, a lac operator).

In most cases, fimbriae or fimbria-like structures used in the compositions and, accordingly, in the vaccine compositions of the invention will be constructed from the same type pilin subunit. Typically, fimbriae or fimbria-like structures consisting of identical subunits will be used, since it is assumed that they form structures that are highly ordered and repeating antigenic matrices.

However, the compositions of the invention also include compositions and vaccines containing fimbriae and fimbria-like structures formed from heterogeneous pilin subunits. The pilin subunits that form these fimbriae or fimbria-like structures can be expressed from genes present in bacterial cells in nature, or can be introduced into cells. When both genes, both the naturally occurring pilin gene and the introduced gene, are expressed in a cell that forms fimbriae or fimbria-like structures, the result will usually be structures formed from a mixture of these pilin proteins. In addition, when two or more pilin genes are expressed in a bacterial cell, the relative expression of each pilin gene will usually be a factor that determines the ratio of the different pilin subunits in fimbriae or fimbria-like structures.

In the case where fimbriae or fimbria-like structures having a specific composition of mixed pilin subunits are required, the expression of at least one of the pilin genes can be regulated by a heterologous inducible promoter. Such promoters, as well as other genetic elements, can be used to regulate the relative amounts of the various pilin subunits produced in the bacterial cell, and therefore the composition of the fimbriae or fimbria-like structures.

In addition, the antigen or antigenic determinant can be linked to bacterial fimbriae or fimbria-like structures by a bond that is not a peptide bond, bacterial cells that produce fimbriae or fimbria-like structures used in the compositions of the invention can be genetically engineered to create proteins pilin, which are fused with an antigen or antigenic determinant. Such fusion proteins that form fimbriae or fimbria-like structures are suitable for use in vaccine compositions of the invention.

Virus-like particles in the context of this application refer to structures similar to a virus particle, but which are non-pathogenic. In general, virus-like particles do not contain the viral genome and therefore are non-infectious. Also, virus-like particles can be produced in large quantities as a result of heterologous expression and can be easily purified.

In a preferred embodiment, the virus-like particle is a recombinant virus-like particle. One of skill in the art can obtain VLP using a recombinant DNA technique and viral coding sequences that are readily and generally available. For example, the coding sequence of a coat protein or virus cortex can be constructed for expression in a baculovirus expression vector using a commercially available baculovirus vector, under the regulatory control of a viral promoter with appropriate sequence modifications, to provide a functional link between the coding sequence and the regulatory sequence. The coding sequence of the envelope protein or virus core can also be constructed for expression, for example, in a bacterial expression vector.

Examples of VLP include, but are not limited to, hepatitis B virus capsid proteins (Ulrich, et al., Virus Res. 50: 141-182 (1998)), measles virus (Warnes, et al., Gene 160: 173-178 ( 1995)), Sindbis virus, rotavirus (US patent 5071651 and US patent 5374426), vesicular stomatitis virus, foot and mouth disease (Twomey, et al., Vaccine 13: 1603-1610, (1995)), Norwalk virus ( Jiang, X., et al., Science 250: 1580-1583 (1990); Matsui, SM, et al., J. Clin. Invest. 87: 1456-1461 (1991)), GAG retroviral protein (WO 96 / 30523), Ty retrotransposon protein p1, hepatitis B virus surface protein (WO 92/11291), human papillomavirus (WO 98/15631), RNA phages, Ty, fr phage, GA phage and Qβ phage.

As will be readily apparent to those skilled in the art, the VLP of the invention is not limited to any particular form. The particle can be synthesized chemically or through a biological process, which may be natural or non-natural. As an example, this type of variant includes a virus-like particle or its recombinant form.

In a more specific embodiment, the VLP may contain or, alternatively, essentially consist of or, alternatively, consist of recombinant polypeptides or fragments thereof, selected from recombinant rotavirus polypeptides, recombinant Norwalk virus polypeptides, recombinant alphavirus polypeptides, recombinant virus polypeptides of virus I measles, recombinant Sindbis virus polypeptides, recombinant polyoma virus polypeptides, recombinant retrovirus polypeptides, recombinant hepatitis B virus polypeptides (e.g., HBcAg), recombinant tobacco mosaic virus polypeptides, sheep's nightmare recombinant polypeptides, human papilloma virus recombinant polypeptides, bacteriophage recombinant polypeptides, recombinant RNA polypeptides, recombinant recombinant polypeptides, recombinant recombinant polypeptides, recombinant recombinant polypeptides GA-phage and recombinant Qβ-phage polypeptides. A virus-like particle may also contain, or alternatively essentially consist of, or, alternatively, consist of one or more fragments of such polypeptides, as well as variants of such polypeptides. Variants of the polypeptides may have, for example, at least 80%, 85%, 90%, 95%, 97% or 99% amino acid identity with their wild-type counterparts.

In a preferred embodiment, the virus-like particle contains essentially consists or alternatively consists of recombinant proteins or fragments of RNA phage. Preferably, the RNA phage is selected from the group consisting of a) bacteriophage Qβ; b) bacteriophage R17; c) bacteriophage fr; d) bacteriophage GA; e) bacteriophage SP; f) bacteriophage MS2; g) bacteriophage M11; h) bacteriophage MX1; i) bacteriophage NL95; k) bacteriophage f2; and l) bacteriophage PP7.

In another preferred embodiment of the invention, the virus-like particle contains or, alternatively, essentially consists of or, alternatively, consists of recombinant proteins or fragments thereof, Qβ RNA bacteriophage or fr. RNA bacteriophage.

In another preferred embodiment of the present invention, the recombinant proteins contain or, alternatively, essentially consist or alternatively consist of covering RNA phage proteins.

Coating RNA phage proteins forming capsids or VLPs or fragments of bacteriophage coating proteins compatible with self-assembly into capsid or VLP are thus further preferred embodiments of the present invention. Bacteriophage Qβ coating proteins, for example, can be recombinantly expressed in E. coli. In addition, with such expression, these proteins spontaneously form capsids. In addition, these capsids form a structure with its inherent repetitive organization.

Specific preferred examples of bacteriophage coat proteins that can be used to prepare compositions of the invention include bacteriophage RNA coat proteins such as Qβ bacteriophage (SEQ ID NO: 10; PIR Database, Inventory No. VCBPQβ Related to CP Qβ and SEQ ID NO: 11; Inventory No. AAA16663 relating to A1 Qβ protein), bacteriophage R17 (SEQ ID NO: 12; PIR, Inventory No. VCBPR7), bacteriophage fr (SEQ ID NO: 13; PIR, Inventory No. VCBPFR), Bacteriophage GA (SEQ ID NO: 14; GenBank, Inventory No. NP-040754), Bacteriophage SP (SEQ ID NO: 15; GenBank, Inventory No. CAA30374 Related to CP SP, and SEQ ID NO: 1 6; Inventory No. NP 695026 relating to Protein A1 SP), bacteriophage MS2 (SEQ ID NO: 17; PIR, Inventory No. VCBPM2), bacteriophage M11 (SEQ ID NO: 18; GenBank, Inventory No. AAC06250), bacteriophage MX1 (SEQ ID NO: 19; GenBank, inventory No. AAC14699), bacteriophage NL95 (SEQ ID NO: 20; GenBank, inventory No. AAC14704), bacteriophage f2 (SEQ ID NO: 21; GenBank, inventory No. P03611), bacteriophage PP7 (SEQ ID NO: 22). In addition, protein A1 of the bacteriophage Qβ or C-terminal truncated forms in which up to 100, 150 or 180 amino acids from its C-terminus are absent can be included in the capsid assembly of the Qβ coat proteins. Typically, the percentage of A1 Qβ protein relative to CP Qβ in the assembled capsid construct will be limited to allow for capsid formation.

It was also found that the Qβ coating protein undergoes self-assembly into capsids when expressed in E. coli (Kozlovska TM. Et al., GENE 137: 133-137 (1993)). The resulting capsids or virus-like particles had an icosahedral capsid structure similar to that of a phage with a diameter of 25 nm and a quasi-symmetry of T = 3. In addition, the crystal structure of phage Qβ was determined. The capsid contains 180 copies of the coating protein, which are linked into covalent pentamers and hexamers by disulfide bridges (Golmohammadi, R. et al., Structure 4: 543-5554 (1996)), providing amazing stability of the capsid of the Qβ coating protein. However, capsids or VLPs derived from the recombinant Qβ coat protein may contain subunits that are not disulfide bonded to other subunits in the capsid or are not fully bonded. Thus, when a recombinant Qβ capsid is loaded onto a non-reducing SDS-PAGE, bands corresponding to the monomeric Qβ coating protein are visible, as well as bands corresponding to the hexamer or pentamer of the Qβ coating protein. Subunits that are not fully linked by disulfide bonds can be seen as a dimer, trimer or even tetramer band in non-reducing SDS-PAGE. The Qβ capsid protein also exhibits unusual resistance to organic solvents and denaturing agents. Unexpectedly, the authors found that such high concentrations of DMSO and acetonitrile as 30%, and such high concentrations of guanidinium as 1 M, do not affect the stability of the capsid. The high stability of the capsid from the Qβ coating protein is an advantage, in particular for its use in immunization and vaccination of mammals and humans according to this invention.

When expressed in E. coli, the N-terminal methionine of the Qβ coat protein is usually removed as found by Edman N-terminal sequencing as described by Stoll, E. et al. J. Biol. Chem. 252: 990-993 (1977). VLPs consisting of Qβ coating proteins where the N-terminal methionine is removed, or VLPs containing a mixture of Qβ coating proteins, where the N-terminal methionine is either cleaved or present, are also within the scope of this invention.

In addition, it has also been shown that RNA phage coat proteins self-assemble when expressed in a bacterial host (Kastelein, RA. Et al., Gene 23: 245-254 (1983), Kozlovskaya, TM. Et al., Dokl. Akad. Nauk SSSR 287: 452-455 (1986), Adhin, MR. Et al., Virology 170: 238-242 (1989), Ni, CZ., Et al., Protein Sci. 5: 2485-2493 (1996), Priano, C. et al., J. Mol. Biol. 249: 283-297 (1995)). The phage Qβ capsid, in addition to the covering protein, contains the so-called fully readable protein A1 and maturation protein A2. A1 is formed as a result of suppression in the UGA stop codon and has a length of 329 a / c. The capsid of the recombinant phage Qβ coat protein used in this invention lacks the A2 lysis protein and contains RNA from the host. The covering RNA phage protein is an RNA binding protein and interacts with the stem loop of the replicase gene ribosome binding site, acting as a translation repressor during the virus life cycle. The sequence and structural elements of the interaction are known (Witherell, GW. And Uhlenbeck, OC. Biochemistry 28: 71-76 (1989); Lim F. et al., J. Biol. Chem. 271: 31839-31845 (1996)). The stem loop and RNA are known to be generally involved in the assembly of the virus (Golmohammadi, R. et al., Structure 4: 543-5554 (1996)).

In a further preferred embodiment of the invention, the virus-like particle contains or, alternatively, essentially consists of or, alternatively, consists of recombinant proteins or fragments of RNA phage, where the recombinant proteins contain, essentially consist or, alternatively, consist of mutant RNA-covering proteins phage, preferably mutant coat proteins of RNA phages mentioned above. In another preferred embodiment, the mutant RNA phage coat proteins are modified by removing at least one lysine residue by substitution or by adding at least one lysine residue by substitution; alternatively, mutant RNA phage coat proteins are modified by deletion of at least one lysine residue or addition of at least one lysine residue by insertion.

In another preferred embodiment, the virus-like particle contains or, alternatively, essentially consists of or, alternatively, consists of recombinant proteins or fragments of RNA bacteriophage Qβ, where the recombinant proteins contain or, alternatively, essentially consist, or, alternatively, consist of covering proteins having the amino acid sequence of SEQ ID NO: 10, or mixtures of coating proteins having the amino acid sequence of SEQ ID NO: 10 and SEQ ID NO: 11, or mutants of SEQ ID NO: 11, and where the N-terminal methionine is preferably cleaved.

In a further preferred embodiment of the present invention, the virus-like particle contains essentially consists or alternatively consists of recombinant Qβ proteins or fragments thereof, where the recombinant proteins contain or alternatively essentially consist or, alternatively, consist of mutant Qβ coating proteins. In another preferred embodiment, said mutant coating proteins are modified by removing at least one lysine residue by substitution or by adding at least one lysine residue by substitution. Alternatively, said mutant coating proteins are modified by deletion of at least one lysine residue or by adding at least one lysine residue by insertion.

Four lysine residues are exposed on the surface of the capsid from the Qβ coating protein. Qβ mutants, for which exposed lysine residues are replaced with arginines, can also be used for this invention. Thus, the following Qβ coating protein mutants and Qβ mutant VLPs can be used in the practice of the invention: “Qβ-240” (Lys13-Arg; SEQ ID NO: 23), “Qβ-243” (Asn 10-Lys; SEQ ID NO : 24), Qβ-250 (Lys 2-Arg, Lys13-Arg; SEQ ID NO: 25), Qβ-251 (SEQ ID NO: 26) and Qβ-259 (Lys 2-Arg, Lys16-Arg; SEQ ID NO: 27). Thus, in a further preferred embodiment of the invention, the virus-like particle contains essentially consists or alternatively consists of recombinant proteins of mutant Qβ coating proteins, which contain proteins having an amino acid sequence selected from the following group: a) amino acid sequence of SEQ ID NO: 23; b) the amino acid sequence of SEQ ID NO: 24; c) the amino acid sequence of SEQ ID NO: 25; d) the amino acid sequence of SEQ ID NO: 26; and e) the amino acid sequence of SEQ ID NO: 27. The construction, expression and purification of the aforementioned Qβ, VLP coating proteins and capsids from mutant Qβ coating proteins, respectively, are described in pending application for US patent No. 10/050902 filed by this assignee on January 18, 2002. In particular, the link refers to Example 18 of the above application.

In a further preferred embodiment of the invention, the virus-like particle contains or, alternatively, essentially consists or alternatively consists of recombinant Qβ proteins or fragments thereof, where the recombinant proteins contain, essentially consist or, alternatively, consist of a mixture of any one of the above Qβ mutants and the corresponding protein A1.

In a further preferred embodiment of the present invention, the virus-like particle contains or, alternatively, essentially consists of or, alternatively, consists of recombinant proteins of the AP205 RNA phage or their phage.

The AP205 genome consists of a maturation protein, a covering protein, a replicase, and two open reading frames not present in related phages; lysis gene and open reading frame, which plays a role in the translation of the maturation gene (Klovins, J., et al., J. Gen. Virol. 83: 1523-33 (2002)). The AP205 coating protein can be expressed from plasmid pAP283-58 (SEQ ID NO: 111), which is a derivative of pQb10 (Kozlovska, TM, et al., Gene 137: 133-37 (1993)) and which contains the AP205 ribosome binding site. Alternatively, the AP205 coat protein can be cloned into pQb185 below the ribosome binding site present in the vector. Both methods result in protein expression and capsid formation, as described in the pending application for the grant of US patent No. 60/396126, entitled "Molecular Antigenic Matrices" and filed by this assignee on July 17, 2002, which is incorporated by reference in full volume. The vectors pQb10 and pQb185 are vectors derived from the pGEM vector, and the expression of cloned genes in these vectors is controlled by the trp promoter (Kozlovska, TM, et al., Gene 137: 133-37 (1993)). Plasmid pAP283-58 (SEQ ID NO: 111) contains the putative AP205 ribosome binding site in the following sequence, which is located below the XbaI site and immediately above the ATG start codon of AP205 coat protein: tctagaATTTTCTGCGCACCCATCCCGGGTGGCGCCCAAAGT GAGGAg AQCat AATCat AATCat AATCat. Vector pQb185 contains the Shine-Dalgarno sequence below the XbaI site and above the start codon (tctagaTTAACCCAACGCGT AGGAG TCAGGCCatg (SEQ ID NO: 116), the Shine-Dalgarno sequence is underlined).

In a further preferred embodiment of the invention, the virus-like particle comprises or, alternatively, essentially consists of, or alternatively consists of recombinant AP205 RNA phage coat proteins or fragments thereof.

Thus, said preferred embodiment of the invention includes AP205 coat proteins that form capsids. Such proteins are expressed recombinantly or obtained from natural sources. The AP205 coating proteins produced in bacteria spontaneously form capsids, as evidenced by electron microscopy (EM) and immunodiffusion. The structural features of the capsid formed by the AP205 coat protein (SEQ ID NO: 112) and the features of the capsid formed by the AP205 RNA phage coat protein are almost identical when observed in EM. AP205 VLPs are highly immunogenic and can be associated with antigens and / or antigenic determinants to form vaccine constructs exposing antigens and / or antigenic determinants in a repetitive manner. High antibody titers are produced against antigens exposed in this way, which indicates that the associated antigens and / or antigenic determinants are available for interaction with antibody molecules and are immunogenic.

In a further preferred embodiment of the invention, the virus-like particle contains or, alternatively, essentially consists of, or, alternatively, consists of recombinant mutant coat proteins of RNA phage AP205 or fragments thereof.

Assembly-competent mutant forms of the VLP of AP205, including the AP205 coating protein with the substitution of proline at amino acid 5 for threonine (SEQ ID NO: 113), can also be used in the practice of the invention, and they constitute the following preferred embodiment of the invention. These VLPs, AP205 VLPs obtained from natural sources, or AP205 viral particles can be coupled to antigens to form ordered repeatable antigen matrices according to the invention.

The mutant P5-T AP205 coat protein can be expressed from plasmid pAP281-32 (SEQ ID No. 114), which is derived directly from pQb185 and which contains the AP205 mutant cover protein gene instead of the Qβ coat protein gene. Vectors for expression of the AP205 coat protein were transfected into E. coli to express the AP205 coat protein.

Methods for expressing a coating protein and, correspondingly, a mutant coating protein leading to self-assembly in the VLP are described in the jointly pending provisional application for US patent, entitled "Molecular Antigenic Matrices" and filed by this assignee on July 17, 2002, which is incorporated by reference in full volume. Suitable strains of E. coli include, but are not limited to, E. coli K802, JM 109, RR1. Suitable vectors and strains and their combinations can be identified by testing the expression of the coating protein and, accordingly, the mutant coating protein using SDS-PAGE and the formation and assembly of the capsid, first by optional purification of the capsids by gel filtration and then testing them in an immunodiffusion analysis (test Ouchterloni) or by electron microscopy (Kozlovska, TM, et al., Gene 137: 133-37 (1993)).

The AP205 coating proteins expressed from the vectors pAP283-58 and pAP281-32 may be deprived of the initial amino acid methionine due to processing in the E. coli cytoplasm. Cleaved, unsplit forms of VLP AP205 or mixtures thereof are further preferred embodiments of the invention.

In a further preferred embodiment of the invention, the virus-like particle comprises or, alternatively, essentially consists of or alternatively consists of a mixture of recombinant AP205 RNA phage coat proteins or fragments thereof and AP205 RNA phage recombinant mutant coat proteins or fragments thereof.

In a further preferred embodiment of the invention, the virus-like particle contains or, alternatively, essentially consists of or, alternatively, consists of fragments of recombinant coat proteins or recombinant mutant coat proteins of RNA phage AP205.

Fragments of the recombinant coating protein AP205, capable of collecting in VLP and, accordingly, capsid, are also applicable in the practice of the invention. These fragments can be formed by deletion either internally or at the ends of the coating protein and mutant coating protein, respectively. Insertions into the sequence of a coating protein and a mutant coating protein, or fusion of antigenic sequences with a sequence of a coating protein and a mutant coating protein that are compatible with the assembly in the VLP, are further embodiments of the invention that result in AP205 chimeric coating proteins and particles, respectively. The effects of insertions, deletions and fusions with the sequence of the covering protein, and whether it is compatible with the assembly in VLP, can be determined using electron microscopy.

Particles formed by a coating protein, coating protein fragments, or AP205 chimeric coating proteins described above can be isolated in pure form by combining the fractionation steps by precipitation and gel filtration purification steps using columns, for example, with Sepharose CL-4B, Sepharose CL -2B, Sepharose CL-6B and combinations thereof, as described in the jointly pending provisional application for a US patent, entitled "Molecular Antigenic Matrices" and filed by this assignee on Jul 17 I am 2002, which is incorporated by reference in its entirety. Other methods for isolating virus-like particles are known in the art and can be used to isolate virus-like particles (VLPs) of the bacteriophage AP205. For example, the use of ultracentrifugation to isolate the VLP of the yeast retrotransposon Ty is described in US Pat. No. 4,918,166, which is incorporated herein by reference in its entirety.

The crystal structure of several RNA bacteriophages has been determined (Golmohammadi, R. et al., Structure 4: 543-554 (1996)). Using this information, residues exposed on the surface can be identified, and thus, the covering proteins of the RNA phage can be modified so that one or more reactive amino acid residues can be inserted by insertion or substitution. As a result, these modified forms of bacteriophage coating proteins can also be used for this invention. Thus, variants of the proteins that form capsids or capsid-like structures (e.g., covering proteins of the bacteriophage Qβ, bacteriophage R17, bacteriophage fr, bacteriophage GA, bacteriophage SP, and bacteriophage MS2) can also be used to prepare the compositions of this invention.

Although the sequence of protein variants discussed above will differ from their wild-type counterparts, these protein variants will typically retain the ability to form capsids or capsid-like structures. Thus, the invention also includes compositions and, accordingly, vaccine compositions, which, in addition, contain variants of proteins that form capsids or capsid-like structures, as well as methods for producing such compositions and, accordingly, vaccine compositions, individual subunits the protein used to prepare such compositions; and nucleic acid molecules that encode the protein subunits. Thus, variant forms of wild-type proteins that form capsids or capsid-like structures and retain the ability to associate and form capsids or capsid-like structures are included within the scope of the invention.

As a result, the invention further includes vaccine compositions and, accordingly, vaccine compositions containing proteins that contain or, alternatively, essentially consist or, alternatively, consist of amino acid sequences that are at least 80%, 85%, 90%, 95%, 97% or 99% are identical to wild-type proteins, which form ordered matrices and, accordingly, matrices having their inherent repeating structure.

In addition, nucleic acid molecules that encode proteins used to prepare the compositions of this invention are included within the scope of the invention.

In other embodiments, the invention also relates to compositions containing proteins that contain or, alternatively, essentially consist or, alternatively, consist of amino acid sequences that are at least 80%, 85%, 90%, 95%, 97% or 99% are identical to any of the amino acid sequences shown in SEQ ID NO: 10-27.

Proteins suitable for use in this invention also include C-terminus-shortened protein mutants that form capsids or capsid-like structures or VLPs. Specific examples of such truncated mutants include proteins having the amino acid sequence shown in any of SEQ ID NOs: 10-27, where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from C- the end. Typically, these shortened mutants at the C-terminus will retain the ability to form capsids or capsid-like structures.

The following proteins suitable for use in this invention also include N-terminally shortened protein mutants that form capsids or capsid-like structures. Specific examples of such truncated mutants include proteins having the amino acid sequence shown in any of SEQ ID NOs: 10-27, where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from N- the end. Typically, these N-terminally shortened mutants will retain the ability to form capsids or capsid-like structures.

Additional proteins suitable for use in this invention include N- and C-terminus-truncated mutants that form capsids or capsid-like structures. Suitable truncated mutants include proteins having the amino acid sequence shown in any of SEQ ID NOs: 10-27, where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N-terminus and 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids were removed from the C-terminus. Typically, these mutants shortened at the N-terminus and C-terminus will retain the ability to form capsids or capsid-like structures.

The invention also relates to compositions containing proteins that contain or, alternatively, essentially consist or, alternatively, consist of amino acid sequences that are at least 80%, 85%, 90%, 95%, 97% or 99% are identical to the shortened mutants described above.

Thus, the invention relates to vaccine compositions and compositions obtained from proteins that form capsids or VLPs, methods for producing said compositions from individual protein subunits and VLPs or capsids, methods for producing said individual protein subunits, nucleic acid molecules that encode said subunits, and vaccination methods and / or methods that elicit immunological responses in individuals using the compositions of this invention.

As indicated previously, the invention includes virus-like particles or their recombinant forms. In one preferred embodiment, the particles used in the compositions of the invention are comprised of hepatitis B core protein (HBcAg) or an HBcAg fragment. In a further embodiment, the particles used in the compositions of the invention are comprised of hepatitis B core protein (HBcAg) or an HBcAg protein fragment that has been modified to either remove or reduce the amount of free cysteine residues. Zhou et al. (J. Virol. 66: 5393-5398 (1992)) showed that HBcAg, which were modified in order to remove naturally occurring cysteine residues, retain the ability to associate and form capsids. Thus, VLPs suitable for use in the compositions of the invention include VLPs containing modified HBcAg or fragments thereof in which one or more naturally occurring cysteine residues have been either deleted or replaced with another amino acid residue (e.g., a serine residue )

HBcAg is a protein formed by processing the hepatitis B core antigen precursor protein. A number of HBcAg isotypes have been identified and their amino acid sequences are readily available to those skilled in the art. In most cases, the compositions and, accordingly, the vaccine compositions of the invention can be prepared using a processed form of HBcAg (i.e., HBcAg from which the N-terminal leader sequence of the hepatitis B core antigen precursor protein has been removed).

In addition, when HBcAg will be obtained under conditions under which processing will not occur, HBcAg will typically be expressed in “processed” form. For example, when an E. coli expression system directing protein expression in the cytoplasm is used to produce the HBcAg according to the invention, these proteins will typically be expressed so that they lack the N-terminal leader sequence of the hepatitis B core antigen precursor protein.

The preparation of hepatitis B virus-like particles that can be used for this invention is described, for example, in WO 00/32227 and in said application, in particular in Examples 17 to 19 and from 21 to 24, as well as in WO 01/85208 and in it, in particular, in examples 17 to 19, 21 to 24, 31 to 41, and in pending application for the grant of US patent No. 10/050902, filed by this assignee on January 18, 2002. In the case of the last application, this in particular, refers to example 23, 24, 31 and 51. All three documents are incorporated into this description by reference in full.

The invention also includes HBcAg variants that have been modified to remove or replace one or more additional cysteine residues. It is known in the art that free cysteine residues may be involved in a number of adverse chemical reactions. These adverse reactions include disulfide exchanges, reactions with chemicals or metabolites, which, for example, are injected or formed during combination therapy with other substances, or direct oxidation and reaction with nucleotides when exposed to UV light. Thus, toxic adducts can be formed, especially considering the fact that HBcAg have a steady tendency to nucleic acid binding. Thus, toxic adducts can be represented by many species, each of which may separately be present in low concentrations, but together they reach toxic levels.

From the point of view of the above, one of the advantages of using HBcAg vaccines in compositions that have been modified to remove naturally occurring cysteine residues is that the number of sites to which toxic elements can bind when antigens or antigenic determinants may be reduced, or they may be removed altogether.

A number of naturally occurring HBcAg variants have been identified that are suitable for use in the practice of this invention. Yuan et al., (J. Virol. 73: 10122-10128 (1999)), for example, describe variants in which the isoleucine residue at the position corresponding to position 97 in SEQ ID NO: 28 is replaced with either a leucine residue or phenylalanine residues . The amino acid sequences of a number of HBcAg variants as well as several variants of the hepatitis B core antigen precursor are described in GenBank, entry AAF121240 (SEQ ID NO: 29), AF121239 (SEQ ID NO: 30), X85297 (SEQ ID NO: 31), X02496 (SEQ ID NO: 32), X85305 (SEQ ID NO: 33), X85303 (SEQ ID NO: 34), AF151735 (SEQ ID NO: 35), X85259 (SEQ ID NO: 36), X85286 (SEQ ID NO: 37) , X85260 (SEQ ID NO: 38), X85317 (SEQ ID NO: 39), X85298 (SEQ ID NO: 40), AF043593 (SEQ ID NO: 41), M20706 (SEQ ID NO: 42), X85295 (SEQ ID NO: 43), X80925 (SEQ ID NO: 44), X85284 (SEQ ID NO: 45), X85275 (SEQ ID NO: 46), X72702 (SEQ ID NO: 47), X85291 (SEQ ID NO: 48), X65258 (SEQ ID NO: 49), X85302 (SEQ ID NO: 50), M32138 (SEQ ID NO: 51), X85293 (SEQ ID NO: 52), X85315 (SEQ ID NO: 53), U95551 (SEQ ID NO : 54), X85256 (SEQ ID NO: 55), X85316 (SEQ ID NO: 56), X85296 (SEQ ID NO: 57), AB033559 (SEQ ID NO: 58), X59795 (SEQ ID NO: 59 ), X85299 (SEQ ID NO: 60), X85307 (SEQ ID NO: 61), X65257 (SEQ ID NO: 62), X85311 (SEQ ID NO: 63), X85301 (SEQ ID NO: 64), X85314 (SEQ ID NO: 65), X85287 (SEQ ID NO: 66), X85272 (SEQ ID NO: 67), X85319 (SEQ ID NO: 68), AB010289 (SEQ ID NO: 69), X85285 (SEQ ID NO: 70) , AB010289 (SEQ ID NO: 71), AF121242 (SEQ ID NO: 72), M90520 (SEQ ID NO: 73), P03153 (SEQ ID NO: 74), AF110999 (SEQ ID NO: 75) and M95589 (SEQ ID NO: 76), descriptions of each of which are incorporated herein by reference. These HBcAg variants differ in amino acid sequence in a number of positions, including amino acid residues that correspond to amino acid residues located at positions 12, 13, 21, 22, 24, 29, 32, 33, 35, 38, 40, 42, 44, 45 , 49, 51, 57, 58, 59, 64, 66, 67, 69, 74, 77, 80, 81, 87, 92, 93, 97, 98, 100, 103, 105, 106, 109, 113, 116 , 121, 126, 130, 133, 135, 141, 147, 149, 157, 176, 178, 182 and 183 in SEQ ID NO: 77. The following HBcAg variants suitable for use in the compositions of the invention and which may be further modified as described herein are described in WO 01/98333, WO 01/77158 and WO 02/14478.

As indicated above, as a rule, processed HBcAg (i.e., those in which there are no leader sequences) will be used in the compositions and, accordingly, the vaccine compositions of the invention. The present invention includes vaccine compositions as well as methods of using such compositions that use the HBcAg variants described above.

Whether the amino acid sequence of the polypeptide has an amino acid sequence that is at least 80%, 85%, 90%, 95%, 97% or 99% identical to one of the above wild-type amino acid sequences or part thereof, can be determined by a standard method using known computer programs such as Bestfit. When using Bestfit or any other sequence alignment program to determine if a particular sequence is identical, for example, to 95% of the reference amino acid sequence, the parameters are set so that the percentage of identity is calculated over the entire full length of the reference amino acid sequence and that spaces are allowed in homology to 5% of the total number of amino acid residues in the reference sequence.

HBcAg variants and precursors having the amino acid sequences indicated in SEQ ID NOs: 29-72 and 73-76 are relatively similar to each other. Thus, a reference to the amino acid residue of an HBcAg variant located at a position that corresponds to a particular position in SEQ ID NO: 77 refers to the amino acid residue that is present at that position in the amino acid sequence shown in SEQ ID NO: 77. The homology between these HBcAg variants among the hepatitis B viruses that infect mammals is in most cases quite high, so that a person skilled in the art will not have great difficulty viewing both sequences, the amino acid sequence shown in SEQ ID NO: 77, and the amino acid sequence a specific variant of HBcAg, and in the identification of “relevant” amino acid residues. In addition, the amino acid sequence of HBcAg shown in SEQ ID NO: 73, which shows the amino acid sequence of HBcAg derived from a virus that infects woodchucks, has a fairly high homology with HBcAg having the amino acid sequence shown in SEQ ID NO: 77, so it is easy to see that an insertion of three amino acid residues is present in SEQ ID NO: 64 between amino acid residues 155 and 156 of SEQ ID NO: 77.

The invention also includes vaccine compositions that contain HBcAg variants of hepatitis B viruses that infect birds, as well as vaccine compositions that contain fragments of these HBcAg variants. In the case of these HBcAg variants, one, two, three or more cysteine residues present in the indicated polypeptides under natural conditions can either be replaced with another amino acid residue or deleted before being included in the vaccine compositions of the invention.

As discussed above, the removal of free cysteine residues reduces the number of sites where toxic components can bind to HBcAg, and also removes sites where cross-linking of lysine and cysteine residues of the same or neighboring HBcAg molecules can occur. Thus, in another embodiment of the invention, one or more cysteine residues of the hepatitis B virus capsid protein is either deleted or replaced with another amino acid residue.

In other embodiments, the compositions and, accordingly, the vaccine compositions of the invention will contain HBcAg from which the C-terminal region has been removed (e.g., amino acid residues 145-185 or 150-185 of SEQ ID NO: 77). Thus, further modified HBcAg suitable for use in the practice of the present invention include C-terminated shortened mutants. Suitable truncated mutants include HBcAg in which 1, 5, 10, 15, 20, 25, 30, 34, 35 amino acids have been removed from the C-terminus.

HBcAg suitable for use in the practice of this invention also include N-terminally shortened mutants. Suitable truncated mutants include modified HBcAg in which 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N-terminus.

The following HBcAg suitable for use in the practice of this invention include shortened at the N - and C-ends of the mutants. Suitable truncated mutants include HBcAg in which 1, 2, 5, 7, 9, 10, 12, 14, 15, and 17 amino acids have been removed from the N-terminus and 1, 5, 10, 15, 20, 25, 30, 34 , 35 amino acids were deleted from the C-terminus.

The invention also includes vaccine compositions and, accordingly, vaccine compositions containing HBcAg polypeptides containing or, alternatively, essentially consisting of, or, alternatively, consisting of amino acid sequences that are at least 80%, 85%, 90% , 95%, 97% or 99% are identical to the shortened mutants described above.

In some embodiments of the invention, a lysine residue is introduced into the HBcAg polypeptide to mediate the binding of the RANKL protein, RANKL fragment, or RANKL peptide to the HBLAg VLP. In preferred embodiments, the compositions of the invention are prepared using HBcAg containing or alternatively consisting of amino acids 1-144 or 1-149, 1-185 of SEQ ID NO: 77, which is modified so that the amino acids corresponding to positions 79 and 80 are replaced a peptide having the amino acid sequence Gly-Gly-Lys-Gly-Gly (SEQ ID NO: 117; SEQ ID NO: 78). In further preferred embodiments, cysteine residues at positions 48 and 107 of SEQ ID NO: 77 are mutated into serine. The invention also includes compositions containing the corresponding polypeptides having the amino acid sequences shown in any of SEQ ID NOS: 29-74, which also have the above amino acid changes. In addition, additional HBcAg variants that are capable of associating with capsid or VLP formation and have the above amino acid changes are included in the scope of the invention. Thus, the invention also includes compositions and, accordingly, vaccine compositions containing HBcAg polypeptides that contain or, alternatively, consist of amino acid sequences that are at least 80%, 85%, 90%, 95% , 97% or 99% are identical to any of the wild-type amino acid sequences, and the forms of these proteins, which were processed in suitable cases to remove the N-terminal leader sequence, and modified by the above changes.

Compositions or vaccine compositions according to the invention may contain mixtures of different HBcAg. Thus, these vaccine compositions may consist of HBcAg, which differ in amino acid sequence. For example, vaccine compositions containing wild-type HBcAg and modified HBcAg can be prepared in which one or more amino acid residues have been altered (eg, deleted, inserted, or replaced). In addition, preferred vaccine compositions according to the invention are compositions that are a highly ordered and repeating antigenic matrix in which the antigen is a RANKL protein, a RANKL fragment or a RANKL peptide.

In a further preferred embodiment of the present invention, at least one RANKL protein, RANKL fragment or RANKL peptide is bound to said central particle and, accordingly, a virus-like particle of at least one covalent bond. Preferably, at least one RANKL protein, RANKL fragment, or RANKL peptide is bound to a central particle and, accordingly, to a virus-like particle of at least one covalent bond, said covalent bond being a non-peptide bond, which leads to the formation of an ordered and repeating central particle matrix -RANKL and, accordingly, RANKL-VLP-matrix or-conjugate. This matrix or, accordingly, the RANKL-VLP conjugate usually and preferably has a repeating and ordered structure, since at least one, but usually several RANKL proteins, RANKL fragments or RANKL peptides are oriented in a oriented manner with VLP. Preferably, more than 10, 20, 40, 80, 120 RANKL proteins, RANKL fragments, or RANKL peptides are associated with VLP. The formation of a repeating and ordered RANKL-VLP matrix and, accordingly, the conjugate is provided by oriented and directed, as well as certain binding and, accordingly, the attachment of at least one RANKL protein, RANKL fragment or RANKL peptide to VLP, as will be understood from the following. In addition, the usual inherent highly repeatable and organized VLP structure predominantly contributes to the exposure of the RANKL protein, RANKL fragment or RANKL peptide in a highly ordered and repetitive manner, resulting in the formation of a highly organized and repeating RANKL-VLP matrix and, accordingly, RANKL-VLP conjugate.

Thus, preferred conjugates and, accordingly, matrices according to the invention differ from prior art conjugates in their highly organized structure, size and repeatability of the antigen on the matrix surface. A preferred embodiment of the invention furthermore allows the expression of both the particle and the antigen in the expression host, ensuring proper packaging of the antigen, i.e. at least one RANKL protein, RANKL fragment, or RANKL peptide and proper packaging and assembly of the VLP.

The present invention provides methods for binding a RANKL protein, RANKL fragment, or RANKL peptide to central particles and, accordingly, to VLP. As indicated in one aspect of the invention, the RANKL protein, RANKL fragment, or RANKL peptide is coupled to a central particle and, accordingly, to VLP via chemical crosslinking, usually and preferably using a heterobifunctional crosslinking agent. Several heterobifunctional cross-linking agents are known in the art. In preferred embodiments, the heterobifunctional cross-linking agent contains a functional group that can interact with preferred first binding sites, i.e. with the amino group of the side chain of the lysine residues of the central particle and the VLP or at least one VLP subunit, respectively, and an additional functional group that can interact with a preferred second binding site, i.e. a naturally-occurring cysteine residue that is made available for reaction by reduction, or engineered on a RANKL protein, RANKL fragment or RANKL peptide, and optionally also made available for reaction by reduction. The first step of the process, commonly called derivatization, is the interaction of a central particle or VLP with a cross-linking agent. The product of this reaction is an activated core particle or activated VLP, also called an activated carrier. In a second step, unreacted cross-linking agent is removed using conventional methods such as gel filtration or dialysis. In a third step, the RANKL protein, RANKL fragment, or RANKL peptide is reacted with an activated carrier, and this step is commonly referred to as the binding step. Unreacted RANKL protein, a RANKL fragment, or a RANKL peptide can optionally be removed in a fourth step, for example, by dialysis. Several heterobifunctional cross-linking agents are known in the art. These agents include preferred cross-linking agents SMPH (Pierce), sulfo-MBS, sulfo-EMCS, sulfo-GMBS, sulfo-SIAB, sulfo-SMPB, sulfo-SMCC, SVSB, SIA and other cross-linking agents available, for example, from Pierce Chemical Company (Rockford, IL, USA) and having one functional group reactive with respect to amino groups and one functional group reactive with cysteine residues. All of the above cross-linking agents lead to the formation of a thioether bond. Another class of cross-linking agents suitable for the practice of the invention is characterized by the introduction of a disulfide bond between the RANKL protein, RANKL fragment or RANKL peptide and the central particle or VLP upon binding. Preferred cross-linking agents of this class include, for example, SPDP and sulfo-LC-SPDP (Pierce). The degree of derivatization of the central particle and, accordingly, the VLP cross-linking agent can be influenced by various experimental conditions, such as the concentration of each of the reaction partners, the excess of one reagent compared to another, pH, temperature and ionic strength. The degree of binding, i.e. the amount of RANKL protein, RANKL fragment, or RANKL peptides per subunit of the central particle and, accordingly, VLP, can be adjusted by various experimental conditions described above to ensure compliance with vaccine requirements. The solubility of the RANKL protein, RANKL fragment or RANKL peptide may impose a limit on the amount of RANKL protein, RANKL fragment or RANKL peptide that can be associated with each subunit, and in cases where the vaccine obtained may be insoluble, it may be useful to reduce the amount of RANKL protein. a RANKL fragment or RANKL peptides per subunit.

A particularly preferred method of binding the RANKL protein, RANKL fragment or RANKL peptides to the central particle and, accordingly, to the VLP is to bind the lysine residue on the surface of the central particle and, accordingly, VLP to the cysteine residue on the RANKL protein, RANKL fragment or RANKL peptide. Thus, in a preferred embodiment of the invention, the first binding site is a lysine residue, and the second binding site is a cysteine residue. In some embodiments, it may be necessary to construct an amino acid linker containing a cysteine residue, as a second binding site or as part of it, to a RANKL protein, RANKL fragment or RANKL peptide to bind to a central particle and, accordingly, to VLP. Alternatively, cysteine can be introduced into the RANKL protein, RANKL fragment, or RANKL peptide, either by insertion or mutation. Alternatively, a cysteine residue or thiol group may be introduced by chemical coupling.

The choice of amino acid linker will depend on the nature of the antigen and, accordingly, autoantigen, i.e. from the nature of the RANKL protein, RANKL fragment, or RANKL peptide, from its biochemical properties such as pI, charge distribution, and glycosylation. In general, flexible amino acid linkers are preferred. Preferred amino acid linker variants are selected from the group consisting of: (a) CGG; (b) N-terminal linker gamma 1; (c) an N-terminal gamma-3 linker; (d) hinge sections of Ig; (e) N-terminal glycine linkers; (f) (G) _k C (G) _n for n = 0-12 and k = 0-5; (g) N-terminal glycine-serine linkers; (h) (G) _k C (G) _m (S) _l (GGGGS) _n (SEQ ID NO: 118) for n = 0-3, k = 0-5, m = 0-10, l = 0- 2; (i) GGC; (k) GGC-NH2; (l) C-terminal linker gamma 1; (m) C-terminal linker gamma 3; (n) C-terminal glycine linkers; (o) (G) _n C (G) _k for n = 0-12 and k = 0-5; (p) C-terminal glycine-serine linkers; (q) (G) _m (S) _l (GGGGS) _n (G) _o C (G) _k (SEQ ID NO: 119) for n = 0-3, k = 0-5, m = 0-10, l = 0-2 and o = 0-8.

Further preferred examples of amino acid linkers are the hinge region of immunoglobulins, glycine-serine linkers (GGGGS) _n (SEQ ID NO: 120) and glycine linkers (G) _n , which all further contain a cysteine residue as a second binding site and optionally additional glycine residues. Typically, preferred examples of these amino acid linkers are N-terminal gamma 1: CGDKTHTSPP (SEQ ID NO: 121); C-terminal gamma 1: DKTHTSPPCG (SEQ ID NO: 122); N-terminal gamma 3: CGGPKPSTPPGSSGGAP (SEQ ID NO: 123); C-terminal gamma 3: PKPSTPPGSSGGAPGGCG (SEQ ID NO: 124); N-terminal glycine linker: GCGGGG (SEQ ID NO: 125); C-terminal glycine linker: GGGGCG (SEQ ID NO: 126); C-terminal glycine-lysine linker: GGKKGC (SEQ ID NO: 127); N-terminal glycine-lysine linker: CGKKGG (SEQ ID NO: 128).

In a further preferred embodiment of the present invention, and in particular if the antigen is a RANKL peptide, GGCG linkers (SEQ ID NO: 162), GGC or GGC-NH2 (“NH2” means amidation) are preferred as amino acid linkers C-terminus of a peptide or CGG at its N-terminus. In general, glycine residues will be inserted between the bulk of the amino acids and the cysteine used as the second binding site in order to avoid possible steric interference from the bulk amino acids in the binding reaction.

The cysteine residue present on the RANKL protein, RANKL fragment or RANKL peptide must be in its reduced state in order to react with a heterobifunctional cross-linking agent on the activated VLP, i.e. free cysteine or a cysteine residue with a free sulfhydryl group must be available. In the case where the cysteine residue to function as a binding site is in an oxidized form, for example, if it forms a disulfide bridge, restoration of the indicated disulfide bridge is required, for example, using DTT, TCEP or β-mercaptoethanol.

The binding of the RANKL protein, RANKL fragment or RANKL peptide to the central particle or, respectively, to the VLP using a heterobifunctional cross-linking agent according to the preferred methods described above allows the binding of the RANKL protein, RANKL fragment or RANKL peptide to the central particle and, accordingly, to the VLP oriented way. Other methods for linking a RANKL protein, RANKL fragment or RANKL peptide to a central particle and, accordingly, to VLP include methods in which the RANKL protein, RANKL fragment or RANKL peptide cross-link with the central particle and, respectively, to VLP using carbodiimide, EDC and NHS. The RANKL protein, RANKL fragment, or RANKL peptide can also be first thiolated during the reaction, for example, with SATA, SATP or iminothiolan. Then, the RANKL protein, RANKL fragment, or RANKL peptide, if necessary, after deprotection can be coupled to the central particle and, accordingly, VLP as follows. After separation of the excess reagent for thiolation, the RANKL protein, RANKL fragment, or RANKL peptide is reacted with the central particle and, accordingly, with VLP pre-activated by a heterobifunctional cross-linking agent containing a cysteine-reactive residue and, therefore, exhibiting at least one or more functional groups that react with cysteine residues with which the thiolated RANKL protein, RANKL fragment or RANKL peptide, such as described above, can react e. Optionally, small amounts of a reducing agent may be included in the reaction mixture. In the following methods, a RANKL protein, RANKL fragment, or RANKL peptide is coupled to a central particle and, accordingly, to VLP using a homobifunctional crosslinking agent such as glutaraldehyde, DSG, BM [PEO] ₄ , BS ³ , (Pierce Chemical Company, Rockford, IL, USA) or other known homobifunctional cross-linking agents with functional groups reacting with amino groups or carboxyl groups of the central particle and, accordingly, VLP.

In a further embodiment, the RANKL protein, RANKL fragment or RANKL peptide is bound to the central particle and, accordingly, to VLP by modifying the carbohydrate residues present on the glycosylated RANKL protein, RANKL fragment or RANKL peptide, and subsequent interaction with the central particle and, accordingly, with VLP . In one embodiment, the glycosylated RANKL protein, RANKL fragment, or RANKL peptide and sodium periodate are reacted with a mild oxidation reaction of the carbohydrate residue to produce an activated RANKL protein, RANKL fragment, or RANKL peptide with one or more aldehyde functional groups. The RANKL protein activated in this way, the RANKL fragment or the RANKL peptide is separated from the excess sodium periodate and then reacted with the central particle and, accordingly, VLP, in which lysine residues of the central particle and, accordingly, VLP or at least one VLP subunit interact with a previously formed aldehyde functional group on a RANKL protein, RANKL fragment or RANKL peptide, for example, as described by Hermanson, GT at Bioconjugate Techniques, Academic Press Inc., San Diego, CA, USA. The self-polymerization of the activated RANKL protein, RANKL fragment or RANKL peptide can be controlled by adjusting the pH as described in the above publication. The Schiff base formed is preferably further reduced with sodium cyanoborohydride, which is then removed by gel filtration or dialysis. Alternatively, the central particle and, accordingly, VLP and EDC can interact with the carboxyl groups of the central particle and, accordingly, VLP or at least one VLP subunit and a dihydrazide, such as adipic acid dihydrazide, to obtain a hydrazide residue available for reaction with one or more aldehyde functional groups present on the activated RANKL protein, RANKL fragment or RANKL peptide. The hydrazone thus formed can then be reduced with sodium cyanoborohydride. Alternatively, the activated RANKL protein, RANKL fragment or RANKL peptide with one or more aldehyde functional groups is reacted with cysteamine, resulting in the introduction of a cysteine group into the RANKL protein, RANKL fragment or RANKL peptide. Additional cross-linking methods and cross-linking agents suitable for binding the RANKL protein, RANKL fragment or RANKL peptide to the central particle and, accordingly, to the VLP, as well as guidance on the implementation of binding reactions and the use of chemical cross-linking agents and chemical cross-linking methods can be found in Hermanson, GT in Bioconjugate Techniques, Academic Press Inc., San Diego, CA, USA.

Other methods of binding VLP to a RANKL protein, RANKL fragment or RANKL peptide include methods in which the central particle and, accordingly, VLP are biotinylated and the RANKL protein, RANKL fragment or RANKL peptide are expressed as a protein fused to streptavidin, or methods in which biotinylate as a RANKL protein, a RANKL fragment or a RANKL peptide, and a central particle and, accordingly, VLP, for example, as described in WO 00/23955. In this case, the RANKL protein, RANKL fragment, or RANKL peptide can first be coupled to streptavidin or avidin by adjusting the ratio of the RANKL protein, RANKL fragment, or RANKL peptide to streptavidin so that free binding sites are still available for binding of the central particle and, accordingly, VLP, which add in the next step. Alternatively, all components may be mixed in a “single vessel” reaction. Other ligand-receptor pairs where there is a soluble form of the receptor and ligand and which are capable of cross-linking with the central particle and, accordingly, with VLP or RANKL protein, RANKL fragment or RANKL peptide, can be used as binding agents for binding of RANKL protein, fragment RANKL or RANKL peptide with a central particle and, accordingly, with VLP. Alternatively, either the ligand or receptor can be fused to a RANKL protein, RANKL fragment, or RANKL peptide and thus mediate binding to a central particle and, accordingly, to a VLP chemically coupled to either a receptor or a ligand, respectively. Merging can also be accomplished by insertion or replacement.

As already mentioned, in a preferred embodiment of the present invention, the VLP is the VLP of the RNA phage, and in a more preferred embodiment, the VLP is the VLP of the Qβ RNA phage coat protein.

One or more antigen molecules, i.e. the RANKL protein, RANKL fragment, or RANKL peptide can be linked to a single subunit of the capsid or VLP of the RNA phage coat proteins, preferably via the exposed lysine residues of the VLP RNA phages, if sterically permissible. Thus, a special feature of the VLP coat proteins of RNA phages and, in particular, the VLP coat protein Qβ is the ability to bind several antigens to the subunit. This allows the formation of a dense antigenic matrix.

In a preferred embodiment of the invention, the binding and, accordingly, the attachment of at least a RANKL protein, a RANKL fragment or a RANKL peptide with a central particle and, accordingly, a virus-like particle is carried out through interaction and, accordingly, association between at least one first virus-like particle binding site and at least one second antigen or antigenic determinant binding site.

VLP or capsids from the Qβ coating protein expose a certain amount of lysine residues on its surface with a specific topology, with three lysine residues directed inside the capsid and interact with RNA, and four other lysine residues exposed on the outside of the capsid. These specific properties are preferred for binding of antigens to the outside of the particle, rather than from the inside of the particle, where lysine residues interact with RNA. VLPs from other covering RNA phage proteins also have a certain amount of lysine residues on their surface and a specific topology of these lysine residues.

In further preferred embodiments of the invention, the first binding site is a lysine residue and / or the second binding site contains a sulfhydryl group or a cysteine residue. In a very preferred embodiment of the present invention, the first binding site is a lysine residue, and the second binding site is a cysteine residue.

In very preferred embodiments, the RANKL protein, RANKL fragment, or RANKL peptide is linked via a cysteine residue, either naturally occurring on the RANKL protein, RANKL fragment, or RANKL peptide, or constructed with lysine residues of the VLP coat RNA phage protein and, in particular, the VLP coat Qβ protein.

Another advantage of VLPs derived from RNA phages is the high yield of their expression in bacteria, which allows large quantities of material to be obtained at an affordable cost.

As indicated, the conjugates and matrices, respectively, according to the invention differ from the prior art conjugates in their highly organized structure, size and repeatability of the antigen on the matrix surface. In addition, the use of VLP as carriers allows the formation of strong antigenic matrices and conjugates, respectively, with a variable density of antigens. In particular, the use of VLP of RNA phages, and thus, in particular, the use of VLP of the Qβ RNA phage coat protein, allows for a very high epitope density. Obtaining compositions of VLP coating proteins of RNA phages with a high density of epitopes can be carried out using the instructions provided in this application.

Either a natural or non-natural second binding site, as defined herein, may be present on an antigen or antigenic determinant. In the absence of a suitable second binding site of natural origin on the antigen or antigenic determinant, it is necessary to construct a non-natural second binding site on the antigen.

As described above, four lysine residues are exposed on the surface of the VLP of the Qβ coat protein. Typically, such residues are derivatized during a reaction with a cross-linking molecule. In the case where not all exposed lysine residues can be associated with an antigen, lysine residues that have reacted with a cross-linking agent remain with the cross-linking molecule bound to the ε-amino group after the derivatization step. This results in the disappearance of one or more positive charges, which may be undesirable for the solubility and stability of the VLP. By replacing some lysine residues with arginines, as in the claimed mutants of the Qβ coating protein described below, the authors prevented the positive charges from disappearing excessively, since the arginine residues do not interact with the cross-linking agent. In addition, replacing lysine residues with arginines can lead to a more specific antigenic matrix, since fewer sites are available for reaction with the antigen.

Thus, the exposed lysine residues were replaced with arginines in the following Qβ coating protein mutants and Qβ mutant VLPs described in this application: Qβ-240 (Lys13-Arg; SEQ ID NO: 23), Qβ-250 (Lys 2-Arg, Lys13- Arg; SEQ ID NO: 25) and Qβ-259 (Lys 2-Arg, Lys16-Arg; SEQ ID NO: 27). The constructs were cloned, proteins were expressed, VLP was purified and used to bind to peptide and protein antigens. Qβ-251 was also designed (SEQ ID NO: 26), and guidance on how to express, purify and bind the VLP of the Qβ-251 coat protein can be found throughout this application.

In a further embodiment, the authors proposed a mutant coating protein Qβ with one additional lysine residue, suitable for obtaining an antigen matrix with an even higher density. This mutant Qβ coating protein, Qβ-243 (Asn 10-Lys; SEQ ID NO: 24) was cloned, the protein was expressed, and the capsid or VLP was isolated and purified, showing that the addition of an additional lysine residue was compatible with self-assembly of the subunits in capsid or VLP. Thus, matrices and, accordingly, conjugates of the RANKL protein, RANKL fragment, or RANKL peptide can be obtained using VLP mutants of the Qβ coat protein. A particularly preferred method for binding antigens to VLPs, and in particular to VLPs of RNA phage coat proteins, is to bind a lysine residue present on the surface of the VLPs of RNA phage coat proteins with a cysteine residue naturally present or engineered on an antigen, i.e. RANKL protein, RANKL fragment, or RANKL peptide. In order for the cysteine residue to be effective as a second binding site, the sulfhydryl group must be available for binding. Thus, the cysteine residue must be in its reduced state, that is, free cysteine or a cysteine residue with a free sulfhydryl group must be available. In the case where the cysteine residue for functioning as the second binding site is in an oxidized form, for example, if it forms a disulfide bridge, the indicated disulfide bridge must be restored, for example, using DTT, TCEP or β-mercaptoethanol. The concentration of the reducing agent and the molar excess of the reducing agent compared to the antigen should be specified for each antigen. If necessary, the titration limits are tested, starting from such low concentrations of a reducing agent as 10 μM or lower to 10-20 mm or higher, and the binding of antigen to the carrier is evaluated. Although low concentrations of the reducing agent are compatible with the binding reaction, as described in pending application for US patent No. 10/050902 filed by this assignee on January 18, 2002, higher concentrations inhibit the binding reaction, as will be understood by a person skilled in the art, and in this case, the reducing agent must be removed by dialysis or gel filtration. Advantageously, the pH of the dialysis or equilibration buffer is below 7, preferably 6. The compatibility of the low pH buffer with antigen activity and stability should be checked.

The density of the epitope on the VLP of the coating proteins of the RNA phage can be modulated by choosing a cross-linking agent and other reaction conditions. For example, cross-linking agents sulfo-GMBS and SMPH usually provide high epitope densities. Derivatization is positively affected by a high concentration of reactants, and manipulation of the reaction conditions can be used to control the amount of antigens associated with the VLP of the RNA phage coat proteins and, in particular, with the Vβ coat protein Qβ.

Before constructing a non-natural second binding site, it is necessary to choose the position in which it should be merged, integrated, or, in general, constructed. The selection of the position of the second binding site as an example may be based on the crystal structure of the antigen. Such a crystal structure of the antigen can provide information on the availability of the C- or N-ends of the molecule (determined, for example, based on their availability to the solvent) or on exposure to the solvent of residues suitable for use as second binding sites, such as cysteine residues . Exposed disulfide bridges, as in the case of Fab fragments, can also be a source of a second binding site, since they can usually be converted into individual cysteine residues through moderate recovery. Moderate recovery conditions will be selected that do not affect the immunogenicity of the RANKL protein, RANKL fragment, or RANKL peptide. In general, when the goal of immunization with an autoantigen is to inhibit the interaction of a given autoantigen with its natural ligands, a second binding site will be added so that it allows the formation of antibodies against the interaction site with natural ligands. Thus, the position of the second binding site will be chosen so as to avoid steric interference from the second binding site or any amino acid linker containing it. In the following embodiments, a humoral response is required directed to a site other than the site of interaction of the autoantigen with its natural ligand. In such embodiments, the second binding site can be chosen so that it prevents the formation of antibodies against the site of interaction of the autoantigen with its natural ligands.

Other criteria for choosing the position of the second binding site include the antigen oligomerization state, the oligomerization site, the presence of a cofactor, and the presence of experimental evidence for the detection of sites in the antigen structure and the sequence in which the modification of the antigen is compatible with the function of autoantigen or with the formation of antibodies that recognize autoantigen.

In most preferred embodiments, the RANKL protein, RANKL fragment or RANKL peptide contains a single second binding site or a single reactive binding site capable of association with the first binding sites on the central particle and VLP or VLP subunits, respectively. This provides a certain and uniform binding and, accordingly, the association of at least one, but usually several, preferably more than 10, 20, 40, 80, 120, antigens with the central particle and VLP, respectively. Thus, providing one second binding site or one reactive antigen binding site provides one type of uniform binding and association, respectively, resulting in a very highly ordered and repeating matrix. For example, if the binding and association, respectively, is carried out through the interaction of lysine (as the first binding site) and cysteine (as the second binding site), then according to this preferred embodiment of the invention, it is guaranteed that only one cysteine residue per antigen, regardless of whether a given cysteine residue of natural or non-natural origin is present on the antigen, is able to bind and associate, respectively, with VLP and the first binding site of the central particle, respectively Twain.

In some embodiments, the construction of a second binding site on an antigen requires the fusion of an amino acid linker containing an amino acid suitable as a second binding site according to the descriptions of this invention. Thus, in a preferred embodiment of the invention, the amino acid linker is coupled to an antigen or antigenic determinant via at least one covalent bond. Preferably, the amino acid linker contains or, alternatively, consists of a second binding site. In a further preferred embodiment, the amino acid linker contains a sulfhydryl group or a cysteine residue. In another preferred embodiment, the amino acid linker is cysteine. Some criteria for the selection of the amino acid linker, as well as additional preferred variants of the amino acid linker according to the invention are already indicated above.

In a further preferred embodiment of the invention, at least one antigen or antigenic determinant, i.e. RANKL protein, RANKL fragment or RANKL peptide, fused to the central particle and virus-like particle, respectively. As indicated above, a VLP typically consists of at least one subunit assembled in a VLP. Thus, again in a further preferred embodiment of the invention, the antigen or antigenic determinant, preferably at least one RANKL protein, RANKL fragment or RANKL peptide, is fused to at least one subunit of the virus-like particle or protein that can be incorporated into the VLP to form a chimeric fusion RANKL VLP subunit protein, RANKL fragment or RANKL peptide.

The fusion of the RANKL protein, RANKL fragment or RANKL peptide can be accomplished by insertion into the sequence of the VLP subunit or by fusion with either the N- or C-terminus of the VLP subunit or protein that can be incorporated into the VLP. Hereinafter, when referring to fusion proteins of a peptide with a VLP subunit, it is meant to merge either at the ends of the subunit sequence or internal insertion of the peptide into the subunit sequence.

Merging can also be accomplished by inserting the sequences of the RANKL protein, RANKL fragment, or RANKL peptide into a variant of the VLP subunit, where part of the subunit sequence has been deleted, the resulting products are hereinafter referred to as truncated mutants. The truncated mutants may have N- or C-terminal or internal deletions of part of the VLP subunit sequence. For example, a particular HBcAg VLP, for example, with a deletion of amino acid residues 79 to 81, is a truncated mutant with an internal deletion. The fusion of the RANKL protein, RANKL fragment, or RANKL peptide with either the N- or C-terminus of the truncated VLP subunit mutants also leads to the formation of variants according to this invention. Similarly, fusion of an epitope with a VLP subunit sequence can also be accomplished by substitution, in which, for example, for a particular HBcAg VLP, amino acids 79-81 are replaced with a foreign epitope. Thus, the fusion, which is mentioned later, can be performed by inserting the sequence of the RANKL protein, RANKL fragment or RANKL peptide into the sequence of the VLP subunit by replacing part of the sequence of the VLP subunit with the sequence of the RANKL protein, RANKL fragment or RANKL peptide, or by combining a deletion, replacement or insertion .

Chimeric constructs of a RANKL protein, RANKL fragment, or VLP RANKL subunit peptide will typically be capable of self-assembly in VLP. VLPs exhibiting epitopes fused to their subunits are also referred to herein as chimeric VLPs. As indicated, a virus-like particle contains or, alternatively, consists of at least one VLP subunit. In a further embodiment of the invention, the virus-like particle contains or, alternatively, consists of a mixture of chimeric VLP subunits and non-chimeric VLP subunits, i.e. VLP subunits lacking antigen fused with them, resulting in the so-called mosaic particles. This may have advantages for providing education and assembly in VLP. In these embodiments, the proportion of chimeric VLP subunits can be 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95% or more.

Flanking amino acid residues can be added to either end of the sequence of the peptide or epitope that needs to be fused to either end of the VLP subunit sequence, or for internal insertion of such a peptide sequence into the VLP subunit sequence. Glycine and serine residues are particularly preferred amino acids for use in flanking sequences added to the RANKL protein, RANKL fragment, or RANKL peptide to be fused. Glycine residues give additional flexibility, which can reduce the possible destabilizing effect of the fusion of a foreign sequence into the sequence of the VLP subunit.

In a specific embodiment, the VLP is the VLP of hepatitis B core antigen. Fusion proteins are described either with the N-terminus of HBcAg (Neyrinck, S. et al., Nature Med. 5: 1157-1163 (1999)), or insertion into the so-called basic immunodominant region (MIR) (Pumpens, P. and Grens, E., Intervirology 44: 98-114 (2001)), WO 01/98333), and these mergers are preferred variants of the invention. Also described are variants of naturally occurring HBcAgs with deletions in MIR (Pumpens, P. and Grens, E., Intervirology 44: 98-114 (2001), the publication is specifically incorporated by reference in full), and mergers with N- or C- end, as well as insertion at the MIR position corresponding to the deletion site compared to wild-type HBcAg, are further embodiments of the invention. C-terminal fusions are also described (Pumpens, P. and Grens, E., Intervirology 44: 98-114 (2001)). One skilled in the art will easily find guidance on how to construct fusion proteins using classical molecular biology techniques (Sambrook, J. et al., Eds., Molecular Cloning, A Laboratory Manual, 2nd. Edition, Cold Spring Habor Laboratory Press, Cold Spring Harbor, NY (1989), Ho et al., Gene 77:51 (1989)). Vectors and plasmids encoding HBcAg and HBcAg fusion proteins and useful for the expression of HBcAg and HBcAg fusion proteins are described (Pumpens, P. and Grens, E. Intervirology 44: 98-114 (2001), Neyrinck, S. et al., Nature Med 5: 1157-1163 (1999)), which can be used in the practice of the invention. The authors also described, by way of example (Example 6), the insertion of an epitope into HBcAg MIR, resulting in a chimeric self-assembly of HBcAg. An important factor for optimizing the efficiency of self-assembly and exposure of the epitope embedded in HBcAg MIR is the choice of insertion site, as well as the number of amino acids that must be deleted from the HBcAg sequence in MIR (Pumpens, P. and Grens, E., Intervirology 44: 98-114 (2001); EP 421635; US patent 6231864) at insertion, in other words, which amino acids from HBcAg need to be replaced with a new epitope. For example, the replacement of HBcAg amino acids 76-80, 79-81, 79-80, 75-85 or 80-81 with foreign epitopes is described (Pumpens, P. and Grens, E., Intervirology 44: 98-114 (2001); EP 0421635 ; US patent 6231864). HBcAg contains a long arginine tail (Pumpens, P. and Grens, E., Intervirology 44: 98-114 (2001)), which is not essential for capsid assembly and is capable of binding nucleic acids (Pumpens, P. and Grens, E ., Intervirology 44: 98-114 (2001)). HBcAg, either containing arginine tail or not having one, are variants of the invention.

In a further preferred embodiment of the invention, the VLP is the VLP of an RNA phage. The main covering proteins of RNA phages spontaneously assemble in VLP when expressed in bacteria and, in particular, in E. coli. Specific examples of bacteriophage coat proteins that can be used to prepare compositions of the invention include bacteriophage RNA coat proteins such as the Qβ bacteriophage (SEQ ID NO: 10; PIR Database, Inventory No. VCBPQβ Related to CP Qβ, and SEQ ID NO: 11; Inventory No. AAA16663 relating to A1 Qβ protein) and bacteriophage fr (SEQ ID NO: 4; PIR, Inventory No. VCBPFR).

In a more preferred embodiment, at least one RANKL protein, RANKL fragment, or RANKL peptide is fused to the Qβ coat protein. Fusion protein constructs are described in which epitopes are fused to the C-terminus of the shortened form of A1 Qβ protein or inserted into A1 protein (Kozlovska, T.M., et al., Intervirology, 39: 9-15 (1996)). Protein A1 is formed by suppression in the UGA stop codon and has a length of 329 a / k or 328 a / k, if we take into account the cleavage of the N-terminal methionine. Cleavage of the N-terminal methionine in front of alanine (the second amino acid encoded by the CP Qβ gene) usually occurs in E. coli, and this is the case for the N-terminus of the covering protein Q Qβ. The portion of the A1 gene on the 3 ′ side of the UGA amber codon encodes a CP extension that is 195 amino acids in length. The insertion of at least one RANKL protein, RANKL fragment or RANKL peptide between positions 72 and 73 of the CP extension leads to the formation of the following variants according to the invention (Kozlovska, T.M., et al., Intervirology 39: 9-15 (1996)). The fusion of the RANKL protein, RANKL fragment or RANKL peptide with the C-terminus of the Qβ protein shortened at the C-terminus leads to the formation of the following preferred variants according to the invention. For example, Kozlovska et al., (Intervirology, 39: 9-15 (1996)) described fusions of A1 Qβ protein in which the epitope is fused to the C-terminus of CP Qβ extension shortened at position 19.

As described by Kozlovska et al. (Intervirology, 39: 9-15 (1996)), the assembly of particles exhibiting fused epitopes typically requires the presence of both a fusion of the RANKL A1 protein, RANKL fragment or RANKL peptide, and wild-type CP to form a mosaic particle. However, variants containing virus-like particles, and thus, in particular, the VLP of the Qβ RNA phage coat protein, which consist exclusively of VLP subunits having at least one RANKL protein, RANKL fragment or RANKL peptide, are also included Scope of the Invention

Obtaining mosaic particles can be carried out in a number of ways. Kozlovska et al., Intervirolog., 39: 9-15 (1996) describe two methods that can both be used in the practice of the invention. In the first method, efficient exposure of the fused epitope to VLP is mediated by expression of a plasmid encoding the fusion of A1 Qβ protein having a UGA stop codon between CP and CP extension in an E. coli strain carrying a plasmid encoding a cloned UGA suppressor tRNA that translates UGA codon in Trp (plasmid pISM3001 (Smiley BK, et al., Gene 134: 33-40 (1993))). In another method, the stop codon of the CP gene is modified in UAA and cotransfected with a second plasmid expressing the fusion of Protein A1 with RANKL protein, RANKL fragment or RANKL peptide. The second plasmid encodes resistance to various antibiotics, and the onset of replication is compatible with the first plasmid (Kozlovska, T.M., et al., Intervirology 39: 9-15 (1996)). In a third method, CP and fusion of Protein A1 with a RANKL protein, RANKL fragment or RANKL peptide are encoded in a bicistronic manner when operatively linked to a promoter such as a Trp promoter, as described in FIG. 1 in Kozlovska et al., Intervirology, 39: 9-15 (1996).

In a further embodiment, the RANKL protein, RANKL fragment or RANKL peptide is inserted between amino acids 2 and 3 (CP numbering after cleavage, that is, when the N-terminal methionine is cleaved) CP fr, thereby obtaining a protein fusion RANKL protein, RANKL fragment or peptide RANKL-CP fr. Vectors and expression systems for the construction and expression of CP fr fusion proteins self-assembled in VLP and applicable in the practice of the invention are described (Pushko P. et al., Prot. Eng. 6: 883-891 (1993)). In a specific embodiment, the sequence of the RANKL protein, RANKL fragment, or RANKL peptide is inserted into the deletion variant CP fr after amino acid 2 when residues 3 and 4 of CP fr are removed (Pushko P. et al., Prot. Eng. 6: 883-891 (1993) )

The fusion of epitopes with the N-terminal protruding β-hairpin of the coating protein of RNA phage MS-2 and the subsequent presentation of the fusion epitope on the self-assembled VLP RNA phage MS-2 are also described (WO 92/13081), and the fusion of the RANKL protein, RANKL fragment or the RANKL peptide by insertion or substitution in the coating protein of the MS-2 RNA phage also falls within the scope of the invention.

In another embodiment of the invention, the RANKL protein, RANKL fragment, or RANKL peptide is fused to the papilloma virus capsid protein. In a more specific embodiment, the RANKL protein, RANKL fragment, or RANKL peptide is fused to the major cattle papilloma virus L1 capsid protein (BPV-1). Vectors and expression systems have been described for the construction and expression of BPV-1 fusion proteins in baculovirus / insect cell systems (Chackerian, B. et al., Proc. Natl. Acad. Sci. USA 96: 2373-2378 (1999), WO 00 / 23955). Substitution of amino acids 130-136 L1 BPV-1 with RANKL protein, RANKL fragment or RANKL peptide results in a fusion protein L1 BPV-1 RANKL protein, RANKL fragment or RANKL peptide, which is a preferred embodiment of the invention. Cloning in a baculovirus vector and expression in baculovirus-infected Sf9 cells that can be used in the practice of the invention are described (Chackerian, B. et al., Proc. Natl. Acad. Sci. USA 96: 2373-2378 (1999), WO 00 / 23955). Purification of collected particles exposing the RANKL fusion protein, RANKL fragment or RANKL peptide can be accomplished in a number of ways, such as gel filtration or sucrose gradient ultracentrifugation (Chackerian, B. et al., Proc. Natl. Acad. Sci. USA 96: 2373-2378 (1999), WO 00/23955).

In a further embodiment, the RANKL protein, RANKL fragment, or RANKL peptide is fused to a Ty protein capable of being incorporated into Ty VLP. In a more specific embodiment, the RANKL protein, RANKL fragment, or RANKL peptide is fused to p1 or the capsid protein encoded by the TYA gene (Roth, J.F., Yeast 16: 785-795 (2000)). The yeast retrotransposons Ty1, 2, 3, and 4 are isolated from Saccharomyces cerevisiae, while the retrotransposon Tf1 is isolated from Schizosaccharomyces pombae (Boeke, JD and Sandmeyer, SB, “Yeast Transposable elements,” in The molecular and Cellular Biology of the Yeast Saccharomy , Protein Synthesis, and Energetics., P. 193, Cold Spring Harbor Laboratory Press (1991)). Retrotransposons Ty1 and 2 are related to the copia class of plant and animal elements, while Ty3 belongs to the gypsy family of retrotransposons that are related to plant and animal retroviruses. In the Ty1 retrotransposon, the p1 protein, also called Gag or capsid protein, has a length of 440 amino acids. P1 is cleaved during VLP maturation at position 408, giving p2 protein, an important component of VLP.

Protein fusion proteins and vectors for expressing said fusion proteins in yeast are described (Adams, S.E., et al., Nature 329: 68-70 (1987)). Thus, for example, a RANKL protein, a RANKL fragment or a RANKL peptide can be fused to p1 by inserting a sequence encoding a RANKL protein, a RANKL fragment or a RANKL peptide at the BamH1 site of pMA5620 plasmid (Adams, SE, et al., Nature 329: 68 -70 (1987)). Cloning of sequences encoding foreign epitopes in the pMA5620 vector results in the expression of fusion proteins containing amino acids 1-381 p1 Ty1-15 fused C-terminally with the N-terminus of the foreign epitope. Similarly, it is understood that the N-terminal fusion of a RANKL protein, RANKL fragment or RANKL peptide or internal insertion into the p1 sequence or replacement of part of the p1 sequence is also within the scope of the invention. In particular, the insertion of a RANKL protein, a RANKL fragment, or a RANKL peptide into the Ty sequence between amino acids 30-31, 67-68, 113-114 and 132-133 of the Ty p1 protein (EP0677111) gives preferred variants according to the invention.

Further VLPs suitable for fusion of a RANKL protein, RANKL fragment or RANKL peptide are, for example, particles like retroviruses (WO9630523), HIV Gag (Kang, YC, et al, Biol. Chem. 380: 353-364 (1999)) Vigna mosaic virus (Taylor, KM et al., Biol. Chem. 380: 387-392 (1999)), Parvovirus VLP VP2 (Rueda, P. et al., Virology 263: 89-99 (1999)), HBsAg (US patent 4722840, EP0020416B1).

Examples of chimeric VLPs suitable for practicing the invention are also the VLPs described in Intervirology 39: 1 (1996). The following examples of VLP proposed for use in the invention are: HPV-1, HPV-6, HPV-11, HPV-16, HPV-18, HPV-33, HPV-45, CRPV, COPV, HIV GAG, tobacco mosaic virus . Virus-like particles of SV-40, polyoma virus, adenovirus, herpes simplex virus, rotavirus and Norwalk virus were also obtained, and chimeric VLPs based on these VLPs are also included in the scope of this invention.

In a further preferred embodiment of the invention, the antigen or antigenic determinant is a RANKL protein, a RANKL fragment or a RANKL peptide.

In a very highly preferred embodiment of the invention, the antigen or antigenic determinant is a RANKL protein, a RANKL fragment or a human RANKL peptide.

In a further very preferred embodiment of the invention, the antigen or antigenic determinant comprises, alternatively, essentially consists of or, alternatively, consists of an amino acid sequence selected from the group consisting of a) amino acid sequence of SEQ ID NO: 79; b) the amino acid sequence of any fragment of SEQ ID NO: 79.

In a further preferred embodiment of the invention, the antigen or antigenic determinant is a variant of the RANKL protein, RANKL fragment or RANKL peptide, for example, in particular, containing amino acid substitutions or insertions of peptides or polymorphisms. As already indicated, compositions and, accordingly, vaccine compositions containing variants of the RANKL protein, RANKL fragment, or RANKL peptide are included in the scope of this invention.

In a further preferred embodiment of the invention, the antigen or antigenic determinant is a RANKL fragment. Preferably, the antigen or antigenic determinant is a human RANKL fragment selected from the group consisting of a) extracellular region of human RANKL, b) isoform 1 of splicing human RANKL, c) isoform 2 of splicing, which results in secreted human RANKL, d) proteolytically obtained soluble portion Human RANKL and e) areas of homology with TNF-α.

In a further very preferred embodiment of the invention, the antigen or antigenic determinant comprises, alternatively, essentially consists of or, alternatively, consists of an amino acid sequence selected from the group consisting of a) amino acid sequence of SEQ ID NO: 79; b) the amino acid sequence of SEQ ID NO: 80; c) the amino acid sequence of SEQ ID NO: 81; d) the amino acid sequence of SEQ ID NO: 82; e) the amino acid sequence of SEQ ID NO: 83; f) the amino acid sequence of SEQ ID NO: 84; g) the amino acid sequence of SEQ ID NO: 100; h) the amino acid sequence of SEQ ID NO: 101; i) the amino acid sequence of any fragment of any of SEQ ID NO: 79-84, 100, 101.

RANKL protein or RANKL fragments can be obtained by expressing RANKL cDNA in prokaryotic or eukaryotic expression systems. Various examples thereof are described in the literature and may be used, possibly after modifications, to express any RANKL protein, RANKL fragment or RANKL peptide of any desired type. The RANKL protein and RANKL fragments were expressed in mammalian cells (Anderson, DM, et al., Nature 390: 175-179 (1997), Lacey, DL, et al., Cell 93: 165-176 (1998), Wong BR, et al., J. Biol. Chem. 272: 25190-25194 (1997), Lum, L., et al., J. Biol. Chem. 274: 13613-13618 (2000)), in insect cells (Willard, D., et al., Prot. Express. Purif. 20: 48-57 (2000)) and in prokaryotic cells (Xu, J., et al., J. Bone Mineral Res. 15: 2178-86 (2000) Yasuda et al., Proc. Natl. Acad. Sci USA 95: 3597-3602 (1998)). Descriptions of how to obtain RANKL proteins and fragments are also given in WO 9846751, US Pat. No. 5,843,678, WO 98259958, US Pat. No. 6,242,586, WO 9828426, US Pat.

In a further preferred embodiment, the antigen or antigenic determinant is the RANKL peptide. Such RANKL peptides or fragments thereof can be obtained using standard molecular biology methods in which the nucleotide sequence encoding the fragment of interest is amplified by PCR and cloned into a fusion with a polypeptide tag, such as a histidine tag, Flag tag, myc tag or a constant region of an antibody (Fc region). By introducing a protease cleavage site between the RANKL fragment and the label, the RANKL fragment can be separated from the label after purification by digesting with the appropriate protease. In another method, a RANKL fragment can be synthesized in vitro using standard peptide synthesis reactions known to one skilled in the art. In the following method, RANKL peptides or RANKL fragments can be obtained by protease cleavage or chemical cleavage of a full-sized RANKL protein or RANKL fragments, both methods are well known to those skilled in the art.

In a further preferred embodiment of the invention, the antigen or antigenic determinant further comprises at least one second binding site selected from the group consisting of (i) a binding site of non-natural origin with said antigen or antigenic determinant; and (ii) a binding site of natural origin with the specified antigen or antigenic determinant. Guidance on how to modify a RANKL protein, RANKL fragment, or RANKL peptide to bind to a virus-like particle is given throughout this application. Preferred second binding sites contain a cysteine residue for binding to a derivatized VLP, and examples are given in the description above and in examples 12 and 13.

The authors constructed a model of the 3-dimensional structure of the human RANKL region, which is homologous to TNF-α. The authors found that naturally occurring cysteine may not be available in the stacked structure to interact with the first VLP binding site of the present invention. The authors' model is confirmed by the X-ray structure of the mouse RANKL, which was recently obtained (Lam, J., et al., J. Clin. Invest., 108: 971-979 (2002)). The N-terminus is preferred for attaching a second binding site containing an amino acid linker with an additional cysteine residue, as shown in Example 12. However, an amino acid linker containing a cysteine residue as a second binding site and fused to the C-terminus of the RANKL construct results in the following the preferred embodiment according to the invention, which is shown in Example 13. The human RANKL construct with an N-terminal amino acid linker containing a cysteine residue fused to the extracellular region of RANKL is They are very preferred embodiment of the invention.

Described constructions of mouse RANKL fragments (SEQ ID NO: 96 and SEQ ID NO: 99), and preferred constructs of human RANKL fragments can also be created and have, for example, the sequence of SEQ ID NO: 100-104. The following preferred constructs comprise a complete human RANKL protein, a human RANKL fragment selected from the group consisting of a) the extracellular region of RANKL (SEQ ID NO: 82), b) RANKL splicing isoform 1 (SEQ ID NO: 80), c) isoform 2 splicing, the result of which is secreted by RANKL (SEQ ID NO: 81), d) a proteolytically obtained soluble RANKL region (SEQ ID NO: 83) and e) a region of homology with TNF-α (SEQ ID NO: 84) or human RANKL peptide sequences . Immunization against a RANKL protein, RANKL fragment or RANKL peptide using compositions according to the invention, preferably containing a RANKL protein, RANKL fragment or human RANKL peptide associated with VLP, can provide a method for treating or preventing bone diseases.

In a further preferred embodiment of the invention, the RANKL protein, RANKL fragment or RANKL peptide contains at least one antigenic site of the RANKL protein. One skilled in the art knows how to identify the corresponding peptides and amino acid sequences, respectively.

In a further preferred embodiment of the invention, the antigen or antigenic determinant is the RANKL peptide, which is key for interacting with the RANK receptor. Modeling of the authors of the human RANKL structure and the published crystal structure of the mouse RANKL showed that the RANKL monomer consists of a β-sandwich consisting of two planar antiparallel β-layers. The first layer is formed by β-strands A ", A, H, C and F, while the second layer is formed by β-strands B ', B, G, D and E. The inner β-layer A" AHCF is involved in the association between subunits, then how the β-layer of B'BGDE contributes significantly to the outer surface. The β-strands are connected through an AA "loop, a CD loop, a DE loop, an EF loop. The homotrimer is assembled so that one edge of the β-sandwich in each RANKL monomer is laid against the inner hydrophobic surface of the β-layer AHCF of the neighboring monomer. It is assumed that the binding site RANK includes a pocket formed by adjacent homotrimer monomers. Based on homology between the mouse and human sequences, peptides that include the RANK binding site are selected. In a preferred embodiment, the peptides from the RANKL-RANK interaction site are selected from a group consisting of a) an AA "loop comprising amino acids 171-194 (SEQ ID NO: 87), b) a DE loop comprising amino acids 246-253 (SEQ ID NO: 88), c) β-strands D, comprising amino acids 235-245 (SEQ ID NO: 89), d) a loop of CD, including amino acids 223-234 (SEQ ID NO: 90), e) a loop of EF, including 262-272 (SEQ ID NO: 91), f) β-strands of the B'-loop of B'B, including amino acids 200-207 (SEQ ID NO: 92), g) of the GH loop, including amino acids 300-305 (SEQ ID NO : 93), h) any fragment of said peptides ag, i) any N- and / or C-terminal extensions of said peptides ag by at least one amino acid and up to 25 amino islot, j) any fusion of peptides a-i). The following RANKL peptides suitable for use in this invention can be determined experimentally by their inherent characteristic to induce a T-cell or humoral response. This is mainly accomplished by immunizing an experimental animal with individually selected peptides in an immunologically suitable composition and measuring T-cell and B-cell, i.e. a humoral response using methods known to one skilled in the art. In the case where the antigen is a protein, polypeptide or peptide, this region may be formed by a continuous amino acid sequence. Alternatively, an antibody epitope may be formed by a discontinuous amino acid sequence in which, after three-dimensional folding of a protein, polypeptide or peptide, the amino acids are arranged so that they spatially become closer to each other and form an epitope. Continuous peptide fragments of interest can be identified using the immunization experiments described above.

The following preferred RANKL peptides suitable for use in this invention can be identified using existing or future monoclonal or polyclonal antibodies; methods for accomplishing this are known to those skilled in the art.

The following RANKL peptides suitable for use in this invention can be identified by screening peptide libraries in phage display using antibodies specific for RANKL in a manner well known to one skilled in the art.

In a further preferred embodiment, the antigen or antigenic determinant is an isolated RANKL of any animal, as well as any RANKL antigenic fragments of any animal. Those skilled in the art know how to obtain fragments and peptides from said isolated protein or RANKL fragments.

It will be understood by those skilled in the art that it is easy to assume other suitable modifications and adaptations of the methods and applications described in this application, and they can be carried out without departing from the scope of the invention and any variant thereof. Now, after a detailed description of the present invention, the same will be more clearly understood when referring to the following examples, which are thus included for purposes of illustration only and are not intended to limit the invention.

EXAMPLE 1

Construction and expression of mutant Qβ coat proteins and purification of VLP or capsids from mutant Qβ coat proteins

Plasmid Construction and Cloning of Mutant Coating Proteins

Construction of pQβ-240:

Plasmid pQβ10 (Kozlovska, TM, et al., Gene 137: 133-137) was used as the starting plasmid for constructing pQβ-240. The Lys13 → Arg mutation was generated by reverse PCR. Reverse primers were designed in the reverse tail-to-tail directions:

and

The products of the first PCR were used as templates for the second PCR reaction in which the top primer was used

and lower primer

The second PCR product was digested with XbaI and Mph1103I and cloned in the pQβ10 expression vector, which was digested with the same restriction enzymes. PCR reactions were carried out using reagents from the PCR kit and according to the manufacturer's protocol (MIX Fermentas, Vilnius, Lithuania).

Sequencing using the direct tag labeling method confirmed the required mutations. E. coli cells carrying pQβ-240 supported efficient synthesis of 14 kDa protein migrating to SDS-PAGE together with a control Qβ coat protein isolated from Qβ phage particles.

The resulting amino acid sequence: (SEQ ID NO: 23)

Construction of pQβ-243:

Plasmid pQβ10 was used as the starting plasmid for the construction of pQβ-243. The Asn10 → Lys mutation was generated by reverse PCR. Reverse primers were designed in the reverse tail-to-tail directions:

and

The products of the first PCR were used as templates for the second PCR reaction in which the top primer was used

and lower primer

The second PCR product was digested with XbaI and Mph1103I and cloned in the pQβ10 expression vector, which was digested with the same restriction enzymes. PCR reactions were carried out using reagents from the PCR kit and according to the manufacturer's protocol (MBI Fermentas, Vilnius, Lithuania).

Sequencing using the direct tag labeling method confirmed the required mutations. E. coli cells bearing pQβ-243 supported efficient synthesis of 14 kDa protein migrating to SDS-PAGE together with a control coating protein Qβ isolated from particles of phage Qβ.

The resulting amino acid sequence: (SEQ ID NO: 24)

Construction of pQβ-250:

Plasmid pQβ-240 was used as the starting plasmid for the construction of pQβ-250. The Lys2 → Arg mutation was created by site-specific mutagenesis. Top primer

and lower primer

used for the synthesis of a mutant PCR fragment, which was introduced into the expression vector pQβ-185 at the unique restriction sites NcoI and HindIII. PCR reactions were carried out using reagents from the PCR kit and according to the manufacturer's protocol (MBI Fermentas, Vilnius, Lithuania).

Sequencing using the direct tag labeling method confirmed the required mutations. E. coli cells carrying pQβ-250 supported efficient synthesis of 14 kDa protein migrating to PAGE together with a control Qβ coat protein isolated from Qβ phage particles.

The resulting amino acid sequence: (SEQ ID NO: 25)

Construction of pQβ-251:

Plasmid pQβ10 was used as the starting plasmid for the construction of pQβ-251. The Lys16 → Arg mutation was generated by reverse PCR. Reverse primers were designed in the reverse tail-to-tail directions:

and

The products of the first PCR were used as templates for the second PCR reaction in which the top primer was used

and lower primer

The second PCR product was digested with XbaI and Mph1103I and cloned in the pQβ10 expression vector, which was digested with the same restriction enzymes. PCR reactions were carried out using reagents from the PCR kit and according to the manufacturer's protocol (MBI Fermentas, Vilnius, Lithuania).

Sequencing using the direct tag labeling method confirmed the required mutations. E. coli cells carrying pQβ-251 supported efficient synthesis of 14 kDa protein migrating to SDS-PAGE together with a control Qβ coat protein isolated from Qβ phage particles. The resulting amino acid sequence encoded by this construct is shown in SEQ ID NO: 26.

Construction of pQβ-259:

Plasmid pQβ-251 was used as the starting plasmid for the construction of pQβ-259. The Lys2 → Arg mutation was created by site-specific mutagenesis. Top primer

and lower primer

used for the synthesis of a mutant PCR fragment, which was introduced into the expression vector pQβ-185 at the unique restriction sites NcoI and HindIII. PCR reactions were carried out using reagents from the PCR kit and according to the manufacturer's protocol (MBI Fermentas, Vilnius, Lithuania).

Sequencing using the direct tag labeling method confirmed the required mutations. E. coli cells carrying pQβ-259 supported efficient synthesis of the 14 kDa protein migrating to SDS-PAGE together with a control Qβ coat protein isolated from Qβ phage particles.

The resulting amino acid sequence: (SEQ ID NO: 27)

General methods for the expression and purification of Qβ and Qβ mutants

Expression

E. coli JM109 was transformed with plasmids expressing the Qβ coat protein. In 5 ml of LB liquid medium containing 20 μg / ml ampicillin, clones transformed with plasmids expressing the Qβ coat protein were inoculated. The inoculated culture was incubated at 37 ° C for 16-24 hours without shaking. Then, the resulting inoculum was diluted 1: 100 in 100-300 ml of fresh LB medium containing 20 μg / ml ampicillin and incubated at 37 ° C overnight without shaking. The resulting second inoculum was diluted 1:50 in M9 medium containing 1% casamino acids and 0.2% glucose in flasks and incubated at 37 ° C overnight with shaking.

Cleaning

Solutions and buffers for the cleaning method:

1. Lysing buffer LB

50 mM Tris-HCl pH 8.0 with 5 mM EDTA; 0.1% Triton X100 and freshly prepared PMSF at a concentration of 5 micrograms per ml, without lysozyme and DNase.

2. SAS

A saturated solution of ammonium sulfate in water.

3. NET buffer

20 mM Tris-HCl, pH 7.8 with 5 mM EDTA and 150 mM NaCl.

4. PEG

40% (w / v) polyethylene glycol 6000 in NET.

Destruction and lysis

Frozen cells were resuspended in LB at the rate of 2 ml / g cells. The mixture was sonicated at 22 kHz five times for 15 seconds at intervals of 1 min to cool the solution on ice. The lysate was then centrifuged at 14,000 rpm for 1 hour using a Janecki K 60 rotor. All centrifugation steps described below were carried out using the same rotor, unless otherwise noted. The supernatant was stored at 4 ° C, while cell debris was washed twice in LB. After centrifugation, the supernatants and wash fractions were combined.

Fractionation

To the combined lysate described above, a saturated solution of ammonium sulfate was added dropwise with stirring. The SAS volume was adjusted to one fifth of the total volume to obtain 20% saturation. The solution was allowed to stand overnight and centrifuged the next day at 14,000 rpm for 20 minutes. The precipitate was washed with a small amount of 20% ammonium sulfate and centrifuged again. The resulting supernatants were combined and SAS was added dropwise to obtain 40% saturation. The solution was allowed to stand overnight and the next day was centrifuged at 14,000 rpm for 20 minutes. The resulting precipitate was dissolved in NET buffer.

Chromatography

The capsid or VLP protein redissolved in NET buffer was applied to a CL-4B Sepharose column. Three peaks were eluted during chromatography. The first peak mainly contained membranes and membrane fragments, and it was not collected. Capsids were in the second peak, while the third peak contained other E. coli proteins.

The peak fractions were combined and the NaCl concentration was adjusted to a final concentration of 0.65 M. A volume of PEG solution corresponding to half of the combined peak fraction was added dropwise with stirring. The solution was left to stand overnight without stirring. The capsid protein was precipitated by centrifugation at 14,000 rpm for 20 minutes. Then it was dissolved in a minimal volume of NET and again loaded onto a CL-4B Sepharose column. Peak fractions were combined and precipitated with ammonium sulfate at 60% saturation (w / v). After centrifugation and reconstitution in NET buffer, the capsid protein was loaded onto a CL-6B Sepharose column for rechromatography.

Dialysis and drying

Peak fractions obtained as described above were pooled and dialyzed against a large volume of sterile water and lyophilized for storage.

Expression and purification of Qβ-240

Cells (E. coli JM 109, transformed with pQβ-240 plasmid) were resuspended in LB, sonicated five times for 15 seconds (shirt containing ice water) and centrifuged at 13,000 rpm for one hour. The supernatant was stored at 4 ° C until further processing, while cell debris was washed 2 times with 9 ml of LB and, finally, 9 ml of 0.7 M urea in LB. All supernatants were combined and loaded onto a CL-4B Sepharose column. The combined peak fractions were precipitated with ammonium sulfate and centrifuged. Then the redissolved protein was again purified on a column with Sepharose 2B and, finally, on a column with Sepharose 6B. Finally, the capsid peak was dialyzed against a large volume of water and lyophilized as described above. The assembly of the coating protein into a capsid was confirmed by electron microscopy.

Expression and purification of Qβ-243

Cells (E. coli RR1) were resuspended in LB and processed as described in the general method. The protein was purified by two successive gel filtration steps on a CL-4B Sepharose column and finally on a CL-2B Sepharose column. Peak fractions were combined and lyophilized as described above. The assembly of the coating protein into a capsid was confirmed by electron microscopy.

Expression and purification of Qβ-250

Cells (E. coli JM 109 transformed with pOβ-250) were resuspended in LB and processed as described above. The protein was purified by gel filtration on a CL-4B Sepharose column and finally on a CL-2B Sepharose column and lyophilized as described above. The assembly of the coating protein into a capsid was confirmed by electron microscopy.

Expression and purification of Qβ-259

Cells (E. coli JM 109 transformed with pQβ-259) were resuspended in LB and sonicated. Cell debris was washed once with 10 ml LB and a second time with 10 ml 0.7 M urea in LB. The protein was purified by two gel chromatography-based chromatography steps on a CL-4B Sepharose column. The protein was dialyzed and lyophilized as described above. The assembly of the coating protein into a capsid was confirmed by electron microscopy.

EXAMPLE 2

Insertion of a peptide containing a lysine residue into the HBcAg c / e1 epitope (1-149)

Epitope c / e1 (residues 72 to 88) of HBcAg is located in the apical region on the surface of the hepatitis B virus capsid (HBcAg). Part of this region (proline 79 and alanine 80) was genetically replaced by the Gly-Gly-Lys-Gly-Gly peptide (HBcAg-Lys construct: (SEQ ID NO: 117)). The lysine residue introduced contains a reactive amino group in its side chain, which can be used for intermolecular chemical cross-linking of HBcAg particles with any antigen containing a free cysteine group.

HBcAg-Lys DNA encoding the amino acid sequence shown in SEQ ID NO: 78 was generated by PCR: two fragments encoding HBcAg fragments (amino acid residues 1 to 78 and 81 to 149) were amplified separately in PCR. The primers used for these PCRs also introduced a DNA sequence encoding a Gly-Gly-Lys-Gly-Gly peptide (SEQ ID NO: 117). The HBcAg fragment (1 to 78) was amplified with pEco63 using EcoRIHBcAg (s) and Lys-HBcAg (as) primers. The HBcAg fragment (81 to 149) was amplified with pEco63 using Lys-HBcAg (s) and HBcAg (1-149) Hind (as) primers. Primers Lys-HBcAg (as) and Lys-HBcAg (s) introduced complementary DNA sequences at the ends of two PCR products, allowing fusion of the two PCR products in a subsequent PCR assembly. The blocked fragments were amplified by PCR using EcoRIHBcAg (s) and HbcAg (1-149) Hind (as) primers.

For PCR, 100 pmol of each oligonucleotide and 50 ng of DNA templates in 50 ml of reaction mixtures containing 2 units of Pwo polymerase, 0.1 mM dNTP and 2 mM MgSO _{4 were used} . In both reactions, temperature cycles were carried out as follows: 94 ° C for 2 minutes; 30 cycles of 94 ° C (1 minute), 50 ° C (1 minute), 72 ° C (2 minutes).

Primer Sequences:

To fuse the two PCR fragments by PCR, 100 pmol of EcoRIHBcAg (s) and HBcAg (1-149) Hind (as) primers with 100 ng of two purified PCR fragments in 50 ml of the reaction mixture containing 2 units of Pwo polymerase, 0, 1 mM dNTP and 2 mM MgSO ₄ . The conditions of the PCR cycles were: 94 ° C for 2 minutes; 30 cycles of 94 ° C (1 minute), 50 ° C (1 minute), 72 ° C (2 minutes). The product obtained by PCR assembly was analyzed by agarose gel electrophoresis, purified and digested for 19 hours in an appropriate buffer with restriction enzymes EcoRI and HindIII. The cleavage DNA fragment was ligated into an EcoRI / HindIII-digested pKK vector to obtain the pKK-HBcAg-Lys expression vector. The insertion of the PCR product into the vector was analyzed by restriction analysis with EcoRI / HindIII enzymes and DNA sequencing of the insert.

EXAMPLE 3

Expression and purification of HBcAg-Lys

Strains of E. coli K802 or JM109 were transformed with the pKK-HBcAg-Lys vector. 1 ml of overnight bacterial culture was used to inoculate 100 ml of LB medium containing 100 μg / ml ampicillin. The specified culture was grown for 4 hours at 37 ° C until reaching an OD at 600 nm, approximately equal to 0.8. The synthesis of HBcAg-Lys was induced by the addition of IPTG to a final concentration of 1 mM. After induction, the bacteria were additionally shaken at 37 ° C for 4 hours. Bacteria were collected by centrifugation at 5000 xg for 15 minutes. The precipitate was frozen at -80 ° C. The pellet was thawed and resuspended in bacterial lysis buffer (10 mM Na ₂ HPO ₄ , pH 7.0; 30 mM NaCl; 0.25% tween-20; 10 mM EDTA) supplemented with 200 μg / ml lysozyme and 10 μg benzonase ( Merck). Cells were incubated for 30 minutes at room temperature and destroyed by sonication. E. coli cells bearing the pKK-HBcAg-Lys expression plasmid or control plasmid were used to induce the expression of HBcAg-Lys using IPTG. Before IPTG was added, a sample was taken from a culture of bacteria carrying the pKK-HBcAg-Lys plasmid and from a culture of bacteria carrying the control plasmid. Four hours after the addition of IPTG, samples were again taken from a culture containing pKK-HBcAg-Lys and from a control culture. Protein expression was monitored using SDS-PAGE followed by Coomassie staining.

The lysate was then centrifuged for 30 minutes at 12,000 x g to remove insoluble cell debris. The supernatant and sediment were analyzed by Western blotting using a monoclonal anti-HBcAg antibody (YVS1841, purchased from Accurate Chemical and Scientific Corp., Westbury, NY, USA), showing that a significant amount of the HBcAg-Lys protein is soluble. Briefly, lysates of E. coli cells expressing HBcAg-Lys and control cell lysates were centrifuged at 14,000 x g for 30 minutes. The supernatant (= soluble fraction) and the precipitate (= insoluble fraction) were separated and diluted in SDS sample buffer to equal volumes. Samples were analyzed in SDS-PAGE followed by Western blotting with monoclonal antibody YVS 1841.

The clarified cell lysates were used for centrifugation in a stepwise gradient using a stepwise sucrose gradient consisting of 4 ml of a 65% sucrose solution, onto which 3 ml of a 15% sucrose solution was layered, and then 4 ml of a bacterial lysate. The sample was centrifuged for 3 hours at 100,000 x g, at 4 ° C. After centrifugation, 1 ml fractions were collected from the top of the gradient and analyzed in SDS-PAGE followed by Coomassie staining. The HBcAg-Lys protein was detected by Coomassie staining.

The enriched HBcAg-Lys protein fraction was located at the border between 15 and 65% sucrose, which indicates that the protein formed a capsid particle. Most bacterial proteins remained in the sucrose-free upper layer of the gradient, thus centrifuging HBcAg-Lys particles in a stepwise gradient resulted in both enrichment and partial purification of the particles.

The expression and purification of HBcAg-Lys on a large scale was carried out as follows. An overnight culture was obtained by plating a single colony in 100 ml LB, 100 μg / ml ampicillin and growing the culture overnight at 37 ° C. The next day, 25 ml of the preliminary culture was diluted in 800 ml of LB medium with ampicillin and the culture was grown to an optical density of OD ⁶⁰⁰ equal to 0.6-0.8. The culture was then induced with 1 mM IPTG and allowed to grow for another 4 hours. Cells were harvested and lysed essentially as described above.

Then, HBcAg-Lys was purified by first precipitating the protein with ammonium sulfate (30% saturation) from the clarified cell lysate, then depositing the re-dissolved pellet on a gel filtration column (Sephacryl S-400, Pharmacia). The combined fractions were again precipitated with ammonium sulfate, the precipitate was redissolved and applied a second time on the same gel filtration column. Finally, the fractions were combined and concentrated, and the concentration was evaluated using the Bradford test (BioRad).

EXAMPLE 4

Construction of HBcAg, devoid of free cysteine residues and containing a built-in lysine residue

Hepatitis Cortical Antigen (HBcAg), referred to herein as HBcAg-lys-2cys-Mut, lacking cysteine residues at positions corresponding to 48 and 107 in SEQ ID NO: 77, and containing an integrated lysine residue, was constructed using the following methods.

Two mutations were first introduced by separate amplification of three fragments of the HBcAg-Lys gene, obtained as described above in Example 2, with the following combinations of PCR primers. PCR methods and conventional cloning methods were used to obtain the HBcAg-lys-2cys-Mut gene.

Briefly, to obtain fragment 1, the following primers were used:

Primer 1: EcoRIHBcAg (s)

Primer 2: 48as

To obtain fragment 2, the following primers were used:

Primer 3: 48s

Primer 4: 107as

To obtain fragment 3 used the following primers:

Primer 5: HBcAg149hind-as

Primer 6: 107s

Then fragments 1 and 2 were combined using EcoRIHBcAg (s) and 107as PCR primers to give fragment 4. Then, fragment 4 and fragment 3 were combined using EcoRIHBcAg (s) and HBcAg149hind-as primers to give the full gene. The full-sized gene was then digested with EcoRI (GAATTC) and HindIII (AAGCTT) enzymes and cloned into pKK vector (Pharmacia), cut at the same restriction sites. Expression and purification of HBcAg-lys-2cys-Mut was carried out as described in example 3.

EXAMPLE 5

Construction of HBcAg1-185-Lys

Hepatitis measles antigen (HBcAg) 1-185 was modified as described in Example 2. Part of the c / e1 epitope region (residues 72 to 88) (proline 79 and alanine 80) was genetically replaced with the Gly-Gly-Lys-Gly-Gly peptide (construct HBcAg1-185-Lys: SEQ ID NO: 117). The lysine residue introduced contains a reactive amino group in its side chain, which can be used for intermolecular chemical cross-linking of HBcAg particles with any antigen containing a free cysteine group. To obtain the HBcAg1-185-Lys gene, PCR methods and conventional cloning methods were used.

The Gly-Gly-Lys-Gly-Gly sequence (SEQ ID NO: 117) was inserted by amplification of two separate fragments of the HBcAg gene from pEco63, as described above in Example 2, and then by fusion of the two fragments using PCR to collect the full-sized gene. Used the following combinations of PCR primers:

fragment 1:

primer 1: EcoRIHBcAg (s) (see example 2)

primer 2: Lys-HBcAg (as) (see example 2)

fragment 2:

primer 3: Lys-HBcAg (s) (see example 2)

primer 4: HBcAgwtHindIIII

Assembly:

primer 1: EcoRIHBcAg (s) (see example 2)

primer 2: HBcAgwtHindIIII

Then, the assembled full-sized gene was digested with the EcoRI (GAATTC) and HindIII (AAGCTT) enzymes and cloned into the pKK vector (Pharmacia), cut at the same restriction sites.

EXAMPLE 6

Fusion of the peptide epitope in the MIR region of HbcAg

Residues 79 and 80 of HBcAg1-185 were replaced by the CεH3 epitope of the VNLTWSRASG sequence (SEQ ID NO: 149). The CεH3 sequence is derived from the sequence of the third constant domain of the human IgE heavy chain. The epitope was inserted into the HBcAg1-185 sequence using the PCR assembly method. In the first PCR step, the HBcAg1-185 gene, derived from the ATCC clone pEco63 and amplified with HBcAg-wt EcoRI fwd and HBcAg-wt Hind III rev primers, was used as a template in two separate reactions to amplify two fragments containing sequence elements, encoding the sequence CεH3. Then, the two fragments were assembled in a second PCR step in a PCR assembly reaction.

The combinations of primers in the first stage of PCR: CεH3fwd with HBcAg-wt Hind III rev, and HBcAg-wt EcoRI fwd with CεH3rev. In the PCR assembly reaction, two fragments isolated in the first PCR step were first assembled for 3 PCR cycles without external primers, which were added to the reaction mixture later for the next 25 cycles. External primers: HBcAg-wt EcoRI fwd and HBcAg-wt Hind III rev.

The PCR product was cloned into pKK223.3 using EcoRI and HindIII sites for expression in E. coli (see Example 2). The chimeric VLP was expressed in E. coli and purified as described in Example 2. In the elution volume in which HBcAg1-185-CεH3 was eluted by gel filtration, the assembly of fusion proteins into the chimeric VLP is shown.

Primer Sequences:

EXAMPLE 7

Fusion of the RANKL Peptide Epitope in the MIR Region of HbcAg

Residues 79 and 80 of HBcAg1-185 were replaced by an epitope of the RANKL peptide with the sequence: SIKIPSSH (SEQ ID NO: 88). Two overlapping primers were constructed using the same procedure as described in Example 6, and the fusion protein was constructed by PCR assembly. The PCR product was cloned in pKK223.3 vector and expressed in E. coli K802. Chimeric VLPs were expressed and purified as described in Example 3.

EXAMPLE 8

Fusion of the RANKL peptide epitope with the C-terminus of Qβ A1 protein shortened at position 19 of CP extension

A primer was used that annealed at the 5'-end of the A1 gene Qβ, and a primer that was annealed at the 3'-end of the A1 gene and contained an additional sequence element encoding an epitope of the RANKL peptide with the sequence: SIKIPSSH (SEQ ID NO: 88), in PCR with pQβ10 as template. The PCR product was cloned into pQβ10 (Kozlovska T.M. et al., Gene 137: 133-37 (1993)), and chimeric VLPs were expressed and purified as described in Example 1.

EXAMPLE 9

Insertion of the epitope of the RANKL peptide between positions 2 and 3 of the coating protein fr

Complementary primers encoding a sequence of the RANKL peptide epitope with the sequence: SIKIPSSH (SEQ ID NO: 88) and containing Bsp119I-compatible ends and additional nucleotides providing a frame-wise insertion, were inserted into the Bsp119I site of the pFrd8 vector (Pushko, P. et al. , Prot. Eng. 6: 883-91 (1993)) by standard molecular biology methods. Alternatively, the protruding ends of the pFrd8 vector were filled with a Klenov fragment after cleavage of Bsp119I and oligonucleotides encoding the sequence of the RANKL protein, RANKL fragment or RANKL peptide and additional nucleotides for frame cloning were ligated into pFrd8 after treatment with the Klenov fragment. Clones with the insert in the correct orientation were analyzed by sequencing. Expression and purification of the chimeric fusion protein in E. coli JM109 or E. coli K802 was carried out as described in Pushko, P. et al, Prot. Eng. 6: 883-91 (1993), with the exception of chromatography steps that were performed using Sepharose CL-4B or Sephacryl S-400 (Pharmacia). The cell lysate was precipitated with ammonium sulfate and purified using two successive gel filtration steps, similar to the method described for Qβ in Example 1.

EXAMPLE 10

Insertion of an epitope of the RANKL peptide between positions 67 and 68 of the Ty1 p1 protein in the pOGS8111 vector

Two complementary oligonucleotides encoding an epitope of the RANKL peptide with the sequence were synthesized: SIKIPSSH (SEQ ID NO: 88) with ends compatible with the pheS8111 NheI site. Additional nucleotides were added to provide a reading frame reading of the sequence encoding the RANKL epitope as described in EP06777111. The amino acids AS and SS flanking the inserted epitope are encoded by altered NheI sites resulting from the insertion of the oligonucleotide into the TyA (d) gene pOGS8111.

POGS8111 was transformed into S. cerevisiae MC2 strain for expression of the chimeric VLP Ty, as described in EP0677111 and the references herein. The chimeric VLP Ty was purified by sucrose gradient ultracentrifugation as described in EP0677111.

EXAMPLE 11

Insertion of the RANKL peptide epitope into the major protein of the papilloma virus type 1 capsid L1 (BPV-1)

The sequence encoding the epitope of the RANKL peptide with the sequence SIKIPSSH (SEQ ID NO: 88) was replaced by the sequence encoding amino acids 130-136 of the BPV-1 L1 gene cloned in the pFastBac1 vector (GIBCO / BRL) as described (Chackerian, B. et al ., Proc. Natl. Acad. USA 96: 2373-2378 (1999)). The sequence of the construct was checked by analysis of the nucleotide sequence. Recombinant baculovirus was created using the GIBCO / BRL baculovirus system as described by the manufacturer. Chimeric VLPs were purified from baculovirus-infected Sf9 cells as described by Kirnbauer, R. et al., Proc. Natl. Acad. Sci. 89: 12180-84 (1992) and Greenstone, H. L., et al., Proc. Natl. Acad. Sci. 95: 1800-05 (1998).

EXAMPLE 12

Introduction N-terminal cys-containing linker, expression and purification of RANKL

The RANKL fragment was recombinantly expressed with an N-terminal linker containing one cysteine for binding to VLP.

The construction of expressing plasmids

C-terminal coding region of the RANKL gene was amplified by PCR with oligos RANKL-UP and RANKL-DOWN (oligonucleotides: RANKL-UP: 5'CTGCCAGGGGCCCGGGTGCGGCGGTGGCCATCATCACCACCATCACCAGCGCTTCTCAGGAG-3 '(SEQ ID NO: 154); RANKL-DOWN: 5'-CCGCTCGAGTTAGTCTATGTCCTGAACTTTGAAAG-3 '(SEQ ID NO: 155). RANKL-UP had an internal ApaI site and RANKL-DOWN had an internal XhoI site. The PCR product was digested with ApaI and XhoI and ligated into pGEX-6p1 (Amersham Pharmacia). The resulting plasmid was named pGEX- RANKL All steps were performed using standard molecular biology protocols and the sequence was verified Plasmid pGEX-RANKL encodes a glutathione-S-transferase fusion protein cleavage site PreScission cysteine-containing amino acid linker-RANKL (GST-PS-C-RANKL). The cysteine-containing amino acid linker had the GPGCGGG sequence (SEQ ID NO: 156). The construct also contains a hexahistidine tag between the cysteine-containing amino acid linker and the RANKL The sequences of the resulting cDNA and protein constructs are given as SEQ-ID NO: 94 and SEQ-ID NO: 95.

Expression and purification of C-RANKL

Competent cells of Escherichia coli BL21 (DE3) Gold pLys were transformed with the plasmid pGEX-RANKL. Separate colonies from ampicillin-containing agar plates were propagated in liquid culture (LB medium, 100 μg / ml ampicillin) and incubated at 30 ° C. overnight with 220 rpm shaking. Then, in one liter of LB (with 100 μg / ml ampicillin), a night culture of 1: 100 v / v was sown. and grown at 24 ° C to OD ₆₀₀ = 1. Expression was induced by 0.4 mM IPTG. Cells were harvested after 16 hours and centrifuged at 5000 rpm. The cell pellet was suspended in lysis buffer (50 mM Tris-HCl, pH 8.0; 25% sucrose; 1 mM EDTA, 1% NaN ₃ ; 10 mM DTT; 5 mM MgCl ₂ ; 1 mg / ml lysozyme; 0.4 U / ml DNase) for 30 minutes Then 2.5 volumes of buffer A were added (50 mM Tris-HCl, pH 8.0; 1% Triton X100; 100 mM NaCl; 0.1% NaN ₃ ; 10 mM DTT; 1 mM PMSF) and incubated at 37 ° C within 15 minutes Cells were sonicated and pelleted at 9000 rpm for 15 minutes. The supernatant was immediately used for GST affinity chromatography.

A 5 ml GST trap FF column (Amersham Pharmacia) was equilibrated in PBS, pH 7.3 (140 mM NaCl; 2.7 mM KCl; 10 mM Na ₂ HPO ₄ ; 1.8 mM KH ₂ PO ₄ ). The supernatant was applied to a 5 ml GST trap FF column, and then the column was washed with a PBS volume of 5 column volumes. The GST-PS-C-RANKL protein was eluted using 50 mM Tris-HCl, pH 8.0, containing 10 mM reduced glutathione.

The purified GST-PS-C-RANKL protein was digested using the PreScission protease (Amersham Pharmacia). Cleavage was carried out at 37 ° C for 1 hour using a molar ratio of 500/1 GST-PS-C-RANKL to PreScission.

In addition, in the protease cleavage reaction mixture, the buffer was replaced using a HiPrep 26/10 desalination column (Amersham Pharmacia), protein fractions were combined and immediately used for another GST affinity chromatography step using conditions such as conditions described above. Purification of C-RANKL was analyzed on SDS-PAGE gel under reducing conditions shown in figure 1. Cleaved C-RANKL is present in the flow (unbound fraction), while the uncleaved GST-PS-C-RANKL, cleaved GST-PS and PreScission remain bound to the column. The C-RANKL protein (SEQ ID NO: 96) of the expected size of 22 kDa was obtained highly purified.

EXAMPLE 13

Introduction C-terminal cys-containing linker, expression and purification of RANKL

The RANKL fragment was recombinantly expressed with a C-terminal linker containing one cysteine for binding to VLP.

The construction of expressing plasmids

MCS pET22b (+) (Novagen, Inc.) was changed to GTTTAACTTTAAGAAGGAGATATACACATATGGATCCGGCTAGCGCTCGAGGGTTTAAACGGCGGCCGCATGCACC (SEQ ID NO: 157) by replacing the original sequence with the following sequence: pH 8). The resulting plasmid was named pMod00, which had the restriction sites NdeI, BamHI, NheI, XhoI, PmeI and NotI in its MCS. The annealed pair of Bamhis6-EK-Nhe-F and Bamhis6-EKNhe-R oligonucleotides and the annealed pair of oligo1F-C-glycine linker and oligo1R-C-glycine linker were ligated together into the BamHI-NotI digested pMod1 plasmid to obtain pMod1 to N-terminal histidine tag, enterokinase cleavage site, and C-terminal amino acid glycine linker containing one cysteine residue.

A DNA fragment containing a glutathione S-transferase gene with a C-terminal enterokinase cleavage site was amplified by PCR using oligonucleotides GST-UP and GST-EK from plasmid SP-GST-EK-pCEP-Pu (Wuttke, M., et. al., J. Biol. Chem., 276: 36839-36848) digested with NheI and BamHI, and cloned into pModEC1 vector.

The resulting plasmid pMod-GST-EK-C1 contains the gene encoding glutathione-S-transferase fused to the enterokinase cleavage site and the C-terminal cys-containing linker. Then, the C-terminal coding sequence of RANKL was amplified by PCR using mRANKL-1 and mRANKL-2 oligonucleotides, digested with NheI and XhoI, and cloned into plasmid pMod-GST-EK-C1. The resulting plasmid pMod-GST-EK-mRANKL-C1 encodes a fusion protein consisting of glutathione-S-transferase, an enterokinase cleavage site, a RANKL fragment and a cysteine-containing amino acid linker (GST-EK-RANKL-C). The sequences of the resulting cDNA and protein constructs are given as SEQ ID NO: 97 and SEQ ID NO: 98.

Oligonucleotide Sequences:

Expression and purification of RANKL-C

Competent Escherichia coli BL21 (DE3) Gold pLys cells were transformed with the plasmid pMod-GST-EK-mRANKL-C1. Separate colonies from ampicillin-containing agar plates were propagated in 100 ml of liquid culture (LB medium, 200 μg / ml ampicillin) and incubated at 30 ° C. overnight and shaken 220 rpm. Then, in one liter of medium (SB with 150 mM MOPS; pH 7.0; 200 μg / ml Amp), a night culture of 1: 100 v / v was seeded. and grown at 30 ° C and shaking 125 rpm to OD ₆₀₀ = 2.5. The cultures were then moved to 18 ° C and after 30 minutes protein expression was induced by the addition of 0.1 mM IPTG. The bacteria were collected after overnight culture at 18 ° C by centrifugation (SLA-3000, 15 min, 4 ° C, 6000 rpm), resuspended in 40 ml of lysis buffer (10 mm Na ₂ HPO ₄ , 30 mm NaCl, 10 mm EDTA and 0.25% Tween-20) and incubated for 30 min on ice with 0.8 mg / ml lysozyme. Then the bacteria were lysed by sonication and incubated for 30 min at RT with 0.2 M MgCl ₂ and 8 μl of benzonase. The lysate was purified from insoluble material by centrifugation (SS-34, 30 min, 4 ° C, 20,000 rpm) and immediately used for affinity chromatography on glutathione-sepharose.

A 5 ml GST trapping FF column (Amersham Pharmacia) was equilibrated with lysis buffer (10 mM Na ₂ HPO ₄ , 30 mM NaCl, 10 mM EDTA and 0.25% tween-20) and the clarified lysate was loaded at a constant flow rate of 0, 5 ml / min. The column was then washed three times with 5 volumes of a lysis buffer column, and GST-EK-RANKL-C protein was eluted in 9 fractions of 1 ml of elution buffer (50 mM Tris-HCl, pH 8.0; 10 mM reduced glutathione) each. The purification shown in FIG. 2A gave a GST-EK-RANKL-C fusion protein of approximately 45 kDa with a small fraction of GST-EK.

The eluted fractions were combined and the purified GST-EK-RANKL-C protein was digested using Max ^TM enterokinase (Invitrogen). Cleavage was carried out at 4 ° C for 16 hours using 10 units of Max enterokinase per mg of purified GST-EK-RANKL-C. FIG. 2B shows that the cleavage reaction resulted in RANKL-C with an apparent M.m. approximately 16 kD.

After cleavage, the protein solution was dialyzed against PBS, pH 7.2 (140 mM NaCl; 2.7 mM KCl; 10 mM Na ₂ HPO ₄ ; 1.8 mM KH ₂ PO ₄ ) and glutathione S-transferase was removed by second affinity chromatography on glutathione-sepharose. For this, a 5 ml GST capture FF column was equilibrated with PBS pH 7.2 and a protein solution was loaded onto the column at a constant flow rate of 0.5 ml / min. Protein fractions were analyzed before and after chromatography on glutathione-sepharose in SDS gels. As shown in FIG. 2C, the cleaved RANKL-C protein (SEQ ID NO: 99) was in a high purity passing stream, while the GST-EK protein remained bound to the column.

EXAMPLE 14

Binding of C-RANKL to Qβ capsid protein

A solution of 1.48 ml of Qβ capsid protein at a concentration of 6 mg / ml in 20 mM Hepes, 150 mM NaCl, pH 7.2, was reacted with 14.8 μl SMPH (Pierce) for 30 minutes at 25 ° C (from 100 mM stock solution dissolved in DMSO). Then, the reaction solution was dialyzed twice for 3 hours against 2 L of 20 mM Hepes, 150 mM NaCl, pH 7.0, at 4 ° C. 230 μl of a solution of protein C-RANKL at a concentration of 9.8 mg / ml in 20 mm Hepes, 150 mm NaCl, pH 7.2 for 30 min at 25 ° C was subjected to interaction with 1.7 μl of a 100 mm TCEP solution (Pierce) . To bind, 80 μl of derivatized and dialyzed Qβ was then mixed with 24 μl of reduced C-RANKL and 96 μl of 20 mM Hepes, 150 mM NaCl, pH 7.0, and incubated overnight at 25 ° C.

Bound products were analyzed on 16% SDS-PAGE gels under reducing conditions. The gels were either stained with Coomassie brilliant blue or blotted onto nitrocellulose membranes. In the latter case, the membranes were blocked and incubated either with a polyclonal rabbit antiserum against Qβ (1: 2000 dilution), then with goat peroxidase conjugated goat anti-rabbit IgG antibody (1: 5000 dilution) or with mouse monoclonal anti-RANKL antibody (dilution 1 : 2000), then with goat peroxidase conjugated anti-mouse goat antibody (dilution 1: 5000). The blots were then developed using ECL ^™ Western Blot Registration Reagents (Amersham Pharmacia). The results are shown in figa and figv. Bound products could be detected in Coomassie stained gels (Figure 3A) and with both anti-Qβ antiserum and anti-RANKL antibody (Figure 3B), which clearly indicates covalent binding of C-RANKL to protein Qβ capsid.

EXAMPLE 15

Immunization of C-RANKL Mice Associated with Qβ Capsid Protein

A total of 8 female Balb / c mice were vaccinated with C-RANKL bound to the Qβ capsid protein. 25 μg of the total protein of each sample was diluted in PBS to 200 μl and injected subcutaneously (100 μl on both sides of the abdomen) on day 0, day 16 and day 64. Four mice received the vaccine without the addition of adjuvants, while four others received the vaccine with the addition of alum. Mice were bled from the retroorbital region at days 0, 16, 23, 64, and 78, and their serum was analyzed using a RANKL-specific ELISA.

EXAMPLE 16

Detection of RANKL-specific antibodies in ELISA

ELISA plates were coated with C-RANKL at a concentration of 10 μg / ml. The plates were blocked and then incubated with serial dilutions of mouse serum obtained on days 16, 23, 64 and 78. Bound antibodies were detected using enzyme-labeled anti-mouse IgG antibodies. As a control, the sera of the same mice obtained before immunization were also tested. Figure 4 shows the average titers of RANKL-specific antibodies that can be detected in the serum of mice that were immunized with Qβ-C-RANKL in the presence or absence of alum. ELISA titers were expressed as serum dilutions that give half the maximum OD in the ELISA assay. In mice immunized without alum, the average titer reached 28,000, while the average titer in mice immunized with alum was 160,000. Serum showed no reactivity to C-RANKL prior to immunization. This clearly indicates that the RANKL-VLP conjugate is able to induce a high titer of antibodies against an autologous protein.

EXAMPLE 17

Inhibition of the interaction of RANKL-RANK with the serum of mice immunized with Qβ-C-RANKL

In order to check whether antibodies formed in mice vaccinated with Qβ-C-RANKL possess neutralizing activity, an in vitro binding assay was developed for RANKL and its related RANK receptor. For this, ELISA plates were coated with C-RANKL protein at a concentration of 10 μg / ml and incubated with serial dilutions of the purified RANK-Fc fusion protein or unrelated Fc-fusion protein as a negative control. Binding proteins were detected using horseradish peroxidase conjugated anti-Fc antibody. 5A shows the result of this analysis. It was found that the purified RANK-Fc fusion protein binds with high affinity (half maximum binding at 1-3 nM) to its RANKL ligand, whereas when using the unrelated Fc-fusion protein, virtually no binding was observed.

Then, the sera of mice vaccinated with C-RANKL bound to Qβ were tested for their ability to inhibit the binding of RANKL to RANK-Fc. For this, ELISA plates were coated with C-RANKL protein at a concentration of 10 μg / ml and incubated together with serial dilutions of mouse sera obtained on day 78 mixed with 1 nM RANK-Fc fusion protein. The binding of the RANK-Fc fusion protein to C-RANKL was recorded using horseradish peroxidase conjugated anti-Fc antibody. FIG. 5B shows that all 8 mice that received the vaccine produced antibodies that specifically inhibited the binding of RANK-Fc to C-RANKL. On average, half the maximum inhibition was achieved with 1:90 serum dilutions. This clearly indicates that immunization with the RANKL-VLP conjugate induces antibodies with high titers that can inhibit the interaction of RANKL with its RANK receptor. Thus, inhibition of the RANK-RANKL interaction by injection of a specific variant according to this invention can eliminate or prevent bone diseases characterized by increased bone resorption.

EXAMPLE 18

Expression and purification of recombinant VLP AP205

A. Expression of Recombinant VLP AP205

E. coli JM109 was transformed with the plasmid pAP283-58. A separate colony was inoculated in 5 ml of LB liquid medium with 20 μg / ml ampicillin and incubated at 37 ° C for 16-24 hours without shaking.

The resulting inoculum was diluted 1: 100 in 100-300 ml of LB medium containing 20 μg / ml ampicillin and incubated at 37 ° C overnight without shaking. The resulting second inoculum was diluted 1:50 in 2TY medium containing 0.2% glucose and phosphate for buffering, and incubated at 37 ° C overnight on a rocking chair. Cells were harvested by centrifugation and frozen at -80 ° C.

B. Purification of Recombinant VLP AP205

Solutions and buffers:

1. Lysis buffer

50 mM Tris-HCl, pH 8.0 with 5 mM EDTA; 0.1% Triton X100 and PMSF at a concentration of 5 micrograms per ml.

2. S AS

A saturated solution of ammonium sulfate in water.

3. Buffer NET .

20 mM Tris-HCl, pH 7.8 with 5 mM EDTA and 150 mM NaCl.

4. PEG

40% (w / v) polyethylene glycol 6000 in NET.

Lysis

Frozen cells were resuspended in lysis buffer at the rate of 2 ml / g cells. The mixture was sonicated at 22 kHz five times for 15 seconds at intervals of 1 min to cool the solution on ice. The lysate was then centrifuged for 20 minutes at 12,000 rpm using a F34-6-38 rotor (Ependorf). All centrifugation steps described below were performed using the same rotor, unless otherwise specified. The supernatant was stored at 4 ° C, while the cell debris was washed twice with lysis buffer. After centrifugation, the lysate supernatants and wash fractions were combined.

Fractionation

Ammonium sulfate precipitation can then be used to purify the AP205 VLP. In the first step, a concentration of ammonium sulfate was chosen at which the VLP AP205 did not precipitate. The resulting precipitate was discarded. In the next step, the concentration of ammonium sulfate was selected at which the VLP of AP205 was quantitatively precipitated, and the VLP of AP205 was isolated from the precipitate obtained in this deposition step by centrifugation (14,000 rpm for 20 min). The resulting precipitate was dissolved in NET buffer.

Chromatography

The capsid protein from the combined supernatants was loaded onto a 4B Sepharose column (2.8 X 70 cm) and eluted with NET buffer at a rate of 4 ml / hour / fraction. Fractions 28-40 were collected and precipitated with ammonium sulfate at 60% saturation. Before sedimentation, fractions were analyzed by SDS-PAGE and Western blotting using antiserum specific for AP205 (FIG. 6A and FIG. 6B). The precipitate isolated by centrifugation was redissolved in NET buffer and loaded onto a 2B Sepharose column (2.3 x 65 cm), eluting at a rate of 3 ml / hour / fraction. Fractions were analyzed in SDS-PAGE and fractions 44-50 were collected, combined and precipitated with ammonium sulfate at a saturation of 60%. The precipitate isolated by centrifugation was redissolved in NET buffer and purified on a 6B Sepharose column (2.5 X 47 cm), eluting at a rate of 3 ml / hour / fraction. Fractions were analyzed in SDS-PAGE. Fractions 23-27 were collected, the salt concentration was adjusted to 0.5 M and precipitated with PEG 6000 added from a 40% mother liquor in water and to a final concentration of 13.3%. The precipitate isolated by centrifugation was redissolved in NET buffer and applied to the same column of Sepharose 2B as described above, eluting in the same manner. Fraction analysis in SDS-PAGE is shown in FIG. 6C. Fractions 43-53 were collected and precipitated with ammonium sulfate at a saturation of 60%. The precipitate isolated by centrifugation was redissolved in water and the resulting protein solution was dialyzed against a large volume of water. About 10 mg of purified protein per gram of cells could be isolated.

Determination of virus-like particles by electron microscopy showed that they were identical to phage particles (FIGS. 7A and 7B).

On figa on the top panel shows silver-stained SDS-PAGE, accelerated under reducing conditions, of the fractions obtained in the first stage of chromatography on sepharose 4B. On lanes 1-13, each second fraction from fractions 20 to 44 was applied. Fraction 50 was applied to lane 14. The same fractions were applied to the second gel and analyzed by Western blotting using antiserum specific for AP205, the second gel is shown on the bottom panels (figv).

On figs shows silver-stained SDS-PAGE, accelerated under reducing conditions, fractions from the last stage of chromatography on sepharose 2B. Fractions 38-54 plotted on tracks 1-16.

FIG. 7A shows an EM picture of AP205 phage particles, while an EM picture of recombinant AP205 VLP particles generated by self-assembly is shown in FIG. 7B.

EXAMPLE 19

Inhibition of RANKL-induced Osteoclast Formation in Serum of Mice Immunized with Qβ-C-RANKL

In order to test whether antibodies formed in mice immunized with Qβ-C-RANKL are able to inhibit the biological activity of RANKL, an in vitro osteoclast differentiation assay was performed. For this, bone marrow cells were isolated from Balb / c mice (4 weeks old) and incubated at a density of 10 ⁶ / ml with recombinant mouse M-CSF (5 ng / ml) in α-MEM / 10% FCS for 16 hours. Unattached cells were then harvested and further cultured with M-CSF (30 ng / ml), PGE2 (1 μM) and various concentrations of C-RANKL. On day 4, osteoclast formation was assessed by the number of multinucleated cells positively stained with tartrate-resistant acid phosphatase (TRAP). C-RANKL was found to induce a significant amount of TRAP-positive multinucleated cells at a concentration of 100-1000 ng / ml.

Then, the sera of mice vaccinated with Qβ-C-RANKL were tested for their ability to inhibit the formation of osteoclasts from C-RANKL-treated bone marrow cells. To do this, osteoclast precursor cells were isolated from Balb / c mice and incubated with M-CSF (30 ng / ml), PGE ₂ (1 μM), C-RANKL (1000 ng / ml) and serial dilutions of sera obtained from immunized mice , in α-MEM / 10% FCS for 4 hours. The formation of osteoclasts was then analyzed by counting the number of TRAP-positive multinucleated cells and comparing with controls incubated only in C-RANKL and with C-RANKL and sera obtained prior to immunization.

EXAMPLE 20

Inhibition of bone loss when vaccinated with Qβ-C-RANKL in a murine model of ovariectomy

To test whether Qβ-C-RANKL vaccination protects against bone loss induced by estrogen deficiency, a mouse ovariectomy (ovx) model was prepared. To do this, a total of 40 C57 / BL6 mice at the age of 12 weeks were randomly divided into 4 groups and processed as follows: group 1 was not immunized and subjected to false operation, group 2 was not immunized and subjected to ovx, group 3 was immunized with 25 μg Qβ-C-RANKL without alum and subjected to ovx and group 4 was immunized with 25 μg Qβ-C-RANKL with alum and also subjected to ovx. Animals from groups 3 and 4 were immunized on days 0, 14, 21 and 42, and all animals were operated on (either falsely or ovx) on day 28 and were killed on day 63. Body weight was measured at 0, 28, and 63 days, and blood samples were collected at 0, 14, 21, 28, 42, and 63 days. Antibody titers, as well as markers of bone formation and bone degradation, were continuously monitored, and bone mineral density was evaluated after slaughtering animals using a DXA scan of an isolated spinal column and a pQCT scan of excised femurs in one distal section and one section of the middle third of the bone.

Now, on the basis of a full description of the present invention with some details, using an illustration and an example for the sake of a clear understanding, it will be obvious to a person skilled in the art that the same can be done by modifying or changing the invention within wide and equivalent ranges of conditions, compositions and other parameters, affecting the scope of the invention or any particular variant thereof, and that such modifications or changes are intended to be included within the scope of the appended claims.

All publications, patents and patent applications referred to in this description are an indicator of the level of specialist in the field to which this invention relates, and are incorporated by reference to the same extent as in the case when it is separately indicated that each individual the publication, patent, or patent application is incorporated by reference.

Claims (35)

1. The composition intended for immunization and containing (a) a virus-like particle of an RNA phage; and (b) at least one antigen or antigenic determinant, wherein said antigen or antigenic determinant is a RANKL protein, a RANKL fragment, or a RANKL peptide, and where the specified at least one antigen or antigenic determinant is associated with the specified virus-like particle of at least one non-peptide covalent bond. 2. The composition according to claim 1, where the specified virus-like particle contains recombinant proteins of RNA phage or fragments thereof. 3. The composition according to claim 2, where the specified RNA phage is selected from the group consisting of (a) bacteriophage Qβ; (b) bacteriophage R17; (c) bacteriophage fr; (d) bacteriophage GA; (e) bacteriophage SP; (f) bacteriophage MS2; (g) bacteriophage M11; (h) bacteriophage MX1; (i) bacteriophage NL95; (j) bacteriophage f2; (k) bacteriophage PP7; and (1) AP205 bacteriophage. 4. The composition according to claim 1, where the specified virus-like particle contains recombinant proteins of RNA phage Qβ or fragments thereof. 5. The composition according to claim 1, where the specified virus-like particle contains recombinant proteins of the RNA phage fr or fragments thereof. 6. The composition according to claim 1, where the specified virus-like particle contains recombinant proteins of the RNA phage AP205 or fragments thereof. 7. The composition according to claim 1, where the specified antigen or antigenic determinant is a RANKL protein or a fragment of RANKL. 8. The composition according to claim 1, where the specified antigen or antigenic determinant is a human RANKL protein or a fragment of human RANKL. 9. The composition according to claim 1, where the specified antigen or antigenic determinant has an amino acid sequence selected from the group consisting of (a) the amino acid sequence of SEQ ID NO: 79; (b) the amino acid sequence of SEQ ID NO: 80; (c) the amino acid sequence of SEQ ID NO: 81; (d) the amino acid sequence of SEQ ID NO: 82; (e) the amino acid sequence of SEQ ID NO: 83; (f) the amino acid sequence of SEQ ID NO: 84; (g) the amino acid sequence of SEQ ID NO: 100; (h) the amino acid sequence of SEQ ID NO: 101; (i) the amino acid sequence of a fragment of any of the sequences of SEQ ID NO: 79-84, 100, 101. 10. The composition according to claim 1, where the specified antigen or antigenic determinant is a RANKL peptide. 11. The composition of claim 10, wherein said RANKL peptide is a human RANKL peptide. 12. The composition according to claim 1, where the specified antigen or antigenic determinant is a RANKL peptide containing an amino acid sequence selected from the group consisting of (a) the amino acid sequence of SEQ ID NO: 87; (b) the amino acid sequence of SEQ ID NO: 88; (c) the amino acid sequence of SEQ ID NO: 89; (d) the amino acid sequence of SEQ ID NO: 90; (e) the amino acid sequence of SEQ ID NO: 91; (f) the amino acid sequence of SEQ ID NO: 92; (g) the amino acid sequence of SEQ ID NO: 93; (h) the amino acid sequence of a fragment of any of the sequences of SEQ ID NO: 87-93. 13. The composition according to claim 1, where the specified virus-like particle contains at least one first binding site and where the specified antigen or antigenic determinant further comprises at least one second binding site, where the second binding site is selected from the group consisting of (i) a binding site of non-natural origin with the specified antigen or antigenic determinant; and (ii) a binding site of natural origin with the specified antigen or antigenic determinant; and wherein said second binding site is capable of associating with said first binding site; and where additionally the specified antigen or antigenic determinant and the specified virus-like particle interact through the specified association, forming an ordered and repeating antigenic matrix. 14. The composition of claim 13, wherein said first binding site is a lysine residue and where said second binding site is a cysteine residue. 15. The composition according to item 13, where the specified antigen or antigenic determinant with the specified at least one second binding site contains an amino acid sequence selected from the group consisting of (a) the amino acid sequence of SEQ ID NO: 104; (b) the amino acid sequence of SEQ ID NO: 105; (c) the amino acid sequence of SEQ ID NO: 106; (d) the amino acid sequence of SEQ ID NO: 107; (e) the amino acid sequence of SEQ ID NO: 108; (f) the amino acid sequence of SEQ ID NO: 109; (g) the amino acid sequence of SEQ ID NO: 110; (h) the amino acid sequence of a fragment of any of the sequences of SEQ ID NO: 104-110. 16. The composition of claim 1, wherein said RANKL protein, RANKL fragment, or RANKL peptide is coupled to said virus-like particle using a heterobifunctional cross-linking linker. 17. The pharmaceutical composition intended for immunization and containing (a) the composition according to claim 1; and (b) an acceptable pharmaceutical carrier. 18. The vaccine composition intended for immunization and containing a composition, where the specified composition contains (a) a virus-like particle of an RNA phage; and (b) at least one antigen or antigenic determinant, wherein said antigen or said antigenic determinant is a RANKL protein, a RANKL fragment, or a RANKL peptide, and where the specified at least one antigen or antigenic determinant is associated with the specified virus-like particle of at least one non-peptide covalent bond. 19. The composition of claim 18, wherein said vaccine composition further comprises an adjuvant. 20. The vaccine composition according to claim 18, wherein said virus-like particle contains recombinant RNA phage proteins or fragments thereof, where preferably said virus-like particle contains recombinant Qβ RNA phage proteins, fr RNA phage or AP205 RNA phage or fragments thereof. 21. The vaccine composition of claim 18, wherein said at least one antigen or antigenic determinant is coupled to said virus-like particle of at least one covalent bond, and wherein said covalent bond is a non-peptide bond. 22. The composition of claim 18, wherein said antigen or antigenic determinant is a RANKL protein or a RANKL fragment, and where preferably said antigen or antigenic determinant is a human RANKL protein or a human RANKL fragment. 23. The vaccine composition of claim 18, wherein said antigen or antigenic determinant is a RANKL peptide and where preferably said RANKL peptide is a human RANKL peptide. 24. A method of obtaining a composition according to claim 1, including (a) obtaining a virus-like particle of an RNA phage; and (b) obtaining at least one antigen or antigenic determinant, wherein said antigen or antigenic determinant is a RANKL protein, a RANKL fragment, or a RANKL peptide; (c) combining said virus-like particle and said at least one antigen or antigenic determinant so that said at least one antigen or antigenic determinant is associated with said at least one non-peptide covalent bond. 25. An immunization method comprising administering a composition according to claim 1 to an animal or human, wherein preferably said antigen or antigenic determinant is an autoantigen. 26. The immunization method of claim 25, wherein said animal is a human and where said antigen or antigenic determinant is a RANKL protein, a RANKL fragment, or a human RANKL peptide. 27. The use of a composition according to claim 1 for the manufacture of a medicament for the treatment of bone diseases. 28. The use of the composition according to claim 1, where the specified composition is used in combination with at least one drug suitable for the treatment of bone diseases. Priorities: 11/07/2001 - items 1, 2, 7, 8, 10-15, 18-19, 21-28, November 7, 2001 - Clause 3 with respect to features (a) - (i), November 7, 2001 - claims 4 and 5 with respect to the RNA trait of phage Fr, November 7, 2001 - Clause 9 with respect to the characteristics of SEQ ID No: 81, 82, January 18, 2002 - Clause 3 with respect to features (j) - (k), January 21, 2002 - Clause 3 with respect to features (j) - (k), 07/19/2002 - p. 3 in relation to the sign (1), p. 6 in relation to the sign AP205, clause 9 with respect to the characteristics of SEQ ID No: 79, 80, 83, 84, 100 and 101, clauses 16, 17 and clause 20 with respect to the RNA signs of phages AP205 and Fr.

Images