RU1445193C - Recombinant plasmid dna pga 23 - Google Patents

Abstract

FIELD: genetic engineering, biotechnology. SUBSTANCE: method involves the use of new recombinant plasmid pTNF311311Δ, encoding constitutive synthesis of human tumor necrosis factor (HTNF), the strain E. coli SG 20050/pTNF311311Δ, providing the high level of mutant HTNF biosynthesis and recombinant plasmid DNA pGA23 which is an intermediate product for preparing recombinant plasmid pTNF31Δ,. Recombinant plasmid pGA23 consistis of PstI/Bam HI DNA-fragment of plasmid vector pDSI Δ, (3.06 thousand base pairs) containing the genes of dihydrofolate reductase, chloramphenicol acetyltransferase, part Δ.-lactamase gene and terminator of phage T^°2+ transcription, PstI/Bam HI DNA-fragment of plasmid pLZ 56 containing promoters A2 and A3 of bacteriophage T7 early region and part of β-lactamase gene. Recombinant plasmid pTNF11l, encodes polypeptide 5-157 HTNF and consists of PstI/KpnI DNA-fragment of plasmid pGA23 (1.83 thousand base pairs) containing tandem of strong promotors A2 and A3 of bacteriophage T7 and part of β-lactamase gene, and KpnI/PstI DNA-fragment of plasmid pTNF31D containing semisynthetic artificial gene encoding polypeptide 5-157 HTNF, terminator of phage b transcription and part of D,-lactamase gene (2.79 thousand base pairs). Strain E. coli SG 20050 containing plasmid pTNFλ provides the level of polypeptide expression at HTNF activity 1.25 x b U/ml cell suspension. EFFECT: increased biosynthesis of polypeptide HTNF, simplified technology.

Description

 The invention relates to biotechnology, in particular to genetic engineering, and represents in vitro recombinant plasmid DNAs containing semisynthetic human tumor necrosis factor genes, promoters of the early region of T7 phage and synthetic translation initiation sites that cause biosynthesis of polypeptides with biological activity of tumor necrosis factor ( TNF), and E. coli strains are producers of these polypeptides.

 The aim of the invention is to increase the level of biosynthesis of tumor necrosis factor and simplify the process of its preparation.

A new recombinant plasmid pTNF 311 Δ encoding constitutive synthesis of a polypeptide with the properties of a human tumor necrosis factor, a new recombinant plasmid pGA 23, which is intermediate in the construction of plasmid pTNF 311 Δ and E. coli strain SG 20050 / pTNF 31, providing a level of TNF expression of 1.25, was constructed ^. 10 ⁶ units per 1 ml of cell suspension.

Recombinant plasmid DNA pTNF 311Δ encoding a polypeptide with the properties of a human tumor necrosis factor, is characterized by the following features:
encodes a polypeptide 3-157 of human tumor necrosis factor;
has a mol.m. 2.3 MD (3.79 kbp).

It consists of
Pst I / Kpn I of the DNA fragment of plasmid pGA 23 containing the tandem of promoters A2 and A3 of the early region of the bacteriophage T7 and part of the β-lactamase gene (0.99 kb);
Kpn I / Pst I DNA fragment of the plasmid pTNF 311 containing a semisynthetic artificial gene encoding a human tumor necrosis factor polypeptide 5-157, a synthetic translation initiation site, a bacteriophage λ transcription terminator, and a portion of the β-lactamase gene (2.79 tp .about.)
and contains
as a genetic marker, the β-lactamase gene that determines the resistance of penicillin antibiotics transformed with the plasmid pTNF 311 Δ of E. coli;
unique recognition sites by restriction endonucleases located at the following distances from the Kpn I site: NcoI 333 nucleotides to the right, Pst I 1613 nucleotides to the left.

 Recombinant plasmid DNA pGA 23, which is an intermediate product in the construction of recombinant plasmid DNA pTNF 311 Δ contains a tandem of strong transcription promoters of the early region of the bacteriophage T7, has a mol.m. 2.5 md.

It consists of
Pst I / Bam I of the DNA fragment of plasmid pLZ 56 containing the tandem of the A2 and A3 promoters by the early region of the T7 phage and part of the β-lactamase gene (1.01 kb);
Bam I / Pst I of the DNA fragment of the plasmid pDSI T ^about 2+ containing the genes of dihydrofolate reductase, chloramphenicol acetyl transferase, phage λ transcription terminator and part of the β-lactamase gene.

and contains
as genetic markers, β-lactamase and chloramphenicolacetyltransferase genes that determine the resistance of E. coli cells transformed with plasmid pGA 23 to penicillin antibiotics and chloramphenicol;
unique recognition sites by restriction endonucleases located at the following distances from the Bam I site: Hind III 665 nucleotides to the right, Pvu Ii 813 nucleotides to the right, Kpn I 16 nucleotides to the left, Pst I 1010 nucleotides to the left.

 The recombinant plasmid pGa 23 is the source of the Pst I / Pvu II DNA fragment, which contains the tandem of two strong transcription promoters A2 and A3 of the early region of the T7 colophage and can be used as a vector for constructing plasmids that provide a high level of heterologous expression of genes encoding practically important polypeptides .

 The recombinant plasmid pTNF 311Δ contains a semisynthetic tumor necrosis factor gene. The source of the C-terminal part of the gene is the Msp I / Hind III fragment of the fourth exon of the natural TNF gene. The missing DNA sequence encoding the sequence of 29 N-terminal amino acids was obtained by chemical synthesis.

The human gene pool is prepared from a mixture of high molecular weight DNA isolated from 6 individual placentas. For this, the DNA is hydrolyzed by restriction endonuclease EcoRI and the obtained hydrolyzate is fractionated by agarose gel electrophoresis, highlighting the zone containing DNA 0.5-2; 2-4; 4-6 kb and so on up to 12 kb The material of individual fractions was subjected to Southern blot hybridization with oligonucleotides
5'CTACTCCCAGGTCCTCT 3 '
3'GTCCAGGACAAGTTCCCG 5 ', the sequence of which corresponds to the amino acid sequence 59-77 of the mature protein of tumor necrosis factor. In order to increase the specific radioactivity of the sample, oligonucleotide probes are first 5-phosphorylated with γ- [ ³² P] ATP, and then the protruding ends are extended with a Maple fragment of E. coli polymerase using high-labeled α- [ ³² P] -deoxynucleoside-5-triphosphates . The use of specific radioactivity probes obtained in this way up to 10 ⁸ (imp / min.pmol) made it possible to identify the fraction of DNA containing the tumor necrosis factor gene (2-4, etc.).

 The DNA of this fraction is ligated with pre-dephosphorylated large fragments ("shoulders") of the phage vector λgtWesB, which are isolated after hydrolysis of phage DNA endonuclease restriction EcoRI. To increase the efficiency of doping, the reaction is carried out in two stages: at the first stage, genomic fragments are ligated in high concentration without phage DNA, which is added by repeated ligation. Before screening the clonotheque, the preparations of packaged recombinant phages are concentrated by centrifugation in a stepwise gradient of cesium chloride, after which transfection is carried out and plated on plates. The analysis of the clonoteca obtained in this way is carried out by hybridization amplified on duplicated filters with the aforementioned oligonucleotide probes. Of the 40,000 clones, primary screening revealed two positive signals. Zones containing recombinant phages are excised from the original plates and subjected to secondary screening after amplification. DNA of one of the recombinant phages, λ422, which gave positive hybridization with oligonucleotide probes, is isolated and analyzed by Southern hybridization using recombinant phage DNA hydrolysates with restriction endonucleases EcoRI, EcoRI / Bgl I, EcoRI / Xho I, Alu I, Mbo I, Mbo , Tag I, HinF I, Hind II, and Pvu II. Next, the DNA of the recombinant phage λ 422 is hydrolyzed with EcoRI restrictase, a 2.8 kb fragment is isolated. containing the TNF gene and reclone it at the EcoRI site into plasmid pUC 12. The result is a recombinant plasmid p4221, in which the human tumor necrosis factor gene is in such an orientation that its transcription coincides with the transcription of E. coli β-galactosidase α-peptide.

 To obtain a 5'-terminal fragment of the tumor necrosis factor gene, fourteen oligodeoxyribonucleotides from 11 to 20 nucleotide units were synthesized by the phosphoramidite method. Ligase cross-linking of oligonucleotides is carried out in two stages: at the first stage, two four-component and one six-component cross-linking are performed, and all oligonucleotides are phosphorylated before crosslinking with dATP and T4 polynucleotide kinases, with the exception of oligonucleotides (I) and (XIV) from segments A and C, respectively . At the second stage, ligase cross-linked segments A + B + C, which are pre-purified by electrophoresis in 20% polyacrylamide gel (PAAG). The resulting 96-link double-stranded DNA is purified by electrophoresis in 15% SDS page.

To construct recombinant pTNF 2 DNA, the vector plasmid pUR 291 is cleaved together with Sal I and Hind III endonucleases and a large fragment containing the promoter, operator, and altered E. coli β-galactosidase gene is isolated. At the same time, the DNA of plasmid p4221 containing an EcoRI fragment of 2.8 kb was digested with Hind III and Msp I endonucleases. genomic clone of phage λ 422, and a DNA fragment of 506 bp is isolated. containing the 3'-terminal gene sequence of a mature tumor necrosis factor gene. The resulting fragment was combined using DNA ligase with a synthetic 5'-terminal fragment of the tumor necrosis factor gene and Sal I / Hind III vector fragment of plasmid pUR 291. After transformation of E. coli / jM 101 cells, ampicillin-resistant clones were selected, giving X-Gal and IPTG media are bright red and screened for the presence of synthetic and natural fragments of the tumor necrosis factor gene by in situ hybridization of colonies with ³² P-labeled oligonucleotide probes TCGACCATGTCCTCGAGCC and CTACTCCCAGGTCCTCT. Colonies hybridizing with both probes were selected and a plasmid designated pTNF 2 was isolated from them.

 New in this method is the use of a synthetic 5'-terminal fragment of the tumor necrosis factor gene when constructing a plasmid for multicomponent assembly of the plasmid, the use of restriction endonuclease Msp I for this purpose, as well as hybridization with two oligonucleotide probes corresponding to the cloned fragments. This makes it possible to unambiguously select E. coli clones containing the target plasmid, which greatly simplifies the procedure for constructing plasmid DNA.

Plasmid pTNF 2 during the transformation of E. coli jM 101 cells provides inducible synthesis of human tumor necrosis factor in them as a part of a hybrid protein with altered E. coli β-galactosidase. the use of the plasmid pTNF 2 strain E. coli CSH 36 (F ^- ) as a recipient provides constitutive synthesis of the chimeric protein β-galactosidase tumor necrosis factor.

Based on the pTNF 2 plasmid, another recombinant plasmid pTNF 22 is created that encodes a complete mature tumor necrosis factor protein. For this, the plasmid pTNF 2 is digested with a mixture of restriction enzymes Bam I and Xho I, a large fragment is isolated and it is ligated with synthetic oligonucleotides
5 'GATCCGAATTCTAAGGAAATTTAAATGGTTCGTCC 3'
3 'GCTTAAGATTCCTTTAAATTTACCAAGCAAGGAGCT 5'
After transformation of E. coli strain HB 101, target clones were selected for positive hybridization with cloned synthetic oligonucleotides and the insert structure was confirmed by analysis of its nucleotide sequence using the modified Maxam and Gilbert method.

 Thus obtained plasmid pTNF 22 in E. coli (jM 101) cells, upon induction with isopropylthio-β-D-galactopyranoside (IPTG), expresses a mature tumor necrosis factor protein in the amount of 60,000 units per ml of cell culture with a density of 2.0. To create a construct for constitutive synthesis of tumor necrosis factor, a semisynthetic gene is recloned into plasmid pGA 23 containing the tandem of strong promoters A2 and A3 of the T7 bacteriophage. In turn, the pGA 23 plasmid is obtained by cloning at the Pst I / Bam I sites a small fragment of the plasmid pLZ 56 into the pDSI plasmid vector. For this, a fragment of 714 bp is isolated from the plasmid pTNF 22 after hydrolysis with EcoRI reductase. and clone it in the promoter-containing plasmid pGA 23 after its partial hydrolysis with EcoRI. The result is the plasmid pTNF 30, in which the expression of the artificial gene for tumor necrosis factor is controlled by the tandem of strong promoters of the early region of the T7 bacteriophage. After transformation of plasmid pTNF 30, E. coli cells (HB 101) are capable of constitutively synthesizing 120,000 units. tumor necrosis factor activity per 1 ml of cell culture.

To improve the expression system of tumor necrosis factor, a new recombinant plasmid pTNF 311Δ is constructed which contains an improved ribosome-binding site and a transcoded artificial gene of tumor necrosis factor. For this, the DNA of plasmid pTNF 30 is hydrolyzed with endonuclease Xh 01, the 5'-protruding ends of the linearized plasmid are removed with the help of SI nuclease, the resulting DNA with blunt ends is subjected to additional hydrolysis with Pst I restriction endonuclease and a fragment of 2.98 TP is isolated .about. On the other hand, the DNA of plasmid pGA 23 is hydrolyzed with a mixture of restriction enzymes Pst I and Pvu II and a fragment of about 1.8 kb is isolated. Both fragments are then combined using a DNA ligase with a synthetic double-stranded DNA containing the sequence of the E. coli translation initiation site and the serine codon. The E. coli HB 101 cells are transformed with the obtained ligase mixture, ampicillin-resistant clones are selected, and among them, a semisynthetic tumor necrosis factor gene is screened by in situ hybridization with a ³² P-labeled cloned duplex top chain. Colonies giving positive hybridization with the sample is selected and the plasmid isolated from them is characterized by restriction analysis.

 The result is a new recombinant plasmid pTNF 311 Δ containing a semisynthetic gene encoding a polypeptide 5-157 of mature human tumor necrosis factor.

 To obtain a producer strain of a polypeptide with biological activity, the TNF plasmid pTNF 311 Δ transforms competent E. coli SG 20050 cells.

 Thus obtained E. coli strain SG 20050 / pTNF 31 is characterized by the following features.

 Morphological signs: the cells are very small, thickened, rod-shaped, gram-negative, non-spore.

 Cultural traits: cells grow well on simple nutrient media; when growing on Difco agar, the colonies are round, smooth, pressed, muddy, shiny, gray, the edge is even; when growing on liquid media (on a minimal medium with glucose or LB broth) they form even intense turbidity.

Physiological and biological features: the cells grow in the range of 4 to 40 ° ^C under optimum pH from 6.8 to 7.5. As a source of nitrogen, both mineral salts in ammonium form and organic compounds in the form of peptone, tryptone, yeast extract, amino acids, etc. are used. Amino acids, glycerin, carbohydrates are used as a carbon source.

 Resistance to antibiotics: cells show resistance to chloramphenicol (up to 500 μg / ml) and to ampicillin (up to 250 μg / ml), due to the presence of the plasmid.

Strain E. coli SG 20050 / pTNF 31 determines the constitutive synthesis of the polypeptide with a biological activity of the factor of necrosis of human tumors at the level of 1.25 ^. 10 ⁶ u / ml cell suspension.

 PRI me R 1. Chemical-enzymatic synthesis of the N-terminal part of the structural gene of human tumor necrosis factor.

). Каждый цикл наращивания состоит из следующих операций: промывка полимерного носителя ацетонитрилом (3 мл, 2 мин); детритилирование с помощью 0,5 М раствора дихлоруксусной кислоты (2 мл, 2 мин); промывка ацетонитрилом (1,5 мл, 1 мин); промывка абсолютным ацетонитрилом (3 ил, 3 мин); конденсация прибавление смеси 0,05 М раствора соответствующего амидита и 0,3 М раствора дважды возогнанного тетразола порциями по 0,1 мл( 0,2 мл, 2 мин); промывка ацетонитрилом (1,5 мл, 1 мин); окисление прибавление 0,1 М раствора иода в смеси тетрагидрофуран лутидин вода, 8:1:1 (1 мл, 1 мин); промывка абсолютным ацетонитрилом (3 мл, 3 мин); "кэппирование" обработка 1 М раствором уксусного ангидрида и 0,1 М раствором 4-диметиламинопиридина в ацетонитриле.The synthesis of oligonucleotides is performed by the solid-state method with the growth of the oligonucleotide chain in the direction from the 3'-end to the 5'-end using protected phosphamidites 5'-dimethoxytrityl-N-acyl-2'-deoxynucleoside-3'-0 (methoxydiisopropylamino) phosphites, activated by tetrazole. The synthesis is carried out in a glass column with a porous filter by manual addition of reagents and solvents, using for this purpose 0.6-0.8 μmol of a 3'-terminal nucleoside covalently bound to 25-30 mg of porous glass (pore size 500

) Each extension cycle consists of the following operations: washing the polymer carrier with acetonitrile (3 ml, 2 min); detritylation with a 0.5 M dichloroacetic acid solution (2 ml, 2 min); washing with acetonitrile (1.5 ml, 1 min); washing with absolute acetonitrile (3 sludge, 3 min); condensation, adding a mixture of a 0.05 M solution of the corresponding amidite and 0.3 M solution of twice sublimated tetrazole in 0.1 ml portions (0.2 ml, 2 min); washing with acetonitrile (1.5 ml, 1 min); oxidation, the addition of a 0.1 M solution of iodine in a mixture of tetrahydrofuran lutidine water, 8: 1: 1 (1 ml, 1 min); washing with absolute acetonitrile (3 ml, 3 min); "capping" treatment with 1 M solution of acetic anhydride and 0.1 M solution of 4-dimethylaminopyridine in acetonitrile.

After completion of the synthesis, the carrier is dried, treated with 0.5 ml of a mixture of thiophenol triethylamine dioxane 1: 2: 2 (1.5 h, 20 ^° C), washed with methanol and dried again. Separation of the oligonucleotide from the polymer carrier and removal of the acyl protective groups is carried out by the action of concentrated ammonia (24 h, 55 ^° C). Then the carrier is filtered off, washed with 0.05 M triethylammonium bicarbonate (TEAB) and ethanol; the filtrate and washes were evaporated and chromatographed on a Zorbax ODS column (0.46x25 cm) in a gradient of acetonitrile concentration (5-30%) in 0.05 M TEAV. The fraction containing the dimethoxytrityl derivative of the oligonucleotide was evaporated and treated with 80% acetic acid (30 min, 20 ^° C), the solvent was evaporated and the oligonucleotide was isolated by chromatography on the same column in an acetonitrile concentration gradient (5-15%). The yield of purified oligonulotide 20-80 nmol.

Ligase crosslinking segment A. A mixture of 480 pmoles of the oligonucleotide (I), 400 pmol of each of the phosphorylated oligonucleotides II, III, IV and V and 480 pmol of the phosphorylated oligonucleotide VI heated for 10 minutes at 65 ° ^C in 100 ul of buffer containing 20 mM Tris-HCl pH 7.5; 10 mm MgCl ₂ , then slowly cooled to 1 ^about With, add d ATP to a concentration of 0.2 mm, dithiothreitis to a concentration of 10 mm and 300 units of T4 DNA ligase. The mixture was incubated for 6 hours at 15 ^{° C,} then deproteiniziruyut twofold extraction with phenol, DNA was precipitated with ethanol and crosslinking products are isolated by electrophoresis in 20% polyacrylamide gel containing 7 M urea. The crosslinked product is eluted from the gel by electroelution onto DE 81 DEAE paper, which is washed several times with TE buffer (10 mM Tris-HCl, pH 8.0; 0.5 mM EDTA) and ethanol. The nucleotide material was eluted with a 1.5 M NaCl solution in TE buffer and desalted on a Sephadex G-50 column. The output of segment A is 280 pmol.

 In a similar manner, segments B and C are obtained, yields 350 and 320 pmol, respectively.

Next, 50 pmol of each of segments A, B, and C are crosslinked in 20 μl of buffer L containing 20 mM Tris-HCl, pH 7.5; 10 mM MgCl _2, 0.2 mM dATP, 10 mM dithiothreitol and 250 units of T4 DNA ligase for 4 hours at 15 ^C. The product was isolated by crosslinking electrophoresis in 15% PAGE as described above. Yield 35 pmol. The structure of the intermediate and final products of ligase reactions is proved by analysis of the nucleotide sequence.

 PRI me R 2. Construction of recombinant plasmid DNA pTNF 2.

Cells bacteria E.coli jM 101 containing the plasmid pUR 291 DNA, were grown at ³⁷ ° C in LB-broth containing 100 ug / ml ampicillin to stationary phase. Then the cells are precipitated by centrifugation (15 min, 6000 rpm) and plasmid DNA is isolated by the method with modifications, namely, to the supernatant obtained after acidification with sodium acetate, RNase A is added to a concentration of 10 μg / ml, the mixture is incubated for 20 min at 37 ^about C, extracted twice with a mixture of phenol chloroform (1: 1), after which DNA was planted with ethanol. The precipitate was dissolved in 1 M NaCl, was added polyethylene glycol PEG-6000 to a concentration of 1.5% was kept 1 h at ⁰ ° C, centrifuged 10 min at 10000 rev / min, the precipitate was washed with 70% ethanol, dried and dissolved in TE buffer . The output of plasmid DNA 500-800 μg. The concentration of plasmid DNA was determined spectrophotometrically at 260 nm using an extinction coefficient of 20 OU / mg.

DNA of plasmid p 4221 containing the tumor necrosis factor gene in the form of an EcoRI fragment (2.8 kb) cloned in plasmid pUC 12 from recombinant phage λ 422 was isolated in the same way. The obtained plasmid DNA preparations were used to construct pTNF plasmid 2, which is carried out as follows. 5 μg of plasmid pUR 291 incubated with restriction endonucleases Sal I (20 units) and Hind III (10 units) in buffer R containing 20 mm Tris-HCl, pH 7.5; 50 mM NaCl, 10 mM MgCl _2, 5 mM mercaptoethanol for 1 hour at 37 ^C. After incubation the reaction was stopped by extracting twice with phenol chloroform (1: 1). The analysis of the completeness of hydrolysis and isolation of the vector SalI / Hind III fragment (5.3 kbp) is carried out by electrophoresis in a 1% agarose gel. Simultaneously 10 g of plasmid p 4221 was treated for 1.5 hours at ³⁷ ° C in buffer R with the restriction enzymes Msp I (20 units) and Hind III (20 units), followed by electrophoresis in 5% polyacrylamide gel was isolated C-terminal gene fragment necrosis factor tumors (Msp I / Hind III, 506 bp). Next, this fragment (0.2 μg) is combined with a Sal I / Hind III vector fragment (1.5 μg) and a synthetic fragment (0.1 μg, see Example 1) using T4 DNA ligase (50 units) in 50 μl of buffer L for 6 hours at 15 ^about C.

A tenth of the reaction mixture is used to transform E. coli jM 101 cells. Transformation is carried out as follows. Previously, cells were plated on agar containing M9 medium, 0.2% glucose and 2 μg / ml thiamine. A single colony is introduced into 50 ml of LB broth and grown at ³⁷ ° C until the turbidity of 0.3-0.5, the cells are then cooled, pelleted by centrifugation (10 min, 5000 rpm / min), washed with a solution of 10 mM MgCl _2, centrifuged, suspended in 20 ml of a 0.1 M solution of CaCl ₂ , kept at 0 ^about C for 30 minutes After centrifugation, the cells were resuspended in 3 ml of 0.1 M CaCl ₂ and after 3 hours used for transformation. To this 5 l of the ligation mixture was mixed with 50 .mu.l (0.05 M CaCl ₂ was added 150 .mu.l of a suspension of competent cells, incubated for 30 min at ⁰ ° C, followed by 2 minutes at 42 ^{° C} and then 10 min at 0 ° ^C was added 1.4 ml of LB-broth, incubated 1 h at ³⁷ ° C and aliquots were plated on LB- agar containing ampicillin (50 ug / ml), X-Gal (40 .mu.g / ml) and 1 mM IPTG. The resulting bright -blue colonies are transferred onto parallel nitrocellulose filters and analyzed for the content of synthetic and natural TNF gene fragments by in situ hybridization of colonies with ³² P-labeled TCGACCATG oligonucleotides TCCTCGAGCC and CTACTCCCAGGTCCTCT Colonies giving positive hybridization with both probes were selected and the plasmid designated pTNF 2 was isolated from them. The structure of the plasmid DNA pTNF 2 was confirmed by restriction analysis and the nucleotide sequence of the plasmid DNA between the endonuclease I and Bam I sites.

 PRI me R 3. Construction of recombinant plasmid DNA pTNF 2.

1 ug plasmid DNA pTNF 2 is hydrolyzed with the restriction endonucleases BamI (28 units) and XhoI (15 U) for 1.5 h at 37 ^C. After incubation, the mixture was extracted twice with phenol chloroform (1: 1). 5.92 kb vector fragment isolated by electrophoresis in 1% agarose. 0.5 μg of this fragment are ligated with 15 pmol of synthetic duplex
GATCCTGAATTCTAAGGAAATTTAAATGGTTCGTTCC
GACTTAAGATTCCTTTAAATTTACCAAGCAAGGAGCT in 50 l buffer L for 6 hours at 15 ^{° C} in the presence of 50 units of T4 DNA ligase. A fifth of the ligase mixture was used to transform competent E. coli HB 101 cells, as described in Example 2. Clones were selected by hybridization of colonies with ³² P-labeled insertion oligonucleotides. Positive hybridization colonies were selected and a plasmid designated pTNF 22 was isolated from them. The structure of plasmid DNA pTNF 22 was confirmed by restriction analysis and nucleotide sequence determination between EcoRI sites.

 PRI me R 4. Construction of recombinant plasmid DNA pGA 23.

 The construction of plasmids pGA 23 is as follows.

First, the plasmid DNA ^of pDSI t 2+ (5 ug) was incubated with the restriction endonuclease Pst I (10 units) and Bam I (10 units) in 50 l buffer R 1,5 hours at 37 ^C. After processing as in Example 2 , the vector fragment is isolated by electrophoresis on a 1% agarose gel. Next, 10 μg of plasmid pLZ 56 is hydrolyzed using restriction endonucleases Pst I (20 units) and Bam I (20 units) and a fragment of about 1 about. containing promoters A2 and A3 of the early region of the T7 phage, secrete by electrophoresis in 5% SDS page. Then, 0.5 ug of the vector fragment is combined with 0.2 ug promoter-containing fragment with T4 DNA ligase in 15 l buffer L for 6 hours at 15 ^C. Aliquots of the reaction mixture, competent cells are transformed E.coli C 600, and the transformed cells were plated on agar containing LB medium and 150 μg / ml chloramphenicol. Plasmid DNA designated pGA 23 is isolated from chloramphenicol-resistant colonies. The structure of plasmid DNA pGA 23 is confirmed by restriction analysis.

PRI me R 5. Construction of recombinant plasmid DNA pNTF 311 Δ
First, the construction of the intermediate is carried a recombinant plasmid pTNF 30. For this purpose, 15 .mu.g of plasmid DNA pGA 23 is incubated with 10 units of endonuclease EcoRI in 120 l buffer R for 1 hour at 25 ^C. The reaction was stopped by extracting twice with phenol chloroform (1: 1) and the linearized plasmid was isolated by electrophoresis on a 1% agarose gel. Similarly, by hydrolysis with EcoRI endonuclease and electrophoresis in a 1% agarose gel, a fragment of 714 bp was isolated from pTNF 22 plasmid. 0.1 μg of which is incubated with 1 μg of linearized plasmid pGA 23 in 25 μl of L buffer in the presence of 50 units of T4 DNA ligase.

One tenth of the ligase crosslinking transform competent EW cells. coli HB 101, as described in Example 2. The mixture was plated on plates with LB agar containing ampicillin (50 μg / ml) and chloramphenicol (100 μg / ml). The resulting colonies are scanned for semisynthetic gene content by hybridization with ³² P-labeled segment B (see example 1). Colonies giving positive hybridization were selected, plasmid DNA was isolated from them and restriction analysis was performed using Hind III endonuclease to orient the fragment containing the artificial tumor necrosis factor gene and using Hae III endonuclease. Plasmid DNA forming a fragment of 784 bp upon restriction enzyme Hind III hydrolysis and containing a 360 bp promoter-containing fragment in the Nae III hydrolyzate denoted as pTNF 30. The structure of the recombinant pTNF 30 DNA was confirmed by restriction analysis using restriction endonucleases Hae III, Msp I and Hing III, as well as determining the cytopathic activity of cell lysates containing the plasmid pTNF 30 (see example 7).

Then, 10 mg of plasmid pTNF 30 are incubated with 20 units of Xho I endonuclease in 150 ul buffer R for 1.5 hours at 37 ^o C. After the reaction mixture was extracted twice with phenol chloroform (1: 1) and the DNA precipitated with ethanol. The precipitate was washed with 80% ethanol, dried, dissolved in 150 μl of buffer containing 50 mM sodium acetate (pH 4.5), 10 mM ZnSO ₄ , 0.5 M NaCl, 15 units of SI nuclease were added and the mixture was incubated for 45 min. at 25 ^about C. The reaction is stopped by triple extraction with a mixture of phenol chloroform (1: 1). DNA is planted with ethanol, the precipitate is washed with 80% ethanol and dried. The DNA thus obtained was dissolved in 200 l buffer R, incubated 1.5 hours at ³⁷ ° C with 20 units of endonuclease Pst I and the larger fragment (about 3 kb) was isolated by electrophoresis in 1% agarose gel. On the other hand, a small fragment obtained by hydrolysis of 10 μg of DNA of plasmid pGA 23 using 15 units of restriction enzyme Pst I and 20 units of restriction enzyme Pvu II is isolated in the same way. Then both fragments (0.7 and 0.3 .mu.g) Digir with 1 ug of double-stranded synthetic DNA containing a translation initiation site and the serine codon, using 150 units of T4 DNA ligase in 10 l buffer L for 16 hours at 18 ^C. A tenth of the reaction mixture is used to transform competent E. coli HB 101 cells. Transformants are plated on LV agar containing ampicillin (50 μg / ml). Among ampicillin-resistant clones, hybridization screening is carried out with ³² P-labeled top chain of the cloned synthetic duplex. DNA from hybridizing clones is isolated and analyzed using restriction endonucleases Hae III and Msp I, as well as by determining the nucleotide sequence in the region of the insert. 1 g of the thus obtained DNA plasmid pTNF 311 was incubated with 2 units of restriction endonuclease Kpn I in 20 l buffer R for 1 hour at 37 ^C. The reaction is stopped by extraction with phenol chloroform (1: 1) and the larger fragment (about 3.8 t.p.O.) is isolated by electrophoresis on a 1% agarose gel. 0.2 .mu.g of this fragment were incubated in 10 l buffer L and 20 U T4 DNA ligase for 3 h at 15 ^C. The fourth portion of the reaction mixture was used to transform competent E.coli HB 101 cells Transformants were plated on LB- ampicillin-containing agar (5 μg / ml) and DNA from ampicillin-resistant clones are analyzed by restriction analysis using Hal III and Msp I endonucleases. Thus, a recombinant plasmid DNA is obtained, designated pTNF 311 Δ whose structure is confirmed by analysis of the nucleotide sequence in the region of the Kpn I site .

 PRI me R 6. Obtaining a producer strain of a polypeptide with the properties of a human tumor necrosis factor.

The plasmid pTNF 311 Δ transform cells of E. coli SG 20050 according to the method described in example 2, and get the producer strain of the polypeptide 5-157 of human tumor necrosis factor E. coli SG 20050 / pNTF 311 Δ
PRI me R 7. Determination of the productivity of a strain of E. coli producer of a polypeptide with the properties of human tumor necrosis factor.

Cells E.coli SG 20050 / pTNF 311 Δ grown at 37 ^{° C} in 20 ml LB-broth for 20 hours with a rotary shaker at a speed of 190 rev / min. A 2 ml sample was taken, the cells were centrifuged for 10 min at 6000 rpm, then suspended in 25 mM Tris buffer (pH 8.0) containing 0.5 mM phenylmethylsulfonyl fluoride and lysozyme (5 mg / ml), and incubated for 30 min at 25 ^C. to the mixture was frozen autopsy cells for 10 min at ^-70 ° C, and then thawed in ice, this operation is repeated three times, after which the content of tumor necrosis factor in solution by measuring its biological activity.

The biological activity of TNF is determined on a culture of transformed murine fibroblasts of the L-929 line. For this, a monolayer cell culture is grown in a CO ₂ thermostat in 96-well plates for cell cultures in DMEM medium containing 10% calf serum. To determine the biological activity, the culture medium is replaced with fresh DMEM medium containing 1% calf serum, actinomycin D (1 mg / ml) and cell lysate in serial two-fold dilutions (approximately corresponding to the concentration of tumor necrosis factor from 10 to 10 ^-1 μg / ml). The boards are again incubated for 16-20 hours in a CO ₂ thermostat, then the cells are stained with trypan blue and the number of stained (non-viable) and unstained (living) cells is counted. The unit of activity is the amount of tumor necrosis factor causing the death of 50% of transformed cells.

Thus, the invention allows to increase the level of biosynthesis of a polypeptide with the biological activity of human tumor necrosis factor up to 8 ^. 10 ⁶ units per 1 ml of cell suspension and simplify the process of obtaining it by eliminating the non-technological stage of induction.

Claims (3)

1. Recombinant plasmid DNA pGA 23 - an intermediate product for the construction of recombinant plasmid DNA pT pTNF311Δ with mol.m. 2.5 MD containing:
Rst I-Bam I-DNA fragment of plasmid p 4256 with a tandem of promoters A2 and A3 of the early region of the T7 phage and with a part of the lactamase gene b of 1.01 kb;
Bam I — Pst DNA fragment of the plasmid pDSI T ⁰ 2 ⁺ with the gene for dihydrofolate reductase, chloramphenicol acetyl transferase with phage l transcription terminator and part of the β-lactamase gene;
genetic markers:
the β-lactamase and chloramphenicol acetyltransferase gene, which determine the resistance of penicillin antibiotics and chloramphenicol to plasmid pGA 23 of Escherichia coli cells;
unique recognition sites by restriction endonucleases located at the following distances from the Bam I site: Hind III 665 nucleotides to the right, Pvu II 813 nucleotides to the right, Kpn I 16 nucleotides to the left, Pst I 1010 nucleotides to the left. 2. Recombinant plasmid DNA pTNF311Δ encoding a polypeptide with the properties of a human tumor necrosis factor with mol.m. 2.3 MD 3.79 in size, etc. about. containing
Pst I - Kpn I-DNA fragment of plasmid pGA 23 with the tandem of promoters A2 and A3 of the early region of the bacteriophage T7 and part of the β-lactamase gene of size 0.99, etc. about.;
Kpn I - Pst I DNA fragment of plasmid pTNF 311 with a semisynthetic artificial gene encoding a polypeptide 5 - 157 of human tumor necrosis factor and a synthetic translation initiation site, bacteriophage l transcription terminator and part of the 2.75 kb lactamase b gene .;
genetic markers: the β-lactamase gene that determines the resistance of penicillin antibiotics to Escherichia koli transformed with the plasmid pTNF311Δ;
unique recognition sites by restriction endonucleases located at the following distances from the Kp I site: N col I 333 nucleotides to the right, Rst I 1613 nucleotides to the left.  3. The bacterial strain Escherichia coli VKPM B-3967 is a producer of polypeptide 5-157 with the properties of human tumor necrosis factor.