RU2265055C2 - Recombinant plasmid expressing module polypeptide for delivery of photosensitizer and strain escherichia coli vkpm b-8356 - producer of module polypeptide - Google Patents

Abstract

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention proposes a new recombinant plasmid pR752 (5269 pair bases) comprising genetic construction under control of bacteriophage T5 promoter and encoding a module polypeptide consisting of 6 histidine residues, hemoglobin-like protein of E. coli, modified fragment of large T-antigen SV-40, translocation domain of diphtheria toxin, spacer sequence (Gly-Ser)₅ and human epidermal growth factor (6 His-HMP-NLS-Dtox-(Gly-Ser)₅-EGF) and designated for the directed transfer of photosensitizers into target-cell nuclei. By transformation of the strain E. coli M15 (rep 4) with plasmid pR752 the recombinant strain E. coli VKPM B-8356 as a producer of new polypeptide vector is prepared. The usage of this new strain is able to enhance the effectiveness of effect of photosensitizers by some orders. Invention can be used in medicinal-biological industry in preparing agents providing the directed transport of photosensitizing agents into tumor cell nuclei.

EFFECT: valuable biological and medicinal properties of polypeptide.

3 dwg, 4 ex

Description

The invention relates to biotechnology, genetic engineering, as well as medicine, and is a plasmid pR752 encoding a modular recombinant polypeptide and E. coli strain M15 (Rep4, pR752), a producer of a modular peptide.

A known composition for the photodynamic damage of target cells, consisting of a photosensitizer, a carrier component of the photosensitizer, a component for recognizing target cells and transport of the photosensitizer into the target cell by a specific receptor-mediated endocytosis, and a component with the ability of targeted transport of the photosensitizer inside the target cells. Based on this composition, a method of photodynamic damage to cells has been developed, which consists in adding the proposed composition to the cells and keeping them at a temperature normal for the life of the cells. When cells are irradiated with light, a photochemical reaction occurs, as a result of which target cells die (RF Patent No. 2066552, 1996). Obtaining such multi-component transport compositions for use in clinical practice is too expensive and time-consuming procedure. A more acceptable way to obtain similar transport media includes designing, operating time in E-coli and cleaning modular recombinant transporters (MRI) for photosensitizers (FS), bearing:

ligand module, optimized SV-40 large T-antigen as a nuclear localization signal, carrier module — hemoglobin-like HMP E-coli protein, endosomolytic module — amphipathic polypeptide. These MRIs deliver FS to the nuclei of target melanoma cells and significantly enhance the photocytotoxic effect of FS (Genetics, 2003, Volume 39, No. 2, pp. 259-268). The MRI described in this work does not deliver PS efficiently to the nuclei of cells.

The objective of the invention is to obtain a recombinant plasmid encoding a modular polypeptide, which will increase the efficiency of photosensitizer delivery, and a strain producing a modular polypeptide.

The problem is solved by obtaining the plasmid pR752 encoding a modular recombinant polypeptide (MCI), consisting of 6 histidine residues (6His), hemoglobin-like E. coli protein (HMP), a modified fragment of the large T-antigen of the virus SV-40 (NLS), a fragment of diphtheria toxin containing a translocation domain and its own interdomain spacer (DTox), as well as having an additional spacer - (Gly-Ser) ₅ and human epidermal growth factor (EGP), and E. coli strain M15 (Rep4, pR752) - producer of a modular peptide, obtained by transformation of strain M15 (Rep4) plasmid pR752.

The essence of the invention is to create a new design of the recombinant plasmid pR752 for encoding a modular polypeptide (SEQ ID No. 1), length 694, M. m. 76306 D, having the following structure: 6His-HMP-NLS-DTox- (Gly-Ser) ₅ -EGF in which aa 5-10 is 6His, aa 14-409 is HMP, aa 439-624 is DTox 198-384 with replacements, aa 628-638 (Gly-Ser) ₅ , 642-694 EGF.

Plasmid pR752 has a size of 5269 bases (SEQ ID No. 2) and contains the following regulatory regions and coding regions:

- an artificial bacterial operon containing the promoter region of the T5 bacteriophage and a gene encoding the multidomain protein 6His-HMP-NLS-DTox- (Gly-Ser) ₅ -EPP (coding region - 115-2199 n.p.);

- bla bacterial operon encoding beta-lactamase protein, which is a selective marker for the transformation of E. coli strains (coding region 5064-4204 n.a. in the complementary chain);

- a bacterial site of replication initiation type Col E1 3206-4196 n.a., providing for the replication of the plasmid in E. Coli strains.

To obtain a modular polypeptide, the E. Coli strain M15 (Rep4, pR752), a collection number of VKPM B-8356 obtained by transforming strain M15 (Rep4) with the plasmid pR752, is proposed.

The strain was deposited in the All-Union Collection of Industrial Microorganisms (VKPM), FSUE State Research Institute of Genetics 07/17/2002

A significant difference of the proposed plasmid pR752 is the presence of a gene encoding the multidomain protein 6His-HMP-NLS-DTox- (Gly-Ser) ₅ -EGF.

When cultivating the recombinant E. coli strain M15 (Rep4, pR752), a modular recombinant polypeptide (MCI) is obtained for the delivery of the photosensitizer, which differs from the known ones by the presence of a spacer (Gly-Ser) ₅ in its structure, which separates the ligand from the bulk general structure, providing the most effective interaction of the ligand with the receptor on the cell surface, as well as the presence of the 6His sequence in front of the NMR module, to simplify the process of MRI isolation.

Characteristics of E. Coli strain - M15 (Rep4, pR752)

The strain was obtained by transformation of plasmid pR752 of strain M15 (Rep4) provided by QIAGEN.

Cultural and morphological characteristics of the strain

When the strain is grown on LB agar (for 1 l - 10 g of bactotryptone, 5 g of bacterium yeast extract, 10 g of NaCl, 15 g of bactoagar, pH 7, 5 - NaOH) for 18 hours at 37 ° C receive:

- rounded colonies,

- colorless,

- opaque

- the surface is smooth,

- the profile is convex,

- the edge of the colony is wavy,

- the structure is homogeneous,

- the consistency is viscous,

- the ability to emulsify - uniform,

- the pigment does not emit on Wednesday.

The product synthesized by the strain is a modular recombinant polypeptide 6His-HMP-NLS-DTox- (Gly-Ser) ₅ -EGF

Strain activity: expression level of the modular recombinant 6His-HMP-NLS-Dtox- (Gly-Ser) ₅ -EGF polypeptide is 32% of the total protein, solubility is 70%.

Genetic features of the strain: resistant to ampicillin and kanamycin, metabolic markers - able to ferment lactose, arabinose, galactose and mannitol.

A brief description of the drawings.

Figure 1 Map of plasmid pR752 indicating restriction sites.

Figure 2 The dependence of the survival of A431 cells on the concentration of added chlorin e ₆ and its conjugate with MRI, irradiation at a dose of 288 kJ / m ² without filters.

Figure 3 The dependence of the survival of A431 cells on the concentration of bacteriochlorin p ₆ and its conjugate with 6His-HMP-NLS-Dtox- (Gly-Ser) ₅ -EGF when irradiated at a dose of 75 kJ / m ² with a combination of filters providing transmission in the region of 730 -800 nM.

Examples of carrying out the invention

All standard genetic engineering and microbiological manipulations, as well as amplification and DNA sequencing, were performed according to well-known methods (Maniatis T., Fritsch E., Sambrook J., Molecular Cloning, M .: Mir, 1984; DNA Cloning. Methods. Ed. D. Glover, Per. English, Moscow, Mir, 1988; The QIAexpressionist. QUIAGEN Inc., 1991; The QIAexpressionist. Second edition. QUIAGEN Inc., 1992).

Example 1. A method of obtaining a plasmid pR752

a) Chemical synthesis of oligodeoxyribonucleotides

Oligodeoxyribonucleotides were synthesized by the solid-phase aminophosphite method using an AFM 100-2 synthesizer (Novosibirsk) and purified by electrophoresis in a 12% SDS page gel.

b) Cloning of the site providing the photosensitizer (porphyrin) -binding activity

A hemoglobin-like HMP of E. Coli was taken as a photosensitizing binding protein. For cloning of NMR, primers were designed corresponding to the ends of the coding region of the gene. The product was cloned in E. Coli with 6His in front of the protein for possible isolation of expression products by affinity chromatography on Ni-agarose.

Using E. coli chromosomal DNA containing the HMP gene as a DNA template by polymerase chain reaction using oligonucleotide primers of the composition (restriction enzyme sites BamHI, XbaI and BgIII are underlined)

5'-gcaaaaaaag ggatcc catatgcttgacgctc

5'-ccggcaact ctagatct cagcaccttatgcg

the corresponding initial and terminal parts of the DNA encoding HMP amplified the nucleotide sequence. The reaction was carried out in 25 μl of the reaction mixture containing 2 μg of DNA, 10 pcM of each primer, 67 mM Tris-HCl buffer (pH 8.8 at 25 ° C), 15 mM ammonium sulfate, 2.5 mM magnesium chloride, 0.01 % Tween-20, a mixture of deoxynucleotide triphosphates (dATP, dCTP, dTTP, dGTP 2.5 mmol) and 1 unit Taq polymerase. The amplification reaction was carried out under vaseline oil for 5 cycles: 93 ° C for 1 min, 45 ° C for 1 min and 72 ° C for 2 min, and then 30 cycles: 93 ° C for 1 min, 55 ° C for 1 min and 72 ° С - 2 min. Amplification products were separated by electrophoresis in 1% agarose gel, stained with ethidium bromide solution and a 1213 bp DNA fragment containing the HMP gene, excised and isolated from the gel by centrifugation through glass wool. DNA was precipitated with three volumes of ethanol and dissolved in bidistilled water. The resulting DNA was designated as pCRHMP and consisted of 1213 n.p. In order to create a vector expressing HMP, the obtained pCRHMP DNA, as well as the plasmid pQE13 DNA, was hydrolyzed with restriction endonucleases BamHI and XbaI at 37 ° C in a buffer containing 33 mM Tris-acetate (pH 7.9 at 37 ° C), 10 mM acetate magnesium, 66 mm potassium acetate for 1.5 hours. The restriction products were separated by 1% agarose gel electrophoresis, stained with ethidium bromide solution and DNA fragments corresponding to the 1199 bp NMR gene and 2443 bp plasmid pQE13 fragment, excised, isolated from the gel by centrifugation through glass wool and mixed up. The resulting mixture of restriction fragments was ligated using T4 phage DNA ligase in a buffer containing 40 mM Tris-HCl (pH 7.8 at 25 ° C), 10 mM MgCl ₂ , 10 mM dithiothreitol (DTT), and 5 mM ATP. The ligated DNA was used to transform E. Coli M15 [REP4] cells (Nal ^s , Str ^s , rif ^s , lac-, ara-, gal-, mtl-, F-, recA +, uvr +) by electroporation. Transformed cells were selected on LB agar medium with ampicillin (100 μg / ml) and kanamycin (25 μg / ml). Plasmid DNA was isolated from antibiotic-resistant colonies by alkaline lysis, analyzed using restriction enzymes BamHI and XbaI, as well as restriction enzymes of sites located inside the cloned fragment, and clones whose DNA contained the HMP gene were selected. This plasmid is called pR507.

c) Cloning of a site providing ligand-specific activity

An epidermal growth factor (EGF) was used as a specific ligand. The gene encoding this peptide was isolated by PCR from a plasmid provided to us by V. Vertiev. Using a plasmid containing the cloned EGF gene as a DNA template by polymerase chain reaction using oligonucleotide primers of the composition (the restriction enzyme sites BamHI and Kpn21 are underlined)

5'-gggggcccg ggatc caattccgatagcgagtgtcctc

5'-caaggagat ggatcc caacagtcct ccgga cacggggcc

corresponding to the beginning of the EGF gene and the DNA of the amplified plasmid after its end, the nucleotide sequence was amplified. The reaction is carried out in 25 μl of the reaction mixture containing 2 μg of DNA, 10 pcM of each primer, 67 mM Tris-HCl buffer (pH 8.8 at 25 ° C), 15 mM ammonium sulfate, 2.5 mM magnesium chloride, 0.01% Tween -20, a mixture of deoxynucleotide triphosphates (dATP, dTCP, dTTP, dGTP at 2.5 mm) and 1 unit. Taq polymerase. The amplification reaction was carried out under vaseline oil for 30 cycles: 93 ° C for 1 min, 65 ° C for 1 min and 72 ° C for 30 sec. Amplification products were separated by electrophoresis in 1% agarose gel, stained with ethidium bromide solution and a 355 bp DNA fragment. cut out and isolated from the gel by centrifugation through glass wool. DNA was precipitated with three volumes of ethanol and dissolved in bidistilled water. The resulting DNA is designated as pCREGF and consists of 355 n.p.

To create a vector expressing EGF, the obtained pCREGF DNA as well as the plasmid pQE16 DNA was hydrolyzed with restriction endonucleases BamHI and Kpn21 at 37 ° C in a buffer containing 33 mM Tris-acetate (pH 7.9 at 37 ° C), 10 mM magnesium acetate 66 mM potassium acetate for 1.5 hours. The restriction products were separated by 1% agarose gel electrophoresis, stained with ethidium bromide solution and DNA fragments, a fragment comprising an EGF gene of 340 bp and a plasmid fragment pQE16 of 3052 bp cut out, isolated from the gel by centrifugation through glass wool and mixed. The resulting restriction fragment mixture was ligated using T4 phage DNA ligase in a buffer containing 40 mM Tris-HCl (pH 7.8 at 25 ° C), 10 mM MgCl ₂ , 10 mM DTT, and 5 mM ATP. The ligated DNA was used to transform E. coli M15 [REP4] cells (Nal ^s , Str ^s , rir ^s , lac-, ara-, gal-, mtl-, F-, recA +, uvr +) by electroporation. Transformed cells were selected on LB agar medium with ampicillin (100 μg / ml) and kanamycin (25 μg / ml). Plasmid DNA was isolated from antibiotic-resistant colonies by alkaline lysis, analyzed using restriction enzymes BamHI and Kpn21, as well as restriction enzymes of sites located inside the cloned fragment, and clones whose DNA contained the EGF gene were selected. The resulting plasmid is named pR700.

d) Cloning of the site providing endosomolytic activity (Dtox).

As the endosomolytic module, the translocation domain (T) of diphtheria toxin was used with an adjacent natural spacer separating the T and L domains of the native diphtheria toxin. For its cloning, primers were designed corresponding to the ends of the coding region of the T domain, but the N-end of the T domain was modified — ¹⁹⁹ Leu was replaced by Gly, and ²⁰¹ Cys by Ser.

Using a plasmid containing the cloned diphtheria toxin gene as a DNA template by polymerase chain reaction using oligonucleotide primers of the composition (the restriction enzyme sites BamHI and Kpn21 are underlined)

5'-gtaggt ggatccg ggtcatccataaatctttgattgg

5'-cccgtcat ccgga aatggttaagatctatgccccgg

the corresponding initial and terminal parts of the DNA encoding the T domain of the diphtheria toxin gene amplified the nucleotide sequence. The reaction was carried out in 25 μl of the reaction mixture containing 2 μg of DNA, 10 pcM of each primer, 67 mM Tris-HCl buffer (pH 8.8 at 25 ° С), 15 mM ammonium sulfate, 2.5 mM magnesium chloride, 0.01% Tween -20, a mixture of deoxynucleotide triphosphates (dATP, dTTP, dTTP, dGTP at 2.5 mmol) and 1 unit. Taq polymerase. The amplification reaction was carried out under vaseline oil for 5 cycles: 93 ° C - 1 min 30 sec, 45 ° C - 2 min and 72 ° C - 40 sec, and then 30 cycles: 93 ° C - 1 min, 55 ° C - 1 min and 72 ° С - 40 sec. Amplification products were separated by electrophoresis in 1% agarose gel, stained with ethidium bromide solution and a 599 bp DNA fragment (pCRDTox) was excised and isolated from the gel by centrifugation through glass wool. DNA was precipitated with three volumes of ethanol and dissolved in bidistilled water. To create a vector expressing the T domain of diphtheria toxin, the obtained pCRDTox DNA, as well as the DNA of plasmid pQE16, were hydrolyzed with restriction endonucleases BamHI and Kpn21 at 37 ° C in a buffer containing 33 mM Tris-acetate (pH 7.9 at 37 ° C), 10 mm magnesium acetate, 66 mm potassium acetate for 1.5 hours. The restriction products were separated by 1% agarose gel electrophoresis, stained with ethidium bromide solution and DNA fragments corresponding to the diphtheria toxin gene of size 584 bp and plasmid pQE16 DNA of size 3052 bp cut out, isolated from the gel by centrifugation through glass wool and mixed. The resulting restriction fragment mixture was ligated using T4 phage DNA ligase in a buffer containing 40 mM Tris-HCl (pH 7.8 at 25 ° C), 10 mM MgCl ₂ , 10 mM DTT, and 5 mM ATP. The ligated DNA was used to transform E. Coli M15 [REP4] cells (Nal ^s , Str ^s , rif ^s , lac-, ara-, gal-, mtl-, F-, recA +, uvr +) by electroporation. Transformed cells were selected on LB agar medium with ampicillin (100 μg / ml) and kanamycin (25 μg / ml). Plasmid DNA was isolated from antibiotic-resistant colonies by alkaline lysis, analyzed using restriction enzymes BamHI and Kpn21, as well as restriction enzymes of sites located inside the cloned fragment, and clones whose DNA contained the diphtheria toxin T-domain gene were selected. The resulting plasmid is named pR670.

e) Cloning of a site including a nuclear localization signal (NLS)

The sequence of the large T-antigen of the SV-40 virus was used as a nuclear localization signal. Plasmid p10, kindly provided to us by Dr. D. Jans, was used as a matrix. To standardize the NLS sequence in accordance with the concept of the module, primers have been developed that introduce the BgIII site into the region encoding the C-terminus of the structure and replace the non-essential Asp region with Glu. This replacement is made to remove the Asp-Pro acid hydrolysis site.

Using a plasmid containing the cloned NLS gene as a DNA template, PCR using oligonucleotide primers of the composition

5'-gtgagatctgggttcttctacctttctctcttc

5'-gtg agatct gcgcgtaatgagctccttgcaaac

corresponding to the sequence of template plasmid DNA in front of the NLS gene and the end of the NLS gene, the nucleotide sequence was amplified. The BgIII restriction enzyme site located in the reverse primer is underlined. The BamHI restriction enzyme site is contained in the plasmid, which is the template, and the direct primer, for the convenience of cloning, was moved more than 700 bp due to the small size of NLS (25 amino acids or 75 bp). The reaction was carried out in 25 μl of the reaction mixture containing 2 μg of DNA, 10 pcM of each primer, 67 mM Tris-HCl buffer (pH 8.8 at 25 ° С), 15 mM ammonium sulfate, 2.5 mM magnesium chloride, 0.01% Tween -20, a mixture of deoxynucleotide triphosphates (dATP, dTCP, dTTP, dGTP at 2.5 mm) and 1 unit. Taq polymerase (Deep Vent). The amplification reaction was carried out under vaseline oil for 30 cycles: 94 ° C for 1 min, 57 ° C for 1 min and 72 ° C for 1 min. Amplification products were separated by electrophoresis in 1% agarose gel, stained with ethidium bromide solution and a DNA fragment (pCRNLS) of 809 bp. cut out and isolated from the gel by centrifugation through glass wool. DNA was precipitated with three volumes of ethanol and dissolved in bidistilled water. The resulting pCRNLS DNA was ligated with the plasmid pGEM4Z hydrolyzed with HincII restriction enzyme at 37 ° C in a buffer containing 33 mM Tris acetate (pH 7.9 at 37 ° C), 10 mM magnesium acetate, 66 mM potassium acetate for 1.5 hours . Ligation was performed using T4 phage DNA ligase in a buffer containing 40 mM Tris-HCl (pH 7.8 at 25 ° C), 10 mM MgCl ₂ , 10 mM DTT, and 5 mM ATP. The ligated DNA was used to transform E. coli cells DH5α [F ^- (φ80dlacZ) recA1 endA1 gyrA96 thi-1 hsdR17 (r _k ^- m _k ⁺ ) supE44 relA1 deoR Δ (lacZYA-argF) U169] by electroporation. Transformed cells were selected on agar medium LB with ampicillin (100 μg / ml). Recombinant clones with direct orientation of the cloned fragment confirmed by restriction mapping (plasmid pR402dir) were selected. In order to create a vector expressing NLS, the plasmid DNA pR402dir and pQE16 was digested with restriction exonucleases BamHI and Bg1I at 37 ° C in a buffer containing 33 mM Tris acetate (pH 7.9 at 37 ° C), 10 mM magnesium acetate, 66 mM potassium acetate for 1.5 hours. The restriction products were separated by gel electrophoresis on 1% agarose, stained with ethidium bromide solution and a DNA fragment containing the NLS gene of size 1507 bp, as well as a DNA fragment of plasmid pQE16 of size 993 bp cut out, isolated from the gel by centrifugation through glass wool and mixed. The resulting restriction fragment mixture was ligated using T4 phage DNA ligase in a buffer containing 40 mM Tris-HCl (pH 7.8 at 25 ° C), 10 mM MgCl ₂ , 10 mM DTT, and 5 mM ATP. The ligated DNA was used to transform E. Coli M15 [REP4] cells (Nal ^s , Str ^s , rif ^s , lac-, ara-, gal-, mtl-, F-, recA +, uvr +) by electroporation. Transformed cells were selected on LB agar medium with ampicillin (100 μg / ml) and kanamycin (25 μg / ml). Plasmid DNA was isolated from antibiotic-resistant colonies by alkaline lysis, analyzed using restriction enzymes BamHI and Bg1I, as well as restriction enzymes of sites located inside the cloned fragment, and clones whose DNA contained the NLS gene were selected. The resulting plasmid was named pR407.

f) Cloning of the spacer (Gly-Ser) ₅

The spacer (Gly-Ser) _{5 is} designed to spatially separate the ligand from the bulk of the overall structure to allow the ligand to interact with the receptor on the surface of the cell, which can be located deep in the membrane. This sequence is obtained from chemically synthesized oligonucleotides.

The sequence is flanked by the BamHI and HindIII restriction enzyme half-sites, the Bg1II restriction enzyme site is provided at the C-terminus of the HindIII site, as well as the SmaI and EheI restriction enzyme sites for ease of testing (All restriction enzyme sites are underlined). Each of the chains of chemically synthesized oligonucleotides

5'- gatccccggg ttctggctccggctctggttccggttct ggcgccagatct a

5'- agcttagatctgg cgccagaaccggaaccagagccggagagagaa cccggg

phosphorylated separately. The reaction was carried out in 10 μl of Tris-HCl pH 9.5 buffer containing 10 mM magnesium chloride, 50 mM DTT, 1 mM ATP, 100 pmol oligonucleotide, 1 unit. polynucleotide kinase of phage T4, for 30 min at 37 ° C. After the reaction, the samples were combined, heated at 90 ° C for 10 min, and slowly cooled to 25 ° C. To create a vector expressing the spacer (Gly-Ser) ₅ , the plasmid pQE13 DNA was hydrolyzed with restriction exonucleases BamHI and HindIII at 37 ° C in a buffer containing 33 mM Tris acetate (pH 7.9 at 37 ° C), 10 mM magnesium acetate, 66 mM potassium acetate in Bg1II. The restriction products were separated by 1% agarose gel electrophoresis, stained with a solution of ethidium bromide and a DNA fragment of plasmid pQE13 with a size of 3420 n.p. excised, isolated from the gel by centrifugation through glass wool and combined with a mixture of cinated oligonucleotides. The resulting mixture was ligated using T4 phage DNA ligase in a buffer containing 40 mM Tris-HCl (pH 7.8 at 25 ° C), 10 mM MgCl ₂ , 10 mM DTT and 5 mM ATP. Ligation DNA was used to transform E. coli M15 [REP4] cells (Nal ^s , Str ^s , rif ^s , lac-, ara, gal-, mtl-, F-, recA +, uvr +) by electroporation. Transformed cells were selected on LB agar medium with ampicillin (100 μg / ml) and kanamycin (25 μg / ml). Plasmid DNA was isolated from antibiotic-resistant colonies by alkaline lysis, analyzed using restriction enzymes BamHI and HindIII, as well as restriction enzymes of sites located inside the cloned fragment, and clones whose plasmid DNA contained the peptide gene (Gly-Ser) ₅ were selected. The resulting plasmid was named pR703

g) Obtaining plasmids pR689 (module block NMP-NLS)

To obtain an MRI expressing plasmid containing HMP-NLS modules, pR407 plasmid DNA was hydrolyzed with restriction endonucleases BamHI, EcoO1091, and plasmid pR507 DNA was hydrolyzed with restriction endonucleases BglII, EcoO1091 at 37 ° C in a buffer containing 33 mM Tris acetate 9 at 37 ° C), 10 mM magnesium acetate, 66 mM potassium acetate for 1 hour. Restriction fragments isolated from the gel: DNA fragment of plasmid pR407, including 2363 bp NLS module, and also DNA fragment of plasmid pP507, including 1358 bp NMP gene ligated with T4 phage DNA ligase. The resulting ligation mixture transformed E. coli M15 cells [REP4] by electroporation. Transformed cells were selected on LB agar medium with antibiotics ampicillin (100 μg / ml) and kanamycin (25 μg / ml). Plasmid DNA was isolated by alkaline lysis, analyzed using restriction enzymes BamHI, Bg1II, and EcoO1091, as well as restriction enzymes of sites located inside the cloned fragment, and clones (pR689) were selected whose plasmid DNA contained a block of HMP-NLS modules.

h) Obtaining plasmids pR711v (module block Dtox- (Gly-Ser) ₅ )

To obtain plasmid pR711v containing a block of Dtox- (Gly-Ser) ₅ modules, DNA of plasmid pR703 was hydrolyzed with restriction endonucleases BamHI and Pvul at 37 ° С in 66 mM Tris-acetate buffer (pH 7.9 at 37 ° С), 20 mM magnesium acetate, 132 mM potassium acetate and 0.2 mg / ml bovine serum albumin (BSA) for 1 hour, and plasmid pR670 DNA was hydrolyzed with restriction endonucleases Bg1II and Pvul at 37 ° C in a buffer containing 50 mM Tris-HCl (pH 7.5 at 37 ° C), 10 mM magnesium chloride, 100 mM sodium chloride and 0.1 mg / ml BSA for 1 hour. Restriction fragments isolated from the gel: the pR703 plasmid DNA fragment containing the 2704 bp module (Gly-Ser) ₅ and the pR670 plasmid DNA fragment including the 1307 bp Dtox module were ligated using T4 phage DNA ligase . The resulting ligation mixture transformed E. Coli M15 cells [REP4] by electroporation. Transformed cells were selected on LB agar medium with antibiotics ampicillin (100 μg / ml) and kanamycin (25 μg / ml). Plasmid DNA was isolated by alkaline lysis, analyzed using restriction enzymes Pvul, BamHI, and Bg1II, as well as restriction enzymes of sites located inside cloned fragments, and pR711v clones (4011 bp) were selected whose plasmid DNA contained a block of Dtox- (Gly -Ser) ₅ .

i) Obtaining plasmids pR727v (module block Dtox- (Gly-Ser) ₅ -EGF)

To obtain a plasmid expressing an MRI containing Dtox- (Gly-Ser) ₅ modules, plasmid DNA and pR700 were digested with restriction endonucleases BamHI, Bg1I, and plasmid DNA pR711v were digested with restriction endonucleases Bg1II and Bg1I at 33 ° C, -acetate (pH 7.9 at 37 ° C), 10 mm magnesium acetate, 66 mm potassium acetate for 1 hour. Restriction fragments isolated from the gel: DNA fragment of plasmid pR700, including 2365 bp EGF gene, as well as DNA fragment of plasmid pR711v, including 1602 bp Dtox- (Gly-Ser) ₅ module block. ligated with T4 phage DNA ligase. The resulting ligation mixture transformed E. Coli M15 cells [REP4] by electroporation. Transformed cells were selected on LB agar medium with antibiotics ampicillin (100 μg / ml) and kanamycin (25 μg / ml). Plasmid DNA was isolated by alkaline lysis, analyzed using restriction enzymes BamHI, Bg1I and Bg1II, as well as restriction enzymes of sites located inside the cloned fragments, and clones (pR727v) were selected whose plasmid DNA contained a block of Dtox- (Gly-Ser) modules ₅ -EGF.

k) Obtaining plasmid pR752 encoding MRI

To obtain it, a plasmid containing a block of Dtox- (Gly-Ser) ₅ -EGF modules (pR 727v) was digested with restriction enzymes XhoI and BamHI (in a buffer containing 10 mM Tris-HCl, pH 8.5 at 37 ° С, 10 mM MgCl ₂ , 100 mM KCl, 0.1 mg / ml BSA), and the plasmid containing the HMP-NLS module block (pR689) with restriction enzymes XhoI and Bg1II (in a buffer containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl ₂ , 100 mM NaCl, 0.1 mg / ml BSA) for 1 hour at 37 ° C. The restriction products were separated by gel electrophoresis on 1% agarose, stained with ethidium bromide solution and the DNA fragment of plasmid pR727v, including a 3847 bp Dtox- (Gly-Ser) ₅ -EGF module block, as well as a fragment of plasmid pR689, including a block 1422 bp HMP-NLS modules were cut out, isolated from the gel by centrifugation through glass wool, and mixed. The resulting restriction fragment mixture was ligated using T4 phage DNA ligase in a buffer containing 40 mM Tris-HCl (pH 7.8 at 25 ° C), 10 mM MgCl ₂ , 10 mM DTT, and 5 mM ATP. The ligated DNA was used to transform E. Coli M15 [REP4] cells (Nal ^s , Str ^s , rif ^s , lac-, ara-, gal-, mtl-, F-, recA +, uvr +) by electroporation. Transformed cells were selected on LB agar medium with ampicillin (100 μg / ml) and kanamycin (25 μg / ml). Plasmid DNA (pR752) was isolated from antibiotic-resistant colonies by alkaline lysis, analyzed with restriction enzymes XhoI, BamHI and Bg1II, as well as restriction enzymes located inside the cloned fragments, and clones were selected whose DNA contains the desired sequences. Thus, plasmid pR 752 encoding MRI 6His-HMP-NLS-Dtox- (Gly-Ser) ₅ -EGF was obtained.

The primary structure of the obtained plasmid was confirmed by sequencing with the Sanger dideoxymethod.

Example 2. Obtaining a producer strain of MCI 6His-HMP-NLS-Dtox- (Gly-Ser) ₅ -EGF and microbiological synthesis of MCI.

E. coli M15 cells (REP 4) (Nal ^s , Str ^s , rif ^s , lac-, ara-, gal-, mtl-, F-, recA +, uvr +) were transformed with plasmid pR752 by electroporation. Transformed cells were selected on LB agar medium with ampicillin (100 μg / ml) and kanamycin (25 μg / ml).

The synthesis of MRI was induced in accordance with the standard protocol of QUIAGEN. LB medium with ampicillin (100 μg / ml) and kanamycin (25 μg / mg) was inoculated with fresh overnight culture of cells of strain M15 [REP4] carrying an MRI encoding plasmid and grown at 37 ° C with aeration, determining the optical density at 600 nm every hour until a density of 0.9-1.2 is reached. An isopropylthiogalactoside inducer (IPTG) was added to the cell suspension to a concentration of 0.2 mM and grown for 5 hours at 30 ° C with aeration. Cells were harvested by centrifugation for 15 min at 5000 g; the resulting precipitate was stored at -20 ° C. The expression level of 6His-HMP-NLS-Dtox- (Gly-Ser) ₅ -EGF MRI encoded by pR752 plasmid was 32%, solubility - about 65%.

Example 3. Cleaning MCI

Cells grown, as a rule, in 1 liter of medium, were lysed in a buffer of the following composition: 10 mM HEPES-Na buffer, pH 7.5, 0.1 mM EDTA, 1 mM DTT, 3 mM phenylmethylsulfonyl fluoride, 10 μg / ml lysozyme. The amount of buffer was determined by the ratio: 10 ml of buffer per 10 g of cells. After sonication, the suspension was centrifuged for 25 min at 17,000 rpm (JA-20 rotor to a Beckman J2-21 centrifuge). The supernatant was further purified on a Blue Sepharose CL-6B sorbent (Pharmacia). The protein was eluted with a gradient of NaCl concentration of 0.2-1.6 M. Fractions of 0.7-1.6 M NaCl contained the desired preparation of 96% purity. The yield is 20 mg per 1 g of biomass. The homogeneity and molecular weight of the MRI was evaluated by electrophoresis in the Laemmly system.

Example 4. Determination of the effectiveness of the photodynamic effects of conjugates of MCI with FS

To assess the interaction of a modular recombinant polypeptide with cancer cells, we studied the photodynamic effect of MPI conjugates with photosensitizers (PS) on cells in culture. A431 human epidermoid carcinoma cells were used as cancer cells, chlorin e ₆ with a long-term absorption peak at 660 nm and bacteriochlorin p ₆ with a long-wave absorption peak at 760 nm were used as PS.

Synthesis and purification of MCI conjugates with photosensitizers - chlorin e ₆ and bacteriochlorin p ₆

To a solution of chlorin e ₆ or bacteriochlorin p ₆ in 5 mM Na-phosphate buffer (pH 8.0) was added a solution of 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide bifunctional cross-linking agent (30 mg / ml) in water and a solution of N-hydroxycuccinimide (100 mg / ml) in tetrahydrofuran (porphyrin: carbodiimide: N-hydroxycuccinimide ratio 1:30:30). The reaction mixture was thoroughly mixed and incubated for 3 hours at room temperature. All operations with FS were performed in the dark in an inert gas atmosphere. To obtain the MPP-FS conjugate, a solution of activated PS in a ratio of 1:15 was added to a protein solution in 0.1 M borate buffer (pH 9.0) and incubated on ice for 19 hours with constant stirring. Gel filtration (Sephadex G-50) was used to purify the conjugate from unbound PS and crosslinking agents. For this, 1 ml of a conjugate solution, pre-incubated for 30 minutes at 0 ° C in 3 M guanidine with the addition of 1 mM EDTA, was applied to a column with a diameter of 1 cm, 10 cm long. Purification was carried out in a buffer containing 50 mM Na-phosphate , 150 mM NaCl, 3 M guanidine chloride, 1 mM EDTA, pH 8.0. Protein-containing fractions were immediately dialyzed against a buffer containing 5 mM Na-phosphate, 150 mM NaCl, 1 mM EDTA, pH 8.0, and the last dialysis was carried out against a buffer not containing EDTA.

The synthesis of 6His-HMP-NLS-Dtox- (Gly-Ser) ₅ -EGF conjugates with PS - chlorin e ₆ carried out in this way allowed us to obtain a preparation with a molar ratio of covalently attached PS to MPI of 1.5 to 1, a conjugate with bacteriochlorin p _{6 was} obtained with a molar ratio of covalently attached FS to MCI as 1 to 1.

Study of the photodynamic effects of FS and MPP-FS conjugates

A431 cells were scattered into 48-well plates of 5,000 cells per well in DMEM medium with 10% fetal serum, after 24 hours various concentrations of free FS or MPP-FS conjugates in DMEM medium with 2 mg / ml BSA were added and incubated 20 hours. After incubation, the cells were washed 3 times from free PS or conjugates with Hanks solution, DMEM medium with 10% fetal serum was added and incubated for 2 hours. After incubation, the cells were washed three times with Hanks solution, DMEM medium for air was added and the required dose of light was irradiated with a Peleng-2400 graphoprojector (Russia). When irradiating cells incubated with bacteriochlorin p ₆ and the corresponding conjugate, a combination of filters (KC17 + CC4) was used with transmission in the range of 730-800 nm. Cells incubated with chlorin e ₆ and its protein conjugate were irradiated in the same way without a filter. Then the cells were incubated in DMEM medium with 10% fetal serum for 48 hours in a CO ₂ incubator at 37 ° C and 5% CO ₂ . Then the cells were washed three times with Hanks solution, a 0.5% solution of methylene blue in 50% ethanol was added and incubated at room temperature for 30 minutes. Excess paint was washed with distilled water, the dye absorbed by the cells was extracted with a 0.5 mM HCl solution in 50% ethanol, and the optical density was measured on a Multiscan spectrophotometer (Labsystem, Sweden) at a wavelength of 650 nm.

A study of the photodynamic effect of photosensitizers and their 6His-HMP-NLS-Dtox- (Gly-Ser) ₅ -EGF conjugates 22 hours after the addition of the active component showed that when PS is included in the composition of MCI it increases their efficiency by 3 orders of magnitude. The results of the experiments are shown in figure 2 and figure 3. Figure 2 shows the dependence of the survival of A431 cells on the concentration of added chlorin e ₆ and its conjugate with MCI, irradiation at a dose of 288 kJ / m ² without filters, where 1 is conjugate 6His-HMP-NLS-Dtox- (Gly-Ser) ₅ -EGF with PS - chlorin e ₆ , 2 - chlorin e ₆ . Figure 3 presents a similar dependence for the conjugate 6His-HMP-NLS-Dtox- (Gly-Ser) ₅ -EGF with bacteriochlorin p ₆ when irradiated at a dose of 75 kJ / m ² with a combination of filters providing transmission in the range of 730-800 nM where 1 - conjugate 6His-HMP-NLS-Dtox- (Gly-Ser) ₅ -EGF with bacteriochlorin p ₆ , 2 - bacteriochlorin p ₆ .

Thus, testing of 6His-HMP-NLS-Dtox- (Gly-Ser) ₅ -EGF conjugates with PS chlorin e ₆ and bacteriochlorin p ₆ showed that covalent attachment of PS to the proposed MRI provides an increase in PS efficiency in A431 cell culture by 3 orders of magnitude . This is a good prerequisite for creating tools that can be used in the photodynamic therapy of malignant tumors.

Claims (2)

1. The recombinant plasmid pR752 expressing a modular recombinant photosensitizer delivery polypeptide, which has a size of 5269 bases, is characterized by the nucleotide sequence of SEQ ID No. 2 and contains the following regulatory regions and coding regions: an artificial bacterial operon containing the promoter region of the T5 bacteriophage and a nucleotide sequence encoding the multi-domain protein 6 His-HMP-NLS-DTox- (Gly-Ser) ₅ -EGF with SEQ ID No. 1; bacterial bla operon encoding beta-lactamase protein used as a selective marker; Col E1-type bacterial replication initiation site that provides plasmid replication in E. coli strains. 2. The strain Escherichia coli VKPM B-8356 is a producer of a modular recombinant polypeptide for photosensitizer delivery.

Images