RU2054041C1 - RECOMBINANT PLASMID DNA PIF16 ENCODING THE MATURE HUMAN LEUCOCYTE α-INTERFERON, THE STRAIN OF ESCHERICHIA COLI - A PRODUCER OF THE MATURE HUMAN LEUCOCYTE a-INTERFERON - Google Patents

Abstract

FIELD: biotechnology. SUBSTANCE: new recombinant plasmid pIF16 has the tandem of two interferon genes between of which the synthetic cistron orf-69 consisting of 69 nucleotide residues is incorporated. This cistron encodes the constitutive synthesis of polypeptide showing properties of human leucocyte interferon. The strain of E. coli SG 20050/pIF 16 provides the expression level of a U/ml cell suspension at cell density a cells/ml that is about 200-300 mg per 1 l cell suspension. Strain is deposited in All-Union Collection of industrial microorganisms at number ВКПМ B-5809. EFFECT: new recombinant plasmid indicated above. 3 cl, 3 dwg, 2 tbl

Description

The invention relates to biotechnology, in particular to genetic engineering, and is the construction of in vitro recombinant plasmid DNA containing synthetic genes of human leukocyte interferon α2, tandem mutant promoters (P _tgr x2) of tryptophan operon E. coli and synthetic translation initiation sites that determine effective translation biosynthesis of a polypeptide with the biological activity of human interferon α2, as well as the Escherichia coli strain producing this polypeptide.

 Interferon protein with a molecular weight of about 18,000 Da, produced in the human body by activated leukocytes, has a pronounced antiviral activity against a number of DNA and RNA viruses. Clinical studies of natural leukocyte interferon and a number of recombinant interferons have been conducted. The high efficiency of leukocyte interferon has been shown for a number of viral infections (viral hepatitis, influenza virus as a prophylactic, herpes virus, etc.), as well as for certain types of tumor diseases (hairy cell leukemia, etc.). It was also shown that the use of leukocyte interferon in combination with other lymphokines, such as immune interferon, interleukins-1 and -2, human tumor necrosis factors, and others is very promising.

 A known method of producing human leukocyte interferon, based on the use of leukocytes of donor blood, which upon induction by viruses or appropriate inducers (dissipol, double-stranded RNA, etc.) secrete interferon into the extracellular medium.

 The disadvantage of this method is the extremely low yield of the target product, the difficulties of large-scale induction of leukocytes of donated blood and, as a consequence, the high cost of interferon preparations. In addition, the aforementioned method for producing interferon does not guarantee the production of preparations free from contamination with viruses (such as hepatitis B virus, human immunodeficiency viruses, etc.). Therefore, the method of leukocyte interferon microbiological synthesis is much more promising, which makes it possible to obtain the target product with a significantly higher yield from a relatively inexpensive starting material. Using this chemical approach allows you to create optimal variants of the structural gene for bacterial expression, as well as regulatory elements that control its expression.

Recombinant plasmids pLeIF (plac) and pLeIF-B1 are known that contain a fully synthetic gene encoding a polypeptide with the properties of human leukocyte interferon α2 and expressed under the control of the E. coli lactose operon and A1 promoter of the early region of T7 phage. E.coli BMN 7118 cells containing plasmid pLeIF (plac) upon induction with isopropylthio-β-D-galactopyranoside (IPTG) or E. coli BMN 7118 cells containing plasmid pLeIF-B1 provided an interferon biosynthesis level of about 10 ⁸ units. act./l bacterial culture at a density of 2.5 OD ₅₅₀ , which corresponds to the production of interferon (IFN-α2) 0.5 mg / l.

A recombinant plasmid p280 / 2IFN is known that encodes a polypeptide with the properties of human interferon α2, in which the tandem of two synthetic IFN-α2 genes is expressed under the control of the tandem of two promoters of the E. coli tryptophan operon and E. coli strain SG 20050 with this plasmid. When E. coli cells of E. coli strain SG 20050 are grown with plasmid p280 / 2IFN on minimal medium with a low tryptophan content or when cell culture is induced using indolyl acrylic acid, a high level of expression of IFN-α2 genes is achieved (25-40 mg of recombinant protein per 1 l of cell suspension at a culture density of 10 ⁹ cells / ml).

 According to the design principle, technical nature and the achieved result, the recombinant plasmid p280 / 2IFN and strain E. coli SG 20050 with this plasmid are the closest to the claimed technical solution and are selected as a prototype.

 However, a significant drawback of the p280 / 2IFN plasmid is the need for a non-technological and expensive stage of biosynthesis induction in the preparation of interferon, since the expression of IFN-α2 genes in this construct is inducible. In addition, the polycistronic mRNA, the translation of which ensures the synthesis of interferon, in the region of the interferon gene junction has closely spaced terminating and initiating signals, which leads to a decrease in the level of synthesis of the target product as a result of negative interference between the terminating and initiating ribosomes.

 The aim of the invention is to increase the level of biosynthesis of intefreron and simplify the process of its preparation.

The goal is achieved using the new recombinant plasmid pIF16 containing the tandem of two interferon genes and encoding constitutive synthesis of the polypeptide with the properties of human leukocyte interferon, and the strain E.coli SG20050 / pIF16, which provides the expression level of IFN-α2 3-5 · 10 ⁷ units / ml cell suspension at a cell density of 10 ⁹ cells / ml, which is about 200-300 mg in one liter of such a cell suspension.

The recombinant plasmid pIF16 DNA encoding a polypeptide with the properties of human interferon is characterized by the following features:
encodes the amino acid sequence of mature human leukocyte interferon α2,
has a molecular weight of 2.84 MD (4.311 kb),
comprises:
EcoRI of the pmDS280 plasmid DNA fragment (3.170 kbp).

two EcoRI / PstI fragments of plasmid pIF6 / 8 containing a fragment of the synthetic gene of human leukocyte interferon without 7 C-terminal triplets (513 bp);
synthetic deoxyoligonucleotide duplex
ATSTSTGCGTTCTAAAGAATAAGGATT (I)
ACGTTAGAGACGCAAGATTTCTTATTCCTAATTAA (II)
synthetic cistron orf ATCTCTGCGTTCTAAAGAATAAGGATT AATTCGATGACATATGGCGGCCTTCCTCCGTCGTATTCGCCCTAAACTGAAGTAAGGATC having 5'- and 3'-sticky ends for restriction endonucleases PstI and EcoRI, respectively) (88;
contains:
as a genetic marker, the β-lactamase gene, which determines the resistance of penicillin antibiotics to E. coli transformed with plasmid pIF16,
tandem of mutant promoters of the tryptophan operon of E. coli.

phage λ transcription terminator;
unique restriction endonuclease recognition sites located to the right of the EcoRI site (279 nucleotides): NcoI 1716 nucleotides; PstI 3564 nucleotides.

 The recombinant plasmid pIF16 contains a tandem of synthetic interferon genes, expression of which occurs by translation of the polycistronic messenger RNA, in which the termination codon of the precursor cistron TAA is part of the Shine Dalgarno TAAGGA sequence in the site of translation initiation of the distal cistron. To reduce the interference between the inducing and terminating ribosomes between the two interferon genes, the synthetic orf cistron is inserted with a length of 89 nucleotide residues. Such organization of polycistronic mRNA leads to a decrease in negative interference in conjugated cistron translation, which, in turn, makes ribosome protein biosynthesis more efficient.

Figure 1 and 2 shows the design scheme and physical map of recombinant plasmid DNA pIF16. To this end, first in the pmDS280 plasmid (this plasmid is a derivative of the known plasmid pDS280, but contains mutations in the region of P _trp promoters that ensure independent tryptophan operon induction transcription), an EcoRi PstI DNA fragment of plasmid pIF6 / 8 containing the synthetic gene is inserted into the EcoRI site interferon without 7 C-terminal triplets, in the presence of synthetic duplex
ATCTCTGCGTTCTAAAGAATAAGGATT (I)
ACGTTAGAGACGCAAGATTTCTTATTCCTAATTAA (II)
which restores the integrity of the interferon gene and leads to the loss of PstI and one of the EcoRI sites. The thus obtained plasmid pm280 / IFN is hydrolyzed with restriction endonuclease EcoRI and the linearized plasmid DNA is ligated with the same fragment and synthetic cistron orf (the structure of the upper DNA chain is shown) respectively. After selection of the necessary variants, the target plasmid pIF16 is obtained, the structure of which is confirmed by analysis of restriction endonucleases HaeIII and MspI, as well as by determining the nucleotide sequence of the translation initiation regions and the N-terminal part of the IFN-α2 gene (see Figs. 2 and 8).

 To obtain a producer strain of a polypeptide with the biological activity of human leukocyte interferon, plasmid pIF16 transform competent E. coli SG20050 cells.

 Thus obtained E. coli strain SG20050 / pIF16 is characterized by the following features.

 Morphological signs. Small cells of a thickened rod-shaped, gram-negative, non-spore-bearing.

 Cultural signs. Cells grow well on simple nutrient media. When growing on Difco agar, the colonies are round, smooth, pressed, cloudy, shiny, gray, the edge is even. The growth in liquid media (on a minimal medium with glucose or LB broth) forms an intense even haze.

Physico-biological signs. The cells grow at 4-40 ^C. under optimum pH of 6.8-7.0. As a source of nitrogen, both mineral salts in ammonium form and organic compounds in the form of peptone, tryptone, yeast extract, amino acids, etc. are used. Amino acids, glycerin, carbohydrates are used as a carbon source.

 Antibiotic resistance. Cells are resistant to ampicillin (up to 300 μg / ml) due to the presence of a plasmid, as well as to tetracycline (up to 50 μg / ml) due to the presence of transposon.

Significant differences between the strain E. coli SG20050 / pIF16 is that it determines the constitutive synthesis of a polypeptide with the properties of human interferon α2 with an expression level of 3-5 · 10 ⁷ IU / ml of cell suspension, which is more than 50% of the total bacterial cell protein and exceeds known strains of E. coli. These differences are given in table 1.

 The resulting strain was deposited in the All-Union Collection of Industrial Microorganisms at the All-Russian Research Institute of Genetics.

 In FIG. 1 shows schemes for obtaining plasmids pm280 / IFN and pIF16; figure 2 physical map of the recombinant plasmid pIF16; figure 3 the primary structure of the plasmid pIF16 in the area of insertion of the tandem of artificial IFN-α2 genes and the amino acid sequences encoded by them. Nucleotide substitutions in the structural parts of IFN-α2 genes that distinguish them from natural and synthetic analogues are emphasized. The N-terminal sequence of the polypeptide isolated from E. coli strain SG20050 / pIF16, and the asterisks at the top are the N-terminal amino acids identified in the products of its bromine cleavage. The amino acid bottom points identified by hydrolysis of carboxypeptidases A + B and P.

 PRI me R 1. Chemical synthesis of oligonucleotides.

, размер частиц 40-80 мкм), к которому через 3-сукцинатную связь присоединяют первое нуклеозидное звено (нагрузка 20-30 мкмоль/г). Используют известный синтетический цикл, но после реакции конденсации проводят промывку смолы смесью тетрагидрофуранпиридин-вода (5:3:2). После окончания синтеза защитные группы удаляли последовательной обработкой тиофенолятом триэтиламмония и конц. аммиаком. При этом происходит отделение олигонуклеотида от носителя, 5'-диметокситритильную группу удаляют кислотной обработкой, и олигонуклеотид очищают электрофорезом в 20% ПААГ, содержащем 7М мочевину. выход 1-5 о.е.The oligonucleotides are synthesized using the solid-state phosphoramidite method on a System 1 DNA synthesizer (Beckman) with the oligonucleotide chain being extended in the direction from the 3'-scotch and the 5'-end using protected phosphamitides 5-dimethoxytrityl-N-acyl-2-deoxynucleoside -3-O- (methoxydiisopropylamino) -phosphites activated with tetrazole. The synthesis is carried out on a scale of 05, -0.7 μmol, using porous glass as a carrier (pore size 500

, particle size 40-80 μm), to which the first nucleoside unit (load 20-30 μmol / g) is attached via a 3-succinate bond. A known synthetic cycle is used, but after the condensation reaction, the resin is washed with a mixture of tetrahydrofuranpyridine-water (5: 3: 2). After completion of the synthesis, the protective groups were removed by sequential treatment with triethylammonium thiophenolate and conc. ammonia. In this case, the oligonucleotide is separated from the carrier, the 5'-dimethoxytrityl group is removed by acid treatment, and the oligonucleotide is purified by electrophoresis in 20% PAG containing 7M urea. yield 1-5 p.u.

 PRI me R 2. Construction of recombinant plasmid DNA pIF16.

Bacteria E.coli C600 cells containing plasmid DNA pmDS280, greater than at ³⁷ ° C in LB-broth containing 100 ug / ml ampicillin to stationary phase. Then plasmid DNA is isolated in accordance with a known procedure.

Similarly, pIF6 / 8 plasmid DNA containing the synthetic α2 interferon gene is isolated. The resulting plasmid DNA preparations were used to construct the pm280IFN plasmid. For this purpose, 10 μg of pmDS280 and pIF6 / 8 plasmid DNA are incubated with EcoRI restriction endonuclease (10 units) and EcoRI and PstI restriction endonuclease mixture (10 units each) in 30 μl of R buffer containing 20 mm Tris-HCl, pH 7, respectively , 5, 50 mM NaCl, 10 mM MgCl _2), 7 mM mercaptoethanol, for 1 h at 37 ^C. After incubation the reaction is stopped by two fold extraction with phenol-chloroform (1: 1) and the DNA precipitated with 70% ethanol. The analysis of the completeness of hydrolysis and the isolation of the vector EcoRI fragment by pmDS280 plasmid DNA (3.168 kbp) and EcoRI / PstI fragment by pIF6 / 8 DNA plasmid (about 0.54 kbp) was performed using electrophoresis in 1 % gel fusible agarose. Next, the fragment (0.2 μg) is combined in the presence of a duplex:
AGAATCTCTGCGTTCTAAAGAATAAGGATT (I)
ACGTTCTTAGAGACGCAAGATTTCTTATTCCTAATTAA (II)
with vector DNA (1.5 μg) using 30 units. T4 DNA ligase in 50 l buffer L for 6 hours at 15 ° ^C. One tenth of the reaction mixture was used to transform competent E.coli C600 cells. Transfomanty plated on agar medium containing ampicillin (100 ug / ml) and the thus obtained single colonies grown at ³⁷ ° C in LB-broth containing 100 ug / ml ampicillin to stationary phase. Then plasmid DNA was isolated in accordance with a known procedure and analyzed using restriction endonucleases HaeIII and EcoRI. Plasmid DNA is isolated from clones containing the inserted fragment, the structure of which is confirmed by direct determination of the nucleotide sequence of DNA in the insertion region using the modified Maxam-Gilbert method. The pm280IFN plasmid obtained in this way is used to obtain the target plasmid pIF16.

To a solution of 10 ug of plasmid DNA pm280IFN in 80 ul buffer was added R 10 units EcoRI restriction nuclease and incubated 90 min at 37 ° ^C. Analysis of the completeness of hydrolysis and isolation of vector fragment (about 3.7 kbp) carried by electrophoresis in a 1% gel of low-melting agarose and 0.5 μg of the isolated vector, they are ligated with 02, μg of the fragment and synthetic duplex used in the previous crosslinking to obtain plasmid pm280IFN, under the conditions described above. 15 μl of this ligase mixture is used to transform competent E. coli C600 cells. Transformants are plated on LB agar containing 100 μg / ml ampicillin. DNA is isolated from 10 ampicillin-resistant clones and analyzed by restriction analysis using restriction enzymes HaeIII and XhoI. From the analyzed 5 DNA preparations, the desired set of restriction fragments was shown. Finally, the structure of recombinant pIF16 DNA is confirmed by determining the nucleotide sequence in the region where the tandem of the synthetic interferon genes is located. The physical map of the plasmid pIF16 and the nucleotide sequence of the tandem of the artificial interferon genes are shown in FIGS. 2 and 3, respectively.

 PRI me R 3. Obtaining a producer strain of a polypeptide with the properties of human leukocyte interferon α2.

 Plasmid pIF16 transform competent E. coli SG20050 cells and obtain a producer strain of the polypeptide with the properties of human leukocyte interferon.

 PRI me R 4. Determination of the productivity of a strain of E. coli producer of a polypeptide with the properties of human leukocyte interferon.

Cells E.coli SG20050 / pIF16 grown at 37 ^{° C} in 20 ml LB-broth for 20 hours with a rotary shaker at a speed of 120 rev / min, 2 ml sample is taken and the cells were centrifuged for 10 minutes at 10,000 rev / min. The content of recombinant interferon α2 is determined in three different ways.

 I. Radioimmunoassay.

The cell pellet was dissolved in 200 μl of a solution of 8 M urea in 0.1 M phosphate buffer (pH 7.0) containing 20 μg / ml p-methylsulfonyl fluoride. Before entering the wells, the samples were centrifuged for 2 minutes at 12,000 rpm. First, 50 μl of a solution of rabbit antibodies (0.2 μg / ml) against interferon α2 (VNIIOCHB of the USSR Ministry of Health, Leningrad) in buffer A containing 0.02 M sodium phosphate, pH 7.5, 0.15 M NaCl, 1 mM EDTA and 0.1% BSA, and incubated for 1 h at 20 ^C. The solution was then removed from the wells by aspiration, is added 200 .mu.l of 0.4% solution of bovine serum albumin in buffer a (buffer B) and incubated 1 h at 20 ^C. The wells were washed thoroughly with buffer A, and then introduced investigated calibration samples and incubated 18 hours at 4 ° ^C. After three times indu ki 200 ul buffer B solution was introduced into the wells ¹²⁵ J-labeled monoclonal antibodies NK-2 (CellTech, USA) in a buffer B and incubated 6 hours at 20 ° ^C. Then the wells are washed several times with buffer A, is cut and counted in a gamma counter (LKB, Sweden). To construct the calibration curves, a highly purified interferon α2 preparation (NPO Ferment, Vilnius) with a specific activity of 1.6 · 10 ⁸ IU / kg was used.

According to radioimmunoassay, the productivity of the claimed E. coli strain is 4.7 · 10 ⁷ IU / ml cell culture.

 II. Determination of biological activity.

 Cells are suspended in 200 μl of buffer containing 0.1 M Tris-HCl, pH 7.0, 30 mM NaCl, 1% SDS, 1% mercaptoethanol and 5 M urea, heated for 3 min in a boiling water bath and centrifuged for 10 min at 12000 rpm Samples are prepared from supernatants by successive twofold dilutions in Earl medium (starting with 1/100 dilution). The activity of interferon was determined in a standard way by inhibiting the cytopathic effect of the vesicular stomatitis virus on human diploid fibroblasts. As a standard, preparations of human leukocyte interferon (VNII OCHB of the USSR Ministry of Medical Industry, Leningrad) were used, which were characterized relative to international standard B 69/19.

According to the determination of biological activity, the productivity of the claimed E. coli strain is 3-50 · 10 ⁷ IU / cell cell culture.

 III. Definition with respect to total cellular protein.

 Cells are suspended in 200 μl of buffer containing 125 mM Tris-HCl, pH 6.8, 20% glycerol, 3% SDS, 3% mercaptoethanol, 0.005% bromphenol blue, and heated for 10 min in a boiling water bath and cooled in ice. Samples 2, 5 and 10 μl were subjected to electrophoresis in 12.5% SDS-PAGE. At the end of electrophoresis, the gel is washed with a 10% trichloroacetic acid solution and stained with Coomassie R-250. After washing off the excess dye, the gel is scanned at 550 nm using an UltroScan XL laser scanner (LKB, Sweden).

 According to the scan, recombinant interferon 2 makes up from 50 to 65% of the total E. coli protein.

 PRI me R 5. Isolation and characterization of a protein synthesized in the cells of a strain of E. coli producer polypeptide with the properties of human leukocyte interferon.

Cells E.coli SG20050 / pIF16 grown at ²⁸ ° C in 500 ml LB-broth as described in Example 4, the biomass was collected tsentrifugirvoaniem 15 min at 6000 rev / min, the cell pellet was washed with 200 ml of buffer 5A containing 10% sucrose, 0, 1 M Tris-HCl, pH 7.5, 5 mM Na ₂ EDTA and 0.5 mM DTT, resuspended in 20 ml of the same buffer and destroyed by ultrasound using an ultrasonic unit Soniprep 150 (MSE). The resulting lysate is clarified by centrifugation for 30 min at 10,000 rpm, the precipitate is washed twice with 30 ml of a solution of 6 M urea in PBS buffer containing 150 mM NaCl, 20 mM potassium phosphate, pH 7.5, 5 mM Na ₂ EDTA, dissolved in 20 ml solution of 7.5 M guanidine hydrochloride in PBS buffer, undissolved particles removed by centrifugation for 30 min at 2000 rev / min and the clarified solution IFN- α2 stored at -15 ° ^C. Aliquots of this solution was analyzed IFN- α2 three different ways as described in example 4.

According to radioimmunoassay data, the resulting IFN-α2 solution contains 3 · 10 ¹⁰ IU in 20 ml of solution.

According to the determination of biological activity, the resulting IFN-α2 solution has an activity of 2-5 · 10 ⁹ IU / ml.

 According to the scan data, recombinant interferon α2 in the resulting IFN-α2 solution makes up 90-95% of the total protein.

 PRI me R 6. Analysis of the amino acid sequence of recombinant interferon α2.

 2 ml of IFN-2 solution is chromatographed on a 2.3 x 40 mm column with a wide-pore reversed-phase Polysil ODS-300 support in the gradient of a mixture of acetonitrile, isopropanol and water (3: 1: 1) at a rate of 1 ml / min with an elution profile detection at 280 nm. The main protein peak containing, according to electrophoresis data, homogeneous IFN-α2, is collected and used for analysis of amino acid composition. C-terminal amino acid sequence and N-terminal amino acid residues in the products of its complete hydrolysis with cyanogen bromide using known methods. The results of these analyzes are shown in table 2 and figure 3.

 The obtained data on the structure of the expression product of the artificial gene IFN-α2 in the cells of the E. coli strain SG20050 / pIF16 indicate the identity of the studied polypeptide to its natural analogue of human leukocyte interferon α2.

Thus, the claimed invention allows to obtain a polypeptide with a protein structure identical to the structure of natural human leukocyte interferon α2 and with the properties of human leukocyte interferon α2, and the level of interferon biosynthesis is 3-5 · 10 ⁷ IU / ml cell culture, which is over 50% of the total E.coli cell protein with a simplified technology for its production by eliminating the stage of induction of protein biosynthesis and improving the structural organization of polycistronic mRNA containing the tandem w synthetic interferon genes.

Claims (1)

1. Recombinant plasmid DNA pIF16 encoding mature human leukocyte interferon α2, 4.311 kbp and mol.m. 2.84 MD, containing:
EcoRI - DNA fragment of plasmid pmDs280 with a size of 3.170 kbp .;
two EcoRI / Pst - fragments of plasmid pIF6 / 8 with a size of 513 bp .;
synthetic deoxyoligonucleotide duplex:
ATCTCTGCGTTCTAAAGAATAAGGATT (I)
ACGTTAGAGACGCAAGATTTCTTATTCCTAATTAA (II)
- synthetic cistron orf: ATCTCTGCGTTCTAAAGAATAAGGATTAATTC GATGACATATGGCGGCCTTCCTCCGTCGTATTCGCCCTAA ACTGAAGTAAGGATC (88 bp);
- A unique recognition site for restriction endonuclease EcoRI;
- Unique recognition sites by NcoI and PstI restriction endonucleases located at a distance of 1437 and 3285 bp clockwise from the EcoRI site, respectively;
- genetic marker: β-lactamase gene, which determines the resistance of E. coli cells transformed with plasmid pIFI6 to penicillin antibiotics;
- a tandem of mutant promoters of the tryptophan operon of E. coli;
- phage l transcription terminator.
2. The strain Escherichia coli VKPM B-5809 - producer of mature leukocyte interferon α2 person.

Images