RU2238974C2 - Dna fragment of mycelial fungus penicillium verruculosum encoding synthesis of secretable endoglucanase iii and group of penicillium canescens strains producing penicillium verruculosum endoglucanase iii constructed by methods of transformation and genetic engineering based on this dna fragment - Google Patents

Abstract

FIELD: microbiology, biotechnology, biochemistry, genetic engineering.

SUBSTANCE: DNA fragment of mycelial fungus Penicillium verruculosum encoding synthesis of secretable endoglucanase III has been incorporated to the composition of plasmids pPrEG and pXEG wherein structural part of gene endoglucanase III encoding mature protein is butt-joined with nucleotide sequence encoding beta-galactosidase signal peptide and promoter regions of genes beta-galactosidase and xylanase in Penicillium canescens, respectively. Based on these plasmids Penicillium canescens strains R201 and R201-151 have been obtained and these strains have been constructed by methods of transformation and genetic engineering and synthesizing Penicillium verruculosum endoglucanase III under control of Penicillium canescens beta-galactosidase gene promoter and Penicillium canescens strain R3020 synthesizing Penicillium verruculosum endoglucanase III under control of Penicillium canescens beta-galactosidase and xylanase genes promoters simultaneously. Invention provides enhancing productivity of synthesis of Penicillium verruculosum endoglucanase III.

EFFECT: enhanced synthesis of enzyme, valuable biological properties of DNA fragment and strains.

8 cl, 5 dwg, 11 ex

Description

The invention in the field of biotechnology relates to the creation of a new transformation system for the genetic engineering of mushroom producers of industrial enzymes. The invention relates to the microbiological and textile industries and includes: a) Penicillium canescens mycelium fungus as a host; b) a DNA fragment of the mycelial fungus Penicillium verruculosum encoding the synthesis of the secreted enzyme endoglucanase III; c) the promoter regions and signal peptides of the Penicillium canescens beta-galactosidase and xylanase genes used to realize the high regulatory transcriptional potential of these genes in the expression of the heterologous endoglucanase III gene Penicillium verruculosum in the host strain of Penicillium canescens strain and d) - group methods of transformation and genetic engineering based on this DNA fragment and synthesizing endoglucanase III Penicillium verruculosum in industrial quantities.

The natural producer of secreted acid beta-galactosidase mycelial fungus Penicillium canescens (VKPM F-178) secretes a group of proteins with enzymatic activity into the culture fluid during growth. Among the secreted enzymes that accumulate in the culture fluid during the deep fermentation of this fungus, beta-galactosidase and xylanase occupy about half of the total secreted protein (Nikolaev I.V. et al., 1992. Biochemistry, T. 57: 873-879).

The Penicillium canescens genome contains one copy of the secreted beta-galactosidase gene (Nikolaev I.V. et al. Molecular Biology. 1992, v. 26: 869-875). Beta-galactosidase and xylanase genes include a DNA nucleotide sequence encoding the structural part of a gene, a promoter (5'-untranslated region of DNA), which is the site of attachment and functioning of regulatory proteins and transcription mechanism proteins, a 3'-untranslated region of the terminator. The structural parts of the genes consist of a sequence encoding a leader peptide of 39 amino acids in beta-galactosidase and 25 amino acids in xylanase, and a sequence encoding a mature protein. The regulation of the activity of both beta-galactosidase and xylanase is carried out by inducing or repressing its synthesis at the transcriptional level. The inducing principle is the presence of arabinose in the medium. In industrial conditions, the source of arabinose is beet pulp, which is part of the industrial environment as the main carbohydrate component (Nikolaev IV, Vinetskiy Yu.P., 1998. Biochemistry, t.63: 1523-1528)

Penicillium canescens beta-galactosidase and xylanase gene promoters belong to a small group of strong fungal promoters that can be used in expression constructs for the synthesis of heterologous proteins. Under the control of the beta-galactosidase gene promoter under induction conditions, firefly luciferase was synthesized in Aspergillus nidulans fungal cells in traces and expression of the human interleukin-6 gene was found at the transcriptional level (Zakharova ES et al, 1992. Int. Conf. AIDS, cancer and human retroviruses, St. Petersburg, p. 36; Zakharova ES, 1994.2nh Europ.Conf.Fung. Genet., abstr.AS, Lunteren, The Netherlands).

Endo-β-1,4-glucanases (endo-β-1,4-glucan-D-glycosyl hydrolases, EC 3.2.1.4) or cellulases are enzymes with hydrolytic activity against polyglucans having β-1,4- glycosidic bonds, which include natural insoluble crystalline cellulose - for example, cotton and wood pulp; soluble cellulose derivatives — for example, carboxymethyl cellulose and methyl cellulose; β-glucans - for example, oat β-glucan and lichenin, as well as some other polysaccharides, for example - xylans (Sinitsyn A.P. et al. Bioconversion of lignocellulosic materials. M: Publishing House of Moscow University, 1995). By endo-β-1,4-glucanase activity is understood the ability of an enzyme to hydrolyze internal β-1,4-glucosidic bonds, removed from the ends of polymeric cellulose molecules to form cello-oligosaccharides (Sinitsyn A.P. et al. Bioconversion of lignocellulosic materials. M. : Publishing House of Moscow University, 1995). According to the homology of amino acid sequences, endoglucanases, as well as other cellulases and glycosyl hydrolases, are divided into more than 70 families (SWISS-POT Protein Sequence Data Bank, http://www.expasy.ch/cgi-bin/lists.glycosid).

Mushroom secreted endoglucanases are used in the textile industry, for example, to partially remove indigo from denim (to obtain so-called “boiled jeans”), to bi-polish cotton and prevent pilling (Gusakov AV et al, 2000. Appl. Biochem. Biotechnol. V .88: 119-126).

Endoglucanase III Penicillium verruculosum belongs to the 12th family of glycosyl hydrolases. The molecular weight of Penicillium verruculosum endoglucanase III is 24.213 kDa, pI = 5.4, pH optimum 3.5-4.5 (at 50 ° C), temperature optimum 45-55 ° C (at pH 4.0). The enzyme is represented by a single polypeptide chain of 222 amino acid residues, consists only of a catalytic domain and does not have a cellulose-binding domain.

Endoglucanase III Penicillium verruculosum has a specific activity with respect to carboxymethyl cellulose (CMCase activity) equal to 25 u / mg protein (CMCase activity was determined by the initial rate of formation of reducing sugars during hydrolysis of CMC at pH 4.5 and 50 ° C, reducing sugars were determined using the Nelson-Somody method, the method for determining CMCase activity is given in Sinitsyn A.P. et al. Bioconversion of lignocellulosic materials. M: Publishing House of Moscow University, 1995) and specific activity for β-glucan equal to 15 u / mg protein (β-glu Anase activity was determined by the initial rate of formation of reducing sugars during hydrolysis of oats β-glucan at pH 4.5 and 50 ° C, reducing sugars were determined using the Nelson-Shomody method, the method for determining β-glucan activity was described in A. Sinitsyn and other Bioconversion of lignocellulosic materials. M: Publishing house of Moscow University, 1995). Endoglucanase III Penicillium verruculosum is not active against microcrystalline cellulose, xylanau, p-nitrophenyl-β-D-glucoside and p-nitrophenyl-β-D-cellobioside.

Penicillium verruculosum cellulase complex has a high “textile” activity, suitable for preparing “boiled” denim and biofiling of cotton products, with endoglucanase III being the key enzyme Penicillium verruculosum for performing these “textile” functions and has an extremely high ability to produce “boiled” denim fabrics (and characterized by a low value of indigo resorption) and to the biopolishing of cotton products. The key role of endoglucanase III is explained by the features of the tunnel structure of its active center, the absence of a cellulose-binding domain, and the presence of a special cluster of hydrophobic amino acids exposed on the surface of its protein globule (Gusakov AV, et al, 2000. Enz. Microb. Technol. V.27 : 664-671).

The intrinsic endoglucanase activity of the Penicillium canescens VKPM F178 strain is very small, on the order of less than a unit of activity per 1 ml of culture fluid, which makes it possible to use this strain as a recipient for inclusion and expression of the endoglucanase III Penicillium verruculosum gene under the control of strong promoters of the beta-galactosidase and xylanase genes.

As the closest analogue of the claimed invention, a PCG 2.6 DNA fragment encoding the synthesis of beta-galactosidase Penicillium canescens and a strain of the production of beta-galactosidase Penicillium canescens F-725 constructed on its basis (RF Patent No. 2126049, RF Bulletin No. 4, dated 10.02) can be considered. .1999).

The task of the claimed group of inventions is to achieve high productivity of the synthesis of endoglucanase III Penicillium verruculosum in the recipient strain of Penicillium canescens under the control of the beta-galactosidase gene promoter, under the control of the xylanase gene promoter, and also under the control of the promoters of these genes at the same time.

To solve the problem, a pREG B-1 DNA fragment of 11.7 thousand nucleotide pairs (kbp) carrying the complete structural part of the endoglucanase III gene is obtained and an expression plasmid construct is created. To obtain this construct, a fragment with a nucleotide sequence encoding a mature protein and terminator of the endoglucanase III gene is isolated from the pREG B-1 DNA fragment, this fragment is connected with the DNA fragment of the beta-galactosidase gene Penicillium canescens, carrying the 5'-promoter region and the nucleotide sequence encoding beta-galactosidase leader peptide, a hybrid DNA fragment is obtained and the resulting construct is incorporated into a vector plasmid. Then, by cotransformation of the recipient strain of Penicillium canescens, a multicopy first generation strain is created. Then create a plasmid containing a marker gene for substitution, and by transforming the multicopy strain of the first generation include a marker gene in the natural site of beta-galactosidase, so that the resulting transformant no longer produces this enzyme. Then, by a series of genetic engineering manipulations, a second substitution plasmid is created, by which, when cotransformed due to homologous recombination in the promoter and terminator regions, the endoglucanase gene replaces the marker gene and increases the copy number in the first generation strain. As a result, multicopy strains of Penicillium canescens R201 and R201-151 of the second generation are created. As a final step in creating a new transformation system based on the regulatory elements of the fungal host Penicillium canescens, a series of third-generation strains is obtained by adding additional copies of the endoglucanase III gene to strain R201-151 under the control of the xylanase gene promoter. Among a series of third-generation strains, a strain is selected that is capable of accumulating 160-180 units / ml of endoglucanase Sh in the culture fluid in 96-120 hours of fermentation on a medium with beet pulp and peptone.

The construction of a family of strains included several stages:

Stage 1 - isolation of a DNA fragment of Penicillium verruculosum encoding a secreted endoglucanase gene with a full regulatory region and its inclusion as a part of a DNA fragment in the structure of a vector molecule.

Stage 2 - docking of the selected gene with the promoter region and the region encoding the leader peptide of the beta-galactosidase gene Penicillium canescens.

Obtaining expression plasmids pPrEG (figure 2).

Stage 3 - transformation of the recipient strain of Penicillium canescens PCA 10 (niaD ^- ) with the expression plasmid pPrEG with the endoglucanase gene included and selection of Penicillium canescens transformants secreting endoglucanase III Penicillium verruculosum. Selection of the most productive Penicillium canescens R201 strain of the first generation.

Stage 4 is the construction of the replacement plasmid pPrHPHTr, in which the structural part of the beta-galactosidase gene is replaced by the hygromycin resistance gene.

Stage 5 - transformation of the R201 strain with the pPrHPHTr replacement plasmid and selection of the Penicillium canescens R201-55 strain with the genotype (bgaS ^- - hph) that does not synthesize beta-galactosidase and is resistant to hygromycin under induction conditions.

Stage 6 - cell mutagenesis of the strain Penicillium canescens R201-55 (bgaS ^- , hph) and selection of the strain of the recipient R201-55-15 (bgaS ^- , hph, niaD ^- ).

Stage 7 - inclusion of additional copies of the endoglucanase gene in the natural site of the beta-galactosidase gene in the Penicillium canescens R201-55-15 genome instead of the hygromycin resistance gene during cotransformation using the pPrEGTr vector replacement plasmid.

Stage 8 - selection of the most productive strain of Penicillium canescens R201-151 (bgaS ^- , hph) of the second generation and its genotypic, phenotypic and physiological-biochemical analysis.

Stage 9 - matching the sequence encoding the leader peptide of the beta-galactosidase gene Penicillium canescens and the endoglucanase III gene Penicillium verruculosum with the promoter region of the xylanase gene Penicillium canescens.

Obtaining expression plasmids pXEG (figure 5).

Stage 10 - cell mutagenesis of the strain Penicillium canescens R201-151 and selection of the strain of the recipient R201-151 (bgaS ^- , niaD ^- ).

Stage 11 - the inclusion of additional copies of the endoglucanase gene in the recipient strain R201-151 (bgaS ^- -niaD ^- ) during cotransformation using the expression plasmid pXEG. Obtaining a strain of the third generation R3020.

Stage 12 - growing strains R201 and R201-151 and R3020 on a fermentation medium in flasks and scaling the fermentation process.

The obtained strains of Penicillium canescens R201, R201-151 and R3020 are characterized by the following cultural-morphological and physiological-biochemical characteristics:

1. Cultural and morphological characters on various nutrient media after 10 days of growth at 30 ° C:

a) Wort agar. The diameter of the colonies is 6.5-7.5 cm. The reverse side is orange-dark brown. Conidiophores 430-450 × 3.0-3.2 μm in size, conidia 2.0-2.2 μm, spherical, smooth at a young age, rough in the old, formed in chains, connected into columns, decaying over time.

b) Rolen-Thom agar medium with sucrose. The diameter of the colonies is 38-48 mm. The colonies are felt or slightly fluffy in the center, slightly convex, with radial grooves, white in color, painted on the edges in a gray-blue tone, the edges are uneven, lobed, the reverse side of a gray-beige tone.

c) Chapek agar medium with glucose. The diameter of the colonies is 2.8-4.0 cm. The colonies are gray, folded, with a smooth edge, conid formation is intense, the color of the conidia is light gray. The reverse side of colonies with radial folds of a weak cream tone.

According to the cultural and morphological characteristics listed above, there were no significant differences from the natural Penicillium canescens VKPM F-178 strain and from the recombinant Penicillium canescens VKPM F-725 strain, a beta-galactosidase producer.

2. Physiological and biochemical characteristics.

Mesophiles grow at 25-37 ° C, the optimum growth temperature is 29 ° C. The optimum growth at pH values of 4.1-5.8. Gelatin is diluted slightly. Relation to carbon sources. Mono-, di- and polysaccharides are well absorbed, with the exception of arabinose, which is poorly utilized. Ammonium and nitrate nitrogen, peptone, urea are well absorbed. During growth on a medium containing peptone, beet pulp and potassium phosphate, the activity of secreted beta-galactosidase in the Penicillium canescens R201 strain is three times less than in the initial F-178 strain and is about 20 units / ml, and the activity of the Penicillium canescens R201 strain -151 is 20 times smaller and at the same time fermentation is not more than 1 unit / ml. Protease activity is expressed to a small extent.

As a result of the inclusion of the Penicillium verruculosum endoglucanase gene in the inventive Penicillium canescens R201 strain, the endoglucanase activity under optimal fermentation conditions is 120 units / ml of culture fluid, in the R201-151 and R3020 strain the endoglucanase activity under the same conditions was 160 units / ml and 180 units ./ml respectively. The proportion of endoglucanase was 40-60% of the total secreted protein.

The invention is illustrated by the following examples.

Example 1. Obtaining a DNA fragment of Penicillium verruculosum encoding the synthesis of endoglucanase III.

To obtain a genomic bank of DNA, this strain is treated with Sau3A restriction enzyme under conditions of incomplete cleavage, fractionated by centrifugation in a sucrose density gradient, isolating DNA fragments 10-20 kb in size, and included by ligation of the phage vector λGM12 in DNA. Next, a packaging mixture is prepared (phage head proteins and lambda phage tail proteins separately), packaging is carried out at optimal ratios of the components of the mixture, and the resulting phage particles with recombinant DNA are plated on Petri dishes with nutrient medium and indicator bacteria (T. Maniatis, E. Fritsch, J. Sambrook, Molecular Cloning (Moscow: Mir, 1984). The resulting negative colonies (independent clones) in an amount of 6 × 10 ⁴ together represent a penicillin gene bank. Then, a phage clone carrying a DNA fragment with an endoglucanase gene with a promoter region carrying all signal sequences for regulating its synthesis is isolated from this gene bank.

To solve this problem, after studying the homology of the amino acid and nucleotide sequences of endoglucanases of fungi of the family of 12 glucosyl hydrolases, two oligonucleotide primers are synthesized:

(1) CC (G / C) GTGAAIGGCTC (G / A) GTICC (A / G) AATTG

(2) GGIGACTA (T / C) GA (A / G) CT (T / C) ATGATITGG, where I is inosine.

Then, using the PCR (polymerase chain reaction), an internal DNA fragment of the endoglucanase gene of 0.4 kbp is synthesized. This fragment is cloned into a Bluescript SK plasmid vector and a partial nucleotide sequence is determined. A PCR DNA fragment is used to select a phage clone with the endoglucanase gene. For this task, molecular hybridization is carried out on nylon filters with a P ³² -labeled PCR fragment. Among the 30 phage clones that detected a positive signal with a radioactive probe, a clone was isolated with two XhoI and PstI subfragments with the endoglucanase gene in the cloned fragment. These fragments are subcloned into the Bluescript SK ⁺ plasmid vector. Next, the nucleotide sequence of the Penicillium verruculosum endoglucanase III gene is determined on both DNA strands by the Sanger method (FIG. 1). The coding region of the endoglucanase gene had an open reading frame of 711 bp, in which there were two 56 bp introns. and 66 bp respectively. The position of the introns and the sequence of their 5 'and 3' boundaries are conservative for the gene structure of other fungal endoglucanases. The calculated sequence of amino acids in the protein coincided with the sequence of amino acids in the peptides of the mature protein, determined by direct sequencing of the peptides.

Example 2. Obtaining a plasmid construct pPrEG for expression and secretion of the endoglucanase III gene of Penicillium verruculosum in Penicillium canescens cells.

To introduce the AraI restriction site immediately after the sequence encoding the leader peptide of the endoglucanase III gene, a PCR fragment encoding the structural part of the endoglucanase III Penicillium verruculosum is carried out. For this, primers are used:

EG3ApaI primer:

5` <sup>-</sup> GTT-GCC-GCG-TGG-GCC-CAA-CAA-CAG-AG - 3`

M13 / pUC reverse sequencing primer:

5` - GAG-CGG-ATA-ACA-ATT-TCA-CAC-AGC - 3`

The PCR product digested with the restriction enzymes AraI and SalI is cloned into the pEG5 plasmid containing the part of the egl gene (endiclucanase III gene Penicillium verruculosum) digested with the same restriction enzymes (plasmid pEGApa is obtained).

For subsequent EcoRV-BglII manipulations, a 3.1 kb fragment of plasmid pPr2.6 containing the promoter of the bgaS gene (secreted beta-galactosidase gene Penicillium canescens) and the 5`-translated region of the bgaS gene are cloned into the pIC20R plasmid vector, digested with restriction enzymes BglII and SmaI (plasmid pPrBg-V is obtained).

A 2.0 kb KpnI-ApaI fragment of the pPrBg-V plasmid containing the bgaS gene promoter and the sequence encoding the leader peptide of secreted beta-galactosidase Penicillium canescens is ligated into the pEGApa plasmid digested with the same restriction enzymes to obtain the plasmid pPrEG .

Example 3. Cotransformation of Penicillium canescens PCA10 (niaD) strain with plasmids pSTA-10 and pPrEG and selection of Penicillium canescens R201 strain, producer of endoglucanase III Penicillium verruculosum.

The recipient strain Penicillium canescens PCA10 (niaD ^- ) (Aleksenko AY et al, 1995. Curr Genet. 28: 474-477) was grown for 16 h at 30 ° C in complete growth medium with NH ₄ Cl as a nitrogen source, transferred mycelium in a solution of 1.2 M MgSO ₄ and 10 mM NaH ₂ PO ₄ , pH 5.8, and the Trichoderma harzianum lysing enzyme is added to a concentration of 5 mg / ml. Protoplasting is carried out for 2 hours at 30 ° C under stirring conditions. The suspension is transferred to a centrifuge tube and 1-2 cm of a solution of 0.6 M sorbitol, 10 mM CaCl, 10 mM Tris-HCl are layered. After centrifugation at 3000 rpm./min, 4 ° C for 10 min, an interphase that contains protoplasts is selected. Protoplasts are washed 2 times in a stabilizing solution containing 1.2 M sorbitol, 10 mM Tris, pH 7.5, 10 mM CaCl ₂ and resuspended therein to a concentration of 10 ⁸ protoplasts / ml. The transformation is carried out as follows: 1 μg of pSTA-10 plasmid DNA containing Aspergillus niger reductase gene and 10 μg of pPrEG plasmid DNA with the Penicillium verruculosum endoglucanase gene are added to 200 μl of protoplast suspension, incubated in an ice bath 20 min after whereupon osmotic shock is carried out for 5 min in 50% polyethylene glycol in the presence of 10 mM CaCl, 10 mM Tris-HCl and the protoplasts in the upper layer are plated on an agarized minimal medium containing 1.2 M sorbitol, 10 mM NaNO ₃ . Transformants are checked by fermentation, as described in example 9.

Example 4. Construction of replacement plasmids pPrHPHTr and pPrEGTr. Substitution plasmid pPrHPHTr (Fig. 3).

To introduce the HindIII restriction site immediately after the ATG codon of the hph gene of Escherichia coli resistance to hygromycin B, PCR of the fragment encoding the structural part of the hph gene and the Aspergillus nidulans trpC gene terminator is performed. The expression vector PAN7-1 containing the hph gene under the control of the Aspergillus nidulans gpdA gene promoter and the trpC gene terminator are used as a matrix. For this, primers are used:

HYG-I primer:

5` - CATCACCAAGCTTGAACTCACCGC - 3`

pUC / m13 reverse primer:

5`- CAGGAAACAGCTATGAC - 3`

The PCR fragment was cloned into the pBluescript KS ⁺ vector cut at the SmaI restriction site (plasmid pHRH was obtained).

To remove the second HindIII restriction site of the pHRH plasmid, the HindIII-SphI fragment of the 1.9 kb pHRH plasmid containing the hph gene and the A. nidulans trpC gene terminator was cloned into the pIC20R vector, which was restricted with the same endonucleases (plasmid pICH was obtained -HS).

XhoI-HindIII 193 bp fragment the bgaS gene promoter with the ATG codon from pPr2.6 plasmid is ligated into the pICH-HS plasmid, keeping the reading frame of the hph gene (receive plasmid pICH-XS).

The remaining BglII-XhoI part of the bgaS promoter from plasmid pPr2.6 is inserted into plasmid pICH-XS, which is restricted with the same endonucleases (plasmid pPrHPH is obtained).

BglII-BglII fragment of the 3'-region of the bgaS gene 2.5 kbp from the plasmid pBG12 containing the bgaS gene with the truncated promoter, subcloned into the plasmid pPrHPH at the BamHI restriction site (plasmid pPrHPHTr is obtained).

Substitution plasmid pPrEGTr (Figure 4). BglII-BglII fragment of the 3 ′ region of the bgaS gene 2.5 kbp from plasmid pCG12 subcloned into plasmid pPrEG at the SmaI restriction site (plasmid pPrEGTr is obtained). For this, the sticky ends of the BglII-BglII fragment are preliminarily completed using the Klenov fragment of DNA polymerase I, and the blunt ends of the restricted plasmid pPrEG are dephosphorylated using alkaline phosphatase.

Example 5. Transformation of the Penicillium canescens R201 strain with a pPrHPHT-replacement plasmid and selection of the Penicillium canescens R201-55 strain not synthesizing beta-galactosidase due to the replacement of the structural part of the beta-galactosidase gene with a marker gene for hygromycin resistance.

The strain Penicillium canescens R201 is grown for 16 hours at 30 ° C in a complete nutrient medium with NaNO ₃ as a nitrogen source, and then the protoplastic procedure is carried out according to the procedure described in example 3.

The transformation is carried out by adding to the 200 μl protoplast suspension 10 μg of the DNA of the plasmid pPrHPHTr carrying the hygromycin resistance gene under the control of the beta-galactosidase gene promoter as a selective marker. Next, an osmotic shock is carried out for 5 minutes in 50% polyethylene glycol in the presence of 10 mM CaCl and 10 mM Tris-HCl pH 7.5. Next, protoplasts are plated in a liquid layer on an agarized minimal medium containing 720 mM KCl, 50 mM fructose, 1 mM arabinose, 10 mM NaNO ₃ and hygromycin (0.8 mg / ml). Transformants are tested for the ability to synthesize secreted beta-galactosidase.

The strains not synthesizing beta-galactosidase are selected and these strains are tested for the productivity of the synthesis of endoglucanase III Penicillium verruculosum.

A strain is selected with the best endoglucanase synthesis and the lowest residual beta-galactosidase activity of Penicillium canescens R201 -55.

Example 6. Mutagenesis of cells of the strain Pemcillium canescens R20l (bgaS ^- , hph) and selection of the recipient strain R201-55-15 (bgaS ^- , hph, niaD ^- ).

Conidia of Penicillium canescens R201 strain are treated with nitrosoguanidine (0.4 mg / ml) and plated on plates with nutrient medium containing chlorate (0.45 M). The plates are incubated for 4-5 days at 30 ° C and the grown colonies are tested on plates with additives as the sole source of nitrogen: a) 10 mM NaNO ₃ ; b) chlorate (0.45M); c) hypoxanthine (5 mM); g) - NH ₄ Cl. Colonies capable of growth on plates with chlorate and hypoxanthine and incapable of growth on plates with NaNO _{3 were} selected. The selected strains are grown on a nutrient medium with peptone and beet pulp and select the recipient strain R201-55-15 with endoglucanase productivity not lower than the original strain Penicillium canescens R201-55.

Example 7. The inclusion of additional copies of the endoglucanase gene in the natural site of the beta-galactosidase gene in the genome of Penicillium canescens R201-55-15 during transformation using the vector replacement plasmid pPrEGTr.

The recipient strain Penicillium canescens R201-55-15 (bgaS ^- hph, niaD ^- ) is co-transformed with plasmids pSTA-10 and pPrEGTr according to the procedure described in example 3. 180 cotransformants are selected and 21 strains are selected that lose their resistance to hygromycin due to gene replacement hygromycin with additional copies of the endoglucanase gene. All selected strains are fermented on a nutrient medium with beet pulp and peptone. A strain of Penicillium canescens R201-151 with an activity of endoglucanase exceeding the activity of a strain of Penicillium canescens R201 is selected.

Example 8. Construction of the plasmid pXEG.

To introduce the HindIII restriction site immediately after the ATG codon of the xylA gene of Penicillium canescens xylanase, PCR of the fragment containing the xylA gene promoter is performed. As the matrix, the plasmid pPCXYLA containing the complete xylA gene is used. For this, primers are used:

XYLH primer:

5` - CAGTCTTGAGAAGCTTCATGATTGTGAATGTG - 3`

pUC / m13 sequence primer:

5` -GCCAGGGTTTTCCCAGTCACGA - 3`

A 2 kb PCR fragment cut at the KpnI and HindIII restriction sites containing the xylA gene promoter and ATG codon is cloned into the pPrEG plasmid cut with the same restriction enzymes instead of the bgaS gene promoter (pXEG plasmid is obtained).

Example 9. Mutagenesis of cells of the Penicillium canescens strain R201-151 and selection of the recipient strain R201-151 (niaD ^- ).

Conidia of Penicillium canescens R201 strain are treated with nitrosoguanidine (0.4 mg / ml) and plated on plates with nutrient medium containing chlorate (0.45 M). Cups are incubated and mutants are selected, as in Example 6. The selected strains are grown on a nutrient medium with peptone and beet pulp and select the recipient strain R201-151 (niaD ^- ) with endoglucanase productivity not lower than the original Penicillium canescens R201-151 strain.

Example 10. The inclusion of additional copies of the endoglucanase gene under the control of the xylanase gene promoter in the Penicillium canescens R201-151 (niaD ^- ) gene during transformation using plasmid pXEG.

Penicillium canescens R201-151 (niaD ^- ) recipient strain is co-transformed with pSTA-10 and pXEG plasmids according to the procedure described in Example 3. 130 cotransformants are selected and among them, the Penicillium canescens R3020 strain with an endoglucanase activity exceeding the activity of canillium Rensen cancens R1011 Penic more than Pen1 .

Example 11. The cultivation of strains of Penicillium canescens R201, R201-151 and R3020 on a fermentation medium in flasks.

To obtain seed, the culture of the strain Penicillium canescens R201, R201-151 go R3020 is grown on an agarized minimal medium at 30 ° C for 5-7 days. An aqueous suspension of conidia (10 ⁷ conidia / ml) was inoculated with 100 ml of medium (beet pulp - 30 g / l; peptone - 50 g / l; KH ₂ PO ₄ - 25 g / l, pH 4.5) and incubated in a rocking flask at 30 ° C for 120 hours on a circular rocking chair at 240 rpm. At the end of the fermentation, the culture fluid is separated from the mycelium and solid media by centrifugation (5000 g, 15 min) and the activities of endoglucanase III and beta-galactosidase are determined in the supernatant.

Determination of endoglucanase activity:

A solution of a chromogenic substrate, a 1% solution of OS-41 (KMS stained with an orange dye) in 0.1 M Na-acetate buffer pH 4.5 is mixed with a diluted enzyme, incubated for 10 min at 40 ° C and the reaction is stopped by adding 1 M CaCl ₂ in 80% ethanol. The mixture is centrifuged and the enzyme activity is determined by the optical density of the supernant at 490 nm. The activity of endoglucanase is quantitatively calculated according to the manual (A.P. Sinitsin et al. Bioconversion of lignocellulosic materials. M: Publishing House of Moscow University, 1995).

Determination of beta-galactosidase activity.

The reaction mixture containing 3 mg of o-nitrophenyl-β-galactopyranoside (ONPH) in 1.9 ml, 50 mM Na-acetate buffer pH 4.5 and 100 μl of the appropriate dilution culture liquid is incubated for 15 minutes at 30 ° C, then 1 ml of 1 M Na ₂ CO ₃ and measure the optical density of the solution at 420 nm. The unit of beta-galactosidase activity is taken as the amount of the enzyme that releases 1 μmol of o-nitrophenol from ONPH substrate in 1 min under these reaction conditions.

After 96 hours of fermentation, the Penicillium canescens R201 strain accumulates 120 units / ml of endoglucanase activity and 20 units / ml of beta-galactosidase activity in the culture fluid. The Penicillium canescens strain R201-151 under the same conditions produced 160-170 units / ml and 0.8-1.0 units / ml of activity, and strain R3020 produced 180-190 and less than 1 unit / ml of activity, respectively.

Claims (7)

1. A DNA fragment of the mycelial fungus Penicillium verruculosum encoding the synthesis of secreted endoglucanase III shown in FIG. 1. 2. The pPrEG inclusion plasmid, in which the structural part of the Penicillium verruculosum endoglucanase III gene encoding a mature protein, is linked to the nucleotide sequence encoding the beta-galactosidase signal peptide and the promoter region of the Penicillium canescens β-galactosidase gene. 3. The pXEG inclusion plasmid, in which the structural part of the Penicillium verruculosum endoglucanase III gene encoding the mature protein, is linked to the nucleotide sequence encoding the beta-galactosidase signal peptide and the promoter region of the Penicillium canescens xylanase gene. 4. The replacement plasmid pPrEGTr, in which the Penicillium canescens hygromycin resistance gene is docked at the 5 ′ end with the promoter region of the beta-galactosidase gene and at the 3 ′ end with the terminator of the Penicillium canescens beta-galactosidase gene. 5. The strain Penicillium canescens R201 (VKM F-3795D), designed by transformation and genetic engineering, synthesizing endoglucanase III Penicillium verruculosum under the control of the promoter of the beta-galactosidase gene Penicillium canescens. 6. The strain Penicillium canescens R201-151 (VKM F-3794D), designed by transformation and genetic engineering, synthesizing endoglucanase III Penicillium verruculosum under the control of the promoter of the beta-galactosidase gene Penicillium canescens. 7. The strain Penicillium canescens R3020 (VKM F-3796D), designed by transformation and genetic engineering, synthesizing endoglucanase III Penicillium verruculosum under the control of beta-galactosidase and xylanase gene promoters Penicillium canescens.

Images