RU2270859C1 - STRAIN OF BACTERIUM BACILLUS SUBTILIS AS PRODUCER OF RESTRICTION ENDONUCLEASE Bisi - Google Patents

Abstract

FIELD: biotechnology, biochemistry, enzymology, genetic engineering.

SUBSTANCE: invention relates to preparing new strain used for isolation of the new restriction endonuclease Bis I that can be used in detection of the modified DNA. The strain Bacillus subtilis 230 isolated from soil as result of search of producers of restriction endonucleases provides preparing the restriction endonuclease Bis I recognizing and cleaving both chain of DNA nucleotide sequence comprising at least one C5-methylcytosine base in the recognition site 5'-GCNGC-3'.

EFFECT: valuable properties of strain, new enzyme.

1 tbl, 3 dwg, 2 ex

Description

The invention relates to biotechnology and relates to the production of a new strain used to isolate a new restriction endonuclease that recognizes and cleaves the nucleotide sequence on double-stranded DNA, provided that at least one of the cytosine bases of the recognized sequence is methylated at position 5 (C5-methylcytosine): 5 ' -GCNGC-3 '

3'-CGNCG-5 '.

A restriction endonuclease (restrictase) having this specificity can be used to identify and cleave methylated DNA regions, in particular, DNA of eukaryotic organisms containing C5-methylcytosine.

A known strain of Escherichia coli K MG1655, producing a vsr protein, recognizing and cleaving only one (unmethylated) nucleotide sequence from double-stranded DNA chains:

5'-CmC (A / T) GG-3 '

3'-GG (A / T) SS-5 ', where mC is C5-methylcytosine [Hennecke F., Kolmar H., Brundl K., Fritz H. - J. Nature - 1991, v.253, p.776 -778].

A disadvantage of the known strain is that the vsr protein isolated from it cleaves only one of the double-stranded DNA chains (unmethylated).

A known strain of Diplococcus pneumoniae producing the restriction enzyme DpnI, which recognizes and cleaves the methylated nucleotide sequence of 5'-GmATC-3 ', where mA is N6-methyladenine [Lacks S., Greenberg B.J. Biol. Chem. - 1975, v. 250, p.4060-4066].

A disadvantage of the known strain is that the restriction enzyme secreted from it is not able to recognize sites containing C5-methylcytosine bases.

Closest to the claimed strain, the prototype is the Fusobacterium nucleatum strain producing the Fnu4HI restriction enzyme that recognizes and cleaves the 5'-GCNGC-3 'nucleotide sequence without methylated bases [Leung DW, Lui ACP, Merilees H., McBride BC, Smith M Nucleic Acids Res. - 1979, v.6, p.17-25].

The disadvantage of this strain is that the restriction enzyme produced by it is not able to recognize and cleave recognition sites containing C5-methylcytosine bases.

An object of the invention is to obtain a bacterial strain that produces a restriction endonuclease that recognizes and cleaves both strands of the DNA nucleotide sequence containing one C5-methylcytosine base at the 5'-GCNGC-3 'recognition site.

The technical task is achieved by obtaining a strain of Bacillus subtilis 230 - producer of restriction endonuclease BisI.

The proposed strain is isolated from natural material (soil) as a result of a targeted systematic search.

The obtained strain of Bacillus subtilis 230 was deposited in the SibEnzyme Microorganism Culture Collection under registration number 1M38, and the restriction enzyme produced by it, which recognizes and cleaves only DNA molecules that contain methylated cytosine bases, is called BisI.

The strain of Bacillus subtilis 230 is characterized by the following features:

Cultural and morphological characters. On the environment, Luria-Bertrani (LB) forms light gray, opaque, granular, slightly convex colonies with smooth edges. The cells are mobile, rod-shaped, 0.6-0.8 × 1.5-2.5 μm in size, often forming chains. Form elliptical centrally located endospores without swelling of sporangium.

The optimum growth temperature is 30 ° C, pH 7.0-7.2.

Physiological and biochemical characteristics. Not capable of anaerobic growth. Catalopositive. The Voges-Proskauer reaction is positive. Hydrolyze starch and casein, tyrosine does not degrade. Form acids from D-glucose, D-xylose, D-mannitol and L-arabinose.

The strain is stored in a freeze-dried state or in a solution of 30% glycerol at a temperature of -60 ° C.

For the cultivation of the strain, the following composition is used (g / l): peptone - 10, yeast extract - 5, NaCl - 5, distilled water - the rest. Cultivation is carried out at 30 ° C with aeration until a stationary growth stage is reached.

The yield of the target enzyme is 30 u / g crude biomass with a specific activity of 200 u / ml.

The obtained restriction endonuclease BisI is characterized by the following properties:

- recognizes and cleaves the sequence of nucleotides 5'-GCNGC-3 ', in which at least one of the cytosine bases is methylated at position 5 (C5-methylcytosine);

- cleaves the bonds between the second cytosine residue (C) and the next nucleotide (N) in both chains of the above methylated sequence;

- does not split the same sequence that does not contain C5-methylcytosine bases (unmethylated);

- the optimum temperature is 33-40 ° C;

- the optimal pH for the action of the enzyme is 8.5-9.5;

- the optimal salt concentration during DNA cleavage is 100-200 mm KCl;

- Mg ²⁺ ions are required to activate BisI, the optimal concentration is 10-20 mm.

The defining difference between the proposed strain and the Fusobacterium nucleatum strain is that the former produces one restriction enzyme that recognizes and cleaves both strands of the DNA nucleotide sequence containing one C5-methylcytosine base at the 5'-GCNGC-3 'recognition site. Thus, BisI restrictase is a new, unparalleled restriction enzyme.

Since the proposed strain was obtained for the first time and was never used to isolate the restriction enzyme that recognizes and cleaves the above nucleotide sequence, we can conclude that the proposed strain meets the criteria of the invention of "novelty" and "inventive step".

The invention is illustrated by examples of specific performance.

Example 1

Growing a strain and isolating an enzyme.

To obtain biomass, cells of the producer strain are transferred onto agarized LB medium in a Petri dish and incubated overnight at 30 ° C. Freshly grown colonies are transferred with a sterile bacteriological loop to flasks containing a liquid LB nutrient medium and cultivated on a rocking chair at 30 ° C with stirring at 150 rpm until a stationary growth phase is reached. Cells are pelleted by centrifugation at 5000 rpm at 4 ° C. The biomass yield is 5 g / l of medium. Disintegration, isolation and purification of the enzyme is carried out according to the known method [Bickle T.A., Pirotta V., Imber R. Nucl. Fcids Res. 1977, v.4, p.2561-2572].

Example 2

Determination of the specificity of BisI restriction endonuclease.

The specificity of the enzyme is determined by the patterns of specific cleavage of various DNA (figures 1 and 2). The DNA of bacteriophages lambda and T7, various plasmid DNAs, as well as synthetic oligonucleotide DNA duplexes with or without methylated bases (C5-methylcytosine or A6-methyladenine) are used as substrates for the detection of cleavage. After incubation under optimal conditions for 1 hour, the reaction products are separated by gel electrophoresis. The cleavage of substrates occurs only in the presence of the sequence 5'-GCNGC-3 ', in which at least one of the cytosine bases is modified to C5-methylcytosine.

Figure 1 presents the electrophoregram of the DNA cleavage products of plasmids pUC19 and pFsp4HI with restriction endonucleases BisI and Fsp4HI. Lanes 1-3 — pUC19 DNA linearized with BamHI restriction endonuclease; 4-6 - pFsp4HI DNA linearized with BamHI restriction endonuclease. Lanes 2 and 5 - DNA was digested with restriction enzyme Fsp4HI; 3 and 6 - DNA was digested with BisI restriction enzyme.

Since plasmid pUC19 does not contain methylated bases in the 5'-GCNGC-3 'sequence, it is cleaved with the Fsp4HI restriction endonuclease (Fnu4HI restriction endonuclease isoschisomer) and is not cleaved with the BisI restriction enzyme. Plasmid pFsp4HI contains the methylated sequence 5'-GCNGC-3 'because it includes the Fsp4HI DNA methyltransferase gene that performs this DNA modification. Figure 1 shows that it is cleaved by the restriction endonuclease BisI, but not cleaved by the restriction endonuclease Fsp4HI.

Figure 2 presents the electrophoregram of the cleavage products of radioactively labeled synthetic oligonucleotide duplexes with restriction endonucleases BisI and Fsp4HI. The oligonucleotide sequences are shown in the table.

Table. Title Oligonucleotide sequence L7 5 'GAGTTTAGCGGCTATCGATCT 3' L8 5 'AGATCGATAGCCGCTAAACTC 3' L9 5 'GAGTTTAG (m5C) GGCTATCGATCT 3' L10 5 'AGATCGATAG (m5C) CGCTAAACTC 3' L11 5 'GAGTTTAG (m5C) AGCTATCGATCT 3' L12 5 'AGATCGATAG (m5C) TGCTAAACTC 3'

Description of the tracks on the electrophoregram depicted in figure 2:

1 - source duplex L7 * / L8;

2 - duplex L7 * / L8 cleaved by Fsp4HI;

3 - duplex L7 * / L8 after incubation with BisI;

4 - source duplex L9 * / L10;

5 - duplex L9 * / L10 after incubation with Fsp4HI;

6 - duplex L9 * / L10, split BisI;

7 - source duplex L11 * / L12;

8 - duplex L11 * / L12 after incubation with Fsp4HI;

9 - duplex L11 * / L12, split BisI.

Oligonucleotides labeled with a radioactive label at the 5'-end are marked with *.

As can be seen from figure 2, the BisI restriction endonuclease cleaves the L9 * / L10 and L11 * / L12 duplexes containing the methylated sequence 5'-GCNGC-3 ', but does not cleave the L7 * / L8 duplex that contains the same unmethylated sequence.

Thus, experiments with oligonucleotide duplexes of various nucleotide compositions containing BisI and Fsp4HI recognition sites confirm the conclusion that the restriction enzyme BisI digestion of DNA requires the presence of a 5'-GCNGC-3 'sequence containing C5-methylcytosine bases in it.

Example 3

Determination of DNA cleavage positions by BisI restriction endonuclease.

Determination of the positions of DNA cleavage by BisI restriction endonuclease was carried out by comparing the length of the fragments formed during the cleavage of oligonucleotide duplexes with BisI and Fsp4HI restriction endonucleases (Fig. 3). The oligonucleotide sequences are shown in the table. Oligonucleotides labeled with a radioactive label at the 5'-end are marked with *.

Description of the tracks on the electrophoregram depicted in figure 3:

1 - source duplex L8 * / L7;

2 - L8 * / L7 duplex treated with ExoIII exonuclease;

3 - duplex L8 * / L7, split Fsp4HI;

4 - duplex L10 * / L9, split BisI;

5 - duplex L10 * / L9, treated with exonuclease ExoIII;

6 - source duplex L10 * / L9;

7 - source duplex L7 * / L8;

8 - duplex L7 * / L8 treated with exonuclease ExoIII;

9 - duplex L7 * / L8, split Fsp4HI;

10 - duplex L9 * / L10 split BisI;

11 - duplex L9 * / L10 treated with exonuclease ExoIII;

12 - source duplex L9 * / L10.

As a marker of fragment lengths, products of partial cleavage of the same duplexes with exonuclease ExoIII were used. From figure 3 it is seen that the fragments (products of DNA cleavage) on 3 and 4 and on 9 and 10 tracks have the same length, which indicates the coincidence of the positions of the cleavage of restriction endonucleases BisI and Fsp4HI. Since Fsp4HI is known to cleave the bonds between the second cytosine residue and the next nucleotide at the recognition site on both chains, it follows from the electrophoregram that the BisI restriction endonuclease cleaves DNA relative to the recognition site in the same way.

The yield of BisI restriction endonuclease is determined by the electrographic pattern of DNA cleavage of the linearized plasmid pFsp4HI. The unit of activity is the minimum amount of enzyme required for complete cleavage of 1 μg of DNA of the linearized plasmid pFsp4HI for 1 hour at a temperature of 37 ° C. The yield of the enzyme is 30 u / g crude biomass, the specific activity of 200 u / ml

The enzyme is stored at - 20 ° C in glycerol.

Thus, a new strain was obtained that produces the BsiI restriction endonuclease, which recognizes and cleaves both chains of the nucleotide sequence, which necessarily contains C5-methylcytosine bases in both double-stranded DNA chains.

Claims (1)

The bacterial strain Bacillus subtilis KKM NPO SibEnzyme 1M38 is a producer of a restriction endonuclease that recognizes and cleaves both chains of the DNA nucleotide sequence containing at least one C5-methylcytosine base at the 5'-GCNGC-3 'recognition site.

Images