PT100511A - USE OF NEUROTROPHIN-4, DIAGNOSTIC PROCEDURE BASED ON THE EXPRESSION OF THE SAME AND PRODUCTION OF NEUROTROPHIN-4, AND DIAGNOSTIC ASSEMBLY - Google Patents

Description

-2- 73 993 6526-079-118, DESCRIPTIVE MEMORY ^ THERAPEUTIC AND DIAGNOSTIC PROCESSES BASED ON NEUROTROPHIN-4 EXPRESSION

1. INTRODUCTION The present invention relates to neurotrophin-4 (NT-4), a novel member characterized from the BDNF / NGF / NT-3 gene family and to diagnostic and therapeutic processes using neurotrophin-4 in treatment of neurological disorders.

2. BACKGROUND OF THE INVENTION The family of nerve growth factor includes β-nerve growth factor (NGF), brain derived neurotrophic factor (BDNF), and neurotrophin-3 (NT-3), also known as a factor derived from the hippocampus (HDNF). This family of proteins plays an important role in the nervous system of adult or developing vertebrates, supporting neuronal survival.

Based on the amino acid sequence of the mouse NGF protein (Angeletti, et al., 1973 Biochemistry, 12: 100-115), the DNA sequences encoding human and mouse NGF were isolated (Scott et al., 1983, Nature 302: 538-540; Ullrich et al., 1983 Nature 303: 821-825). Comparison between human and mouse NGF showed that the protein is conserved among mammals and supporting this, NGF-like activities were isolated from several species (Harper and Thoenen, 1991 Ann Rev Rev. Pharmacol, Toxicol 21: 205-229).

Subsequently, goat NGF DNA sequences (Meier et al., 1986, EMBO J. 5: 1489-1493); of chick (Meier et al .. EMBO J. 5: 1489-1493; Ebendal et al., 1986 EMBO J. 5: 1483-1487; Wion et al., 1986 FEBS Letters 203: 82-86); snake (Selby et al., 1987, Neurosci. Res. 18: 293-298); mouse (Whittemore et al., 1988, J. Neurosci. Res. 20: 403-410); and guinea pig (Schwarz et al., 1989, Neurochem., 52: 1203-1209) were also determined. Brain-derived neurotrophic factor (BDNF) was initially isolated from pig brain (Barde et al., 1982: 73993 / 6526-079-118-EMBO J. 1, 549-553) and subsequently cloned from this tissue as a cDNA (Leibrock et al., 1989, Nature 341: 149-152). The NT-3 gene was isolated from rat mouse (Hohn et al., 1990, Nature 344: 339-341) (Maisonpierre et al., 1990, Science 247: 1446-1451; Ernfors et al., 1990, Proc. , Natl Acad Sci USA 87: 5454-5458), and human (Rosenthal et al., 1990, Neuron 4: 767-773), using degenerate oligonucleotides based on sequence similarity between the other two factors. All three factors exhibit approximately 55% amino acid similarity to each other, and most sequence differences are present " in five regions that contain amino acid motifs characteristic of each protein. It has recently been shown that the in vitro neurotrophic activity of two of these proteins could be acquired by specific combinations of these variable regions. NGF supports the development and maintenance of sympathetic peripheral and sensory neurons derived from neural Christian (reviewed in Thoenen and Barde, 1980, Phvsiol Rev. 60: 1284-1325; Levi-Montalcini, 1987, Science 237: 1154-1162 ). No BDNF activity was found in peripheral sympathetic neurons, but this factor supports in vivo the survival of both placental and neural Christian sensory neurons (Hofer and Barde, 1988, Nature 331: 261-262). NT-3-sensitive neurons in vivo remain unidentified. However, in chick explanted ganglia or dissociated neuronal cultures, in vitro. the three factors support both groups of overlapping or single neuronal populations, suggesting that NT-3 also exerts in vivo both specific or superimposed neurotrophic activities (Hohn et al., 1990, Nature 344: 339-341; Maisonpierre et al. 1990, Science 247: 1446-1451, Ernfors et al., 1990, Proc Natl Acad Sci USA 87: 5454-5458; Rosenthal et al., 1990, Neuron 4: 767-773). All three factors are expressed in specific groups of neurons in the brain, with the highest mRNA levels for the three factors in the hippocampus (Ayer-LeLievre et al., 1988, Science 240: 1339-1341, Ernfors et al. 1990, Proc. Natl Acad Sci USA 87: 5454-5458; Ernfors et al., 1990, Neuron 5: -4- 73 993 Ο 6526-079-118 511-526 Watmore et al., 1991 , Neurol 109: 141-152, Hofer et al., 1990, EMBO J. 9: 2459-2464, Phillips et al., 1990, Science, 250: 290-294). In the brain, NGF has been shown to support cholinergic neurons of the basal forebrain (review in Whittemore and Seiger, 1987, Brain Res .. 434: 439-464; Thoenen et al., 1987, Rev. Phyto. Biochem. Pharmacol., 105: 145 And BDNF was shown to stimulate the survival of these neurons in vitro (Alderson et al., 1990, Neuron 5: 297-306).

The effects of the three proteins " are mediated by their interaction with specific receptors present on sensitive cells. Molecular clones for rat, human and chicken NGF (NGF-R) receptors were isolated, and analysis of the nucleotide sequence of these clones revealed that NGF-R contains a plasma membrane bound domain, a cytoplasmic region and a (R et al., 1987, Nature et al., 1987, Nature et al., 1989, Neuron 2: 1123-1134). NGF-R shows a low but significant sequence similarity to the receptor for a tumor necrosis factor (Schall et al., 1990, Cell 61: 361-370) as well as for CD40 surface lymphocyte antigens ( Stamenkovic et al., 1989, EMBO J. 8: 1403-1410) Θ 0X40 (Mallett et al., 1990, EMBO J. 9: 1063-1068). NGF-R can occur in two apparent states, known as states of low and high affinity (Sutter, et al., 1979, J. Biol. Chem., 254: 5972-5982; Landreth and Shooter, 1980, Proc. Schechter and Bothwell, 1991, Cell 24: 867-874). The gene for NGF-R appears to encode a protein that is part of both the low and high receptor affinity states (Hampstead et al., 1989, Science 243: 373-375), although only the high affinity receptor has been proposed to mediate the biological activity of NGF. Both BDNF (Rodriguez-Tebar et al., 1990, Neuron, 4: 487-492) and NT-3 (Ernfors et al., 1990, Proc Natl Acad Sci USA 87: 5454-5458) may interact with the low affinity NGF-R, suggesting that the low affinity NGF-R may be, in an unknown manner, involved in mediating the biological effects of all three factors .

In the developing nervous system, NGF and its receptor have been shown to be synthesized in the target area and in response neurons, respectively, at the time the growing axon reaches its target (Davies et al., 1987, Nature 326: 353-358). Accordingly, the level of NGF mRNA in the developing chick embryo reaches a maximum on embryonic day 8 (E8) (Ebendal and Persson, 1988, Develoornent, 102: 101-106), which coincides with the time of sensory innervation However, in the chick, NGF-R mRNA is expressed at its highest in early embryonic stages prior to neuronal innervation (Ernfors et al., 1988, Neuron, 1, 983-996), and in chick embryo E8 high levels of NGF-R mRNA were detected in the mesenchyme, somites and neural tube cells (Hallbook et al., 1990, Develoornent 108, 693-704, Heuer et al., 1990, Dev Biol. 287-304, Heuer 1990, Neuron 5: 283-296). This observation, coupled with the fact that NGF mRNA is expressed in the E3 chick embryo at relatively high levels (Ebendal and Persson, 1988, Development, 102: 101-106), indicates that NGF may play a role in early development which is distinct from its function as a neurotrophic factor. In accordance with this possibility, NGF has recently been shown to control the proliferation and differentiation of E14 mouse embryonic striatum precursor cells in culture (Cattaneo and McKay, 1990, Nature 347: 762-765). In the chick embryo the BDNF and NT-3 mRNA are expressed at their maximum at E4.5, and BDNF has been shown to control the differentiation of neural Christian cells from birds in vitro (Kalcheim and Gendreau, 1988, Dev Brain Res 41: 79-86).

In addition, evidence was also presented for a non-neuronal NGF function. The still unexplained high levels of NGF found in the submandibular gland of male mice may indicate other functions for NGF (Levi-Montalcini, 1987, Science 237: 1154-1162). In the adult rat the NGF was shown to induce DNA synthesis and stimulate IgM secretion at -6-73993 6526-079-118 B cells (Otten et al., 1989, Proc. Natl. Acad Sci USA 86: 10059-10063). In addition, NGF is present in sufficient quantity in the guinea pig prostate, such that Rubin and Bradshaw (1981, J. Meur. Res. 6: 451-464) have been successful in isolating and characterizing Substantially pure NGF from this exocrine tissue. The high level of NGF in the porcine prostate supports the hypothesis that this neurotrophic factor functions in a non-neuronal capacity not yet understood (Bradshaw, 1978, Ann Rev. Biochem 47: 191-216, Harper, et al., 1979, Nature 279: 160-162, Harper and Thoenen, 1980, J. Neurochem 34: 893-9'3) T ~ ...........

In addition, NGF mRNA is expressed in early spermatocytes and spermatocytes in adult mouse testes (Ayer-LeLievre et al., 1988, Proc Natl Acad Sci USA 85: 2628-2632), and protein NGF is present in germ cells of all stages from spermatocytes to spermatozoa (Olson et al., 1987, Cell Tissue Res .. 248: 275-286, Ayer-LeLievre et al., 1988a, Proc Natl Acad Sci. USA 85: 2628-2632). NGF-R mRNA was also detected in adult mouse testes where it is expressed on Sertoli cells under negative control of testosterone, and it has been suggested that NGF controls meiosis and spermiation in the testes (Persson et al., 1990, Science, 247: 704-707).

SUMMARY OF THE INVENTION The present invention relates to neurotrophin-4 (NT-4), a newly characterized new member of the BDNF / NGF / NT-3 gene family. The present invention provides nucleic acid molecules encoding NT-4. These molecules may comprise a sequence substantially as presented for NT-4 in Figure 1 (SEQ ID NO: 1 (NT-4, viper), SEQ ID NO: 2 (NT-4, Xenopus) NO: 43), Figure 8 (SEQ ID NO: 49), Figure 14 (SEQ ID NO: 61), Figure 15 (SEQ ID NO: 63), Figure 17 (SEQ ID NO. NO: 75), Figure 20 (SEQ ID NO: 93) and Figure 21 (SEQ ID NO: 116) or may comprise a -7- / 73,993 >. which is at least about seventy percent homologous to that sequence. The present invention also provides a peptide protein or molecules comprising a sequence substantially as those shown for NT-4 in Figure 2 (SEQ ID NO: 22 (NT-4, viper), SEQ ID NO: 23 (NT-4, Xenopus )], Figure 4 (SEQ ID NO: 44), Figure 8 (SEQ ID NO: 50), Figure 14 (SEQ ID NO: 62), Figure 15 (SEQ ID NO: 70), Figure 18 (SEQ ID NO: 76), Figure 20 (SEQ ID NO: 94), or Figure 2 (SEQ ID NO: 117) or may comprise a sequence which is at least seventy percent homologous to that sequence . The present invention further provides for the expression of biologically active NT-4 molecules in prokaryote and eukaryotic systems. The present invention further provides for the production of NT-4 in amounts sufficient for therapeutic and diagnostic applications. Likewise, anti-NT-4 antibodies can be used in therapeutic and diagnostic applications. For most purposes it is preferable to use NT-4 genes or gene products from the same species for therapeutic and diagnostic purposes, although the utility of NT-4 cross species may be useful in specific embodiments of this invention. The present invention further provides therapeutic and diagnostic applications based on expression of NT-4 by the development of detectable levels of NT-4 expression in human skeletal muscle, prostate, thymus and testes.

4. DESCRIPTION OF THE FIGURES FIG. DNA sequence alignments of the isolated fragments encoding NGF, BDNF, NT-3 and the novel NT-4 neurotrophic factor of different species. (A) Schematic representation of the mouse preproNGF molecule. The dashed box indicates the signal sequence 73 993 6526-079-118

(SS), black bars indicate proteolytic cleavage sites and the shaded box represents mature NGF. Regions used for degenerate primers are indicated by arrows. The primer upstream of the coding region was lysine 50 to threonine 56 and the downstream primer includes from tryptophan 99 to aspartic acid 105. The amplified region comprises base pair (bp) DNA sequences 168 to 294 in mature NGF molecules and in all members of the NGF family heretofore described, this region is located in an exon. (B) Alignment of nucleotide sequences for NGF, BDNF, NT-3 and NT-4 isolated from different species. The fragments correspond to amino acids 57 to 98 in mature mouse NGF. Identical bases are marked by periods. Numbering refers to nucleotides in the mouse mature NGF sequences (Scott et al., 1983, Nature 300: 538-540). SEQ ID NO: 1 (NT-4, viper), SEQ ID NO: 2 (NT-4, Xenopus). SEQ ID NO: 3 (NGF, human), SEQ ID NO: 4 (NGF, rat), SEQ ID NO: 5 (NGF, chicken), SEQ ID NO: 6 (NGF, viper), SEQ ID NO: 7 NGF,

SEQ ID NO: 8 (BDNF, chicken), SEQ ID NO: 8 (NDNF, salmon), SEQ ID NO: 9 (BDNF, human), SEQ ID NO: 10 : 12 (BDNF, viper), SEQ ID NO: 13 (BDNF,

Xenopus). SEQ ID NO: 14 (BDNF, salmon), SEQ ID NO: 15 (BDNF, streak), SEQ ID NO: 16 (NT-3, human), SEQ ID NO: 17 (NT- NO: 18 (NT-3, chicken), SEQ ID NO: 19 (NT-3, Xenopus). SEQ ID NO: 20 (NT-3, salmon), SEQ ID NO: 21 (NT-3, line).

FIGURE 2. Alignment of deduced amino acid sequences to NGF, BDNF, NT-3 and NT-4 from different species. Amino acid numbering (single letter code) is taken from mature mouse NGF (Scott et al., 1983, Nature 300: 538-540). Identical amino acids are indicated with dots. Positions which exhibit conservative amino acid substitutions in all variant species of the same factor are underlined. The dashed line indicates that the corresponding sequence was not isolated. The bars have variable regions in the different molecules (R59 to S67 and D93 to A98). SEQ ID NO: 22 (NT-4, viper), SEQ ID NO: 23 (NT-4, Xenopus). SEQ ID NO: 24 (NGF, human), SEQ ID NO: 25 (NGF, mouse), SEQ ID NO: 26 (NGF, chicken ), SEQ ID NO: 27 (NGF, viper), SEQ ID NO: 28 (NGF, Xenopus). SEQ ID NO: 29 (BDNF, mouse), SEQ ID NO: 32 (BDNF, chicken), SEQ ID NO: 29 (NGF, salmon), SEQ ID NO: 30 (BDNF, BDNF, viper), SEQ ID NO: 34 (BDNF, Xenopus). SEQ ID NO: 35 (BDNF, salmon), SEQ ID NO: 36 (BDNF, streak), SEQ ID NO: 37 (NT-3, human), SEQ ID NO: 38 (NT- NO: 39 (NT-3, chicken), SEQ ID NO: 40 (NT-3, Xenopus). SEQ ID NO: 41 (NT-3, salmon), SEQ ID NO: 42 (NT-3, line). FIGURE 3. Induced phylogeny of members of " NGF family "; Phylogenetic trees showing evolution of NGF (A), BDNF (B), and NT-3 (C) were constructed using nucleotide sequence analyzes. NT-3 was used as reference in (A) and (B), human NGF and human BDNF were used in (C). The scale bar in (A) represents a branch length corresponding to a relative difference mark of 20. The same scale was used in (B) and (C). (D) presents a phylogram of the evolutionary relationship between the different members of the NGF family. The data were compiled from deduced amino acid sequences. The scale bar represents a branch length of 20. All the trees presented are devoid of root, so that the branches are measured relative to each other without external reference. Abbreviations: chi, chicken; hum, human; salt, salmon; vip, viper; xen Xenopus. FIGURE 4. Xenopus NT-4 Sequence and Comparison with NGF, BDNF and NT-3. (A) A potential translation start site was placed in a box. A putative signal cleavage site is indicated by an arrow marked SC. Amino acids within the signal sequence that are identical between Xenopus NT-4 and porcine and rat BDNF are indicated with stars. A consensus sequence for N-glycosylation is underlined and the arrow indicates the presumed onset of the mature NT-4 protein. (SEQ ID NO: 43 and SEQ ID NO: 44) -10- /. (B) Amino acid sequence (single letter code) comparison of Xenouus NT-4 (SEQ ID NO: 45) with mouse NGP (Scott et al., 1983, Nature 300 : 538-540) (SEQ ID NO: 46), mouse BDNF (Hofer et al., 1990, EMBO J. 9: 2459-2464) (SEQ ID NO: 47) and mouse NT-3 (Hohn et al. al., 1990, Nature 344: 339-341) (SEQ ID NO: 48). Identical amino acid substitutions compared to the amino acid sequence of NT-4 are given by dot. Sequences differing between NGP, BDNF and NT-3 also differ in the sequence of NT-4 protein. FIG. 5. Transient expression of Xenopus NT-4 protein in COS cells and their interaction with NGF-R in PC12 cells. (A) SDS-PAGE of conditioned media from COS-labeled cell cultures. (3 x 104 cpm applied in each lane) transfected with the rat NGF gene, a control plasmid without insert, or the Xenopus NT-4 gene. An autoradiography of the dry gel is exposed after exposure to the X-ray film overnight. (B) Serial dilutions of transfected COS cell medium containing equal amounts of NT-4 (open circles), or NGF closed) were tested for their ability to replace 125I-NGF at its receptor in PC12 cells. Binding tests were performed at 37 ° C using 125 x 125 IU Ngf and 1 x 10 4 cells per ml. Simulatedly transfected cell media failed to replace the 125 I-NGF binding of PC12 cells. Each point represents the mean ± SD of triplicate determinations. FIGURE 6. Stimulation of neurite outgrowth in chicken embryonic ganglia. (A, B, and C) Excretion of neurites induced in dorsal root ganglia with recombinant NT-4 protein (A), recombinant NGF (B) and BDNF (C) protein. (D) Dorsal root ganglia response to conditioned medium from mock transfected cells. (E and F) Excretory stimulation of ganglia neuritis 73 993 6526-079-118

-li of the sympathetic in response to NT-4 (E) or NGF (F). (G, H, and I) Giant ganglia stimulated with recombinant NT-4 (G), NT-3 (H), and BDNF (X) proteins. All figures are light-field microscopic photographs of ganglia after 1.5 days in culture. FIGURE 7. Detection of NT-4 mRNAs in different tissues of Xenopus. (A) + (10æg per well) RNA of the indicated tissues of adult Xenopus female was subjected to electrophoresis on formaldehyde-containing agarose gel, transferred to a nitrocellulose filter and hybridized with a 500 bp Hindi fragment of the exon 3 'gene from the Xenopus NT-4 gene. For comparison, the filter was also hybridized with a 180 bp PCR fragment from the Xenopus NGF gene (labeled center of the band, NGF). the filter hybridized with the NT-4 probe was exposed for 2 days; the filter hybridized with the NGF probe was exposed for 2 weeks. Prolonged 2 week exposure of the NT-4 probe hybridized did not reveal NT-4 mRNA in any tissue other than ovarian tissue including oocytes of different stages. The band marked with CNS includes brain and spinal cord. (B) Poly (A) + (10æg) Xenopus ovary RNA was analyzed for expression of the four members of the NGF family. Each filter was hybridized with the indicated probes, obtained by labeling PCR fragments of their respective Xenopus genes. The location of the labeled PCR fragments in the 3 'exon of their genes is shown in Figure 1A. Filters were washed with high severity and exposed to x-ray films for 5 days. FIG. 8. Nucleotide sequence of Xenopus NT-4 with restriction endonuclease cleavage sites (SEQ ID NO: 49 and SEQ ID NO: 50). FIGURE 9. Expression of NT-4 mRNA in Xenopus laevis ovary. 73 993 c 6526-079-118 -12-

Adult Xenonus laevis ovary was sectioned on a cryostat (sections 14 μm thick) and the sections were then hybridized with the indicated 48 nd oligonucleotides labeled with 35 S-dATP using terminal deoxynucleotidyl transferase. (A) Hybridization using a Xenopus NT-4 mRNA-specific oligonucleotide having the sequence 5'CCCACAAGCTTGTTGGCATCTATGGTCAGAGCCCTCACATAAGACTGTTTTGC3 '. (SEQ ID NO: 95) (B) Hybridization using a control oligonucleotide of similar length and content in G + C. After hybridization the sections were washed in 1 x SSC at 55 ° C followed by exposure to x-ray films for 10 days. Shown in the figure are photographs of the revealed X-ray films. Note the intense labeling on many small cells with the NT-4 probe and the absence of labeling with the control probe. The arrows point to large oocytes (step VI) that are not labeled with either of the two probes. Scale bar, 2 mm. FIGURE 10. Clear-light illumination of emulsion autoradiographs showing oocytes expressing NT-4 mRNA in the Xenopus ovary. Sections hybridized with Xenopus NT-4 mRNA probes. (A, B) or control (C), as described in FIG. 9 were coated with Kodak NTB2 emulsion, exposed for 5 weeks, developed and contrasted to light with cresyl violet. This figure shows clear field micro photographs of the revealed sections. Note the strong labeling of NT-4 mRNA on small oocytes (Steps I and II) and the absence of labeling on large oocytes (Steps V and VI) in Table A. Table B shows a larger magnification of the area within the rectangle in Table A. Note the intense cytoplasm marking of Stage II oocytes shown in the photograph. (C) No labeling can be observed using the control probe. Abbreviations: n, nucleus; fc, follicle cells; 73 993 6526-079-118

-13-, and. The levels of NT-4 mRNAs in oocytes at different stages of ogenicity were determined using autoradiographs (Fig. (shown in Figure 10) of sections hybridized with the Xenopus NT-4 mRNA probe specific for counting the number of grains in a unit area The unit area chosen was about one-hundredth of a step I oocyte The expression of NT-4 mRNA was determined by transfer of Northern blots during the experiment. The oocytes were then pooled in the indicated groups following the steps described by Dumont, 1972, J. Morphol, 136: The total ovary and the The follicular cells released were also included in the analysis. Total cellular RNA was then prepared and 40æg / well of RNA was electrophoresed on a 1% agarose gel containing formaldehyde. This was transferred to a nitrocellulose filter and hybridized with a 600 bp HincII fragment of the 3 'exon of the Xenopus NT-4 gene. The filter was washed with high severity and exposed for five days to an X-ray film. Note the marked decrease in the level of NT-4 mRNA in oocytes in steps V and VI. FIGURE 13. (A) The partial amino acid sequence of xNT-4 (SEQ ID NO: 51) indicating the positions where the degenerate oligonucleotides were synthesized and used to initiate amplification of human and rat genomic DNA by the chain reaction with polymerase. The arrows indicate oligonucleotides representing degenerate sense or antisense oligonucleotides. A set of degenerate oligonucleotides for the 2Z primer represents amino acids 184-189 of rBDNF (SEQ ID NO: 52). The partial amino acid sequence of NT-4 from Xenopus

Up to amino acid 223 as shown is from amino acid 167 depicted in Figure 4, supra. (B) Degenerate oligonucleotides used for cloning of human and rat NT-4. The 3Z oligonucleotide in Figure 13 is comprised of a mixture of 3Z and 3Z 'to allow degeneracy of the serine codon. 2Y (SEQ ID NO: 53) / 2Z (SEQ ID NO: 54) / 3Y (SEQ ID NO: 55), 3Z (SEQ ID NO: 56), 3'Z (SEQ ID NO: 57) and 4Z (SEQ ID NO: ID NO: 58). (C) Cloning tails for degenerate oligonucleotides 3 '(SEQ ID NO: 59) and 5' (SEQ ID NO: '60). Eur-lex.europa.eu eur-lex.europa.eu FIGURE 14. DNA sequence of the isolated fragment encoding a portion of rat NT-4 (SEQ ID NO: 61). The predicted open reading frame for the peptide encoded by the rNT-4 nucleic acid fragment is represented by the single letter code (SEQ ID NO: 62). The sequence in parentheses forms part of the pcr primer. FIGURE 15. DNA sequence of the isolated fragment encoding a portion of human NT-4 (SEQ ID NO: 63). The predicted open reading frame for the peptide encoded by the nucleic acid fragment hNT-4 is represented by the single letter code (SEQ ID NO: 64). The sequence in parentheses forms part of the PCR primer. FIGURE 16. Induced amino acid sequence alignment from representative neurotrophins. Amino acids are indicated using single letter code. Identical amino acids are indicated by dots. Dashed lines indicate an insertion of 7 amino acids within the conserved region of both rNT-4 (SEQ ID NO: 62) and hNT-4 (SEQ ID NO: 64). XNT-4 (SEQ ID NO: 65) / rNGF (SEQ ID NO: 66), rBDNF (SEQ ID NO: 67), rNT-3 (SEQ ID NO: 68). x = Xenopus. r = rat, h = human. The sequence in parentheses forms part of the PCR primer. FIGURE 17. (A) DNA sequence of an isolated fragment encoding a portion of human NT-4 (SEQ ID NO: 69). Peptide 73 993

6526-079-118 encoded by the 192 bp hNT-4 nucleic acid fragment is represented by the single letter code (SEQ ID NO: 70). The sequence in parentheses forms part of the PCR primer. (B) 5 'end primer oligonucleotide sequence, designated hNT-4-5 # / [containing a sequence (SEQ ID NO: 71) encoding ETRCKA (SEQ ID NO: 72)], used in primary DNA amplification genomic primer together with the 3 'end primer, designated 4Z (SEQ ID NO: 58) [containing a nucleotide sequence encoding WIRIDT] (C) Sequence of oligonucleotides of the 5' end primer used to amplify the reaction product of primary PCR. The primer, designated hNT-4-5 " ' [containing a sequence (SEQ ID NO: 73) encoding DNAEEG (SEQ ID NO: 74)] was used with the 3 ', 4Z primer (SEQ ID NO: 58) to obtain a 162 bp fragment (plus bp of the cloning tail). The 162 bp PCR fragment was then used in a PCR separation reaction using our previously used upstream PCR fragment (designated 2YZ3Z) to generate the single 192 bp fragment plus the cloning tail shown in (A). Further information on the 3 'extended nucleic acid sequence was obtained following subcloning and sequencing of this fragment. FIGURE 18. DNA sequence of that portion of the human genome 7-2 isolated phage clone encoding human NT-4 (SEQ ID NO: 75). The predicted hNT-4 protein encoded by genomic clone 7-2 is represented by the single letter symbols for amino acids (SEQ ID NO: 76). The boxed region represents the predicted cleavage site of the hNT-4 preprotein. The arrows indicate residues preserved in the pre-sequence. The underlined region (N-R-S) represents a consensus sequence for n-glycosylation. The circle region represents the initiation methionine. The site of binding acceptability is located at base pairs 461-462 (AG) of SEQ ID NO: 75, representing the 3 'end of the intron. FIGURE 19. Alignment of deduced amino acid sequences from representative neurotrophins (SEQ ID NOS 77-92). Amino acids are indicated using single letter code. Amino acids identical to those encoded by the human genome phage clone 7-2 (SEQ ID NO: 77) are indicated with an asterisk. The dotted lines represent interruptions at homologous amino acids as compared to the protein encoded by SEQ ID NO: 77. FIG. 20. DNA sequence of the isolated fragment encoding a portion of the human genome phage clone, 2-1 (SEQ ID NO: 93). The predicted open reading frame of the peptide encoded by the isolated nucleic acid fragment is represented by the single letter code (SEQ ID NO: 94). FIGURE 21. DNA sequence of the isolated fragment encoding a portion of the human genome phage clone, 4-2 (SEQ ID NO: 116). The predicted open reading frame for the peptide encoded by the isolated nucleic acid fragment is represented by the single letter code (SEQ ID NO: 117). FIG. 22. Analysis of human NT-4 mRNA expression by Northern blot. Human tissue specific mRNA was purchased from Clontech. RNA electrophoresis (10 μg) on a 1% agarose-formaldehyde gel followed by capillary transfer to a nylon membrane (MagnaGraph, Micron Separations, Inc.) with 10X SSC (pH 7). RNAs were membrane crosslinked under UV action by exposure to ultraviolet light (Strataiinker, Stratagene, Inc) and hybridized at 65øC with a radioactively labeled probe (a 680 bp XhoI-NotI fragment containing the complete coding region of HG7-2 NT-4 (see Example in Section 9, infra) in the presence of 0.5 M NaP04 (pH 7), 1% bovine serum albumin (Fraction V, Sigma), 7% SDS, 1 mM EDTA (Mahmoudi and Lin, 1989, Biotechniques No. 331-333), and 100æg / ml sonicated denatured salmon sperm DNA (sonicated) .The filter was washed at 65øC with 2X SSC, 1% SDS and autoradiographed overnight with an intensification screen (Cronex, DuPont) and X-ray film (XAR-5, Kodak) at -70Â ° C 73 993 6526-079-118 -17 The staining of the gel with ethidium bromide demonstrated that equivalent levels of total RNA had been tested for the different samples (as in Maisonpierre et al., 1990, Science 247: 1446-1451).

Lane 1: Poly (A) + fetal liver mRNA; Lane 2: poly (A) + mRNA of the fetal brain? Lane 3: poly (A) + prostate mRNA; Lane 4: poly (A) + muscle mRNA; Lane 5: Poly (A) + gut mRNA? Lane 6: Poly (A) + kidney mRNA; Lane 7: Poly (A) + liver mRNA; Lane 8: poly (A) + spleen mRNA; Lane 9: poly (A) + thymus mRNA; "Range 10: poly (A) + ovary mRNA? Flank 1Γ: mRNA pol (A) + testicular; Lane 12: poly (A) + placental mRNA; Lane 13: Poly (A) + brain mRNA; Range 14: Total RNA of brain. FIGURE 23. Supernatants of transfected COS cell lines; (PCMX-HG7-2Q), N7 (pCMX-hNT-3 / hNT-4) and XI (pCMX-XNT4 / hNT4) were tested in 10 μΐ, 50 μΐ and 250 μ volumes volumes for neurite outgrowth activity in DRG explants. A supernatant from a simulated transfected cos cell line was used as the control. FIGURE 24. Supernatants of COS, Q1 (pCMX-HG7-2Q) and M (pCMX-HG7-2M) cell lines were tested for their survival promoter activity in DRG-associated cells. The volumes tested ranged from 5 μΐ to 250 μΐ in a total volume of 2 ml. FIGURE 25. Enriched cultures in motor neurons isolated from E14 rat embryos were treated with two dilutions of COS cell supernatants from the M cell line (pCMX-HG7-2M). Biological activity was measured by choline acetyltransferase (CAT) activity, as described in Fonnum, 1975, J. Neurochem. 24: 407-409. Both a simulated transfected COS (MOC COS) cell line and an untreated motor neuron (C-NT) were shown as controls. DETAILED DESCRIPTION OF THE INVENTION The present invention provides NT-4 genes and proteins. It is based, at least in part, on the cloning, characterization, and expression of the NT-4 gene.

In particular, the present invention provides recombinant nucleic acid molecules encoding NT-4. These molecules comprise a sequence substantially as shown in Figure 1 (SEQ ID NO: 1) for viper, Figure 1 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 43) or Figure 8 (SEQ ID NO: 49). ) for Xenopus NT-4. Figure 15 (SEQ ID NO: 63), Figure 17 (SEQ ID NO: 69) or Figure 18 (SEQ ID NO: 75) for (SEQ ID NO: 93) and Figure 21 (SEQ ID NO: 116) for a human NT-4-like sequence, or a sequence that is at least about seventy percent homologous to any of those sequences in which the homology refers to sequence identity (e.g., a sequence having 70 percent homology with a second sequence sharing 70 percent of the same nucleotide residues with the second sequence).

In a particular aspect, the present invention, detailed in Section 8 of the Example and in Figure 15 (SEQ ID NO: 63, SEQ ID NO: 64) set forth herein, the nucleotide and amino acid sequence for a portion of a molecule of neurotrophin. In another aspect of the present invention, detailed in Section 9 of the Example and in Figure 17 (SEQ ID NO: 69, SEQ ID NO: 70) and in Figure 18 (SEQ ID NO: 75, SEQ ID NO: 76) determining the nucleotide and amino acid sequence for the entire human neurotrophin molecule. In another aspect of the present invention detailed in section 9 of the Example and in Figure 20 (SEQ ID NO: 93, SEQ ID NO: 94) and in Figure 21 (SEQ ID NO: 116, SEQ ID NO: 117) detailed nucleotide and amino acid sequences for a portion of clones of a human genomic phage, 2-1 and 4-2, respectively, which are similar but not identical to the nucleotide and amino acid sequences described in Figure 18 (SEQ ID NO: 75). Although this human neurotrophin molecule is referred to herein as human neurotrophin-4, it should be understood that this molecule may be the human homologue of the Xenoous neurotrophin-4 described herein or, alternatively, a molecule of distinct but homologous neurotrophin. Similarly, the molecule referred to herein as rat NT-4 may be the rat homolog of NT-4 or, alternatively, a distinct but homologous neurotrophin molecule. The processes and compositions of the present invention do not depend on any individual nomenclature. The present invention also provides for NT-4 protein or substantially purified peptidic molecules. These molecules may comprise a sequence substantially as shown here in Figure 2, (SEQ ID NO: 1 and SEQ ID NO: 2), Figure 4 (SEQ ID NO: 44) Figure 8 (SEQ ID NO: 50), Figure 14 (SEQ ID NO: 62), Figure 15 (SEQ ID NO: 64), Figure 20 (SEQ ID NO: 64), Figure 18 (SEQ ID NO. SEQ ID NO: 117) for NT-4, or a sequence that is at least seventy percent homologous to any of these sequences. In further specific non-limiting embodiments of the invention, a substantially purified protein or peptide comprises the sequence KCNPSGSTTR (SEQ ID NO: 96). In another embodiment of the invention, a substantially purified peptide or protein comprises the sequence RGCRGVD (SEQ ID NO: 97). In yet another embodiment of the invention, a substantially purified peptide or protein comprises the sequence KQWIS (SEQ ID NO: 98). In yet another embodiment of the invention, a substantially purified peptide or protein comprises the sequence KQSYVR (SEQ ID NO: 99). In yet another embodiment of the invention, a substantially purified peptide or protein comprises the sequence GPGXGGG (SEQ ID NO: 100), wherein X represents one of the group of 20 amino acids. In a further embodiment of the invention, a substantially purified peptide or protein comprises the sequence GPGVGGG (SEQ ID NO: 101) or GPGAGGG (SEQ ID NO: 102). In yet another embodiment of the invention, a substantially purified peptide or protein comprises the sequence ESAGE (SEQ ID NO: 103). In yet another embodiment of the invention, a substantially purified peptide or protein comprises the sequence -20- 73 993 6526-079-118 DNAEE (SEQ ID NO: 104).

The proteins and peptides of the invention may be produced by chemical synthesis using standard techniques or may be made using the nucleic acid molecules of the invention encoding NT-4 using eukaryotic or prokaryotic expression systems known to a person skilled in the art, such as described in PCT application, PCT / US90 / 04916, filed August 29, 1990, issued as WO 91/03569, which is hereby incorporated by reference in its entirety or as exemplified infra (see Section 6.2.4 below, and Figure 5) for transient expression in COS cells. The present invention also provides the use of NT-4 in promoting the growth and / or survival of cells of the nervous system, in particular, but not limited to, dorsal root ganglion cells or neural placental derivatives (see Section 6.2 4, infra, and Figure 6, for example). The present invention also provides portions of nucleic acid or amino acid sequence of NT-4, substantially as follows for NT-4 in Figures 1, 2, 4, 8, 14, 15, 17, 18, 20, or 21 (SEQ ID NO: ID NO listed above) which are not identical to portions of BDNF, NGF, or NT-3 of substantially the same size. The present invention further provides a eukaryotic or prokaryotic cell containing recombinant nucleic acid encoding NT-4 and expressing recombinant NT-4 protein. In a specific embodiment the cell is a eukaryotic cell, such as a COS cell. Accordingly, the present invention also provides a recombinant NT-4 protein or peptide which is produced by insertion into the recombinant nucleic acid cell encoding NT-4 (e.g., by transfection, transduction, electroporation, microinjection , etc.) under conditions allowing the expression of NT-4 and subsequent isolation of NT-4 from the cell.

In addition, the present invention provides PCR molecules using, for example, the following oligonucleotides as primers: 5'CAGTATTTTTACGAAACC (SEQ ID NO: 105) and 3 (SEQ ID NO: 106) for human NT-4 and 5'CAGTATTTTTACGAGACG (SEQ ID NO: 107) and 3'CGATTGTTGGCTTTACA (SEQ ID NO: 108) for rat NT-4, using as template any genomic DNA or suitable cDNA. In a specific embodiment of the invention, such primers may be used in conjunction with human cDNA as a template to produce fragments of the human NT-4 gene which are suitable for cloning. .................................................. .... The production and use of derivatives, analogs, and related peptides with NT-4 are also contemplated, and within the scope of the present invention. Such derivatives, analogs, or peptides having the desired neurotrophic activity, immunogenicity or antigenicity may be used for, for example, therapeutic, or in immunoassays, for immunization, etc. Derivatives, analogs or related peptides with NT-4 can be tested for the desired activity by methods known in the art.

The related NT-4 derivatives, analogs and peptides of the invention may be produced by various methods known in the art. The manipulations that result in their production may occur at the level of the gene or the protein. For example, the cloned NT-4 gene can be modified by any of the numerous strategies known in the art (Maniatis, T., 1982, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). The NT-4 sequence can be cleaved at appropriate sites with restriction endonuclease (s), followed by further enzymatic modification, if desired, isolated and ligated in vitro. In the production of the gene encoding a derivative, analogue or related peptide with NT-4, care must be taken to ensure that the modified gene remains in the same open reading frame as NT-4, uninterrupted by translation stop signals, in the region of the gene where the desired specific NT-4 activity is encoded. -22- 73 993 6526-079-118

In addition, the NT-4 gene may be mutant in vitro or in vivo, to create and / or destroy translation, initiation, and / or termination sequences, or to create variations in coding regions and / or to form new endonuclease sites restriction or destroy pre-existing ones, to facilitate subsequent in vitro modification. Any technique for mutagenesis known in the art may be used including, but not limited to, locally directed mutagenesis in vitro (Hutchison, C. et al., 1978, J. Biol. Chem. 253: 6551), use of TABr Pharmacia), etc.

As discussed below, the prepro or mature NT-4 coding region may be used to construct neurotrophin-based chimeric genes. For example, neurotrophin genes including but not limited to NGF, BDNF and NT-3 can provide the prepro region for the construction of chimeric neurotrophin and prepo / mature coding region of NT-4 genes.

Manipulations of the NT-4 sequence may also be performed at the protein level. Any of the numerous chemical modifications may be performed by known techniques including but not limited to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.

In addition, chemically analogous and related peptides can be synthesized with NT-4. For example, a peptide corresponding to a portion of NT-4 that mediates the desired neurotrophic activity can be synthesized using a peptide synthesizer. The present invention further provides a method of treating fertility disorders related to ovarian / oocyte dysfunction. As shown in the examples below, in particular in Section 7, NT-4 is involved in the maturation of oocytes. The discussion in Section 7.3 shows that NT-4 is produced by oocytes, is preferentially concentrated in immature oocytes relative to mature oocytes, and appears to play a role in oogenesis. The putative function of NT-4 protein in the ovary appears to be coupled to events occurring in the pre-vitellogenic oocyte and early / semi-early vitellogenic.

It has been established that other members of the BDNF / NGF / NT-3 gene family, in particular NGF, are involved in meiotic maturation (Nebrada et al., 1991, Science, 252, 558-563). Since the N-4-kefiexibido NGF-like properties (see Section 6, infra) can be used as a factor involved in the regulation of oocyte development. These properties of NT-4 can be exploited to provide a method for treating infertility disorders and / or other ovarian dysfunctions associated with oogenesis.

Thus, according to the invention, there is provided a method of treating infertility disorders and / or other ovarian dysfunctions comprising administering a therapeutically effective amount of NT-4 or an NT-4 related peptide in a pharmaceutically effective carrier. A therapeutically effective amount is one which induces the appropriate maturation of an oocyte and / or ovulation. For example, a therapeutically effective dose may be sufficient to maintain circulating NT-4 levels in the serum at a concentration of about 1 to 100 x 10 - °M. The additional effective dose setting is within the prediction of an expert in the art.

Effective doses of NT-4 or a related peptide with NT-4 formulated in suitable pharmacological carriers may be administered by any suitable route including, but not limited to, injection (e.g., intravenously, intraperitoneally, intramuscularly, subcutaneously, etc.). ), by absorption through epithelial or mucocutaneous layers (eg, oral mucosa, rectal or intestinal mucosa, etc.); etc. -24-. '73 993 6526-079-118

In addition, NT-4 or an NT-4 peptide can be used in any suitable pharmacological carrier, linked to a target carrier or molecule (e.g., antibody, hormone, growth factor, etc.) and / or incorporated into liposomes, microcapsules, and preparation for controlled release prior to in vivo administration.

Each respective mammalian NT-4 DNA sequence may be used as a 32 P labeled probe to isolate a respective genomic and cDNA clone by the methods outlined in the Materials and Methods section of the SEC " below: The fragments of the human NT-4 gene and rat NT-4 can be used directly (as 32P-labeled probes) or indirectly (to deduce a PCR strategy as described below) to isolate NT-4 cDNA or genomic clones from other mammals , based on the unique nature of the amino acid 7 insertion in the coding region of rNT-4 and hNT-4, or other unique aspects of the human or rat NT-4 coding region.

Any mammalian NT-4 gene isolated through the information disclosed by the human and rat NT-4 sequence can be used in the various manipulations discussed for Xenopus NT-4. although it is not limited thereto. For example, mammalian NT-4 proteins and peptides following the characterization of the full-length gene as discussed in the Example of Section 9 may be produced using the NT-4 molecules of the respective mammal in a prokaryotic or eukaryotic expression system known to a person skilled in the art, such as those described in PCT Application, PCT / US90 / 04916, filed August 29, 1990, published as WO91 / 03569, or as exemplified infra (see Section 6.2.4., supra, and Figure 5) for transient expression in COS cells. Additional functions for mammalian NT-4, as described infra for Xenopus NT-4. include, but are not limited to: promoting growth and / or survival of cells of the nervous system, in particular, but not limited to, dorsal root ganglion cells or neural placental derivatives (see Section 6.2.4., and Figure 6, for example), treatment of fertility disorders related to η '- 73 993 and 6526-079-118. Treatment of infertility disorders and / or other ovarian dysfunctions associated with oogenesis (see Section 6), treatment of motor neuron diseases (see Section 10). ), treatment of epithelial hyperplasia such as benign prostatic hypertrophy (see Section 10), treatment of impotence as related to prostate glandular function (see Section 10) and thus the therapeutically effective amounts of mammalian NT-4 for treatment of said disorders as formulated in suitable pharmaceutical carriers to provide a pharmaceutical composition may be administered by any suitable route including " but " but not limited to injection (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, etc.) by absorption through the epithelial or mucocutaneous layer (eg, oral mucosa, rectal and intestinal mucosa, etc.), etc.

Additionally, NT-4 or rat NT-4, human or other mammal peptide can be used in any suitable pharmacological carrier, linked to a target carrier or molecule (e.g., antibody, hormone, growth factor, etc.). .) and / or incorporated into liposomes, microcapsules, and controlled release preparations prior to in vivo administration.

In addition, the present invention, which relates to nucleic acids encoding NT-4 and to proteins, peptide fragments or derivatives derived therefrom, as well as antibodies directed against NT-4 protein, peptides or derivatives, can be used to diagnose or monitor the progression of diseases and disorders of the nervous system which are associated with changes in NT-4 expression pattern. Such changes may be a decrease or increase relative to normal patients, preferably, or other samples withdrawn from the patient, or from previously withdrawn patient samples.

In various embodiments of the invention, NT-4 genes and related nucleic acid sequences and subsequences, including complementary sequences, may be used in

Hybridization for diagnosis. NT-4 nucleic acid sequences or subsequences thereof, comprising about 15 nucleotides, may be used as hybridization probes. Hybridization tests may be used to detect, prognose, diagnose or monitor conditions, disorders, or disease states associated with changes in NT-4 levels. For example, the data presented in the Example of Section 10 reveals specific human NT-4 expression in tissue in skeletal muscle as well as in the prostate, thymus and testis gland. The level of expression of human NT-4 in muscle tissue may be indicative of the presence or absence of degradation " neuronal. Thus, poly (A) + mRNA or total RNA from a tissue sample from a patient can be tested for the presence of human NT-4 mRNA in skeletal muscle tissue. In addition, the data presented in Section 10 of the Example reveals specific NT-4 expression of tissue in the human prostate gland. DNA sequences encoding NT-4 or a portion thereof, as well as a protein or an NT-4 peptide, may be useful as a therapeutic agent for treating diseases of the prostate.

In a similar process, the diagnostic tests may be immunoassays. Thus, antibodies in immunoassays can be used to quantitate the level of NT-4 in a sample of a patient in order to detect, prognose, diagnose, or monitor conditions, disorders or disease states associated with changes in NT-4 levels.

Immunoassays that may be used include, but are not limited to, competitive and non-competitive assay systems, using techniques such as radioimmunoassay, ELISA (immunoassay using antibody or enzyme-linked antigen), immunoassays by the " sandwich " precipitin, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement fixation assays, immuno-radiometric assays, fluorescent marker immunoassays, protein A immunoassays, and immunoelectrophoresis assays, to name but a few. -27- / 73-993 6526-079-118

Anti-NT-4 antibody fragments or derivatives containing the binding domain may also be used in these assays.

Antibody fragments containing the idiotype of the molecule can be generated by known techniques. For example, such fragments include but are not limited to, F (ab /) 2 fragment that can be produced by pepsin digestion of the antibody molecule; Fab 'fragments which can be obtained by reduction of the disulfide bridges thereof and Fab fragments which can be obtained by treating the antibody molecule with papain and a reducing agent. ~ * .................. ~ ..... · Diagnostic sets are also provided. For example, such an assembly may include a NT-4 specific probe in a suitable vessel. In one embodiment, the probe is an NT-4 specific antibody. In another embodiment, the probe is a nucleic acid (molecular probe) capable of hybridizing to an NT-4 nucleic acid sequence. The probe may be detectably labeled; alternatively the set may further include a labeled specific binding pair for the probe.

The above-described hybridization immunoassays and assays may also be used to quantify NT-4 levels as indicators of therapeutic efficacy by comparing levels in patient samples before and after treatment of a disorder, particularly a motor neuron disease .

In an analogous manner, the expression of human NT-4 mRNA in muscle tissue leads to potential treatment processes of disorders in motor neurons which include administration to a patient in need of such treatment of an effective amount of a NT factor -4 to support the survival, growth, and / or differentiation of motor neurons. Expression of NT-4 mRNA in human muscle suggests additional pathways for the diagnosis and treatment of neuronal disorders. Retrograde axonal transport may be characteristic of NT-4. NT-4 specific retrograde transport can be used to indicate whether neurons are responding to NT-4 in normal or disease states. Thus, the present invention provides a method of diagnosing NT-4 related peripheral nervous system disorders comprising injecting a detectably labeled peptide or NT-4 protein into a peripheral nerve, and determining whether the labeled peptide or NT-4 protein is or is not to be transported in a retrograde manner, where retrograde transport failure correlates positively with the absence of NT-4 response and indicates the presence of a NT-4 peripheral nervous system disorder. Analogous processes can be used to diagnose a disorder of the central nervous system. The evaluation of the retrograde transport may be effected by any method known in the art, including but not limited to MRI, CAT, or scintillation scanning. Such processes can be used to identify the location of a lesion of the nervous system, since the retrograde transport must decrease substantially upon reaching the lesion. The invention further provides kits for evaluating retrograde transport comprising a detectably labeled NT-4 protein, derivative or fragment, in a container. Such labeling may be with a radioactive isotope, or other labeling known in the art. The present invention may be used to treat diseases and disorders of the nervous system which may be associated with changes in the NT-4 expression pattern or may benefit from exposure to NT-4 or anti-NT-4 antibodies (or fragments thereof containing the binding domain). We have shown that human NT-4 is expressed in skeletal muscle (See Example of Section 10, infra,). Based on this finding, the invention provides for the treatment of diseases in motor neurons. A wide range of neurological disorders can affect motor neurons. Upper motor neurons, for example, are predominantly affected by cerebrovascular accidents, neoplasms, infections and traumas. Lower motor neurons, or cells of the anterior cornea, are secondarily 73 993 6526-079-118

J & R

In addition, they are subject to various disorders in which loss of the anterior cornea cell is the primary effect, including amyotrophic lateral sclerosis, childhood and juvenile atrophy of the spinal cord, polio and post-polio syndrome, hereditary neuropathies motor and sensory disorders, and toxic motor neuropathies (eg, vincristine). Disorders of motor neurons that can be treated in accordance with the present invention include but are not limited to the foregoing. Methods for formulating and administering the NT-4 protein, derivatives, fragments or antibodies thereof which may also be used include but are not limited to those described above or to those known in the art.

The invention may also be used to treat benign prostatic hypertrophy (BPH), a common but still poorly known condition that occurs primarily in males over 50 years of age. Prostate proliferation during BPH may be induced by a growth factor such as NT-4 through an autocrine loop phenomenon. Synthesis and excretion of NT-4 will be followed by the transport of NT-4 back into the prostate cell via a specific receptor on the prostatic cell membrane. Autocrine loops have been defined for various growth factor molecules and tumor cell lines. In some cases, these autocrine loops were experimentally defined by the use of antisense approaches for autocrine loop rupture. Thus, a therapeutic application of the present invention includes the use of an antisense nucleic acid for human NT-4 or a portion thereof to inhibit the translation of NT-4 mRNA into the prostate, (for procedures which may be used see the application copending US Serial No. 07 / 788,784 filed July 3, 1991 and incorporated herein in its entirety by reference). For example, a patient suffering from a localized disease in the prostate, characterized by increased transcription of an NT-4 gene in prostate tissue relative to transcription levels of the NT-4 gene in the prostate of normal patients, may be An effective amount of an oligonucleotide is administered to treat a prostate disease, preferably benign prostatic hypertrophy. The oligonucleotide must be at least 6 nucleotides in length and be complementary to at least one. portion of the RNA transcript of the NT-4 gene, and thus be able to hybridize to the RNA transcript. In addition, anti-NT-4 antibodies can be used to inhibit the binding of NT-4 to its specific receptor on the prostate cell membrane. A therapeutically effective amount of an antisense nucleic acid or an anti-NT-4 antibody can be delivered in any way described above. The invention may also be used to treat other prostate-related disorders, specifically impotence. Such disease may be the direct or indirect result of inadequate levels of NT-4 in the prostate. Thus, both the detection of dysfunction and the treatment of the patient for impotence by the application of a therapeutically effective amount of NT-4 protein, or a functional fragment or NT-4 derivative can be delivered by any of the processes described above . The present invention discloses the detection of NT-4 expression in human thymus tissue. Thus, the invention may also be used to treat immunological disorders affecting neuromuscular transmission, including but not limited to myasthenia gravis, an acquired autoimmune disorder associated with the acetylcholine receptor (AChR) in the postsynaptic folds at the neuromuscular junction . The disease manifests itself as muscle weakness and fatigue due to the blockade of postsynaptic AChR or muscle membranes by binding of AChR-specific antibodies. (See for example, Drachman, 1983, Trends, Neurosci 6: 446-451). Treatment of such immunologically mediated neurological disorders may include therapeutic applications of the NT-4 protein or a functional fragment or NT-4 derivative, dispensed by any of the processes described above. The present invention provides a method of treating disorders of motor neurons comprising administering. r / -31- 73 993

J 6526-079-118 to a patient in need of such treatment, an effective amount of an NT-4 protein, derivative or peptide fragment capable of supporting the survival, growth and / or differentiation of motor neurons as demonstrated in a culture system in vitro.

In vitro embodiments. effective amounts of neurotrophic factor may be desirably determined on a case-by-case basis, since motor neurons of different tissue sources or of different species may exhibit different sensitivities to the neurotrophic factor. For any particular culture, it may be desirable to construct a dose response curve that correlates the concentration of the neurotrophic factor and the response of the motor neuron. To assess motor neuron survival, growth, and / or differentiation, motor neurons exposed to an NT-4 protein, derivative or peptide fragment of NT-4 can be compared to motor neurons not exposed to an NT-4 protein, derivative or peptide fragments of NT-4, using, for example, vital dyes to evaluate survival, phase contrast microscopy and / or neurofilament staining to measure the germination of neurites, or techniques that measure the bioactivity of compounds associated with motor neurons, such as choline acyltransferase (CAT), or any other methods known in the art. CAT activity can be measured, for example, by harvesting and lysis of treated and untreated motor neurons in a 20 mM Tris-HCl solution (pH 8.6) containing about 1% Triton X-100, removing an aliquot of a few microliters, and measuring CAT activity using as substrate 0.2 ml of [1-C] acetyl-CoA, 300 mM NaCl, 8 mM choline bromide, 20 mM EDTA, and 0.1 mM neostigmine in buffer 50 mM NaH2 PO4 (pH 7.4) using the micro-Fonnum procedure as described in Fonnum, 1975, J. Neurochem. 24: 407-409, incorporated herein in its entirety by reference.

In a specific, non-limiting embodiment of the invention, motor neurons, and cultured in vitro, can be prepared. as follows. At least a portion of the spinal cord, obtained preferably from an embryonic organism such as the rat, can be aseptically obtained and separated from the bulb, sensory ganglia and adherent meninges. The ventral segments of the marrow can then be isolated, since the motor neurons are located in the ventral (anterior) corneas of the spinal cord. The ventral segments of the bone marrow can be dissected into small pieces and incubated in about 0.1% trypsin and 0.01% deoxyribonuclease type 1 in phosphate buffered saline (PBS) free of calcium and magnesium at 37 ° C for 20 minutes. The trypsin solution can then be removed, and the cells can be washed and placed in a fresh medium, such as 45% Eagle's Minimum Essential Medium (MEM), 45% Ham's F12 nutrient mixture, inactivated fetal bovine serum by 5% heat, 5% heat inactivated horse serum, glutamine (2mM), penicillin G (0.5 U / ml), and streptomycin (0.5æg / ml). The tissue can be mechanically dissociated by gentle milling through a Pasteur pipette, and the supernatants combined and filtered through a nylon filter (for example, Nitex, Tekto; 40æm). The filtered cell suspension can then be fractionated using a modification of the method presented by Schnaar and Shnaffner (1981, J. Neurosci. 1: 204-217). All steps are desirably carried out at 4 ° C. Metrizamide may be dissolved in F12: MEM medium (1: 1) and a discontinuous gradient consisting of an 18% metrizamide (e.g., 0.5 ml) pad, 3 ml 17% metrizamide, 3 ml of 12% metrizamide, and 3 ml of 8% metrizamide. The filtered cell suspension (for example 2.5 ml) can be layered over the batch gradient and the tube can be centrifuged at 2500 g for 15 minutes using a swing rotor (e.g., Sorvall HB4). Centrifugation may result in three cell layers: fraction I (at the 0-8% interface), fraction II (at the interface 8-12%) and fraction III (at the interface 12-17%). Fraction I, enriched in motor neurons, can be removed in a small volume (for example, about 1 ml) and washed twice with a defined serum-free medium, such as 50% F12 and 50% MEM medium supplemented with glutamine (2 mM), insulin (5 μg / ml), transferrin (100 μg / ml), progesterone (20 nM), putrescine (100 μM), and sodium selenite

J 6526-079-118 (30 nM, see Bottenstein and Sato, 1979 Proc Natl Acad Sci USA 76: 514-517). The counting of the viable cells can then be obtained by hemocytometer counting in the presence of trypan blue. The suspension of cells enriched in motor neurons can then be plated at a density of about 100,000 cells / cm 3 tissue culture wells (preferably 6 mm) previously coated with poly-L-ornithine (e.g. æg / ml) and laminin (for example, 10 æg / ml). An NT-4 protein, derived or peptidic factor, may be added. For example, in specific embodiments, NT-4 may be added to give a final concentration of about,, ΐΐ and 100æg / ml, and preferably about 50æg / ml. Cultures of motor neurons may be maintained in defined serum-free medium at 37øC in an atmosphere of 95% air / 5% CO 2 and about 100% relative humidity.

In a further embodiment of the invention, the NT-4 related recombinant nucleic acid sequence, such as that contained in the bacteriophage HG7-2, HG4-2, and / or HG2-1, can be used to construct prepro / NT chimeric genes -4. For example, when it is desired to express a mature NT-4 protein, a peptide derivative or fragment in vivo or in vitro. the prepro region of a distinct neurotrophic gene may be fused to the mature coding region of the related sequence with NT-4. The neurotrophic genes that can provide the prepro region include but are not limited to NGF, BDNF, and NT-3. Such a chimeric construct may promote the stability of the chimeric mRNA transcript relative to a wild-type NT-4 mRNA transcript, may increase translation efficiency or may produce a template more suitable for proteolytic processing in a protein or fragment biologically active peptidic neurotrophin of mature, biologically active, thus enhancing expression. One skilled in the art has the knowledge necessary to construct such chimeric nucleic acid sequences given the published DNA sequences of other neurotrophin genes such as NGF (Scott et al., 1983, Nature 302: 538-540, Ullrich et al. 1983, Nature 302: 821-825), BDNF-34 73 993 6526-079-118 (Leibrock et al., 1989, Nature 341: 149-152) and NT-3 (Honh et al., 1990, Nature 344 , Et al., 1990, Proc. Natl. Acad Sci USA, 7, 5454-5458, Rosenthal et al., 1990, Neuron et al., 1990, Science 247: 1446-1451. 4: 767-773), as well as indications of strategies for producing a fusion junction (for example, see Darling et al., 1983, Cold Spring Harbor Symposium Quantitative Biology 48: 427-434; Edwards et al., 1988 , J. Biol Chem 263: 6810-6815, Suter et al, 1991, EMBO J. 10: 2395-2400) In another embodiment, chimeric constructs which fuse the prepro region of a recombinant nucleic acid related to NT -4, such as those contained in the ba and HG2-1, with the mature regions of other neurotrophins, may also be used to promote the effective expression of these other neurotrophins, as discussed supra. The present invention also provides processes for detecting or measuring NT-4 activity. As described in Example 12, we have found that trkB is a functional NT-4 receptor. Based on these findings, the invention provides methods for detecting or measuring NT-4 activity comprising exposing a cell expressing trkB to a test agent, and detecting or measuring the binding of the test agent to trkB, wherein the specific binding to trkB correlates positively with the NT-4 activity in the test agent. In a specific embodiment, the trkB-expressing cell is a transfected cell, such as 3T3 fibroblast, which expresses recombinant trkB, such that cell survival is dependent on exposure to neurotrophin-4 or BDNF. Thus, the detection of binding of the test agent can be effected by observing the survival of these transfected cells.

6. EXAMPLE: EVOLUTIVE STUDIES OF THE FAMILY OF THE NERVE GROWTH FACTOR REVEAL A NEW MEMBER ABUNDANTLY EXPRESSED ON THE XENOPUS OVARY 73 993 6526-079-118

-35-

6.1. MATERIALS AND METHODS 6. 1. 1. PREPARATION OF DNA Genomic DNA was isolated by standard procedures (Davis et al., 1986, Basic Methods In Molecular Biology " Elsevier, New York) of human leukocytes and rat liver Sprague-Dawley, frog fenopus laevis) and ray (Raia clavata). Genomic DNA was also obtained from salmon (Salmon) and elephant snake (Vipera lebetina). The DNA was precipitated with ethanol, collected using a glass hook, washed with 80% ethanol, dried and " dissolved in water to a final concentration of 1 mg / ml. Salmon DNA (Sigma, St. Louis, MO) was dissolved in water, extracted twice with phenol and once with chloroform, and precipitated with ethanol. 6. 1. 2. POLYMERASE CHAIN REACTIONS, MOLECULAR CLONING AND DNA SEQUENTIATION Six separate blends of 28 oligonucleotides representing all possible codons corresponding to the amino acid sequence KQYFYET (SEQ ID NO: 110) (5'-oligonucleotide) and WRFIRID (SEQ ID NO: 111) (oligonucleotide-3 ') (Fig. 1A) were synthesized on a DNA synthesizer of Applied Biosystems A381. The 5 'oligonucleotide contained a synthetic EcoRI site and the oligonucleotide-37 contained a synthetic HindIII site (Knoth et al., 1988, Nucl Acids Res. 16: 1093; Numberg et al., 1989, J. Virology 63, 3240 -3249). Each oligonucleotide mixture was then used to initiate 0.8 æg amplification of genomic DNA using the polymerase chain reaction (PCR) (Taq DNA polymerase, Promega) (Saiki et al., 1985, Science 230: 1350-1354 ). PCR products were digested with HindIII and EcoRI. analyzed on a 2% agarose gel and cloned into the plasmid Bluescript KS + (Stratagene, La Jolla, CA). The size of the amplified region plus primers is 179 base pairs (bp) for NGF and 182 bp for BDNF and NT-3. As a result of internal EcoRI sites in some cases, smaller fragments of 144 bp and 95 bp were also isolated. The cloned DNA fragments were sequenced using the chain termination process by dideoxy nucleotides -36-73993 6526-079-118 (Sanger et al., 1977, Proc Natl Acad Sci USA 74: 5463-5467) with T7 DNA polymerase (Pharmacia, Uppsala). Seventeen to twenty independent clones were sequenced for each gene and species, and in total more than 200 independent clones were sequenced.

Approximately 2,000 clones from a Xenopus genomic library prepared by insertion of Mbol digested genomic DNA into the BamHI site of the EMBL-3 phage were screened using standard procedures with an 18-2 bp NT-4 'PCR fragment. ................ of xenopus with Î ± -32P] dCTP by shear translation for a specific activity of approximately 5 x 108 cpm / Âμg. Hybridization was performed in 4 x SSC (1 x SSC is 150 mM NaCl, 15 mM sodium citrate (pH 7.0)), 40% formamide, 1 x Denhardt's solution, 10% sulphate dextran at 42 " W. The filters were washed at 55øC in 0.1x SSC, 0.1% SDS and exposed to Kodak XAR-5 films at -70 " C. Eight phage clones were isolated, and a 1.5 kb Psti fragment of hybridization from one of these clones was subcloned into plasmid pBS-KS (Stratagene). The nucleotide sequence of the subcloned fragment was determined by the chain termination process by dideoxy nucleotides (Sanger et al., 1977, Proc Natl Acad Sci USA 74: 5463-5467).

6. 1. 3. COMPUTERIZED ANALYSIS OF SEQUENCE DATA

Comparisons and alignments of the DNA and amino acid sequences shown in Table I were performed on a VAX computer using the UWGCG software (Devereux et al., 1984, Nucl Acid Res. 72: 387-395). The results of comparing the amino acid sequences using the UWGCG programs are presented as percent amino acid or nucleotide identity similarity between the sequences, taking into account the conservative amino acid changes (Gribskov and Burgess, 1986, Nucl Acid Res. : 6745-6763, Schwartz and Dayhoff, 1979, " An Atlas of Protein Sequence and Structure ", ed Natl Biomed Res. Found, Washington DC, pp. 353-358). Phylogenetic Analysis Using Parsimony (version 3.0f PAUP) was used for the construction of the filograms (Felsenstein, 1988, Annu Rev. Gene -37-73993 6526-079-118 22:52-555; Swofford and Olsen , 1990, in " Molecular Systematics ", Hills and Moritz, Eds. Sunderland, MA, Sinaver Assn., Pp pp 441-501). Investigations for the most likely trees were performed using both exhaustive and heuristic algorithms (branch exchange). 6. 1. 4. PRODUCTION OF RECOMBINANT PROTEIN,

PCI2 CELL CONNECTION TEST, AND NEUROTROPHIC ACTIVITY TESTS

For the transient expression of recombinant proteins in COS cells, appropriate DNA fragments were cloned into the pXM vector (Yang et al., 1986, Cell 47: 3 -10). For NT-4 the xenopus sequenced 1.5 kb PstI fragment was cloned into pXM, and for NGF a 771 bp BstEII-PstI fragment from exon 37 of the rat NGF gene (Halbook et al., 1988 ,

Development 108: 693-704). To express the BDNF protein, a PCR amplified fragment containing the BDNF gene prepro coding sequence of the mouse BDNF gene was also subcloned into pXM (Hofer et al., 1990. EMBO J., 9: 2459-2464 ). for NT-3, a 1020 bp mouse cDNA clone was inserted into pXM (Norfors et al., 1990, Proc. Natl. Acad. Know. USA 87: 5454-5458). COS cells (Gluzman, 1981, Cell 3: 175-182) grown to about 70% confluency were transfected with 25æg of plasmid DNA per 100 mm dish using the DEAE-dextran-chloroquine protocol (Luthman and Magnusson, 1983, Nucl Acids Res. 17: 1295-1305). The transfected cells were then grown in complete medium (DMEM with 10% FCS), and conditioned medium was harvested 3 days post-transfection. Plates (35 mm) transfected in parallel were grown until the third night after transfection in the presence of 200 μg / ml [35 S] cysteine (Amersham, UK). Aliquots (10-20 μg each) of conditioned media labeled in vivo were analyzed by SDS-PAGE on 13% polyacrylamide geis. The geis were treated with EnHance (New England Nuclear, Boston, MA), dried, and exposed to Kodak XAR-5 films with intensifying screens for 24-48 hours at 80 ° C. The autoradiographs were scanned in a Shimadzu densitometer, and the relative amounts of the different recombinant proteins were estimated by calculating the area corresponding to each protein relative to the area obtained with rat NGF. The absolute amount of rat NGF protein was obtained by quantitative immunoblotting of the conditioned media using purified mouse NGF standards, and was used to determine the concentration of protein in samples containing other recombinant proteins.

For the binding assay of recombinant proteins to PC12 cells (Greene and Tischler, 1976, Proc Natl Acad Sci USA 73: 2424-2428), mouse NGF was labeled with " 125 I by the process of T-chloramine for an average activity of 7 x 107 cpm / g. Steady state binding was measured by competition assays performed at 37øC or 0øC using 1 x 10 4 cells per ml, 125 I-NGF at 1.5 x 10-9 M; and serial dilutions of conditioned media containing equivalent amounts of NGF or NT-4. All components were added at the same time, and the cells were harvested by centrifugation after equilibration (1-3 hours incubation). Control experiments using simulated transfected COS cell media showed that other proteins present in conditioned media had no effect on 125 æg of binding to PC12 cells. Nonspecific binding was measured in a parallel incubation in which at least an excess of 1000-fold unlabeled NGF was added. All results were corrected for this non-specific binding which was always 10% lower than the total binding.

The biological activities of the different proteins were measured by the ability of the conditioned media of the transfected COS cells containing equal amounts of recombinant protein to stimulate the outgrowth of neurites from sympathetic explants, dorsal root ganglia and nodosa of E9 chicken embryos (Ebendal, 1984, " Organizing Principles of Neural Development, S. Sharms, ed., New York: Plenum Publishing Corp., pp. 93-107; Ebendal, 1989, " Use of Collagen Gels to Bioassay Nerve Growth Factor Activity In Nerve Growth Factors ", RA Rush, ed. (Chichester: John Wiley & Sons, pp. 81-93) 73 993 / - 6526-079-118

Serial dilutions of conditioned medium were tested and the fibrous excrescences were counted.

6. 1. 5. RNA PREPARATIONS AND TRANSFER ANALYSIS

The indicated tissues of adult female Xenopus were dissected and frozen in liquid nitrogen. The brain and spinal cord were combined. Several ovary lobes were dissected, including oocytes of different stages. Frozen tissue samples were homogenized in 4 M guanidine isothiocyanate, 0.1 M 3-mercaptoethanol, 0.025 M sodium citrate (pH 7.0) and homogenized three times for 15 s with a Polytron. Each homogenate was layered onto a pad of 4 ml of CsCl in 0.025 M sodium citrate (pH 5.5) and centrifuged at 15øC in a Beckman SW41 rotor at 35,000 rpm for 76 hours (Chirgwin et al. 1979, Biochemistry 78, 5294-5299). The poly (A) + RNA was purified by cellulose-oligo (dT) chromatography (Aviv and Leder, 1972, Proc Natl Acad Sci USA 69: 1408-1412) and the recovered RNA was spectrophotometrically quantified before use in RNA transfer analysis. The poly (A) + RNA (10 μg) of each sample was electrophoresed on a 1% agarose gel containing 0.7% formaldehyde. UV-transillumination of the stained gel was used to confirm that all samples contained similar amounts of intact RNA. The gel was then transferred to a nitrocellulose filter. The filter was hybridized with the indicated DNA probes. The probes were tagged with [α-33 P] dCTP by shear translation with a specific activity of about 5 x 10 5 cpm, and the hybridization was performed as described above. The filters were washed under high stringency conditions (0.1 x SSC, 1% SDS, 54øC) and exposed to Kodak XAR-5 films.

6. 2. RESULTS

DNA fragments encoding human, rat, snake, frog, and fish NGF, BDNF and NT-3 were isolated using the PCR technique with degenerate primers from regions conserved in these three proteins, located between lysine 50 and threonine 56 to the upstream primer and between tryptophan -40- / 73 993 6526-079-118 C-99 to aspartic acid 105 to the downstream primer (Fig. 1A). The amplified region contains three of the six cysteine residues and covers about one third of the mature molecules. A comparison of the amplified region in the already characterized NGF molecules of different species shows that it contains two variable regions, from arginine 59 to serine 67 and aspartic acid 93 to alanine 98. A hydrophilic region believed to be exposed on the surface of the molecule Bradshaw, 1978, Ann. Rev. Biochem., 47: 191-216), as well as the highly conserved regions of glycine 68 to tryptophan 76 and threonine 85 to threonine 91 are also included in the amplified region. The BDNF and NT-3 molecules have an extra amino acid between positions 94 and 95 of the mouse NGF protein, which is also included in the amplified region.

Sequences of the complete mature NGF, BDNF and mouse NT-3 protein mature molecule were compared in order to calculate the representativity of the amplified region in the complete molecule. Complete mature molecules show 65/57% similarity (amino acid sequence identity / nucleotide sequence identity) between NGF and BDNF, 70/61% similarity between NGF and NT-3 and 68/58% similarity between BDNF and NT-3. When comparing the isolated region in this study, the similarity between NGF and BDNF is 62/53%, between NGF and NT-3 is 67/58% and between BDNF and NT-3 is 69/60%. This strongly suggests that the region isolated in this study is representative of the complete molecule and can be used to monitor the evolutionary relationships between the different factors. Sequence comparison was performed (Table I), taking into account conservative amino acid substitutions, using the Schwartz and Dayhoff comparison matrix (1979, " In Atlas of Protein Sequence and Structure, MO Dayhoff, ed. , Washington, DC, Natl Biomed Res. Found, pp. 353-358). In addition, comparison of the amino acid sequences given below and presented in Table I indicate the percentage of similarity, not identity. Phylogenetic trees were constructed using parsimony analysis (Felsenstein, 1988, Ann. Rev. Genet., 22: 521-565; Swofford and Olsen, 1990, " In Molecular 73 993 6526-079-118

-41-

Systematics, D. M. Hills and C. Moritz, eds., Sunderland, MA: Sinauer Assoc., Inc., pp.411-501). As shown below, all DNA fragments isolated with predicted amino acid sequences related to those of NGF, BDNF, and NT-3 contained conserved cysteine residues in the correct positions. This was used as the initial criterion for considering a sequence as a member of the nerve growth factor gene family.

6. 2. 1. NGF, BDNF and HDNF / NT-3 are HIGHLY PRESERVED DURING A " EVOLUTION ---------------------------- * .................... ..

The nucleotide sequence (Fig. 1B [SEQ ID NO: 3), mouse (SEQ ID NO: 4), chicken (SEQ ID NO: 5), viper SEQ ID NO: 6), Xenopus (SEQ ID NO: 7), salmon (SEQ ID NO: 8)) and the predicted amino acid sequence of isolated fragments encoding NGF are highly conserved from fish to human (Fig. (SEQ ID NO: 24), chicken (SEQ ID NO: 26), viper (SEQ ID NO: 27), Xenopus (SEQ ID NO: 28), salmon (SEQ ID NO: : 29)] Most non-conservative amino acid changes were found in the variable regions of arginine 59 to serine 67 and aspartic acid 93 to alanine 98 (Fig 2) .The similarity between the Xenopus NGF sequences and human is 93/79% (Table I) Xenopus and chicken NGF are identical except for a conservative shift from lysine 62 to arginine 62 (Figure 2) Viper and salmon NGF sequences contain 11 and 19 different amino acids (from 42), compared to human NGF, while all other species showed only four differences. None of the isolated NGF amino acid sequences contained the extra amino acid residue present in BDNF and NT-3 between glutamic acid 94 and lysine 95 of the human NGF sequences.

The inter-species relationships of the different NGF sequences were analyzed by the construction of a phylogenetic tree (Fig. 3A). The salmon NGF sequence appears to have diverged more than the NGF sequences isolated from other species. -42- 73 993 6526-079-118

No NGF sequence can be isolated from the streak using the described PCR technique, suggesting that the NGF sequences from the streak may be above the mismatch tolerance of the primers used in our PCR protocol. Alternatively, the absence of NGF in cartilaginous fish may imply that NGF appeared after the separation of the branch leading to the evolution of bony fish (about 450 million years ago), but before the amphibians and superior vertebrates evolved from this branch ( about 400 million years ago).

TABLE I

NGF

Hum Rat Gal Vib Xen Human Salt - 95 93 86 93 69 Rat 87 - 88 87 88 69 Chicken 80 73 - 90 100 74 Viper 73 72 75 - 90 67 Xenonus 79 73 83 76 - 74 Salmon 60 61 60 51 53 - Raia XXXXXX 73 993 6526-079-118 ΝΤ-3 -43- Hum Rat Gal Xen Salt Streak - 100 100 100 81 88 91 - 100 100 81 88 81 83 - 95 81 86 XXXXXX 73 79 86 - 86 90 67 64 71 71 - 74 76 73 71 72 71

Hum Rat Gal Vib. Xen Sal Raia - 100 95 86 95 100 93 91 - 95 86 95 100 93 88 84 - 91 91 95 93 83 78 85 - 88 86 84 73 82 85 82 - 95 88 82 80 83 75 78 - 99 77 76 78 74 74 78-

J 73 993 6526-079-118

Nucleotide identities and amino acid similarities were calculated with a VAX computer (UWGCG software package Devereux et al., 1984, Nucl Acids Res. 12: 389-395) according to the Schwartz and Dayhoff comparison matrix ( 1979, Washington, DC Natl. Biomed Res Res., Pp.353-358), taking into account conservative amino acid changes. The figures below the diagonals show the percentage of nucleotide identity. The figures above the diagonals show the percentage of amino acid similarity. X indicates that the sequences were not isolated from those species (ray NGF and vibro NT-3). Hum, human; Gal, " chicken? Vib, viper; Salt, salmon; Xen, Xenoous.

6. 2. 1. 2. NEUROTROPHIC FACTOR DERIVED FROM BRAIN

DNA sequences similar to human BDNF were found in all species investigated (Fig. 1B [SEQ ID NOS: 1-21, supra listed). The similarity in the amino acid and nucleotide sequences, between the ray, the most primitive species investigated, and the human are 93/77% (Table I). Only two non-conservative changes were observed outside the variable regions, while ten similar changes were found in two variable regions (Fig. 2). In Xenopus. (SEQ ID NO: 34) leucine 90 is replaced by a phenylalanine as a result of a mutation in a single base pair, C to T in the first position of the codon, and in salmon (SEQ ID NO: 35), tryptophan 77 is substituted by a tyrosine as a result of a double mutation, changing the codon from TGG to TAT (Fig. 1B [SEQ ID NO: 14]). All isolated sequences contained an extra amino acid residue at position 96, compared to NGF (Fig.2 [SEQ ID NO: 24-29]). BDNF sequences from different species appeared as a homogeneous group of sequences when analyzed by the parsimony process (Figure 3B). 6. 2. 1. 3. NEUROFOTOXIN-3

The predicted nucleotide and amino acid sequences for human NT-3 (SEQ ID NO: 16 and 37), mouse (SEQ ID NO: 17 and 38), chicken (SEQ ID NO: 18 and 39), Xenopus (SEQ ID NO: ID NO: 19 and 40), salmon (SEQ ID NO: 20 and 41), and streak are highly similar -45-73993 6526-079-118 (Figs. 1B, Figure 2). Most of the changes are silent mutations that result from changes in the third position of the codons, usually transitions that preserve the pyrimidine or purine structure of the base pair. Only non-conservative amino acid changes were found in the two variable regions and no amino acid substitutions occurred outside the two variable regions. The salmon sequence does not contain Asp-94 which is present in all other NT-3 molecules (Fig. 2) and has a greater distance from the branching point in the phylogenetic tree than the NT-3 sequences of the other species (Figure 3C). " ...... ---- NERVE GROWTH FACTOR GENE FAMILY MEMBER Additional DNA fragments were isolated from viper (SEQ ID NO: 1) and Xenopus (SEQ ID NO: 2), and the predicted amino acid sequences (SEQ ID NO: 22 and SEQ ID NO: 23, respectively) revealed that these fragments contained all three cysteine residues in the same positions as in NGF, BDNF and NT-3 (Fig. 1B, Fig. 2). A comparison with the Xenopus NGF, BDNF and NT-3 sequences indicated that this new sequence is related but not identical to the sequences of other members of the NGF family. The gene comprising this sequence was therefore termed neurotrophin-4 (NT-4). Comparison of the nucleotide and amino acid sequences show that Xenopus NT-4 and viper have a similarity of 91/73%. This similarity is in the same range as that found between NGF and Xenopus BDNF and viper (Table I). As for the other members of the NGF family, nonconservative amino acid changes were only observed in the two variable regions (Fig. 2). A comparison of the phylogenetic trees for NGF, BDNF and NT-3 showed longer branches in the NGF tree, indicating a higher rate of evolutionary changes (Figures 3A-3C). The ratio of each member of the NGF family to the other members was studied by constructing a filogram comparing the amino acid sequences deduced to the four members of the family. The phylogogram showed that NGF is more closely related to NT-3 than to BDNF and NT-4 (Figure 3D). NT-3 is as closely related to NGF as to BDNF. NT-4 is more clearly related to BDNF than to other members. 6. 2. 2. STRUCTURAL CHARACTERISTICS OF NT-4 PROTEIN

In order to allow a more detailed characterization of the NT-4 gene and its gene product, we screened a Xenopus genomic library with the NT-4 PCR fragment and isolated a 16 kb insert phage clone. From this insert a 1.5 kb PstI fragment was subcloned and sequenced, Figure 4A (SEQ ID NO: 43). The nucleotide sequence contained an open reading frame encoding a 236 amino acid protein (SEQ ID NO: 44) which presented various structural aspects characteristic of the other members of the NGF family. The amino terminus of the predicted NT-4 protein contains a putative 18 amino acid signal sequence in which a 4 amino acid region is identical to the corresponding BDNF regions in the pig and rat (Leibrock et al., 1989, Nature 341: 149- 152, Maisonpierre et al., 1990, Science 247: 1446-1451). A potential signal cleavage site follows, which is also identical to that proposed for BDNF (Figure 4A). A potential cleavage site for a mature NT-4 protein of 123 amino acids is found following amino acid 113 on the prepro-NT-4 protein. A single predicted N-glycosylation site (Asn-Lys-Thr) is located 8 amino acids prior to the putative cleavage site.

A comparison of mature NT-4 protein with mature BDNF, NT-3 and mature NGF proteins revealed 60%, 58% and 51% amino acid identity, respectively. All 6 cysteine residues involved in the formation of disulfide bridges [Figure 4B (SEQ ID NO: 45-48)] are included in mature NT-4 protein. Regions that are identical between NGF, BDNF and NT-3 are also similar in NT-4 protein. Most of the sequence differences between NT-4 protein and the other three proteins were found in the same previously variable regions identified in the other members of the family.

6. 2 3. CONNECTION TO NGF-R AND NEUROTROPHIC ACTIVITY OF NT-4 The 1.5 kb Peno I fragment of Xenoous was cloned into the pXM expression vector (Yang et al., 1986, Cell 47: 3-10) and transiently expressed in COS cells. SDS-PAGE of transfected cells conditioned media from [35 S] -cysteine showed an NT-4 protein with a 14K Mr (Figure 5A). The NGF protein produced and tagged in parallel plates migrated somehow faster than NT-4 protein. This difference in mobility is probably due to variations in the charge of the two proteins. Similar mobility differences were also observed for NGF proteins of identical sizes of different species.

Conditioned media from transfected COS cells containing equal amounts of rat NGF and Xenopus NT-4 protein were tested for their ability to compete for 125I-labeled NGF binding to their receptor on PC12 cells. Binding tests were performed at 37 ° C and under conditions where 80% of the cell-associated 125 I-NGF is bound to the low affinity NGF-R (Sutter et al., 1979, J. Biol. Chem 254: 3972) . Similar concentrations of NGF and NT-4 (6 x 10 -10 M) were required to displace 50% of 125i-ngf from PC12 cells, indicating that the two proteins bind to the low affinity NGF-R with a similar affinity (Figure 5B). At high concentrations, NT-4 protein was less effective at 125I-NGF shift, suggesting that in this case the remaining cell-associated 125I-NGF was bound to high affinity or internalized receptors. The fact that this difference may not be observed in a parallel assay carried out at 0 ° C in which membrane mobilization or internalization does not occur suggests that NT-4 protein is not able to compete with NGF for interiorization, a process known to be exclusively mediated through high affinity receptors (Olender and Stach, 1980, J. Biol. Chem. 255: 9338-9343: Bernd and Greene, 1984, J. Biol. Chem. 259: 15509-15516; Hosang and Shooter, 1987, EMBO J.

73 993 6526-079-118, 1197-1202). The transiently expressed NT-4 protein in COS cells was tested for its ability to promote neurite outgrowth from chick embryo ganglion explants. Clear stimulation of neurite outgrowth was observed in chicken dorsal root ganglion explants (Figure 6A). Comparison of the dose response curves using equal amounts of NT-4 and NGF proteins revealed that the NT-4-obtained activity was lower than that observed with NGF (Figures 5A and 5B) rSs " BDNF proteins and Recombinant NT-4 stimulated the outgrowth of neurites in dorsal root ganglia to a similar extent (Figures 6A and 6C). NT-4 protein caused a weak but consistent outgrowth of neuritis from nodose ganglia (Figure 6G), although no detectable ganglia could be detected in sympathetic ganglia (Figure 6E). This contrasts with NGF, which strongly stimulates the outgrowth of neurites from sympathetic ganglia. (Figure 6F), and with NT-3, which showed clear activity in nodose ganglia (Figure 6H). As for NT-4, the activity of promoting the outgrowth of BDNF neurites in the nodose ganglia (Figure 61) was lower than the activity observed with NT-3.

6. 2. 4. EXPRESSION OF NT-4 mRNA IN DIFFERENT XENOPUS FABRICS

Polyadenylated RNA was prepared from 11 different Xenopus tissues and used for Northern blot analysis. Hybridization with the Xenopus NT-4 probe revealed high levels of two 2.3 kb and 6.0 kb NT-4 transcripts in the ovary (Figure 7A). In contrast, the level of NT-4 mRNA was below the detection limit in all other tissues analyzed. Hybridization with the Xenopus NGF probe showed a 1.3 kb NGF mRNA in the heart (Figure 7A) and in the brain. However, the amount of NGF mRNA in these tissues was on the order of 100 times less than the level of NT-4 mRNA in the ovary. NGF mRNA was also detected in the ovary, although the amount of NGF mRNA was approximately 100 fold lower than the level of 73 993 6526-079-118. eur-lex.europa.eu eur-lex.europa.eu NT-4 mRNA in this tissue (Figure 7B). The levels of NT-3 and BDNF in the ovary were both below the detection limit (Figure 7B).

6. DISCUSSION

We used the polymerase chain reaction (PCR) in combination with degenerate oligonucleotide primers to isolate the genes for different members of the NGF family from different species. A comparison of the nucleotide and amino acid sequences of the mature complete proteins NGF, BDNF and NT-3 revealed similarities that are the same as those obtained by comparing the region of the genes analyzed in this study. Thus, this region appears to be representative of the rest of the gene and can thus be used to study the evolutionary conservation of mature complete protein.

The NGF, BDNF and NT-3 genes of different species include regions that show complete identity between fish and mammals as well as regions of low similarity. A comparison of NGF sequences from different species with the corresponding BDNF or NT-3 sequences showed that the NGF gene is less conserved in vertebrates than BDNF and HDNF / NT-3. The latter two genes appear to be equally conserved in all species studied except salmon, where NT-3 is less conserved than BDNF. In this context, it is interesting to speculate about the fact that the molecular clock seems to accelerate in some branches, notably that of NGF, and not in others. It is generally believed that there is a selective force that preserves the correct tertiary structure of the protein (Dickerson, 1971, J. Mol. 71: 2848-2852). The difference in the evolutionary conservation of the three factors suggests that there has been a greater selective pressure on the BDNF and NT-3 genes than on the NGF gene. Environmental changes were proposed to lead to changes in selective pressure by altering the optimal performance of a specific gene product (Kimura, 1983, " Evolution of Genes and Proteins ", pp.208-233). In this context, it is possible that the most extensive evolutionary changes observed /

73 993 6526-079-118

Cp. In NGF when compared to BDNF and NT-3, reflect the fact that the NGF function has been further modified during evolution. NGF structure-function studies have shown that this molecule can tolerate considerable structural changes without loss or modification of its activity profile, suggesting that the lowest degree of evolutionary conservation of NGF may be due to a more stable structure of this protein, which is thus less easily disturbed by substitutions. Another possible explanation is that the regions of the genome where the genes for the different factors are located have different overall mutation rates. Different rates of mutation have been reported for regions of the non-coding genome (Wolfe et al., 1989, Nature 337: 283-285) but this is less clear if it can lead to an increased number of alterations in coding regions. NGF and salmon NT-3 are markedly different when compared to these molecules in other species. Amino acids, including threonine 82 and histidine-threonine-phenylalanine at position 85 to 87 in NGF, as well as the absence of the amino acid between positions 94 and 95 (compared to the two other proteins), are consistent features of the NGF protein. The fact that the isolated salmon sequence contains all these specific NGF motifs argues that this is not an additional member of the family but represents the salmon NGF. In contrast to all other NT-3 sequences studied, salmon NT-3 does not have the amino acid at position 95. Since the extra amino acid is present in the streak NT-3, it is likely that the common ancestor of the streak and salmon had an ancestral NT-3 sequence that included the extra amino acid at position 95. Thus, changes in the salmon NT-3 molecule must have occurred after this separation of the common ancestor gene. Most amino acid changes in the salmon sequence are in the same regions which vary, to a lesser extent, also in the other species, strongly suggesting that the isolated NGF and salmon NT-3 sequences are not pseudogenes. The greater divergence of NGF and NT-3 from salmon, compared to other species, probably reflects the high degree of evolutionary expansion of bone fish. -51- 73 993 .. - /. 6526-079-118

The results in this study indicate that the NGF family probably existed 500 million years ago in primitive fish, which were the ancestors of present-day superior vertebrates. The gene family may have been formed by genetic duplication, which is believed to be the most common mechanism through which new genes evolve (Li, W., 1983, " Evolution of Genes and Proteins ", pp.14-37) . Duplications of functional genes may have been facilitated, since all the information necessary for the synthesis of a biologically active protein is contained in a 3 'exon (Hallbook et al., 1988, Mol. Cell Biol., 8: 452-456 , Leibròck et al., 1989, Nature 341: 149-152, Hohn et al., 1990, Nature 344: 339-441). Family formation involved multiple gene duplications (Figure 3D).

Since NT-4 is more closely related to BDNF than to NT-3 or NGF, it appears that NT-4 and BDNF were formed from a common ancestral gene. However, since no parent molecule has been distinguished from all four factors, the evolutionary relationship of the putative ancestor BDNF / NT-4 with the ancestors of NGF and NT-3 can not be definitively established . The topology of filograms using data from different species is generally in agreement with the consensual evolutionary relationship between different species. However, for both NGF and BDNF, the chicken sequences show an earlier branch in the filogram than expected. Comparison of viper NT-4, NGF and BDNF and Xenopus revealed that the NT-4 sequences in these species have 11 amino acid substitutions, compared to 9 and 8 substitutions in NGF and BDNF, respectively. This suggests that in these species, NT-4 diverged at a rate that is comparable to, or faster than, the rate of divergence of NGF or BDNF.

Highly conserved amino acid substitutions in the NGF molecule do not eliminate biological activity, but in many cases affect the amount of protein produced, indicating that there are other constraints other than biological activity, such as protein stability, which 993 6526-079-118 may be important for the conservation of NGF protein. In addition, the fact that all members of the NGF family may interact with low affinity NGF-R suggests that the complete conservation of certain regions in these factors may be due to constraints in these genes to retain proteins that may interact with NGF-R . The basic mechanisms and strategies for early embryo ontogeny are similar in all vertebrates and presumably involve genes that are conserved in all vertebrates. The evolutionary conservation of neurotrophic factors is thus consistent with the notion that they are important in early embryonic development ..... in many different species. The hippocampus contains the highest levels of NGF, BDNF, and NT-3 mRNA in the brain (Ernfors et al., 1990, J. Dev Neurosci., 57-66). It is a highly specialized structure derived from the archipelium that first appeared in the brains of amphibians and reptiles. Mammalian hippocampus is important for memory, learning, and cognitive functions known to be associated with high neuronal plasticity (Crutcher and Collins, 1982, Science 277: 67-68). These requirements may have produced selective pressure during phylogeny for mechanisms of plasticity promotion, possibly mediated by neurotrophic factors. However, the results in this study clearly show that the event of gene doubling for neurotrophic factors largely preceded the formation of the hippocampus. This evidence indicates that neurotrophic factors did not evolve as a consequence of hippocampal formation and supports the notion that neuronal plasticity in this region of the brain is at least in part due to these molecules. The organization of the nervous system of the primitive vertebrates, that is to say, cartilaginous fish, presents some basic similarities with the nervous system of superior vertebrates. The cranial nerves and the sensory and autonomous somatic nervous system in cartilaginous fish are generally similar to those of the higher vertebrates (Young, J. Z., 1981, The Life of Vertebrates, New York, Oxford University Press). It is 73 993 6526-079-118 rjr

Thus the principles of neurotrophic interactions are likely to be the same in both the primitive and the higher vertebrates. The evolutionary conservation of NGF-like neurotrophic factors also in primitive vertebrates suggests that these factors initially evolved in invertebrates and were then adapted to function in the development of the vertebrate nervous system. Our study of the evolutionary conservation of the NGF family led to the isolation of a new member of this family, called neurotrophin-4 or NT-4, TCR fragments from the " NT-4 gene were isolated from Xenopus and viper, and a clone was subsequently isolated from Xenopus. Analysis of the nucleotide sequence of this clone revealed an open reading frame for a 236 amino acid protein, which showed several structural characteristics resembling those of the other three members of the NGF family. This includes the presence of a putative amino-terminal signal sequence and a potential N-glycosylation site near a proteolytic cleavage site which predicts a mature NT-4 protein of 123 amino acids. The size of the mature NT-4 protein is 4 amino acids longer than that of BDNF and NT-3, and 5 amino acids longer than the mature NGF protein. In mature NT-4 protein, all 6 cysteine residues involved in the formation of disulfide bridges are conserved. The NT-4 protein differs from the other members of the family in the same regions that vary between the sequences of the other three members of the family. As for NGF, BDNF, and NT-3, the complete prepro-NT-4 protein is encoded in a single exon. Thus, both the organization of the gene and the structural features of the predicted protein indicate that the NT-4 gene is an additional member of the NGF family. The fact that the NT-4 gene has been isolated from both reptiles and amphibians suggests that it is present in several different species.

Both BDNF and NT-3 showed interaction with low affinity NGF-R (Rodriguez-Tebar et al., 1990, Neuron 4: 487-492, Edsfors et al., 1990, Proc. Natl. Acad Sci USA 87: 5454-5458). -54- 73 993 6526-079-118 Xenopus NT-4 protein shifted 125I-NGF from its low affinity receptor on PCI2 cells, indicating that the fourth member of this family may also interact with low affinity NGF-R. Comparison of displacement curves obtained at 37 ° C and 0 ° C suggests that NT-4 protein can not compete for binding to high affinity NGF-R. The protein encoded by the low affinity NGF-R gene appears to be part of both the low and high affinity receptors (Hempstead et al., 1989, Science 243: 373-375). The mechanism by which two kinetically different receptors are formed from the same receptor gene is not known, although it has been proposed that the two states can be produced by the formation of a complex between the cytoplasmic domain of the receptor and an intracellular protein (Radeke et al. al., 1987, Nature 325: 593-597: Meakin and Shooter, 1991, Neuron 6: 153-163). Alternatively, a high affinity receptor chain can be encoded by a separate gene and, similarly to the interleukin-2 receptor (Hatakeyama et al., 1989, Science 744: 551-556) and to the growth factor receptor derived from platelets (Matsui et al., 1989, Science 243: 800-804). the two receptor chains may form a dimer that constitutes the high affinity receptor. The fact that all four members of the NGF family can interact with the low affinity NGF-R suggests that the low affinity NGF-R state may be in a manner not yet known to mediate the biological effects of all these factors. In this context, it is interesting to note that the low affinity NGF-R gene was shown to be expressed in many tissues of both neuronal and non-neuronal origin, not known to respond to NGF. This includes the mesenchyme, neural tube cells and somites in the early chick embryo (Halbrook et al., 1990, Development 108: 693-704 Heuer et al., 1990a, Dev Biol., 137: 287-304; al., 1990b, Neuron 5: 283-296), as well as to develop and regenerate spinal motor neurons (Ernfors et al., 1989, Neuron 2: 1605-1613; Ernfors et al., 1991, J. Dev Neurosci 9: 57-66). it will therefore be of interest to investigate whether NT-4 protein is of functional importance in any of these tissues or neuronal populations. The neurotrophic activity of NT-4 protein was assayed in explants of chick embryonic ganglia, and as for three other members of the NGF family, the NT-4 protein showed a clear stimulation of the neurons outgrowth from dorsal root ganglia. However, when compared to NGF, NT-4 protein showed lower activity in the dorsal root ganglia. Both BDNF and NT-3 readily induce the outgrowth of neuritis in explants of nodous ganglia, although the NT-3 response was consistently stronger than with BDNF. NGF strongly stimulates the outgrowth of neurites in sympathetic ganglia, and NT = 3 also has activity in these ganglia, although it is much smaller than that of NGF (Maisonpierre et al., 1990, Science 247: 1446-1451;

Ernfors et al., 1990, Proc. Natl. Acad. Know. USA 87: 5454-5458). NT-4 showed weaker activity on nodal ganglia compared to NT-3 and no activity on sympathetic ganglia. The spectrum of the biological activity of NT-4 in explants of peripheral ganglia resembles that of BDNF, which is in agreement with the fact that NT-4 is structurally similar to BDNF. Northern blot analysis of 11 different tissues of Xenopus showed elevated levels of NT-4 in the ovary, while the level of NT-4 mRNA was below the detection limit in all other tissues examined. Two 2.3 kb and 6.0 kb NT-4 mRNAs were found in oocytes. The presence of two transcripts of the same gene was previously observed for BDNF, in which case two 1.4 kb and 4.0 kb mRNAs are present in rat brain (Leibrock et al., 1989, Nature 341: 149-152 , Maisonpierre et al., 1990, Science 247: 1446-1451, Ernfors et al., 1990a, Proc Natl Acad Sci USA 87: 454-5458). Hybridization with a Xenopus NGF probe revealed NGF mRNA in the heart of Xenopus, probably as a result of the expression of NGF mRNA in target tissues for neuronal innervation. the level of NGF mRNA in the heart was, however, more than 100-fold lower than the level of NT-4 mRNA in the ovary. Since the high level of NT-4 mRNA in the ovary does not correlate with neuronal innervation, it seems unlikely -56-73993 6526-079-118 that NT-4 protein has only a neurotrophic function in this case. Instead, abundant expression of NT-4 mRNA in the Xenopus ovary implies an additional and important non-neurotrophic function for NT-4 protein. NGF mRNA was also detected in Xenoous ovary although at levels about 100 fold lower than that of NT-4 mRNA; No BDNF and NT-3 mRNAs were detected in this tissue.

MRNAs were described for two growth factors as maternal mRNAs in Xenopus oocytes. One of these mRNAs encodes a protein with strong similarity as the basic fibroblast growth factor (Kimelman and Kirschner, 1987, Cell 51, 869-877); the other mRNA encodes an α transforming growth factor homologous protein (Weeks and Melton, 1987, Cell 51: 861-867). It has been suggested that these factors function as morphogens for the formation of the mesoderm and subsequent induction of this tissue in the neural tube. In the mouse, in situ hybridization studies revealed NT-3 mRNA in the epithelium of secondary and tertiary follicles, and a role for NT-3 in oogenesis was suggested (Ernfors et al., 1990, Neuron 5: 51-116) .

7. EXAMPLE: IDENTIFICATION OF CELLS EXPRESSING NT-4 mRNA IN XENOPUS LAEVIS OVARY BY IN-SITU HYBRIDIZATION

7. 1. MATERIALS AND METHODS 7.1.1. ISOLATION. MANIPULATION AND CULTURE OF OOCYTES. EMBRYOS AND XENOPUS CELLS X. leavis male and female frogs were kept in the laboratory at 19 ° C. After being anesthetized by immersing the animals in 0.25% tricaine methanesulfonate (Sandoz, Switzerland), the ovary lobes were surgically removed, washed with modified Barth's salt hepes (MBSH) (Gurdon and Wickens, 1983, Methods Enzymol. 101: 370-86) and dissociated by overnight incubation at 20øC in calcium-free MBSH and -57- 73 993 6526-079-118 containing 2 mg / ml collagenase. Separation of the extract from the pre-vitellogenic and vitellogenic oocytes was achieved by differential sedimentation, and the oocytes were then separated manually under a dissecting microscope in the various developmental classes described by Dumont (1972, supra).

Synchronous cleavage embryos were obtained by in vitro fertilization as essentially described by Newport and Kirchner (1982). Xenopus Ag kidney cells were cultured in Leibowitz L15 medium diluted with 60:40 (v / v) distilled water and supplemented with 10 mM Hepes pH 7.35, 10 μl hypoxanthine (Sigma), 4 mM glutamine and 10% fetal bovine serum (Gibco) at 20 ° C. The cultures were equilibrated with air and kept in the dark.

7.1.2. IN-SITU HYBRIDIZATION

Fresh frozen ova of adult Xenopus laevis frogs were sectioned (14 μ) in a cryostat (Leitz, Germany) and the sections were thawed on slides pretreated with poly-L-lysine (50 μg / ml) and then fixed in formalin 10% for 30 min. and washed twice in PBS. Dehydration was carried out in a graduated series of ethanol including 5 min. incubation in chloroform and subsequent drying of the slides to air. Two 53-mer oligonucleotides, one specific for Xenopus NT-4 mRNA (5'CCCACAAGCTTGTTGGCATCTATGGTCAGAGCCCTCACATAAGACTGTTTTGC3 '[SEQ ID NO: 109]) and the other, as a control, specific for chicken BDNF mRNA (corresponding to amino acids 61 to 77 of the mature chicken BDNF protein (Hallbook et al., 1991 Neuron 6: 845-58 [contained in SEQ ID NO: 11 and 32]) were labeled at the 3 'end with a35S-dATP using terminal deoxyribonucleotidyl transferase (IBI , New Haven) with a specific activity of approximately 1 x 109 cpm / μ. Hybridization was performed at 42øC for 16 hours in 50% formamide, 4x SSC, 1x Denhardt's solution, 1% sarcosyl, NaPO4 (pH 7, 0) 0.02M, 10% dextran sulfate, 0.5 mg / ml yeast tRNA, 0.06M DTT 0.1 mg / ml fragmented salmon sperm DNA and 1x107

Cpm / ml labeled oligonucleotide probe as 35S. Sections were subsequently rinsed, washed 4 times (15 min each) at 55Â ° C in 1 x SSC, rinsed with water, dehydrated in a graduated ethanol series and air dried. Sections were exposed to the X-ray film, followed by coating with Kodak's NTB-3 photographic emulsion (diluted 1: 1 in water), exposed for 5-6 weeks at -20øC, and developed, fixed and contrasted with cresyl violet.

7. 1. 3. ANALYSIS OF RNA TRANSFERS

The indicated samples were homogenized in 4M guanidine isothiocyanate, 0.1M / 8-mercaptoethanol, 0.025M sodium citrate (pH 7.0) and homogenized 3 times for 15 seconds with a Polytrone. Each homogenate was layered onto a pad of 4 ml of 5.7 M CsCl in 0.025 M sodium citrate (pH 5.5) and centrifuged at 15 ° C in a Beckman SW41 rotor at 35,000 rpm for 16 hours (Chirgwin et al. al., 1979, Biochemistry 78: 524-5299). Polyadenylated RNA (Poly (A) + RNA) was purified by oligo (dT) -cellulose chromatography (Aviv and Leder, 1972, PNAS .69: 1408-1412) and RNA recovery (40 μg) was quantified spectrophotometrically before to be used in RNA transfer analysis. Total cellular RNA (40æg) or, where indicated, poly (A) + RNA (5μg) of each sample was electrophoresed on a 1% agarose gel containing 0.7% formaldehyde. The UV transillumination of the stained gel was used to confirm that all samples contained similar amounts of intact RNA. The gel was then transferred to a nitrocellulose filter. The filter was then hybridized with a 350 bp HincII fragment from the 3 'exon of the Xenopus NT-4 gene (Hallbook et al., 1991, Neuron 6: 845-858). The fragment was labeled with Î ± -32P-dCTP by shear translation with a specific activity of about 5x101 cpm / ml and the hybridization was performed as described (Ernfors et al., 1988, Neuron. 1: 983-96 ). Filters were washed with high severity (0.1xSSC, 0.1% SDS, 54øC) and exposed to Kodak's AR-5 films at -70øC. 1

2. RESULTS 2

Sections of adult Xenopus laevis ovary tissue and -59-73993 6526-079-118 were hybridized with a 35S-dATP-labeled oligonucleotide probe specific for Xenopus NT-4 mRNA. As a control for the specificity of the hybridization, adjacent sections were hybridized with an oligonucleotide probe of the same length and GC content complementary to chicken brain derived neurotrophic factor (BDNF) mRNA. The probe specific for NT-4 mRNA revealed an intense labeling between many cells screened through the ovary with a size (50-400 μm in diameter) corresponding to oocytes in early stages of oogenesis (Fig. 9A). No NT-4 mRNA could be detected between mature oocytes, post-vitellogenic stage VI oocytes (arrows in Fig. 9A). The chicken BDNF mRNA specific control probe did not label any cells in the Xenopus ovary. Analysis of the emulsion autoradiographs of the hybridized sections revealed an intense marking between the cytoplasm of oocytes having a diameter of 50-200 μm (Fig. 10A and 10B) corresponding to the oocytes in step I according to Dumont, 1972, supra . The probe specific for NT-4 mRNA also labeled oocytes with higher diameter corresponding to steps II to IV, although the marking intensity between these cells was lower than that among oocytes in step I. According to the low amplification analysis of dark field illuminations (Fig. 9), the emulsion autoradiographs did not show any labeling between the mature oocytes in steps V and VI. No labeling was checked between any cells after hybridization with the BDNF control probe (Fig. 10C). To allow for a more detailed determination of the level of NT-4 mRNA during oogenesis, the number of grains per one arbitrarily chosen area unit was counted. The chosen unit area corresponded to approximately one-hundredth of the cross-sectional area of an oocyte in step I. The result of this analysis showed that the intensity of the labeling between oocytes in step I was 1.7 and 4.3 times greater than that of oocytes in stages II / III and IV, respectively (Fig. 11). The number of grains per unit area between the oocytes in steps V and VI was not significantly higher than the

73 993 6526-079-118 marking background.

7. 2. 1 ANALYSIS BY NORTHERN TRANSFER OF NT-4 mRNA EXPRESSION DURING OOGENESIS AND EARLY DEVELOPMENT OF XENOPUS

A fixed amount of total cellular RNA (40 μg) prepared from different steps of oocytes as well as an enriched fraction of follicle cells was analyzed by Northern blots using a Xenopus NT-4 specific probe (Hallbook et al. 1991, supra). In accordance with the results of the in situ hybridization. the higher levels of NT-4 transcripts with sizes of 2/3 kb and 6.0 kb were present in the smaller oocytes (steps I and II) (Fig. 12). The level of NT-4 mRNA declined abruptly in oocytes from the more mature stages V and VI. A weak signal of hybridization in the preparation of follicle cells was observed which was probably due to contamination with a small number of oocytes in steps I and II. The same result was obtained when the fixed amount of polyadenylated RNA (5 / Ag) was analyzed from the different samples presented in Fig.

The results of analysis of NT-4 mRNA expression in ovary showed that NT-4 mRNA is restricted to immature oocytes. To test the possibility of expression of NT-4 mRNA to be induced after fertilization, the level of NT-4 mRNA was determined in developing Xenopus embryos by Northern blotting of polyadenylated RNA. A low level of NT-4 mRNA was found in somatic Xenopus A6 kidney cells in culture which were also included in the analysis. However, NT-4 mRNA could not be detected in early embryos from the beginning of divisions by cleavage to the nerve cell stage.

7. DISCUSSION Abundant expression of NT-4 mRNA in Xenopus ovary (Hallbook et al., 1991 supra) indicates that this member of the NGF family plays a role in oogenesis and / or early embryogenesis. The localization of cells expressing NT-4 mRNA in ovary provides discernability over the putative function of NT-4 protein in ovary. In amphibians, as in all other vertebrates, fertilization of the egg triggers a period of rapid cellular cleavage. This event is controlled by a class of soluble maternal mRNAs expressed during oogenesis and stored in the infertilized egg for subsequent development (Davidson, 1986, Gene Activity in Early Development (New York, Academic Press)). This class of maternal mRNA includes two growth factors, the basic fibroblast growth factor (Kimelman and Kirchner, 1987, Cell 51: 869-77) and the? of transforming growth (Weeks and Melton, 1987, Cell, 5JL: 861-67), as well as various protooncogenes such as c-myc (Godeau et al., 1986, EMBO J. 5, 3571-77); (Vriz et al., 1989, EMBO J. 4091-97), c-fos (Mohun et al., 1989, Development, 107: 835-46). ras (Andeol et al., 1990, Dev.Biol 139: 24-34). ets-2 (Chen et al., 1990, Science, 250: 1416-1418) and c-mos (Sagata et al., 1988, Nature 335: 519-25). Cytokine-induced Xenopus oocytes in mature stage VI are caught in the prophase of meiosis I and both c-mos (Sagata et al., 1988) and ets-2 (Chen et al., 1990) have been shown to function during re-initiation of the meiotic division . The verification of elevated NT-4 mRNA levels in oocytes in stages I and II but of a decreased level below the detection limit of both Northern blots and in situ hybridization in oocytes in steps V and VI strongly suggests that the NT-4 mRNA does not belong to the maternal mRNA class. This result is also an argument against the role of NT-4 protein in the re-initiation of meiotic division or in early embryogenesis. Accordingly, addition of recombinant NT-4 protein to immature oocytes in step VI did not result in the induction of germinal vesicle cleavage in vitro and no NT-4 mRNA was detected in early Xenopus embryos. Instead, the putative function of NT-4 protein in the ovary appears to be coupled to events occurring in pre-vitellogenic and semi-precocious vitellogenic oocytes. Both NGF (Ayer-LeLievre et al., 1988 PNAS 85: 2628-2632), and the 75 kD low affinity NGF receptor (Persson et al., 1990, Science, 247: 704-707) NKF receptor high affinity trkA (JP Merlo and H. Persson, unpublished) are 73 993 6526-079-118

Expressed in the tests where NGF has recently been shown to stimulate DNA synthesis at the onset of meiosis (Parvinen et al., 1991, submitted for publication). Thus, it appears that neurotrophins do not only function as neurotrophic factors but also play an important role in reproductive tissues.

8. EXAMPLE: ISOLATION AND CHARACTERIZATION OF NUCLEIC ACID FRAGMENTS THAT ENCODER MAMMALIAN NT-4 8.1. MATERIALS AND METHODS -------------- --------------

8.1.1. DNA PREPARATION Genomic DNA was isolated as described in 6.1. 1, supra. 8.1.2.CHRIMERASE CHAIN EMULSIONS, MOLECULAR CLONING AND DNA SEQUENCING Mixtures of 34 (including tail) oligonucleotides representing all possible codons corresponding to the amino acid sequences QYFFET (contained in SEQ ID NO: 51) and QYFYET ( SEQ ID NO: 52) (5 'oligonucleotide) and WISECK, CKAKQS AND WIRIDT (each contained in SEQ ID NO: 51) (3' oligonucleotide) (Fig. 13) were synthesized with ligands as described in 6.1.2 . above. Together, 2Y (derived from xNT-4 [SEQ ID NO: 50]) and 2Z (BDNF / NT-3 derivative [SEQ ID NO: 51]) represent all sequences known for neurotrophins of all species in this region. A first amplification of both rat and human genomic DNA was performed with Taq polymerase (Cetus) at 1 minute cycles at 95øC, 2 minutes at 43 " C and 2 minutes at 72øC. An aliquot of the primary PCR reactions was then amplified using the same first amplification primers, or novel degenerate and complementary primer oligonucleotides that will result in an expected size deviation. The PCR products from the reamplification procedure were purified as follows: the bands of the expected size were gel purified, annealed, and column purified using the " primerase " of Stratagene. These were then digested completely with EcoRI and SalI. (Stratagene) and ligated into EcoRI-XhoI digested Bluescript KS (-). Transformants were selected for pBS-KS containing an insert of approximate size predicted. The cloned fragments were subjected to DNA sequence analysis as described in 6.1.2, supra. 8.1.3 ISOLATION OF GENOMIC CLONES OF TOTAL LENGTH AND OF cDNA CLONES THAT CODE rNT-4 AND hNT-4

A human ovarian cDNA library in Λ GT-10 was obtained from Clontech. An A: ZAPII human hippocampal cDNA library was obtained from Stratagene. A human genomic DNA library on EMBL3 / SP6 / T7 was obtained from Clontech. A mouse brain cDNA library on A-ZAP was obtained from Stratagene. Isolation of NT-4 clones can be carried out as follows:

A cloned insert encoding the rNT-4 fragment (Fig. 14 [SEQ ID NO: 61]) or the hNT-4 fragment (Fig.15 [SEQ ID NO: 63]) are labeled by PCR for a specific activity of approximately 5x108 cpm / ng. Hybridization was performed in a hybridization solution consisting of 0.5 mg / ml salmon sperm DNA at 60 ° C. The filters were washed at 60 ° C in 2xSSC, 0.1% SDS and exposed to a Kodak XAR-5 film at -70 ° C. Alternatively, oligonucleotides whose sequence corresponds exactly to that of the desired mammalian neurotrophin may be used to produce probes (e.g., kinase labeling) and may be used to select the same libraries by standard procedures. Positive phages were plaque purified and infected at low multiplicity, a suitable strain of E. coli in liquid broth as described by Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York) . The GT-10 and EMBL3 / SP6 / T7 phages were prepared as follows: cultures were incubated overnight at 37 " C with constant stirring. The overnight suspension is made 1 M NaCl and 8% PEG, well mixed and incubated overnight at 4 ° C to precipitate the bacteriophage. The bacteriophage was precipitated via centrifugation, and resuspended in TM buffer (10 mM Tris-HCl, pH 7.5, 10 mM MgCl 2), layered over a discontinuous CsCl gradient and centrifuged at the rate, and for the appropriate time to ligating the bacteriophage. The bacteriophage is removed, transferred to a fresh Eppendorf tube and lysed by the addition of 1 volume of formamide. EMBL3 DNA is precipitated by the addition of 2 volumes of 100% ethanol. The EMBL-3 DNA is recovered by microcentrifugation, washed with 70% ethanol and resuspended in 10 mM TM " TTris-HCl buffer; pH 7.5) 1mM Na2_EDTA). The DNA is extracted several times with isomeric phenol: chloroformioralkool (24: 24: 1), precipitated with ethanol, resuspended in TE buffer, digested with various restriction enzymes and electrophoresed through a 1% agarose gel. After electrophoresis, the digested DNA is transferred to nitrocellulose and hybridized with 32P-labeled rNT-4 or hNT-4 probes, under conditions described supra. The hybridized band is subcloned into the plasmid vector pBS-KS and subjected to DNA sequence analysis by the dideoxy chain termination process (Sanger et al., 1977, Proc Natl Acad Sci USA 74: 5463-5467) .

The X-ZAP plasmid preparations were made as follows: 200 X of XL1-Blue cells with ODQQQ = 1.0, 200 λ of high titre phage broth, and 1 do helper phage R408 (1x10 minutes pfu / ml). No phage broth was added for negative control. Incubate at 37 ° C for 15 minutes. 5 ml of 2xYT medium is added, stirred for 3 hours at 37 ° C. After 3 hours, the negative control should be cloudy and the samples clear. The samples are heated at 65øC for 30 minutes, and centrifuged at 4000 g for 5 minutes. The supernatant contains a phagemid broth. To rescue the phagemids, 0.5 λ of the broth is added to 200 λ of XL1-Blue cells (0D60q = 1). Incubate for 15 minutes at 37 ° C. 1-100 λ (preferably 10 λ) is plated on LB plates with ampicillin. Incubate at 37 ° C overnight and large colonies are stung. After purification of the plasmid DNA, the sequence is as above.

Phage cDNA libraries are selected according to standard procedures (Maniatis et al .. supra) as described above.

Positive plaques are purified, re-isolated and subjected to DNA sequence analysis as described above.

8.2. RESULTS AND DISCUSSION

A region of the NT-4 'coding sequence of " Xenopus was used as a template for the synthesis of degenerate oligonucleotide primers. Figure 13 denotes that the oligonucleotide primer 5'YY [SEQ ID NO: 53] (QYFFET) and the oligonucleotide primers -3, 3Y [SEQ ID NO: 55] (WISECK), 32 [SEQ ID NO: 56] (CKAKQS) and 4Z [SEQ ID NO: 58] (WIRIDT) were derived from the amino acid sequence of xNT-4. The 5'-2Z oligonucleotide primer [SEQ ID NO: 54] (QYFYET) is derived from the homologous region of rBDNF. All possible combinations of these degenerate oligonucleotides were used to amplify DNA from both mouse and human genomic DNA libraries. Since primers represented by 3N [SEQ ID NO: 55] and 32 [SEQ ID NO: 56] of xNT-4 are not conserved in the NGF / BDNF / NT-3 gene family, and therefore were not likely to amplify NGF, BDNF or NT-3, these two primers were used in reamplification or in the secondary PCR.

DNA fragments of approximate expected sizes were obtained by PCR amplification and reamplification of both mouse and human genomic libraries when the following primer combinations were used: (1) 2Y / 3Z (primary PCR): 2Y, 2Z 2Y / 3Z (primary PCR): 2Y, 2Z / 32 (secondary PCR) (3) 2Y / 4Z (primary PCR): 2Y, 2Z / 32 / 4Z (primary PCR): 2Y, 2Z / 3Z (secondary PCR)

PCR side products of the approximate size -66-73993 6526-079-118 were electrophoresed through a 2% agarose gel, eluted by standard techniques, digested with EcoRI and SalI, and ligated to pBS DNA -KS digested with EcoRI-XhoI. Positive transformants were selected, and the inserted fragments were subjected to DNA sequencing by the dideoxy chain termination process (Sanger et al., Supra).

An open reading frame was deduced for a portion of mouse NT-4 (Fig. 14 [SEQ ID NO: 62]) and the amino acid sequence encoding human NT-4 (Fig. ). Figure 16 shows the homologous region of the rNT-4- (SEQ ID NO: 62) and hNT-4 (SEQ ID NO: 64) fragments with representative members of the NGF / BDNF / NT-3 gene family.

An open reading frame encoding a portion of human NT-4 greater than that shown in Figure 15 is shown in Figure 17A (SEQ ID NO: 69 and SEQ ID NO: 70). Figure 17A shows additional information of the 3 'sequence for the 3' human NT-4 coding region. The 192 bp nucleic acid fragment was isolated as described above in the Description of the Figures. The current size of the PCR products recovered from the reamplification procedure was larger than expected due to an additional 7 amino acids in the rat NT-4 DNA (GPGVGGG) [SEQ ID NO: 101] and human NT-4 DNA fragment ( GPGAGGG) [SEQ ID NO: 102].

The 7 amino acid insertions of rNT-4 and hNT-4 are described as 'GPGXGGG' [SEQ ID NO: 100], where X = V for rNT-4 and X = A for hNT-4. Valine and alanine have a non-polar R group. It is not presently known whether position 4 is conserved to contain a non-polar group in other mammalian NT-4 proteins, or whether the 7 bp insert will per se be characteristic of other mammalian NT-4 genes. It is interesting to note that fish NGF has an insert of 22 amino acids in the same region as disclosed in the present invention. 73 993 ..... 6526-079-118 -¾-67- 9. EXAMPLE: INSULATION AND CHARACTERIZATION OF A HUMAN NT-4 GENOMIC CLONE We have investigated a human placental genomic library in EMBL3 / SP6 / T7 (Clontech, K802 as host). A total of 1 25 x 106 pfu were plated on large NZY plates. Duplicates of Schleicher and Schuell nitrocellulose filters were made and hybridized with a 120 bp probe (from clone 17B of hNT-4f which was obtained from human genomic DNA using primers 2Z4Z followed by 2Z3Z), labeled by PCR using 2Z / 3Z oligonucleotide primers. The filters were hybridized at 60Â ° C to the radiolabeled probe (106 cpm / ml) under the following hybridization conditions: 0.5 M NaP04, 1% BSA, 7% SDS, 1 mM EDTA, and 100 Mg / ml DNA of salmon sperm. The filters were then washed at 60 ° C with 2x SSC and 071% SDS, and autoradiographed. After four days of exposure, the positive signals were identified on the duplicate filters. A total of 7 wells were spiked, put into 1 ml SM buffer, shaken for 2 hours, and re-plated as follows: 1) 100 μl of a 10 3 dilution (1 μl in 1 ml), mixed with 100 μΐ cells and plated, almost always obtaining a confluent plaque; 2) 200 μΐ of a 10 "dilution, resulting in isolated plaques (" plaque "). Duplicate surveys were performed and screened as described above with the 120 kb probe of hNT-4. After 2 days of exposure, many positives were identified on the confluent plate for wells HG2, 4 and 7. A well isolated positive was identified in both HG4-2 and HG7-2 plates. A single plate for HG4-2 and HG7-2, set in 500 μl of SM buffer, was shaken and shaken for 2 hours, after which 100 μl of eluent was mixed with 100 μl of cells and plated. The plate was then flushed with 3 ml of SM buffer, and the supernatant was collected as the first high titre broth. The three plates were then plated using 100 μΐ of this first broth mixed with 100 μΐ cells. The plates were then overlaid with 3 ml of SM buffer and shaken in a rotary apparatus for 3 hours at room temperature. The supernatant was removed, centrifuged for removal of cell debris, followed by the addition of chloroform and 73 993 6526-079-118 /

The resultant was used as the second high titre broth. Two μΐ of high titre broth of HG4-2 and HG7-2 were loaded onto a Schleicher and Schuell nitrocellulose filter, and found to hybridize with the 180 bp rNT-4 probe [isolated from the plasmid containing a PCR insert of mouse genomic DNA using primers designed based on the sequence of our mouse NT-4 clone encoding amino acids GELSVCD (SEQ ID NO: 112) (degenerate primer) and KAESAG (SEQ ID NO: 113) (exact primer)]. Lysates of liquid plates and lysates were prepared for HG4-2 # HG7-2 and HG2-1. Phagic DNA was prepared, an aliquot of each was subjected to agarose gel electrophoresis and subjected to Southern analysis. HG4-2, HG7-2 and HG2-1 were shown to hybridize with the 180 bp rNT-4 probe (NaP04 hybridization as above, 65 eC), and with a oligonucleotide probe of 45 (GGAGGGGGCTGCCGGGGAGTGGACAGGAGGCACTGGGTATCTGAG) [SEQ ID NO: 114] corresponding to the amino acids GGGCRGVDKRHWVSE [SEQ ID NO: 115] encoded by the human PCR fragment from clone 17B (6xSSC, hybridization at 45øC). The size of the insert for these three genomic clones is approximately 9-23 kb. Both contain the exon encoding the gene (s) which is closely related to the probes used for selection, hNT-4 (120 bp) and rNT-4 (180 bp). The phage DNA for the genomic clones was digested with various restriction enzymes and subjected to Southern analysis. The appropriate fragment that hybridizes to the rNT-4 (180 bp) probe can be subcloned into the Bluescript vector. the size of the DNA fragments to be subcloned is as follows: clone 2-1 (1.0 kb Xhol fragment), clone 4-2 (4.0 kb Xhol fragment) and clone 7-2 (BamHI fragment of 5 , 0 kb). The complete coding sequence can be obtained and this information can be used to identify exon boundaries to allow subcloning of this gene into an appropriate expression vector.

To this end, nucleotide sequence analysis was performed on the human genome 7-2 phage clone, which was obtained by screening a human genomic library with a PCR fragment derived from human genomic DNA using oligonucleotides degenerate to the DNA sequence of NT-4

Xenopus (see discussion, supra). Sequence analysis revealed that human phage clone 7-2 contains a sequence identical to the sequence of the PCR fragment used as a probe for screening the genomic library. This sequence is contained in what appears to be an exon that encodes a new neurotrophic factor (Figure 18, SEQ ID NO: 75 and SEQ ID NO: 76). Alignment of the protein encoded by this exon (Figure 19, SEQ ID NO: 77) with known neurotrophins revealed that it shares features found in all known neurotrophins (Figure 19, SEQ ID Nos: 78-92). It contains a prepro region in which many of the identical amino acids conserved between the prepro regions of previously defined neurotrophins are conserved. In addition, this prepro region is preceded by a binding acceptor site located in the same region as in other neurotrophin genes. The prepro region also contains a consensus glycosylation site at the appropriate position, and ends at a cleavage site that was very similar to the cleavage sites found in the other neurotrophins (Figure 18). The prepro region of 7-2 is, however, unusual because of its short length when compared to the prepro region of known neurotrophins. The decrease in length occurs in the N-terminal portion of the prepro region, which is the least conserved portion of the prepros between the members of the family. The mature region retains all 6 cysteines found in all previously identified neurotrophins. Many of the residues shared among different members of the neurotrophin family are also conserved. Excluding the extensive sequence similarity shared by a PCR fragment derived from rat genomic DNA, which may correspond to the rat protein equivalent to that encoded by the human clone 7-2, computer alignments have revealed that the neurotrophin encoded by the phage clone 7- 2 was very similar to the Xenopus NT-4. This was true for both prepro and mature regions. The protein encoded by clone 7-2 is unusual when compared to known neurotrophins due to the presence of an insert located between the second and third cysteine in the mature region. Sequence analysis was also performed on two additional human clones isolated in the same screening procedure as clone 7-2 (see discussion, supra). The sequence of these clones was similar but not identical to that obtained from clone 7-2, increasing the possibility that they encode new neurotrophins more closely related to 7-2 than with the other neurotrophins. The partial sequence of one of these clones, clone 2-1, is shown in Figure 20 (SEQ ID NO: 93 and SEQ ID NO: 94). The sequence described above begins at the position corresponding to amino acid 50 in the alignments shown in Figure 19. The partial sequence of the remaining clone, clone-4-2, is shown in Figure 21 (SEQ ID NO: 116 and SEQ ID NO: 117) .

10. EXAMPLE: SPECIFIC EXPRESSION IN HUMAN NT-4 FABRICS

A 680 bp Xhol-Notl fragment containing the complete coding region of human genomic NT-4 clone, HG7-2, was radioactively labeled and used in Northern analysis of various human tissue-specific PolyA + RNAs. Human tissue-specific mRNAs were fractionated by electrophoresis through a 1% agarose-formaldehyde gel followed by capillary transfer to a nylon membrane with λxssc. the RNAs were crosslinked on the membranes by exposure to ultraviolet light and hybridized at 65øC with the radiolabelled 680 bp NT-4 Xhol-Notl probe in the presence of 0.5 M NaP04 (pH 7), 1% bovine serum (Fraction V, Sigma), 7% SDS, 1 mM EDTA and 100 ng / ml denatured and sonicated salmon sperm DNA. The filter was washed at 65 ° C with 2XSSC, 0.1% SDS and autoradiographed overnight with an intensification chamber and an x-ray film at -70 ° C. The staining of the gel with ethidium bromide demonstrated that equivalent levels of total RNA were being investigated for the different samples. The human NT-4 probe hybridized strongly to skeletal muscle, prostate, thymus, testes and placental mRNA (Figure 22). The NT-4 probe hybridized to a larger mRNA transcript in skeletal muscle than in the prostate. These data suggest that a small multigene family of human NT-4, having different levels of expression as well as dimensions of transcripts, may be present. The high expression of human NT-4 in skeletal muscle tissue suggests that the present invention can be used to treat disorders of the nervous system, specifically the vast array of neurological disorders affecting motor neurons (see discussion, supra). Additionally, elevated expression of human NT-4 in prostate tissue suggests that the present invention may be used to treat prostate diseases, preferably BPH and impotence (see discussion, supra). Finally, expression of human NT-4 in thymus tissue suggests that the present invention may be used to treat related immune disorders of the nerve and muscle tissue, including but not limited to myasthenia gravis (see discussion, sweat).

11. CONSTRUCTION OF HUMAN NT-4 IN EUCHARIOTIC EXPRESSION VECTORS AND HUMAN NT-4 BIOLOGICAL ACTIVITY MEASUREMENT

11.1 MATERIALS AND METHODS

11. 1. 1. CONSTRUCTION OF EUCHARIOTIC EXPRESSION VECTORS CODING THE HUMAN NT-4

Two eukaryotic expression vectors containing the region encoding the prepro precursor of human genomic clone HG7-2 were constructed in pCMX (Accession NRRL B-18790). The first construct used the normal translation start site of pCMX (pCMX-HG7-2Q), while the other used the Kozak consensus translation start site (pCMX-HG7-2M). A 5 kb genomic fragment of HG7-2, containing the full coding region cloned into the Bam HI site of Bluescript, was amplified by PCR using the following oligonucleotides: hNT4-5'XhoM: CGGTACCCTCGAGCCACCATGCTCCCTCTCCCCTCA [SEQ ID NO: 118] 73 993 / 6526-079-118 ç; HNT4-3'Not: CGGTACAAGCGGCCGCTTCTTGGGCATGGGTCTCAG [SEQ ID NO: 119] HNT4-5'XhoQ: CGGTACCCTCGAGCCACCCAGGTGCTCCGAGAGATG [SEQ ID NO: 120]

Combinations of hNT4-5 / XhoM and hNT4-3'Not oligonucleotide primers were used to construct pCMX-HG7-2Q, while oligo hNT4-5 / XhoQ and hNT4-3 / Not were used to construct pCMX-HG7 . The PCR fragment was digested with XhoI / NotI and subcloned into XhoI / NotI digested pCMX. Eur-lex.europa.eu eur-lex.europa.eu .............................. -11. 1. 2. CONSTRUCTION OF CHEMICAL GENES FUNDING A

NEUROTROFIN PREPRO REGION WITH THE HUMAN NT-4 MATURE CODING REGION

Two eukaryotic expression vectors encoding the mature portion of human NT-4 were constructed. First, the prepro region of human NT-4 was replaced by the prepro region of Xenopus NT-4 (pCMX-xNT4 / hNT4). Second, the prepro region of human NT-4 was replaced by the human NT-3 prepro region (pCMX-hNT3 / hNT4). The following oligonucleotides were used in the construction of pCMX-xNT4 / hNT4 and pCMX-hNT3 / hNT4: (1) 5'CDM8: GAGACCGGAAGCTTCTAGAGATC [SEQ ID NO: 121] (2) hNT3 / HNT4 fusion (oligonucleotide " US ") : TGCAGTTTCGCTCACCCCCCGTTTCCGCCGTGATGT [SEQ ID NO: 122] (3) Melting hNT3 / HNT4 (oligonucleotide " DS ") ACATCACGGCGGAAACGGGGGGTGAGCGAAACTGCA [SEQ ID NO: 123] (4) Melting xNT4 / hNT3 (oligonucleotide " DS "): ACTTCCCGGCTAAAACGGGGGGTGAGCGAAACTGCA [SEQ ID The plasmid vector containing hNT-3 (pC8-hNT3) was amplified by PCR with the 5 'fusion oligonucleotides (SEQ ID NO: 109) and the plasmid vector hNT-3 (pC8-hNT3) CDM8 and hNT3 / hNT4 as primers. The plasmid containing hNT-4 (pCMX-HG7-2Q) was amplified by PCR with the oligonucleotide of hNT3 / hNT4 " DSH and the oligonucleotide hNT4-3 'NotI. The PCR fragment obtained was excised from the gel, and PCR amplified with the oligonucleotides 5'CDM8 and hNT4-3, NotI. The product was then digested with HindIII and PstI and subcloned into HindIII / PstI digested pCMX-HG7-2Q. In this manner, the pCMX-hNT3 / hNT4 expression plasmid contained the prepro region of hNT3 fused to the mature NT-4 coding region. Likewise, the human NT-4 expression plasmid (pCMX-HG7-2Q) was amplified by PCR with the oligonucleotides " US " of fusion xNT4 / hNT4 and 5'CDM8 as primers, while pCMX-HG7-2Q was amplified with the " DS " oligonucleotides " of "xNT4 / hNT4 fusion and hNT4-3 / NotI. The PCR fragment was excised gel, amplified with the oligonucleotides 5'CDM8 and hNT4-3'Not. The product was then digested with HindIII and PstI and subcloned into HindIII / PstI digested pCMX-HG7-2Q. Thus, the resulting eukaryotic expression plasmid, pCMX-xNT4 / hNT4 contains the prepro region of Xenopus NT-4 fused to the region of mature human NT-4 coding.

11. 1. 3. EXPRESSION OF RECOMBINANT HUMAN NT-4

IN COS CELLS

M5 COS cells were grown to a density of 1.5 x 105 cells / well in a Costar 6-well plate in DMEM media supplemented with 10% FBS, glutamine and Na pyruvate (all from Irvine Scientific except FBS).

The following day the cells were aspirated and fed with 2 ml / well RPMI media containing 400æg / ml DEAE-Dextran (Pharmacia), 400 μ cloro chloroquine (Sigma), 4 mM glutamine (Irvine), 1 x ITS (insulin, transferrin, selenium, Sigma). To each well was added 2 μg of the appropriate DNA and mixed by rotation. Three separate constructs were used: pCMX-xNT4, containing the Xenopus NT-4 prepro precursor: and two human NT-4 constructs, pCMX-HG7-2M and pCMX-HG7-2Q. After DNA addition the plates were re-placed at 37øC in a 5% CO2 incubator for 3 hours and 15 minutes. The medium / DNA mixture was then aspirated and 2 ml / well of 10% DMSO in 10% Ca 2+, Mg 2+ PBS was added over 2 minutes. DMSO / PBS was aspirated, the wells were washed again with 10% FBS / DMEM and refed with 10% FBS / DMEM. The next morning, the plates to be bioassayed were washed once with Defined Medium (DM) and refed with 2 ml / well DM. Three days after transfection, the supernatants were removed from the cells and cellular debris were precipitated by microcentrifugation. Supernatants were transferred to fresh tubes and assayed for bioactivity.

11.1.4. PREPARATION OF ENRICHED CULTURES IN NEURON MOTORS

Embryos (E14) from Sprague-Dawley rats (HSD OR Zivic-Miller) were used in all experiments. Pregnant rats were sacrificed by carbon dioxide asphyxiation, and the embryos were quickly removed and placed in an ice-cold medium for further dissection. The spinal marrow was aseptically removed from rat embryos at 14 days' gestation. The caudal region of the spinal cord was separated from the bulbous region (at the level of the first dorsal root ganglion), freed from the sensory ganglia and the adherent meninges. The medulla was then subdivided into ventral and mediodorsal segments for separate cultures. The ventral spinal cord tissues were segmented into small pieces and incubated in 0.1% trypsin (GIBCO) and 0.01% deoxyribonuclease type I (Sigma) in PBS at 37 ° C for 20 minutes. The trypsin solution was then removed, washed and replaced with medium consisting of 45% Eagle's minimal essential medium (MEM), 45% Ham's F12 nutrient mixture (F12), 5% heat-inactivated fetal bovine serum ( GIBCO), 5% heat-inactivated horse serum (GIBCO), glutamine (2 mM), penicillin G (0.5 U / ml), and streptomycin (0.5 μg / ml). The tissue was then mechanically dissociated by gentle milling through a Pasteur pipette, and the supernatants were combined and filtered through a nylon fiber (Nitex, Tekto; 40 μια). The filtered cell suspension was then subjected to a modification of the fractionation procedure described by Schnaar and Schnaffner (1981, J.-75-73993 6526-079-118

Neurosci. 1: 204-217). All steps were carried out at 4 ° C. The metrizamide was dissolved in F12: MEM medium (1: 1), and a discontinuous gradient was established consisting of the preparation of 18% metrizamide layers (0.5 ml), 3 ml 17% metrizamide, 3 ml 12% metrizamide, and 3 ml of 8% metrizamide. The filtered suspension of ventral spinal cord cells (2.5 ml) obtained as described above was lodged on the discontinuous gradient, the tube was centrifuged at 2500 x g for 15 minutes using a oscillating rotor (Sorvall HB4). Centrifugation resulted in three cell layers: fraction I (at the 0-8% interface), frac fraction (at the interface 8-12%), and fraction III (at the interface 12-17%). Cells from each interface were removed in a small volume (about 1 ml), washed twice with defined serum-free medium consisting of 50% F12 and 50% MEM, supplemented with glutamine (2 mM), insulin (5 μg / ml), transferrin (100 Âμg / ml), progesterone (20 nM), putrescine (100 ÂμM), and sodium selenite (30 nM) (Bottenstein and Sato, 1979, Proc Natl Acad Sci 76: 514 -517). The viable cell count was obtained by hemocytometer counting in the presence of trypan blue. Fractional spinal cord (enriched with motor neurons) ventral cells were then plated at a density of 100,000 cells / cm 2 in 6 mm wells previously coated with poly-L-ornithine (Sigma: 10 μg / ml) and laminin (GIBCO 10 μg / ml). Treatment with COS cell NT-4 containing COS cell supernatants was performed on the day of plating. Cultures were maintained in defined serum-free medium at 37øC in an atmosphere of 95% air / 5% CO 2 with almost 100% relative humidity. At day 2 (forty-eight hours), cells were harvested for measurement of choline acetyltransferase (CAT) as described in Fonnum, 1975, J. Neurochem. 24: 407-409.

11.2 RESULTS

11.2.1. The plasmid DNA of each of the constructs based on -76- 73 993 6526-079-118 pCMX (pCMX-HG7-2M, pCMX-hNT3 / hNT4 and pCMX-xNT4 / hNT4) was prepared and individually transfected into COS cells. COS supernatants from each transfected cell line were used in order to evaluate the biological activity of each respective recombinant form of NT-4. The volumes of COS supernatants tested were 10, 50 and 250 μΐ in a total volume of 2 ml. Q1 (PCMX-HG7-2Q), N7 (pCMX-hNT3 / fusion hNT4), and XI (pCMX-xNT4 / hNT4) had neurite-promoting activity in DRG explants (Figure 23). In addition, both Q (pCMX-HG7-2Q) and M (pCMX-HG7-2M) were examined for their survival promoting activity in DRG-dissociated cells. The volumes tested were 5-250 μg in a total volume of 2 ml. When added to cultures of DRG-dissociated neurons, hNT-4 containing COS supernatants promoted 30% neuronal survival compared to 10% survival with simulated transfected COS cell supernatants. (Figure 24). The biological effect of the recombinant human protein from supernatants of COS cells transfected with pCMX-HG7-2M was tested in cultures enriched in motor neurons prepared as sweat described in the Example of Section 11.1.4. Treatment of cultures enriched in motor neurons with 1: 5 diluted human NT-4 derivative pCMX-HG7-2M resulted in a 2.9-fold increase in choline acetyltransferase (CAT) activity after 48 hours when compared to untreated controls (C-NT) and simulated transfected (MOC COS) (Figure 25). The increase in CAT activity fell by 1.7 fold when a 1:50 dilution was tested, suggesting that it was a dose-dependent response (Figure 25).

11.3 DISCUSSION The present invention provides the use of an in vitro eukaryotic expression system for the expression of recombinant human NT-4. The present invention describes various strategies for the expression of a biologically active form of recombinant human NT-4 in cos cells. In one example, the DNA sequence encoding the NT-4 prepro precursor was amplified using two PCR amplification strategies to produce pCMX-based expression plasmids containing the start site (pCMXHG7-2M), or a Kozak consensus translation site (pCMX-HG7-2Q). In another example, two chimeric neurotrophin genes were constructed for expression in COS cells by fusing the prepro region of Xenopus NT-4 (pCMX-xNT4 / hNT4) or the human NT-3 prepro region (pCMX-hNT3 / hNT4), with the mature NT-4 coding region (see Section 5, supraf for a discussion of the use of chimeric constructs for NT-4 expression in vitro). Expression of a biologically active form of human NT-4 in an in vitro expression eukaryotic system substantially increases the ease with which the production of recombinant human NT-4, peptides or derivatives thereof, can be staggered for both therapeutic and diagnostic applications , discussed above. From the point of view of the present invention, one skilled in the art can readily construct a plasmid containing an identical DNA sequence as described, or a similar sequence encoding a protein, or derivative thereof, similar to a homologous but distinct NT-4. The person skilled in the art may also use or choose from a number of plasmid DNA vectors known in the art to construct an expression plasmid for use in a eukaryotic expression system. We have shown that recombinant human NT-4, produced as a full-length precursor or via a neurotrophin-based chimeric construct, is biologically active, as demonstrated by the stimulation effect of recombinant NT-4 COS supernatants on neurites outgrowth in explants DRG and bioactivity of motor neuron cultures. 12. EXAMPLE: trkB IS A RECEIVER FOR NEUROTROPHIN-4 Supernatants from COS cells were also examined in a survival assay using 3T3 fibroblasts. In this assay system, 3T3 fibroblasts, which do not express neurotrophin receptor proteins, are transfected with mammalian expression vectors encoding trkA or trkB. The survival of 3T3 fibroblasts is dependent upon the addition of a neurotrophic factor and its binding to a specific receptor. C0S-M5 cells were cultured and transfected with PCMX-HG7-2Q, pCMX-HG7-2M or pCMX-HG7-2Q as described in the Example of Section 11.1.3.

A complete rat trkA cDNA clone was obtained from Dr. Eric Shooter of Stanford University. the rat trkA cDNA was subcloned into the mammalian expression vector, pCMX to give pCMX-trkA.

A rat trkB cDNA clone was obtained by screening a mouse brain cDNA library in the lambda Zap2 vector (Stratagene) with mouse trkB-specific oligonucleotides corresponding to most of the 5 'and 3' coding regions of trkB. Rat trkB cDNA was subcloned into pCMX to produce pCMX-trkB.

3T3 fibroblasts were cultured and transfected as described in Glass et al., 1991, Cell 66: 405-413.

In this survival assay system, 3T3 fibroblasts, which do not express neurotrophin receptor proteins, were transfected with trkA, a proto-oncogene encoding a tyrosine kinase receptor for NGP, or trkB, a tyrosine kinase that serves as a protein of functional binding to BDNF and NT-3. The transfected cells are dependent on the addition of the corresponding neurotrophin for survival, and thus can be used for assaying the biological activity of neurotrophins. Addition of NT-4-containing COS cell supernatants in this bioassay indicated that viable cells remain after 48 hours only in trT 3T3 cultures (Table 2). Thus, these results demonstrate that NT-4 protein has biological activity in this system, and suggests that trkB, but not trkA, serves as a functional binding protein for NT-4.

J 73 993 6526-079-118, ------- C '" TABLE 2

COS Supernatants Assay on 3T3 Cell Lines Exoressam TrkA and TrkB. Dilutions Simulated HG7- HG7- hNT3 / 2Q 2M hN ·] 1: 5 - - - - 1:10 - - - - 3T3 1:20 - - - - 1:50 - 1:10 - - - - 3T3-trkA 1:20 - - - - 1:50 - - - - 1: 5 - + + + 1:10 - + + + 3T3-trkB 1:20 - + + MICRORGANISM DEPOSITS The following recombinant bacteriophages containing a sequence of the neurotrophin-4 related human genome were deposited on August 22, 1991 (HG4-2 and HG7-2) and on September 11, 1991 (HG2-1) with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852, and marked with the given accession number. In addition, the construction of the chimeric gene, pCMX-hNT3 / hNT4, was deposited on October 30, 1991 with the American Type Culture Collection and marked with the indicated accession number.

Bacteriophage ATCC accession number HG4-2 75069 HG7-2 75070 HG2-1 75098 pCMX-hNT3 / hNT4 75133 73 993 6526-079-118 The present invention is not limited in scope by deposited microorganisms or embodiments described herein. In fact, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims. Various publications have been cited herein which are hereby incorporated by reference in their entirety.

73 993 6526-079-118 -81- igff '£ (1) INFORMATION FOR SEQ. (B) Type of nucleic acid (C) Type of chain: double (D) Topology: not known (ii) Type of molecule: DNA (1) genomic) (xi) Description of the Sequence: SEQ ID NO: 1: 60 120 130

CAAATGTAAT CCCGCTGGG TGGCTGCCGG GGTGTTGATC GACGCCATTG GATCTCTGAG TGCAAGGCTA AACAGTCTTA CGTGAGGGCT CTGACTATGG ATTCTGACAA GATTGTTGGC (1) INFORMATION FOR SEQ. ID Ns 2: (i) Sequence Characteristics (A) Length: 130 base pairs (B) Type: nucleic acid (C) Chain type: double (D) Topology: not known (ii) Molecule type: DNA genomic) (xi) Description of the Sequence: SEQ ID NO: 2: 60 120

CAAGTGCAAT CCATCAGGCA GCACCACTAG AGGATGCCGA GGTGTAGACA AAAAGCAATG GATATCTGAG TGCAAAGCAA AACAGTCTTA TGTGAGGGCT CTGACCATAG ATGCCAACAA GCTTGTGG'GT (1) INFORMATION FOR SEQ. ID NB 3: (i) Sequence Characteristics (A) Length: 127 base pairs (B) Type: nucleic acid (C) Chain type: double 130 -82- 73 993 - ··· * »6526-079 -118 (D) Topology: not known (ii) Molecule Type: DNA (genomic) (xi) Sequence Description: SEQ ID NOs: 3: CAAGTGCCGG GACCCAAATC CCGTTGACAG CGGGTGCCGG GGCATTGACT CAAAGCACTG 60 GAACTCATAT TGTACCACGA CTCACACCTT TGTCAAGGCG CTGACCATGG ATGGCAAGCA 120 GGCTGCC 127 1) INFORMATION FOR SEQ. ID Na 4: (i) Sequence Characteristics (A) Length: 127 base pairs (B) Type: nucleic acid (C) Chain type: double (D) Topology: not known (ii) Molecule type: DNA genomic) (xi) SEQ ID NO: 4: CAAGTGCCGG GCCCCAAATC CTGTAGAGAG TGGATGCCGG GGCATTGACT CCAAGCACTG 60 GAACTCATAC TGCACCACGA CTCACACCTT TGTCAAGGCG TTGACAACAG ACGACAAACA 120 GGCTGCC ,, n (2) INFORMATION FOR SEQ ID NO: ID Ns 5: (i) Sequence characteristics (A) Length: 127 base pairs (B) Type: nucleic acid (C) Chain type: double (D) Topology: not known (ii) Molecule type: DNA genomic) 60 -83- 73 993 6526-079-118 (xi) Sequence Description: SEQ ID NO: 5: 120 127

CAAGTGCAGG GACCCTAGGC CGGTGTCCAG CGGGTGCCGA GGGATCGATG CGAAGCATTG GAACTCTTAC TGCACCACGA CACACACCTT CGTCAAAGCA CTGACCATGG AGGGCAAGCA AGCAGCC (2) INFORMATION FOR SEQ. (B) Type: nucleic acid (C) Type of chain: double (D) Topology: not known (ii) Type of molecule: DNA genomic) (xi) SEQ ID NO: 6: CAAGTGCAAA AATCCAAGTC CAGTATCAGG TGGGTGCAGG GGCATTGATG CCAAGCATTG 60 GAATTCGTAT TGCACCACAA CAGACACATT TGTCAGGGCA TTAACCATGG AAGGCAATCA 120 GGCATCT 127 (2) INFORMATION FOR SEQ ID NO: ID NB 7: (i) Sequence characteristics: (A) Length: 127 base pairs (B) Type: nucleic acid (C) Chain type: double (D) Topology: not known (ii) Molecule type: DNA (genomic) (xi) Sequence description: SEQ ID NO: 7: CAAATGCAGG GACCCAAAGC TAGTTTCAAG CGGATGCCGT GGGATTGATG CAAAGCATTG 60 GAACTCTTAT TGTACCACCA CGCACACCTT TGTCAAAGCA TTAACAATGG AAGGGAAGCA 120

AGCAGCA 127 73 993

6526-079-118 -84- '(2) INFORMATION FOR SEQ. ID Na 8: (i) Sequence Characteristics: (A) Length: 127 base pairs (B) Type: nucleic acid (C) Type of chain: double (D) Topology: not known (ii) Molecule Type: DNA (genomic) (xi) Description of the Sequence: SEQ ID NOS: 8: 60 120 127

CACGTGCCGT GGCGCCCGGG CGGGCAGCTC TGGCTGCCTG GGCATCGACG GGCGACACTG GAACTCCTAC TGCACCAACT CGCACACCTT CGTGCGGGCG CTGACTTCCT TTAAGGACCT GGTGGCC (2) INFORMATION FOR SEQ. (A) Length: 130 base pairs (B) Type: nucleic acid (C) Chain type: double (D) Topology: not known (ii) Type of molecule: DNA (genomic) (xi) Sequence Description: SEQ ID NOS: 9: 60 120

CAAGTGCAAT CCCATGGGTT ACACAAAAGA AGGCTGCAGG GGCATAGACA AAAGGCATTG GAACTCCCAG TGCCGAACTA CCCAGTCGTA CGTGCGGGCC CTTACCATGG ATAGCAAAAA GAGAATTGGC (2) INFORMATION FOR SEQ. ID Na 10: (i) Characteristics of the Sequence (A) Length: 130 base pairs (B) Type: nucleic acid (C) Chain type: double 130

73 993 6526-079-118 -85- (D) Topology: not known (ii) Molecule Type: DNA (genomic) (xi) Sequence Description: SEQ ID NOS: 10; CAAGTGTAAT CCCATGGGTT ACACGAAGGA AGGCTGCAGG GGCATAGACA AAAGGCACTG 60 GAACTCGCAA TGCCGAACTA CCCAATCGTA TGTTCGGGCC CTTACTATGG ATAGCAAAAA 120 GAGAATTGGC 130 (2) INFORMATION FOR SEQ. ID Na 11: (i) Characteristics of the Sequence (A) Length: 130 base pairs (B) Type: nucleic acid (C) Chain type: double (D) Topology; not known (ii) Molecule type: DNA (genomic) (xi) Sequence description: SEQ ID NOS: 11: 60 120 130

CAAATGCAAC CCCAAGGGGT ACACAAAGGA AGGCTGCAGG GGCATAGACA AGAGGCACTG GAACTCACAG TGCCGAACTA CCCAGTCTTA CGTGAGAGCT CTCACCATGG ATAACAAAAAA GAGAGTTGGC (2) INFORMATION FOR SEQ. (B) Type of nucleic acid (C) Type of chain: double (D) Topology: not known (ii) Type of molecule: DNA (SEQ ID NO: 12) CAAGTGCAGC ACGAAGGGTT ATGCAAAAGA AGGCTGTAGA GGCATAGACA AGAGGTACTG 60 GAATTCCCAG TGCCGAACTA CTCAGTCTTA CGTCCGCGCT CTCACCATGG ATAACAAAAA 120 GAGGATTGGA 130 (2) ) INFORMATION FOR SEQ. (B) Type of nucleic acid (C) Type of chain: double (D) Topology: not known (ii) Type of molecule: DNA (genomic) (xi) SEQ ID No: 13: CAAATGCAAC CCTATGGGTT ACATGAAAGA AGGCTGCAGA GGCATAGACA AAAGGTACTG 60 GAACTCTCAG TGCCGAACTA CTCAGTCTTA CGTGCGGGCT TTCACCATGG ATAGCAGAAA 120 AAAAGTTGGT 130 (2) INFORMATION FOR SEQ ID NO: (B) Type of nucleic acid (C) Type of chain: double (D) Topology: not known (ii) Type of molecule: DNA genomic) '(xi) SEQ ID NOs: 14: CAAATGTAAC CCTATGGGGT ACACAAAGGA GGGCTGCCGT GGAATAGACA AGAGGCATTA 60 TAACTCCCAA TGCAGGACAA CCCAGTCCTA CGTGCGAGCG CTCACCATGG ATAGCAAAAA 120 130

GAAGATTGGC (2) INFORMATION FOR SEQ. (B) Type: nucleic acid (C) Type of chain: double (D) Topology: not known (ii) Type of molecule: DNA (genomic) (xi) Sequence Description: SEQ ID No: 15:

CAAATGTAAC CCCAAGGGTT TCACCAACGA AGGCTGCAGA GGGATAGACA AGAAACATTG GAATTCGCAG TGTAGAACCA GCCAATCCTA TGTGCGAGCT CTAACCATGG ATAGTAGGAA GAAGATTGGG (2) INFORMATION FOR SEQ. (B) Type: nucleic acid (C) Type of chain: double (D) Topology: not known (ii) Type of molecule: DNA (genomic) (xi) Description of the Sequence: SEQ ID NO: 16:

GCGATGTAAG GAAGCCAGGC CGGTCAAAAA CGGTTGCAGG GGTATTGATG ATAAACACTG GAACTCTCAG TGCAAAACAT CCCAAACCTA CGTCCGAGCA CTGACTTCAG AGAACAATAA ACTCGTGGGC (2) INFORMATION FOR SEQ. ID Ns 17: (i) Sequence Characteristics (A) Length: 130 base pairs (B) Type: nucleic acid (C) Chain type: double -88- 73 993 6526-079-118 (D) Topology: no known (ii) Molecule Type: DNA (genomic) (xi) Sequence Description: SEQ ID NO: 17: 60 120 130

GAGGTGTAAA GAAGCCAGGC CAGTCAAAAA CGGTTGCAGG GGGATTGATG ACAAACACTG GAACTCTCAG TGCAAAACGT CGCAAACCTA CGTCCGAGCA CTGACTTCAG AAAACAACAA ACTCGTAGGC (2) INFORMATION FOR SEQ. ID Na 18: (i) Sequence Characteristics (A) Length: 130 base pairs (B) Type: nucleic acid (C) Type of chain: double (D) Topology: not known (ii) Molecule type: DNA genomic) (xi) Sequence description: SEQ ID No: 18: 60 120 130

AAGGTGTAAA GAAGCCAAAC CTGTTAAAAA TGGCTGCCGA GGCATTGACG ACAAGCACTG GAACTCCCAG TGCAAGACAT CCCAAACTTA CGTTAGAGCA TTGACTTCAG AAAACAATAA ACTTGTAGGC (2) INFORMATION FOR SEQ. (I) Type of nucleic acid (C) Type of chain: double (D) Topology: not known (ii) Type of molecule: DNA (genomic)

73 993 6526-079-118 -89- (xi) SEQ ID NOS: 19: AAGGIGIAAA GAGGCAAGAC CTGTCAAAAA TGGCTGTCGA GGCATAGACG ACAAACACTG 60 GAATTC 66 (2) INFORMATION FOR SEQ ID NO: ID Na 20: (i) Sequence Characteristics (A) Length: 128 base pairs (B) Type: nucleic acid (C) Chain type: not known (D) Topology: linear (ii) genomic) (xi) Sequence Description: SEQ ID NO: 20: CAAGTGTCGG ACTGCCAAAC CTTTTAAGAG CGGCTGTCGC GGCATCGAXG ACAAACACXG 60 GAACTCGCAG XGTAAGACCX CICAGACGXA CGXCAGAGXC ICXGACGCAG GACCGIACCI 120 CXGXGGGC 12a (2) INFORMATION FOR SEQ ID NO: ID Ns 21: (i) Sequence Characteristics (A) Length: 130 base pairs (B) Type: nucleic acid (C) Chain type: double (D) Topology: unknown (ii) Molecule type: DNA genomic) (xi) Sequence description: SEQ ID No: 21: CCGCXGCAAG GAGXCGAAGC CGGGCAAGAA CGGGXGCCGG GGCAXCGACG ACAAACACXG 60 GAACXCGCAG TGCAAGACCA GCCAGACCXA XGXCCGAGCG CIGAGCAAGG AGAACAAXAA 120 130

AXAXGXGGGC -90- 73 993 6526-079-118 (2) INFORMATION FOR SEQ. ID Ns 22: (i) Sequence Characteristics (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NB: 22:

Lys Cye Aen Pro Ala Gly Gly Thr Go Gly Gly Cye Arg Gly Go Asp 15 5 15

Arg Arg Híb Trp Ile Ser Glu Cya Lys Ala Lys Gin Ser Tyr Vai Arg 20 25 30

Ala Leu Thr Met Asp Ser Asp Lys Ile Val Gly 35 40 (2) INFORMATION FOR SEQ. ID N8 23: (i) Sequence Characteristics (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 23:

Lye Cye Aen Pro Ser Gly Ser Thr Thr Arg Gly Cye Arg Gly Vai Aep 15 10 15

Lys Lys Gin Trp Ile Ser Glu Cys Lys Ala Lys Gin Ser Tyr Vai Arg 20 25 30

Ala Leu Thr Ile Asp Ala Asn Lys Leu Vai Gly 35 40 -91- 73 993 6526-079-118 (2) INFORMATION FOR SEQ. ID N8 24: (i) Characteristics of the Sequence (A) Length: 42 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NH: 24:

Lys Cys Arg Asp Pro Asn Pro Go Asp Ser Gly Cye Arg Gly Ile Asp 15 10 15

Ser Lye His Trp Asn Ser Tyr Cys Thr Thr Thr His Thr Phe Vai Lys 20 25 30

Ala Leu Thr Met Asp Gly Lys Gin Ala Ala 35 40 (2) INFORMATION FOR SEQ. ID N8 25: (i) Characteristics of the Sequence (A) Length: 42 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 25:

Lys Cys Arg Ala Pro Asn Pro Go Glu Ser Gly Cys Arg Gly Ile Asp 1 5 10 15

Ser Lys His Trp Asn Ser Tyr Cys Thr Thr Thr His Thr Phe Val Lys 20 25 30

Ala Leu Thr Thr Asp Asp Lys Gin Ala Ala 35 40 73 993 6526-079-118 -92-; (2) INFORMATION FOR SEQ. ID Ne 26: (i) Characteristics of the Sequence (A) Length: 42 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NB: 26:

Lye Cys Arg Asp Pro Arg Pro Will Be Gly Cye Arg Cly Ile Aep 5 10 15

Ala Lys His Trp Asn Ser Tyr Cys Thr Thr Thr Hie Thr Phe Vai Lys 20 25 30

Ala Leu Thr Met Glu Gly Lys Gin Ala Ala 35 40 (2) INFORMATION FOR SEQ. ID NB 27: (i) Sequence Characteristics (A) Length: 42 amino acids (B) Type: amino acid (C) Chain type; (D) Topology: not known (ii) Molecule Type: Peptide (xi) Sequence description: SEQ ID NO: 27:

Lys Cys Lys Asn Pro Ser Pro Will Be Gly Gly Cys Arg Gly Ile Asp 1 5 10 15

Ala Lye His Trp Asn Ser Tyr Cys Thr Thr Thr Asp Thr Phe Val Arg 20 25 30

Ala Leu Thr Met Glu Gly Asn Gin Ala Ser 35 40 -93-

73 993 6526-079-118 (2) INFORMATION FOR SEQ. ID No 28: (i) Characteristics of the Sequence (A) Length: 42 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NO: 28:

Lys Cye Arg Asp Pro Lys Pro Will Be Gly Cys Arg Gly Ile Asp 5 10 15

Ala Lye Hie Trp Asn Ser Tyr Cys Thr Thr Thr His Thr Phe Vai Lyu 20 25 30

Ala Leu Thr Met Glu Gly Lye Gin Wing Ala 35 40 (2) INFORMATION FOR SEQ. (I) Characteristics of the sequence (A) Length: 42 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: unknown (ii) Type of molecule: Peptide (xi) Description of the Sequence: SEQ ID NB: 29:

Thr Cys Arg Gly Ala Arg Ala Gly Ser Ser Gly Cys Leu Gly Ile Asp 15 10 15

Gly Arg His Trp Asn Ser Tyr Cys Thr Asn Ser Hyp Thr Phe Val Arg 20 25 30

Ala Leu Thr Ser Phe Lys Asp Leu Go Ala 35 40 -94- 73 993 6526-079-118 (2) INFORMATION FOR SEQ. ID N2 30: (i) Characteristics of the Sequence (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: of SEQ ID NO: 30:

Lye Cye Asn Pro Met Gly Tyr Thr Lys Glu Gly Cys Arg Gly Ile Asp 1 5 10 15

Lye Arg His Trp Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr Go Ara 20 25 30

Ala Leu Thr Met Asp Ser Lys Lys Arg Ile Gly 35 40 (2) INFORMATION FOR SEQ. ID No. 31: (i) Characteristics of the Sequence (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 31:

Lye Cys Aen Pro Met Gly Tyr Thr Lys Glu Gly Cye Arg Gly Ile Asp 1 5 10 15

Lye Arg His Trp Asn Ser Cln Cys Arg Thr Thr Gin Ser Tyr Val Arg 20 25 30

Ala Leu Thr Met Asp Ser Lye Lys Arg Ile Gly 35 40-95-99993 6526-079-118 (2) INFORMATION FOR SEQ. ID Na 32: (i) Sequence Characteristics (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 32:

Lys Cys Asn Pro Lys Gly Tyr Thr Lys Glu Gly Cys Arg Gly Ile Asp 1 5 10 15

Lys Arg His Trp Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr Val Arg 20 25 30

Ala Leu Thr Met Asp Asn Lys Lys Arg Val Gly 35 40 (2) INFORMATION FOR SEQ. ID No. 33: (i) Sequence Characteristics (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NO: 33:

Lys Cys Ser Thr Lys Gly Tyr Ala Lys Glu Gly Cys Arg Gly Ile Asp 1 5 10 15

Lys Arg Tyr Trp Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr Val Arg 20 25 30

Ala Leu Thr Met Asp Asn Lys Lys Arg Ile Gly 35 40 73 993 6526-079-118 -96- " i '(2) INFORMATION FOR SEQ. ID N2 34: (i) Sequence Characteristics (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 34:

Lys Cys Asn Pro Met Gly Tyr Met Lys Glu Gly Cya Arg Gly Ile Aep 15 10 15

Lys Arg Tyr Trp Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr Val Arg 20 25 30

Ala Phe Thr Met Asp Ser Arg Lys Lys Val Gly 35 40 (2) INFORMATION FOR SEQ. ID N = 35: (i) Characteristics of the Sequence (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: Description of the Sequence: SEQ ID No: 35:

Lya Cya Aan Pro Met Gly Tyr Thr Lys Glu Gly Cya Arg Gly Ile Aap 15 10 15

Lye Arg Hie Tyr Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr Vai Arg 20 25 30

Ala Leu Thr Met Aap Ser Lye Lys Lys Ile Gly 35 40 -97- 73 993 6526-079-118 (2) INFORMATION FOR SEQ. ID NE 36: (i) Characteristics of the Sequence (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 36:

Lys Cys Asn Pro Lys Gly Phe Thr Asn Glu Gly Cys Arg Gly Ile Asp 15 lo 15

Lys Lys His Trp Asn Ser Gin Cys Arg Thr Ser Gin Ser Tyr Val Arg 20 25 30

Ala Leu Thr Met Asp Ser Arg Lys Lys Ile Gly 35 40 (2) INFORMATION FOR SEQ. ID NE 37: (i) Sequence characteristics (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule type: Peptide of the Sequence: SEQ ID Ns: 37:

Arg Cys Lys Glu Ala Arg Pro Val Lys Asn Gly Cys Arg Gly Ile Asp 15 10 15

Asp Lys His Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr Go Arg 20 25 30

Ala Leu Thr Ser Glu Asn Asn Lys Leu Vai Gly 35 40 -98- 73 993 6526-079-118 (2) INFORMATION FOR SEQ. ID Nfl 38: (i) Sequence Characteristics (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NO: 38:

Arg Cys Lye Glu Ala Arg Pro Val Lys Asn Gly Cys Arg Gly Ile Asp 15 10 15

Asp Lys His Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr Go Arg 20 25 30

Ala Leu Thr Ser Glu Asn Asn Lys Leu Go Gly 35 40 (2) INFORMATION FOR SEQ. ID Ns 39: (i) Characteristics of the Sequence (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 39:

Arg Cys Lys Glu Ala Lys Pro Val Lys Asn Gly Cys Arg Gly Ile Asp 15 10 15

Asp Lys His Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr Go Arg 20 25 30

Ala Leu Thr Ser Glu Asn Asn Lys Leu Val Gly 35 40 "99" ^ // _ 73 993 6526-079-118 (2) INFORMATION FOR SEQ. ID NE 40: (i) Characteristics of the Sequence (A) Length: 21 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 40:

Arg Cys Lys Glu Ala Arg Pro Val Lys Asn Gly Cys Arg Gly Ile Asp 15 10 15

Asp Lys Híb Trp Asn 20 (2) INFORMATION FOR SEQ. ID No. 41: (i) Characteristics of Sequence (A) Length: 42 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NO: 41:

Lys Cys Arg Thr Ala Lys Pro Phe Lys Ser Gly Cys Arg Gly Ile Asp 15 10 15

Asp Lys His Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr Go Arg 20 25 30

Ala Leu Thr Gin Asp Arg Thr Ser Vai Gly 35 40 73 993 6526-079-118 -100- - (2) INFORMATION FOR SEQ. ID Ns 42: (i) Characteristics of the Sequence (A) Length: 43 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 42:

Arg Cys Lys Glu Ser Lys Pro Gly Lys Asn Gly Cys Arg Gly Ile Asp 15 10 15

Asp Lys His Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr Go Arg 20 25 30

Ala Leu Ser Lys Glu Asn Asn Lys Tyr Go Gly 35 40 (2) INFORMATION FOR SEQ. NB 43: (i) Sequence characteristics (A) Length: 1302 base pairs (B) Type: amino acid (C) Chain type: double (D) topology: unknown (ii) Molecule type: ) (ix) Structure

(A) Name / Code: CDS (B) Location: Link (529..534, 538..1248) (xi) Description of the Sequence: SEQ. ID NE: 43 (Sequence Sequence) -101-

73993 -101- J 6526-079-118 CAATCATACT TATGAACAGC AGGGGGAGCC CTCGCCTTAC TTCCCAGCCA TGCAGAACTC 60 AAGCAGCTTT GTTTATGCCG ATCCCTAAGC AGCCCAGACC ACACTGAGCA TGTGCACAGT 120 CTTAGTCTTG CAAAGATGTT TAACAAAGTT ACAAGATGGT GACCCCCXGT AGCCAACTTT 180 GAAAGCATAA ATCATTTGTT TGATTAGGCT TGTGGTGCAG TAAGTTCATG TTTATATTTA 240 GCATACAAAA TACAGCATTT CTAGCCTTAT TCTATTTTAG ACTTTACCCT TTAATGCCCA 300 GTTCTGCCCA TTGCCTTATA GATGTTAAAG TCCCAATATC ACATTGGCAT CCTCGGCTGT 360 TTACAACAAA CATTAAAACT TGTACTTATA TTTAACATTC TGTTGTTCTT CCAATATTCC 420 ATCACACTTA GACCCTAAAA GAATTATATG TATATAATTT GCATAAATTA TATAATGGCA 4B0 GCCGTATTCT AATTCTGTTT TTTTTTTTTT TTTTTGCAGT GGTCTGAG GTG GAT 534

Go Asp 1 TAA GTA Go ATG Met ATC Ile 5 CTC Leu CGC Arg GCC ATC TGC GCT GCC CCC Ala Zle Cys 20 Ala Ala Pro GGC CCC GAT AAA ACA TCA Gly Pro 35 Asp Lys Thr Ser AAC TTC AGT CAT GTC CTG Asn 50 Phe Ser His Vai Leu 55 ACC TAT TCC AGC ATG GCT Thr Tyr Ser Ser Met 70 Ala GTG ACT CTT TCA AGT GAG Go Thr Leu Ser 85 Ser Glu TCA GAG GAG ACA GTG GTA Ser Glu Glu 100 Thr Go Go CTA AAA CGG GCA TCA GGA Leu Lys 115 Arg Ala Ser Gly GAG CTC TCT GTG TGT GAC Glu 130 Leu Ser. Vai Cys Asp 135 ACA GCC GTG GAT GAT CGG Thr Ala Go Asp Asp 150 Arg CAG ACT CTA ACA GGA CCA Gin Thr Leu Thr 165 Gly Pro AAT CCA TCA GGC AGC ACC Asn Pro Ser Gly 180 Ser Thr CAA TGG ATA TCT GAG TGC Gin Trp 195 Ile Ser Glu Cys CTT TAT GCC ATG GTG ATC Leu Tyr Ala 10. Met Vai Ile TTC CAG AGC CGG ACC ACA Phe Gin 25 Ser Arg Thr Thr GAA GCC TCA GAC CGG CAA Glu 40 Ala Ser Asp Arg Gin 45 CAA AAT GGG TTC TTT CCA Gin Asn Gly Phe Phe 60 Pro GGT AAG GAC TGG AAC CTA Gly Lys Asp Trp 75 Asn Leu GAG CCT TCT GGA CCT CCA Glu Pro Ser 90 Gly Pro Pro CAT CCA GAA CCA GCC AAC His Pro 105 Glu Pro Ala Asn TCT GAT TCG GTC AGC TTG be 120 Asp Be Gon Be Leu 125 AGT GTC AAC GTC TGG GTT Be Go Asn Go Trp Go 140 GGT AAA ATA GTG ACT GTC Gly Lys Ile Vai 155 Thr Go CTG AAG CAA TAC TTC TTT Leu Lys Gin 170 Tyr Phe Phe ACT AGA GGA TGC CGA GGT Thr Arg 185 Gly Cys Arg Gly AAA GCA AAA CAG TCT TAT Lys 200 Ala Lys Gin Ser Tyr 205 TCA TAC TGT TGT 582

Ser Tyr Cye Cye 15 GAT TTG GAT TAT 630

Asp Leu Asp Tyr 30 TCA GTT CCC AAC 678

Be Go Pro Asn GAT TTG TCA TCC 726

Asp Leu Ser Ser 65 TAC TCA CCT AGA 774

Tyr Ser Pro Arg 80 CTA CTT TTC TTG 822

Leu Leu Phe Leu 95 AAG ACT TCC CGG 870

Lys Thr Ser Arg 110 TCC CGT CGG GGA 918

Ser Arg Arg Gly ACC GAT AAA CGT 966

Thr Asp Lys Arg 145 ATG TCT GAG ATT 1014

Met Ser Glu Ile 160 GAG ACC AAG TGC 1062

Glu Thr Lye Cye 175 GTA GAC AAA AAG 1110

Go Asp Lys Lys 190 GTG AGG GCT CTG 1158

Vai Arg Ala Leu 73 993 6526-079-118 ACC ATA GAT GCC AAC AAG CTT GTG GGT TGG CGT TGG ATC CGT ATT GAC 1206 Thr Ile Asp Ala Asn Lys Leu Gly Trp Arg Trp Ile Arg Ile Asp 210 215 220 225 ACA GCG TGT GTC TGT ACC TTG TTG AGT CGG ACA GGA AGG ACG 1248 Thr Ala Cys Vai Cye Thr Leu Leu Ser Arg Thr Gly Arg Thr 230 235 TAAAAGACGA GGGTTAGCAA AATAGAGAGA AGAGGTTGAT CCGTTGACCT GCAG 1302 (2) INFORMATION FOR SEQ. ID NO 44: (i) Characteristics of Sequence (A) Length: 239 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule Type: Protein (xi)

Go Asp Go to Met Ile Leu Arg Leu Tyr Ala Met Val Ile Ser Tyr Cys 1 5 10 15 Cys Ala Ile Cys Ala Ala Pro Phe Gin Ser Arg Thr Thr Asp Leu Asp 20 25 30 Tyr Gly Pro Asp Lys Thr Ser Glu Ala Ser Asp Arg Gin Be Pro Pro 35 40 45 Asn Asn Phe Be His Go Leu Gin Asn Gly Phe Phe Pro Asp Leu Ser 50 55 60 Ser Thr Tyr Ser Ser Met Ala Gly Lys Asp Trp Asn Leu Tyr Ser Pro 65 70 75 80 Arg Go Thr Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu Phe 85 90 95 Leu Ser Glu Glu Thr Will Go His Pro Glu Pro Ala Asn Lys Thr Ser 100 105 110 Arg Leu Lys Arg Ala Ser Gly Ser Asp Ser Ser Le Ser Ser Arg Arg 115 120 125 Gly Glu Leu Ser Vai Cys Asp Ser Go Asn Go Trp Go Thr Asp Lys 130 135 140 Arg Thr Ala Go Asp Asp Arg Gly Lys Ile will Thr Vai Met Ser Glu 145 150 155 160 Ile Gin Thr Leu Thr Gly Pro Leu Lys Gin Tyr Phe Phe Glu Thr Lys 165 170 175 Cye Asn Pro Ser G and Ser Thr Thr Arg Gly cys Arg Gly Val Asp Lys 180 185 190 73 993

6526-079-118 -103-

Lys Gin Trp Ile Ser Glu Cye Lys Ala Lye Gin Ser Tyr Vai Arg Ala 195 200 205

Leu Thr Ile Asp Ala Asn Lys Leu Gly Gly Trp Arg Trp Ile Arg Ile 210 215 220

Asp Thr Ala Cys Vai Cye Thr Leu Leu Ser Arg Thr Gly Arg Thr 225 230 235 (2) INFORMATION FOR SEQ. ID No. 45: (i) Sequence Characteristics (A) Length: 123 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NO: 45:

Ala Ser Gly Ser Asp Ser Val Ser Leu Ser Arg Arg Gly Glu Leu Ser 1 5 10 15 Val Cye Asp Ser Val Asn Val Trp Val Thr Asp Lys Arg Thr Ala Val 20 25 30 Asp Asp Arg Gly Lys Ile Val Thr Val Met Ser Glu Ile Gin Thr Leu 35 40 45 Thr Gly Pro Leu Lys Gin Tyr Phe Phe Glu Thr Lys Cys Asn Pro Ser 50 55 60 Gly Ser Thr Thr Arg Gly Cys Arg Gly Val Asp Lys Lys Gin Trp Ile 65 70 75 80 Ser Glu Cys Lys Ala Lys Gin Ser Tyr Val Arg Ala Leu Thr Ile Asp 85 90 95 Ala Asn Lys Leu Val Gly Trp Arg Trp Ile Arg Ile Asp Thr Ala Cys 100 105 110 Val Cys Thr Leu Leu Ser Arg Thr Gly Arg Thr 115 120 -104 - 73 993 6526-079-118 (2) INFORMATION FOR SEQ. ID Ne 46: (i) Sequence Characteristics (A) Length: 118 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 46:

Ser Ser Thr His Pro Go Phe His Met Gly Glu Phe Ser Goa Cye Asp 15 10 15

Being Will Be Will Go Trp Go Gly Asp Lys Thr Thr Ala Thr Asp Ile Lve 20 25 30

Gly Lye Glu Vai Thr Vai Leu Ala Glu Vai Aen Ile Aen Aen Ser Go 35 40 45

Phe Arg Gin Tyr Phe Phe Glu Thr Lye Cys Arg Ala Ser Aen Pro Val 50 55 60

Glu Ser Gly Cys Arg Gly Ile Asp Ser LyB His Trp Asn Ser Tyr Cye 65 70 75 8

Thr Thr Thr Híb Thr Phe Vai Lys Ala Leu Thr Thr Asp Glu Lye Gin 85 90 95

Ala Ala Trp Arg Phe Ile Arg Ile Asp Thr Ala Cye Go Cye Go Leu 100 105 no

Ser Arg Lya Ala Thr Arg 115 (2) INFORMATION FOR SEQ. ID No. 47: (i) Characteristics of the Sequence (A) Length: 119 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: unknown (ii) Type of molecule: Peptide -105- - 105- / 73 993 6526-079-118 (xi) Description of the Sequence: SEQ ID No: 47:

His Ser Asp Pro Ala Arg Arg Gly Glu Leu Ser Val Cys Asp Ser Ile 1 5 10 15 Ser Glu Trp Val Thr Ala Ala Asp Lys Lys Thr Ala Val Asp Met Ser 20 25 30 Gly Gly Thr Go Thr Vai Leu Glu Lys Val Pro Val Ser Lys Gly Gin 35 40 45 Leu Lys Gin Tyr Phe Tyr Glu Thr Lys Cys Asn Pro Met Gly Tyr Thr 50 55 60 Lys Glu Gly Cys Arg Gly Ile Asp Lys Arg His Trp Asn Ser Gin Cys 65 70 75 60 Arg Thr Thr Gin Ser Tyr Val Arg Ala Leu Thr Met Asp Ser Lys Lys 85 90 95 Arg Ile Gly Trp Arg Phe Ile Arg Ile Asp Thr Ser Cys Val Cys Thr 100 105 110 Leu Thr Ile Lys Arg Gly Arg 115 (2) INFORMATION FOR SEQ. ID N 48: (i) Sequence Characteristics (A) Length: 119 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NB: 48:

Tyr Ala Glu His Lys Ser His Arg Gly Glu Tyr Ser Va Cys Asp Ser 1 5 10 15

Glu Ser Leu Trp Go Thr Asp Lys Ser Ser Ala Ile Asp Ile Arg Gly 20 25 30

Hie Gin Go Thr Go Leu Gly Glu Ile Ly9 Thr Gly Asn Ser Pro Go 35 40 45

Lys Gin Tyr Phe Tyr Glu Thr Arg Cys Lys Glu Ala Arg Pro Val Lys 50 55 60 -106 -106- 73 993 6526-079-118

Asn Gly Cys Arg Gly Ile Asp Asp Lys Hia Trp A9n Ser Gin Cys Lya 65 70 75 80

Thr Ser Gin Thr Tyr Go Arg Ala Leu Thr Ser Glu Asn Aen Lys Leu 85 90 95

Gly Trp Arg Trp Ile Arg Ile Asp Thr Ser Cys Val Cys Ala Leu 100 105 110

Ser Arg Lys Ile Gly Arg Thr 115 (2) INFORMATION FOR SEQ. (B) Type: nucleic acid (C) Chain type: double (D) Topology: not known (ii) Type of molecule: DNA genomic) (ix) Structure:

(A) NAME / KEY: CDS (B) LOCATION: 552..1259 (xi) SEQUENCE DESCRIPTION: SEQ ID N ": 49: CTGCAGGGAA ACAATCATAC TTATGAACAG CAGGGGGAGC CCTCGCCTTA CTTCCCAGCC 60 ATGCAGAACT CAAGCAGCTT TGTTTATGCC GATCCCTAAG CAGCCCAGAC CACACTGAGC 120 ATGTGCACAG TCTTAGTCTT GCAAAGATGT TTAACAAAGT TACAAGATGG TGACCCCCTG 180 TAGCCAACTT TGAAAGCATA AATCATTTGT TTGATTAGGC TTGTGGTGCA GTAAGTTCAT 240 GTTTATATTT AGCATACAAA ATACAGCATT TCTAGCCTTA TTCTATTTTA GACTTTACCC 300 TTTAATGCCC AGTTCTGCCC ATTGCCTTAT AGATGTTAAA GTCCCAATAT CACATTGGCA 360 TCCTCGGCTG TTTACAACAA ACATTAAAAC TTGTACTTAT ATTTAACATT CTGTTGTTCT 420 TCCAATATTC CATCACACTT AGACCCTAAA AGAATTATAT GTATATAATT TGCATAAATT 480 ATATAATGGC AGCCGTATTC TAATTCTGTT ΪΤΤΤΤΤΤΤΤΤ TTTTTTGCAG TGGTCTGAGG 540 TGGATTAAGT ATG ATC CTC CGC CTT TAT GCC ATG GTG ATC TCA TAC TGT 590

Met Ile Leu Arg Leu Tyr Ala Met Val Ile Ser Tyr Cys 15 10 TGT GCC ATC TGC GCT GCC CCC TTC CAG AGC CGG ACC ACA GAT TTG GAT Cys Ala Ile Cys Ala Ala Pro Phe Gin Ser Arg Thr Thr Asp Leu Asp 15 20 25 636

73 993 6526-079-118 TAT GGC ccc GAT AAA ACA TCA GAA GCC TCA GAC CGG CAA TCA GTT CCC 686 Tyr Gly Pro Aep 30 Lys Thr 35 Ser Glu Ala Ser Asp Arg 40 Gin Ser Vai Pro 45 AAC AAC TTC AGT CAT GTC CTG CAA AAT GGG TTC TTT CCA GAT TTG TCA 734 Asn Asn Phe Ser His 50 Go Leu Gin Asn Gly Phe 55 Phe Pro Asp Leu 60 Ser TCC ACC TAT TCC AGC ATG GCT GGT AAG GAC TGG AAC CTA TAC TCA CCT 782 Ser Thr Tyr Ser 65 Ser Met Alan Gly Lys 70 Asp Trp Asn Leu Tyr 75 Ser Pro AGA GTG ACT CTT TCA AGT GAG GAG CCT TCT GGA CCT CCA CTA CTT TTC 830 Arg Go Thr 80 Leu Ser Ser Glu Glu 85 Pro Ser Gly Pro Pro 90 Leu Phe TTG TCA GAG GCA ACA GTG CAT CAT CCA GAA CCA GCC AAC ACT TCC 878 Leu Ser 95 Glu Glu Thr Will Go 100 His Pro Glu Pro Ala 105 Asn Lys Thr Ser CGG CTA AAA CGG GCA TCA GGA TCT GAT TCG GTC AGC TTG TCC CGT CGG 926 Arg 110 Leu Lys Arg Ala Ser 115 Gly Ser Asp Ser Va 120 Ser Leu being Arg Arg 125 GGA GAG CTC TCT GTG TGT GAC AGT GTC AAC GTC TGG GTT ACC GAT AAA 974 Gly Glu Leu Ser Vai 13 0 Cys Asp Ser Go Asn Go 135 Trp Go Thr Asp 140 Lys CGT ACA GCC GTG GAT GAT CGG GGT AAA ATA GTG ACT GTC ATG TCT GAG 1022 Arg Thr Ala Va 145 Asp Asp Arg Gly Lys 150 Ile Vai Thr Vai Met 155 Ser Glu ATT CAG ACT CTA ACA GGA CCA CTG AAG CAA TAC TTC TTT GAG ACC AAG 1070 Ile Gin Thr 160 Leu Thr Gly Pro Leu 165 Lys Gin Tyr Phe Phe 170 Glu Thr Lye TGC AAT CCA TCA GGC AGC ACC ACT AGA GGA TGC CGA GGT GTA GAC AAA 1118 Cys Asn 175 Pro Ser Gly Ser Thr 180 Thr Arg Gly Cys Arg 185 Gly V A Asp Lys AAG CAA TGG ATA TCT GAG TGC AAA GCA AAA CAG TCT TAT GTG AGG GCT 1166 Lys 190 Gin Trp Ile Ser Glu 195 Cys Lys Ala Lys Gin 200 Ser Tyr Go Arg Ala 205 CTG ACC ATA GAT GCC AAC AAG CTT GTG GGT TGG CGT TGG ATC CGT ATT 1214 Leu Thr Ile Asp Ala 210 Asn Lys Leu Go Gly Trp Arg 215 Trp Ile Arg 220 Ile GAC AC * Asp Thr GCG Ala TGT Cys 225 GTC Go TGT Cys ACC Thr TTG Leu TTG Leu 230 AGT CGG ACA Ser Arg Thr GGA Gly AGG Arg 235 ACG Thr 1259 TAAAAGACGA GGGTTAGCAA AATAGAGAGA AGAGGTTGAT CCGTTGACCT GCAG 13 13 (2) INFORMATION FOR SEQ. ID Ns 50: (i) Sequence Characteristics (A) Length: 236 amino acids (B) Type: amino acid (D) Topology: linear

73 993 6526-079-118 -108- (ii) Molecule Type: Protein (xi) Sequence Description: SEQ ID NO: 50:

Met Ile Leu Arg Leu Tyr Ala Met Ile Ile Ser Tyr Cys Cys Ala Ile 15 10 15

Cys Ala Ala Pro Phe Gin Ser Arg Thr Thr Asp Leu Asp Tyr Gly Pro 20 25 30

Asp Lys Thr Ser Glu Ala Ser Asp Arg Gin Ser Pro Asn Asn Phe 35 40 45

Be His Go Leu Gin Asn Gly Phe Phe Pro Asp Leu Ser Ser Thr Tyr 50 55 60

Ser Ser Met Ala Gly Lys Asp Trp Asn Leu Tyr Ser Pro Arg Go Thr 65 30 75 80

Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu Phe Leu Ser Glu 85 90 95

Glu Thr Will Go His Pro Glu Pro Ala Asn Lys Thr Ser Arg Leu Lys 100 105 110

Arg Ala Ser Gly Ser Asp Ser To Be Leu Ser Arg Arg Gly Glu Leu 115 120 125

Ser Vai Cys Asp Ser Vai Asn Vai Trp Vai Thr Asp Lys Arg Thr Ala 130 135 140

Go Asp Asp Arg Gly Lys Ile Go Thr Go Met Glu Ile Gin Thr 145 150 155 160

Leu Thr Gly Pro Leu Lys Gin Tyr Phe Phe Glu Thr Lys Cys Asn Pro 165 170 175

Ser Gly Ser Thr Thr Arg Gly Cys Arg Gly Val Asp Lys Lys Gin Trp 180 185 190

Ile Ser Glu Cys Lye Ala Lys Gin Ser Tyr Vai Arg Ala Leu Thr Ile 195 200 205

Asp Ala Asn Lys Leu Gly Gly Trp Arg Trp Ile Arg Ile Asp Thr Ala 210 215 220

Cys Vys Cys Thr Leu Leu Ser Arg Thr Gly Arg Thr 225 230 235 (2) INFORMATION FOR SEQ. ID No. 51: (i) Sequence Characteristics (A) Length: 57 amino acids (B) Type: amino acid. (C) Chain type: simple (D) Topology: not known

(Ii) Molecule Type: Peptide (xi) Description of the Sequence: SEQ ID NO: 51:

Gin Tyr Phe Phe Glu Thr Lye Cys Asn Pro Ser Gly Ser Thr Thr Arg 15 10 IS

Gly Cys Arg Gly Vai Asp Lye Lye Gin Trp Ile Ser Glu Cye Lye Ala 20 25 30

Lye Gin Ser Tyr Go Arg Ala Leu Thr Ile Aep Ala Aen Lye Leu Go 35 40 45

Gly Trp Arg Trp Ile Arg Ile Asp Thr 50 55 (2) INFORMATION FOR SEQ. ID No. 52: (i) Characteristics of Sequence (A) Length: 6 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NB: 52:

Gin Tyr Phe Tyr Glu Thr 1 5 (2) INFORMATION FOR SEQ. (B) Type of nucleic acid (C) Type of chain: single (D) Topology: not known (ii) Type of molecule: DNA genomic) -110- 73 993 6526-079-118 (xi) SEQ ID NO: 53: CARTAYTTYT TYGARAC 17 (2) INFORMATION FOR SEQ ID NO: ID Ns 54: (i) Sequence Characteristics (A) Length: 17 base pairs (B) Type: nucleic acid (C) Type of chain: simple (D) Topology: not known (ii) genomic) (xi) Sequence Description: SEQ ID NO: 54: CARTAYTTYT AYGARAC (2) INFORMATION FOR SEQ. ID Na 55: (i) Sequence Characteristics (A) Length: 17 base pairs (B) Type: nucleic acid (C) Type of chain: single (D) Topology: genomic) (ix) Structure: (A) Name / Code; modified base (B) Location: 9

(C) Other information: / markup = N / note = " N = 1 " (ix) Structure: (A) Name / Code; modified base -111- 73 993 6526-079-118 (B) Location: 12

(C) Other information: / marking = N / note = nN = 1 " (xi) Description of the Sequence: SEQ ID No: 55:

TTRCAYTCNS WNATCCA (2) INFORMATION FOR SEQ. ID Na 56: (i) Sequence Characteristics (A) Length: 17 base pairs (B) Type: nucleic acid (C) Type of chain: simple (D) Topology: not known (ii) genomic) (ix) Structure: (A) Name / Code; modified base (B) Location: 9

(C) Other information: / markup = N / note = " N = I " (xi) Description of the Sequence: SEQ ID NB: 56: GAYTGYTTNG CYTTRCA (2) INFORMATION FOR SEQ. ID Ns 57: (i) Sequence Characteristics (A) Length: 17 base pairs (B) Type: nucleic acid (C) Type of chain: simple (D) Topology: genomic) 73 993 6526-079-118 Structure: (A) Name / Code; modified base (B) Location: 9

(C) Other information: / markup = N / note = " N = i " (xi) Description of the Sequence: SEQ ID NO: 57:

CTYTGYTTNG CYTTRCA (2) INFORMATION FOR SEQ. ID N2 58: (i) Sequence Characteristics (A) Length: 17 base pairs (B) Type: nucleic acid (C) Type of chain: single (D) topology: genomic) (ix) Structure: (A) Name / Code; modified base (B) Location: 6 (C) Other information: / markup = n / note = " N = 1 " (ix) Structure: (A) Name / Code; modified base (B) Location: 9

(C) Other information: / markup = N / note = " N = 1 " (ix) Structure: (A) Name / Code; modified base (B) Location: 12

(C) Other information: / markup = N / note = " N = I " -113- 73 993 6526-079-118 (xi) SEQ ID NO: 58 GTRTCNATNC KNATCCA (2) INFORMATION FOR SEQ ID NO: ID N8 59: (i) Sequence Characteristics (A) Length: 17 base pairs (B) Type: nucleic acid (C) Type of chain: simple (D) Topology: not known (ii) genomic) (xi) Sequence description: SEQ ID NO: 59 CCAAGCTTCT AGAATTC (2) INFORMATION FOR SEQ. ID NB 60: (i) Sequence characteristics (A) Length: 17 base pairs (B) Type: nucleic acid (C) Type of chain: simple (D) Topology: genomic) (xi) Sequence description: SEQ ID No: 60 GACTCGAGTC GACATCG (2) INFORMATION FOR SEQ. ID N8 61: (i) Sequence characteristics (A) Length: 126 base pairs (B) Type: nucleic acid (C) Chain type: double -114- 73 993 6526-079-118 (D) Topology: no known (ii) Type of Molecule: DNA (genomic) (ix) Structure:

(A) Name / Code: CDS (B) Location: 1..126 (xi) Sequence description: SEQ ID NO: 61: CAG TAT TTT TAC GAG ACG CGC TGC AAG GCC GAA AGC GCT GGG GAA GGT 48 Gin Tyr Phe Tyr Glu Thr Arg CyB Lys Ala Glu Ser Ala Gly Glu Gly 1 5 10 15 GGC CCA GGT GTG GGC GGA GGG GGC TGT CGC GGC GTG GAT CGG AGG CAC 96 Gly Pro Gly Gly Gly Gly Gly Gly Cys Arg Gly Vai Asp Arg Arg Hi8 20 25 TGG CTC TCA GAA TGT AAA GCC AAA CAA TCG 126 Trp Leu Ser Glu Cys Lys Ala Lys Gin Ser 35 40 (2) INFORMATION FOR SEQ. ID N1 62: (i) Characteristics of Sequence (A) Length: 42 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule Type: Protein (xi)

Gin Tyr Phe Tyr Glu Thr Arg Cys Lys Ala Glu Ser Ala Gly Glu Gly 1 5 10 15 Gly Pro Gly Gly Gly Gly Gly Gly Cys Arg Gly Va Asp Arg Arg His 20 25 30 Trp Leu Ser Glu Cys Lys Ala Lys Gin Ser 35 40 1 INFORMATION FOR SEQ. ID N1 63; (B) Type of nucleic acid (C) Type of chain: double (D) Topology: not known (ii) Type of molecule: DNA (genomic) (ix) Structure:

(A) Name / Code; CDS (B) Location: 1..126 (xi) Sequence Description: SEQ ID No: 63: CAG TAT TTT TAC GAA ACC CGC TGC AAG GCT GAT AAC GCT GAG GAA GGT Gin Tyr Phe Tyr Glu Thr Arg Cys Lys Ala Asp Asn Ala Glu Glu Gly 1 5 10 15 GGC CCG GGG GCA GGT GGA GGG GGC TGC CGG GGA GTG GAC AGG AGG CAC Gly Pro Gly Ala Gly Gly Gly Gly Cys Arg Gly Va Asp Arg Arg His 20 25 30 TGG GTA TCT GAG TGT AAA GCC AAA CAA TCG Trp Will Be Glu Cys Lys Ala Lys Gin Ser 35 40 48 96 126 (2) INFORMATION FOR SEQ. ID No. 64: (i) Characteristics of the Sequence (A) Length: 42 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule Type: Protein (xi) Sequence Description:

Gin Tyr Phe Tyr Glu Thr Arg Cya Lys Ala Asp Asn Ala Glu Glu Gly 1 5 10 15

Gly Pro Gly Ala Gly Gly Gly Gly Cys Arg Gly Vai Asp Arg Arg Hie 20 25 30

Trp Will Be Glu CyB Lys Ala Lys Gin Ser 35 40 -116-73993 6526-079-118 (2) INFORMATION FOR SEQ. ID Ns 65: (i) Sequence Characteristics (A) Length: 35 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: DNA (genomic) ( xi) Description of the Sequence: SEQ ID NO: 65:

Gin Tyr Phe Phe Glu Thr Lys Cys Aan Pro Ser Gly Ser Thr Thr Arg 15 15

Gly Cye Arg Gly Vai Asp Lye Lys Gin Trp Ile Ser Glu Cye Lye Ala 20 25 30

Lys Gin Ser 35 (2) INFORMATION FOR SEQ. ID No. 66: (i) Characteristics of the Sequence (A) Length: 35 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 66:

Gin Tyr Phe Phe Glu Thr Lys Cys Arg Ala Pro Asn Pro Go Glu Ser 15 10 15

Gly Cys Arg Gly Ile Asp Ser Lys His Trp Asn Ser Tyr Cys Thr Thr 20 25 30

Thr His Thr 35 -117- 73 993 6526-079-118 (2) INFORMATION FOR SEQ. ID Ne 67: (i) Characteristics of the Sequence (A) Length: 35 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID Ns: 67:

Gin Tyr Phe Tyr Glu Thr Lys Cys αβ Pro Met Gly Tyr Thr Lys Glu 15 10 15

Gly Cys Arg Gly Ile Asp Lys Arg His Trp Asn Ser Gin Cye Arg Thr 20 25 30

Thr Gin Ser 35 (2) INFORMATION FOR SEQ. ID No. 68: (i) Sequence Characteristics (A) Length: 35 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID Ns: 68:

Gin Tyr Phe Tyr Glu Thr Arg Cys Lys Glu Ala Arg Pro Val Lys Asn 15 10 15

Gly Cys Arg Gly Ile Asp Asp Lys His Trp Asn Ser Gin Cys Lys Thr 20 25 30

Ser Gin Thr • 35 -118- 73 993 6526-079-118 (2) INFORMATION FOR SEQ. ID N2 69: (i) Sequence characteristics (A) Length: 192 base pairs (B) Type: nucleic acid (C) Chain type: double (D) topology: unknown (ii) Molecule type: DNA genomic) (ix) Structure:

(A) Name / Code; CDS (B) Location: 1..192 (xi) Sequence Description: SEQ ID No: 69: CAA TAT TTT TTC GAG ACC CGC TGC AAG GCT GAT AAC GCT GAG GAA GGT 48 Gin Tyr Phe Phe Glu Thr Arg Cys Lys Ala Asp Asn Ala Glu Glu Gly 1 5 10 15 GGT CCG GGG GCA GGT GGA GGG GGC TGC CGG GGA GTG GAC AGG AGG CAC 96 Gly Pro Gly Ala Gly Gly Gly Gly Cys Arg Gly Vai Asp Arg Arg His 20 25 30 TGG CTA TCT GAG TGC AAG GCC AAG CAG TCC TAT GTG CGG GCA TTG ACC 144 Trp Will Be Glu Cys Lys Ala Lys Gin Ser Tyr Go Arg Ala Leu Thr 35 40 45 GCT GAT GCC CAG GGC CGT GTG GGC TGG CGA TGG ATC CGC ATC GAT ACG 192 Ala Asp F; n Ala Gin Gly Arg Go Gly Trp Arg Trp Ile Arg Ile Asp Thr 55 60 (2) INFORMATION FOR SEQ. ID NB 70: (i) Characteristics of Sequence (A) Length: 64 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule Type: Protein (xi) Sequence Description:

Gin Tyr Phe Phe Glu Thr Arg Cye Lys Ala Asp Asn Ala Glu Glu Gly 1 5 10 15

Gly Pro Gly Ala Gly Gly Gly Gly Cya Arg Gly Vap Aap Arg Arg Hi · 20 25 30 -119- 73 993 6526-079-118

Trp Will Be Glu Cye Lys Ala Lys Gin Ser Tyr Vai Arg Ala Leu Thr 35 40 45

Ala Asp Ala Gin Gly Arg Go Gly Trp Arg Trp Ile Arg He Αερ Thr 50 55 60 (2) INFORMATION FOR SEQ. ID No. 71: (i) Sequence Characteristics (A) Length: 35 base pairs (B) Type: nucleic acid (C) Type of chain: double (D) Topology: genomic) (ix) Structure:

(A) Name / Code: CDS (B) Location: 18..35 (xi) Sequence description: SEQ ID No: 71:

GACTCGAGTC GACATCG GAA ACC CGC TGC AAG GCT

Glu Thr Arg Cys Lys Ala 15 (2) INFORMATION FOR SEQ. ID No. 72: (i) Sequence characteristics (A) Length: 6 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: Protein (xi) Sequence description: SEQ ID NO: 72 :

Glu Thr Arg Cys Lys Ala 15-120-73993 6526-079-118 (2) INFORMATION FOR SEQ. ID Ns 73: (i) Sequence Characteristics (A) Length: 35 base pairs (B) Type: nucleic acid (C) Chain type: double (D) Topology: not known (ii) Molecule type: DNA genomic) (ix) Structure:

(A) Name / Code: CDS (B) Location: 18..35 (xi) Sequence description: SEQ ID NO: 73:

GACTCGAGTC GACATCG GAT AAC GCT GAG GAA GGT

Asp Asn Ala Glu Glu Gly 1 5 (2) INFORMATION FOR SEQ. ID NB 74: (i) Sequence Characteristics (A) Length: 6 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule Type: Protein (xi)

Asp Asn Ala Glu Glu Gly 1 5 (2) INFORMATION FOR SEQ. ID NB 75: (i) Sequence characteristics (A) Length: 1404 base pairs (B) Type: nucleic acid -121- 73 993 6526-079-118 (C) Chain type: double (D) Topology: no known (ii) Type of Molecule: DNA (genomic) (ix) Structure:

(A) NAME / KEY: CDS (B) LOCATION: 460..1104 (xi) SEQUENCE DESCRIPTION: SEQ ID NB: 75: CTTGTCACCC AGGTGGCACC CGAGTGGTGC ACTCTCTGCT CACTGCAACC TCGGCCTCCT 60 GGGTTCGAGT GATTCTCCTA CCTCAGCCTA CTGAGTAGCT GGGATTACAG GCGTGCAGCA 120 CTATGCCCGG TTAATTTTGG TATTTTTGGT AGAGATGAGG TTTCACAATG TTGACCAGCT 180 gctctggaac TCCTGACCTC AAGTCATCCA CCTGCCTCAG CCTCCCAGAG TGCTGGGATT 240 AGAGGTGTGG GGCACAGTGC CTGGCCTGTA GTAGTTGAAT ATTTATTATT AATCTACAAG 300 TTGCGCATTA CGCAAGCCCT AGATATAGGG TCCCCCAAAC TTCTAGAACA AGGGCTTCCC 360 CACAATCCTG GCAGGCAAGC CTCCCCTGGG GTTCCCAACT TCTTTCCCCA CTGAAGTTTT 420 TACCCCCTTC TCTAATCCCA GCCTCCCTCT TTCTGTCTC i CAG GTG CTC GAG CGA 474

Gin Vai Leu Arg Glu ATG CTC CCT CTC CCC TCA TGC TCC CTC CCC ATC 1 CTC CTC CTT TTC 5 CTC 522 Met Leu Pro Leu Pro Ser Cys Ser Leu Pro Ile Leu Leu Leu Phe Leu 10 15 20 CTC CCC AGT GTG CCA ATT GAG TCC CAA CCC CCC CCC TCA ACA TTG CCC 570 Leu Pro Be Pro Glu Ser Glu Pro Gin Pro Pro Be Thr Leu Pro 25 30 35 CCT TTT CTG GCC CCT GAG TGG GAC CTT CTC TCC CCC CGA GTA GTC CTG 618 Pro Phe Leu Ala Pro Glu Trp Asp Leu Leu Ser Pro Arg Vai Leu Leu 40 45 50 TCT AGG GGT GCC CCT GCT GGG CCC CCT CTG CTC TTC CTG CTG GAG GCT 666 Ser Arg Gly Ala Pro Ala Gly Pro Pro Leu Leu Phe Leu Leu Glu Ala 55 60 65 GGG GCC TTT CGG GAG TCA GCA GGT GCC CCG GCC AAC CGC AGC CGG CGT 714 Gly Ala Phe Arg Glu Ser Ala Gly Ala Pro Ala Asn Arg Ser Arg Arg 70 75 80 85 GGG GTG AGC GAA. ACT GCA CCA GCG AGT CGT CGG GGT GAG CTG GCT GTG 762 Gly Gly Glu Thr Ala Pro Ala Ser Arg Arg Gly Glu Leu Ala Val 90 90 100 TGC GAT GCA GTC AGT GGC TGG GTG ACA GAC CGC CGG ACC GCT GTG GAC 810 Cys Aep Ala Will Be Gly Trp Will Thr Asp Arg Arg Thr Ala Will Asp 105 110 115 858 -122-858 -122- Gin Vai Leu Arg Glu Met Leu Pro Leu Pro Ser Cys Ser Leu Pro Ile 1 5 10 15 Leu Leu Leu Phe Leu Leu Pro Ser Pro Pro Glu Pro Gin Pro Pro Pro Thr Leu Pro Pro Phe Leu Pro Pro Glu Trp Asp Leu Leu Ser 35 40 45 Pro Arg Pro Vai Leu Pro Arg Pro Gly Pro Al Pro Gly Pro Pro Leu Leu 50 55 60 73 993 6526-079-118 TTG CGT GGG CGC GAG GTG GAG GTG TTG GGC GAG GTG CCT GCA GCT GGC Leu Arg Gly Arg Glu Vai Glu Vai Leu Gly Glu Vai Pro Ala Ala Gly 120 125 130 GGC AGT ccc CTC CGC CAG TAC TTC TTT GAA ACC CGC TGC AAG GCT GAT Gly Ser Pro Leu Arg Gin Tyr Phe Phe Glu Thr Arg Cye Lys Ala Asp 135 140 145 AAC GCT GAG GAA GGT GGT CCG GGG GCA GGT GGA GGG GGC TGC CGG GGA Asn Ala Glu Glu Gly Gly Pro Gly Ally Gly Gly Gly Gly Cys Arg Gly 150 155 160 165 GTG GAC AGG AGG CAC TGG GTA TCT GAG TGC AAG GCC AAG CAG TCC TAT Go Asp Arg Arg Hie Trp Will Be Glu Cys Lys Ala Lys Gin Ser Tyr 170 175 180 GTG CGG GCA TTG ACC GCT GAT GCC CAG GGC CGT GTG GGC TGG CGA TGG Go Arg Ala Leu Thr Ala Asp Ala Gin Gly Arg Go Gly Trp Arg Trp 185 190 195 ATT CGA ATT GAC ACT GCC TGC GTC TGC ACA CTC CTC AGC CGG ACT GGC Ile Arg Ile Asp Thr Ala Cys Vai Cys Thr Leu Leu Ser Arg Thr Gly 200 205 210 CGG GCC TGAGACCCAT GCCCAGGAAA ATAACAGAGC TGGATGCTGA GAGACCTCAG Arg Ala 215

GGATGGCCCA GCTGATCTAA GGACCCCAGT TTGGGAACTC ATCAAATAAT CACAAAATCA CAATTCTCTG ATTTGGAGCT CAATCTCTGC AGGATGGGTG AAACCACATG GGGTTTTGGA GGTTGAATAG GAGTTCTCCT GGAGCAACTT GAGGGTAATA ATGATGATGA TATAATAATA ATAGCCACTA TTTACTGAGT GTTTACTGTT TCTTATCCCT AATACATAAC TCCTCAGATC AACTCTCATG (2) INFORMATION FOR SEQ. ID No. 76: (i) Characteristics of Sequence (A) Length: 215 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule Type: Protein (xi) Sequence Description: 906 954 1002 1050 1098 1154 1214 1274 1334 1394 1404 -123- 73 993 6526-079-118 <gt; > < tb > ''

Phe Leu Leu Glu Ala Gly Ala Phe Arg Glu Ser Ala Gly Ala Pro Ala 65 70 75 80 Asn Arg Ser Arg Arg Gly Val Ser Glu Thr Ala Pro Ala Ser Arg Arg 85 90 95 Gly Glu Leu Ala Val Cys Asp Ala Val Ser Gly Trp Val Thr Asp Arg 100 105 110 Arg Thr Ala Val Asp Leu Arg Gly Arg Glu Val Glu Val Leu Gly Glu 115 120 125 Pro Pro Ala Pro Gly Gly Ser Pro Leu Arg Gin Tyr Phe Phe Glu Thr 130 135 140 Arg Cye Lys Ala Asp Asn Ala Glu Glu Gly Gly Pro Gly Ala Gly Gly 145 150 155 160 Gly Gly Cya Arg Gly Val Asp Arg Arg His Trp Val Ser Glu Cys Lys 165 170 175 Ala Lye Gin Ser Tyr val Arg Ala Leu Thr Ala Asp A1 & Gin Gly Arg 180 185 190 Gly Gly Trp Arg Trp Ile Arg Ile Asp Thr Ala Cys Val Cys Thr Leu 195 200 205 Leu Ser Arg Thr Gly Arg Ala 210 215 (2) INFORMATION FOR SEQ. ID No. 77: (i) Sequence Characteristics (A) Length: 214 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NO: 77:

Val Leu Arg Glu Met Leu Pro Leu Pro Ser Cys Ser Leu Pro Ile Leu 1 5 10 15 Leu Leu Phe Leu Leu Pro Ser Val Pro Ile Glu Ser Gin Pro Pro Pro 20 25 30 Ser Thr Leu Pro Pro Phe Leu Ala Pro Glu Trp Asp Leu Leu Ser Pro 35 40 45 Arg Val Val Leu Ser Arg Gly Ala Pro Ala Gly Pro Pro Leu Leu Phe 50 55 60 Leu Leu Glu Ala Gly Ala Phe Arg Glu Ser Ala Gly Ala Pro Ala Asn 65 70 75 80 Arg Ser Arg Arg Gly Val Ser Glu Thr Ala Pro Ala Ser Arg Arg Gly 85 90 95 Glu Leu Ala Val Cye Asp Ala Val Ser Gly Trp Val Thr Aap Arg Arg 100 105 110 73 993 6526-079-118 -124-

Thr Ala Go Asp Leu Arg Gly Arg Glu Go Glu Go Leu Gly Glu Go 115 115 125 Pro Ala Gly Gly Pro Pro Leu Arg Gin Tyr Phe Phe Glu Thr Arg 130 135 140 Cye Lys Ala Asp Asn Ala Glu Glu Gly Gly Pro Gly Ala Gly Gly Gly 145 150 155 160 Gly Cys Arg Gly Va Asp Arg Arg Kis Trp Will Be Glu Cys LyB Ala 165 170 175 Lys Gin Ser Tyr Go Arg Ala Leu Thr Ala Asp Ala Gin Gly Arg Val 180 185 190 Gly Trp Arg Trp Ile Arg Ile Asp Thr Ala Cys Vai Cys Thr Leu Leu 195 200 205 Ser Thr Arg Gly Arg Ala 210 (2) INFORMATION FOR SEQ. ID NB 78: (i) Characteristics of the Sequence (A) Length: 176 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 78:

Ser Ser Thr Tyr Ser Ser Met Ala Gly LyB Asp Trp Asn Leu Tyr Ser 1 5 10 15 Pro Arg Go Thr Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu 20 25 30 Phe Leu Ser Glu Glu Thr Will Go His Pro Glu Pro Ala Asn Lys Thr 35 40 45 Ser Arg Leu Lys Arg Ala Ser Gly Ser Asp Ser Ser Le Ser Ser 50 50 Arg Arg Gly Glu Leu Ser Vai Cys Asp Ser Vai Asn Vai Trp Vai Thr Asp 65 70 75 80 Lys Arg Thr Ala Go Asp Asp Arg Gly Lys Ile Go Thr Go Met Met 85 85 95 Glu Ile Gin Thr Leu Thr Gly Pro Leu Lys Gin Tyr Phe Phe Glu Thr 100 105 110 Lya Cys Asn Pro Ser Gly Ser Thr Thr Arg Gly Cys Arg Gly Go Asp 115 120 125 Lys Lys Gin Trp Ile Ser Glu Cys Lys Ala Lys Gin Ser Tyr Val Arg 130 135 140 -125- 73 993 6526-079-118

Ala Leu Thr Ile Asp Ala Asn Lys Leu Go Gly Trp Arg Trp Ile Arg 145 150 155 160

Ile Asp Thr Ala Cye V Cys Thr Leu Leu Ser Arg Thr Gly Arg Thr 165 170 175 (2) INFORMATION FOR SEQ. ID No. 79: (i) Sequence Characteristics (A) Length: 177 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 79:

Glu Phe Gin Pro Met Ile Ala Thr Asp Thr Glu Leu Leu Arg Gin Gin 1 5 10 15 Arg Arg Tyr Asn Ser Pro Arg Val Leu Leu Ser Asp Ser Thr Pro Leu 20 25 30 Glu Pro Pro Pro Leu Tyr Leu Met Glu Asp Tyr Val Gly Asn Pro Val 35 40 45 Go Ala Asn Arg Thr Ser Pro Arg Arg Lys Tyr Ala Glu His Lys Ser 50 55 60 His Arg Gly Glu Tyr Ser Vai Cys Asp Ser Glu Ser Leu Trp Val Thr 65 70 75 80 Asp Lys Ser Ser Ala Ile Asp Ile Arg Gly His Gin Val Thr Val Leu 65 90 95 Gly Glu Ile Lys Thr Gly Asn Ser Pro Val Lys Gin Tyr Phe Tyr Glu 100 105 110 Thr Arg Cys Lys Glu Ala Arg Pro Val Lys Asn Gly Cys Arg Gly Ile 115 120 125 Asp Asp Lys Bis Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr Val 130 135 140 Arg Ala Leu Thr Ser Glu Asn Asn Lys Leu Val Gly Trp Arg Trp Ile 145 150 155 160 Arg Ile Asp Thr Ser Cys Go Cys Ala Leu Ser Arg Lys Ile Gly Arg 165 170 175

Thr

73 993 6526-079-118 -126- (2) INFORMATION FOR SEQ. ID NB 80; (i) Sequence Characteristics (A) Length: 175 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Type of molecule: Peptide (xi) ID No: 80:

Gin Pro Go Ile Ala Met Asp Thr Glu Leu Leu Arg Gin Gin Arg Arg 1 5 10 15 Tyr Asn Ser Pro Arg Go Leu Leu Be Asp Thr Thr Pro Leu Glu Pro 20 25 30 Pro Pro Leu Tyr Leu Met Glu Asp Tyr Go Gly Ser Pro Val Val Ala 35 40 45 Asn Arg Thr Ser Arg Arg Lys Arg Tyr Ala Glu His Lye Ser His Arg 50 55 60 Gly Glu Tyr Ser Vai Cys Asp Ser Glu Ser Leu Trp Val Thr Asp Lys 65 70 75 80 Ser Ser Ala Ile Asp Ile Arg Gly His Gin Val Thr Val Leu Gly Glu 85 90 95 Ile Lys Thr Gly Asn Ser Pro Val Lys Gin Tyr Phe Tyr Glu Thr Arg 100 105 110 Cys Lys Glu Ala Arg Pro Val Lys Asn Gly Gly Arg Gly Ile Asp Asp 115 120 125 Lys Kis Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr Val Arg Ala 130 135 140 Leu Thr Ser Glu Asn Asn Lys Leu Val Gly Trp Arg Trp Ile Arg Ile 145 150 155 160 Asp Thr Ser Cys Val Cys Ala Leu Ser Arg Lys Ile Gly Arg Thr 165 170 175 (2) INFORMATION FOR SEQ. ID No. 81: (i) Sequence Characteristics (A) Length: 178 amino acids (B) Type: amino acid (C) Chain type: single -127-

73 993 6526-079-118 (D) Topology: not known (ii) Molecule Type: Peptide (xi) Sequence Description: SEQ ID NOS: 81:

Glu Phe Gin Pro Met Ile Ala Thr Asp Thr Glu Leu Leu Arg Gin Gin 1 5 10 15 Arg Arg Tyr Asn Ser Pro Arg Val Leu Leu Ser Asp Ser Thr Pro Leu 20 25 30 Glu Pro Pro Pro Leu Tyr Leu Met Glu Asp Tyr Val Gly Asn Pro Val 35 40 45 Go Thr Asn Arg Thr Ser Pro Arg Arg Lys Arg Tyr Ala Glu His Lys 50 55 60 Ser Hie Arg Gly Glu Tyr Ser Val Cys Asp Ser Glu Ser Leu Trp Val 65 70 75 80 Thr Asp Lye Ser Ser Ala Ile Asp Ile Arg Gly His Gin Val Thr Val 85 90 95 Leu Gly Glu Ile Lys Thr Gly Asn Ser Pro Val Lys Gin Tyr Phe Tyr 100 105 110 Glu Thr Arg Cys Lys Glu Ala Arg Pro Val Lys Asn Gly Gly Arg Gly 115 120 125 Ile Asp Asp Lys Hifi Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr 130 135 140 Val Arg Arg Leu Thr Ser Glu Asn Asn Lys Leu Val Gly Trp Arg Trp 145 150 155 160 Ile Arg Xle Asp Thr Ser Cys Val Cys Ala Leu Ser Arg Lys Ile Gly 165 170 175

Arg Thr (2) INFORMATION FOR SEQ. ID Ns 82: (i) Sequence Characteristics (A) Length: 160 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NOS: 82: 73 993

6526-079-118 -128-

Asp Leu Tyr Thr Ser Arg Val Met Leu Ser Ser Val Gin Leu Glu Pro Pro Leu Leu Phe Leu Leu Glu Glu Tyr Lys Asn Tyr Leu Aep Ala 20 25 30 Ala Asn Met Ser Met Arg Val Arg Arg His Ser Asp Pro Ala Arg Arg 35 40 45 Gly Glu Leu Ser Val Cys Asp Ser Ile Ser Glu Trp Val Thr Ala Ala 50 55 60 Aap Lye Lys Thr Ala Val Asp Met Ser Gly Gly Thr Val Thr Val Leu 65 70 75 80 Glu Lys Go Pro Will Be Lys Gly Gin Leu Lys Gin Tyr Phe Tyr Glu 85 90 95 Thr Lys Cys Asn Pro Met Gly Tyr Thr Lys Glu Gly Gly Arg Gly Ile 100 105 110 Asp Lys Arg His Trp Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr Val 115 120 125 Arg Ala Leu Thr Met Asp Ser Lys Lys Arg Ile Gly Trp Arg Phe Ile 130 135 140 Arg Ile Asp Thr Ser Cys Val Cys Thr Leu Thr Ile Lys Arg Gly Arg 145 150 155 160 (2) INFORMATION FOR SEQ. ID NB 83: (i) Characteristics of the Sequence (A) Length: 160 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID N s:; 83: Asp Leu 1 Tyr Thr Ser 5 Arg Val Met Leu Ser 10 Ser Gin Val Pro Leu Glu 15 Pro Pro Leu Leu 20 Phe Leu Leu Glu Glu 25 Tyr Lys Asn Tyr Leu 30 Asp Ala Ala Asn Met 35 Ser Met Arg Val Arg 40 Arg His Ser Asp Pro 45 Ala Arg Arg Gly Glu 50 Leu Ser Val Cys Asp 55 Ser Ile Ser Glu Trp 60 Val Thr Ala Ala Asp Lye 65 Lys Thr Ala Val 70 Aep Met Ser Gly Gly 75 Thr Val Thr Val Leu 80

Clu Lye Go Pro Will Be Lys Gly Gin Leu Lye Gin Phe Phe Tyr Clu -129- 73 993 6526-079-118 85 90 95

Thr Lys Cys Asn Pro Met Gly Tyr Thr Lys Glu Gly Gly Arg Asp Ile 100 105 110 Asp Lys Arg His Trp Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr V 115 115 125 Arg Ala Leu Thr Met Asp Ser Lys Lys Arg Ile Gly Trp Arg Phe Ile 130 135 140 Arg Ile Asp Thr Ser Cys Val Cys Thr Leu Thr Ile Lys Arg Gly Arg 145 150 155 160 (2) INFORMATION FOR SEQ. ID No. 84: (i) Characteristics of the Sequence (A) Length: 160 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 84:

Asp Leu Tyr Thr Ser Arg Vai Met Leu Ser Ser Gin Pro Leu Glu 1 5 10 15 Pro Pro Leu Leu Phe Leu Leu Glu Glu Tyr Lys Asn Tyr Leu Asp Ala 20 25 30 Ala Αβη Met Ser Met Arg V Arg Arg His Ser Asp Pro Ala Arg Arg 35 40 45 Gly Glu Leu Ser Vai Cye Asp Ser Ile Ser Glu Trp Val Thr Ala Ala 50 55 60 Asp Lys Lys Thr Ala Val Asp Met Ser Gly Gly Thr Val Thr Val Leu 65 70 75 80 Glu Lys Go Pro Will Be Lys Gly Gin Leu Lys Gin Tyr Phe Tyr Glu 85 90 95 Thr Lys Cys Asn Pro Met Gly Tyr Thr Lys Glu Gly Gly Arg Asp Ile 100 105 110 Asp Lye Arg His Trp Asn Ser Gin Cye Arg Thr Thr Gin Ser Tyr Val 115 115 125 Arg Ala Leu Thr Met Asp Ser Lys Lys Arg Ile Gly Trp Arg Phe Ile 130 135 140 Arg Ile Asp Thr Ser Cys Val Cys Thr Leu Thr Ile Lys Arg Gly Arg 145 150 155 160 -130- 73 993 6526- 079-118 (2) INFORMATION FOR SEQ. ID No. 85: (i) Characteristics of the Sequence (A) Length: 160 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule type: Peptide xi) Description Sequence: SEQ ID NO: 85: Asp Met Tyr Thr be Arg Vai Met Leu Ser Ser Gin Go Pro Leu Glu 1 5 10 15 Pro Pro Leu Leu Phe Leu Leu Glu Glu Tyr Lys Asn Tyr Leu Asp Ala 20 25 30 Ala Asn Met Ser Arg Arg Arg Arg His Ser Asp Pro Arg Arg Arg 35 40 45 Gly Glu Leu Ser Vai Cys Asp Ser lie Ser Glu Trp Val Thr Ala Ala 50 55 60 Asp Lys Lys Thr Ala Val Asp Met Ser Gly Gly Thr Go Thr Vai Leu 65 70 75 80 Glu Lys Go Pro Will Be Lys Gly Gin Leu Lys Gin Tyr Phe Tyr Glu 65 90 95 Thr Lys Cys Asn Pro Met Gly Tyr Thr Lys Glu Gly Gly Arg Asp Ile 100 105 110 Αερ Lys Arg His Trp Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr V 115 115 125 Arg Ala Leu Thr Met Asp Ser Lys Lys Arg Il and Gly Trp Arg Phe Ile 130 135 140 Arg Ile Asp Thr Ser Cys Val Cys Thr Leu Thr Ile Lys Arg Gly Arg 145 150 155 160 (2) INFORMATION FOR SEQ. ID NB 86: (i) Sequence Characteristics (A) Length: 180 amino acids (B) Type: amino acid. (C) Chain type: single (D) Topology: not known 73 993 6526-079-118 -131- (ii) Molecule type: Peptide (xi) Sequence description: SEQ XD NB: 86:

Ala 1 Ala Arg Val Thr 5 Gly Gin Thr Arg Asn 10 Ile Thr Val Asp Pro Arg 15 Leu Phe Lye Lye 20 Arg Arg Leu His Ser 25 Pro Arg Val Leu Phe 30 Ser Thr Gin Pro Pro 35 Pro Thr Ser Ser Asp Thr 40 Leu Asp Leu Asp 45 Phe Gin Ala His Gly 50 Thr Ile Pro Phe Asn Arg Thr 55 His Arg Ser 60 Lys Arg Ser Ser Ser 65 His Pro Ile Phe His Arg Gly Glu 70 Phe Ser 75 Val Cys Asp Ser Vai 80 Ser Vai Trp Go Gly Asp Lys Thr Thr Ala 85 90 Thr Asp Ile Lys Gly Lys 95 Glu Vai Met Vai 100 Leu Gly Glu Go Asn 105 Ile Asn Asn Ser V 110 Phe Lys Gin Tyr Phe 115 Phe Glu Thr Lys Cys Arg Asp Pro Asn 120 Pro 125 Go Asp Ser Gly Gly 130 Arg Asp Ile Asp Ser Lys His 135 Trp Asn Ser 140 Tyr Cys Thr Thr Thr 145 His Thr Phe Val Lys Ala Leu Thr 150 Thr Asp 155 Glu Lys Gin Ala Ala 160 Trp Arg Phe Ile Arg 165 Ile Asp Thr Ser Cys Go 170 Cys Go Leu Ser Arg 175 Lys Ala Thr Arg 180 (2) INFORMATION FOR SEQ. ID No. 87: (i) Characteristics of the Sequence (A) Length: 180 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Type of molecule: Peptide -132-73 993 6526-079-118 (xi) Description of the Sequence: SEQ ID NO: 87:

Ala Ala Arg Val Thr Gly Gin Thr Arg Asn Ile Thr Val Asp Pro Lye 1 5 10 15 Leu Phe Lys Lys Arg Arg Leu Arg Ser Pro Arg Val Leu Phe Ser Thr 20 25 30 Gin Pro Pro Thr Ser Ser Asp Thr Leu Asp Leu Asp Phe Gin Ala 35 40 45 His Gly Thr Ile Ser Phe Asn Arg Thr His Arg Ser Lys Arg Ser Ser 50 55 60 Thr His Pro Go Phe Hb Met Gly Glu Phe Ser Val Cys Asp Ser Val 65 70 75 80 Ser Vai Trp Gly Asp Lys Thr Thr Ala Thr Asp Ile Lye Gly Lye 85 90 95 Glu Vai Thr Vai Leu Gly Glu Val Asn Ile Asn Asn Ser val Phe Lya 100 105 110 Gin Tyr Phe Phe Glu Thr Lys Cys Arg Ala Pro Asn Pro Val Glu Ser 115 120 125 Gly Gly Arg Asp Ile Asp Ser Lys His Trp Asn Ser Tyr Cye Thr Thr 130 135 140 Thr Híb Thr Phe Vai Lys Ala Leu Thr Thr Asp Asp Lys Gin Ala Ala 145 150 155 160 Trp Arg Phe Ile Arg ile Asp Thr Ser Cys Val Cys Val Leu Ser Arg 165 170 175

Lys Ala Ala Arg 180 (2) INFORMATION FOR SEQ. ID N5 88: (i) Characteristics of Sequence (A) Length: 179 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NO: 88: -133-73993 6526-079-118

Ala Ala Arg Val Ala Gly Gin Thr Arg Asn Ile Thr Val Asp Pro Arg 1 5 10 15 Phe Lye Lye Arg Arg Leu Arg Ser Pro Arg Val Leu Phe Ser Thr Gin 20 25 30 Pro Pro Arg Glu Ala Asp Thr Thr Gin Asp Leu Asp Phe Glu Val Gly 35 40 45 Gly Ala Ala Pro Phe Asn Arg Thr His Arg Ser Lys Arg Ser Ser Ser 55 55 60 Hie Pro Xle Phe His Arg Gly Glu Phe Ser Val Cys Asp Ser Val Ser 65 70 75 80 Val Trp Val Gly Asp Lys Thr Thr Ala Thr Asp Ile Lys Gly Lye Glu 85 90 95 Val Met Val Leu Gly Glu Val Asn Ile Asn Asn Ser Val Phe Lys Gin 100 105 110 Tyr Phe Phe Glu Thr Lys Cys Arg Asp Pro Asn Pro Val Asp Ser Gly 115 120 125 Gly Arg Asp Ile Asp Ser Lys His Trp Asn Ser Tyr Cys Thr Thr Thr 130 135 140 His Thr Phe Val Lys Ala Leu Thr Met Asp Gly Lys Gin Ala Ala Trp 145 150 155 160 Arg Phe Ile Arg Ile Asp Thr Ser Cys Val Cys Val Leu Ser Arg Lys 165 170 175

Ala Val Arg (2) INFORMATION FOR SEQ. ID Ns 89: (i) Sequence Characteristics (A) Length: 163 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NO: 89:

Phe Phe Lye Lys Lye Arg Phe Arg Ser Ser Arg Val Leu Phe Ser Thr 1 5 10 15

Gin Pro Pro Pro Glu Ser Arg Lys Gly Gin Ser Thr Gly Phe Leu Ser 20 25 30 -134- 73 993 6526-079-118

Be Ala Will Be Leu Asn Arg Thr Ala Arg Thr Lys Arg Thr Ala His 35 40 45 Pro Go Leu His Arg Gly Glu Phe Be Vai Cye Asp Ser Val Ser Met 50 55 60 Trp Go Gly Asp Lys Thr Thr Ala Thr Asp Ile Lys Gly Lys Glu Val 65 70 75 B0 Thr Go Leu Gly GlU Go Asn Ile Asn Asn Asn Val Phe Lys Gin Tyr 85 90 95 Phe Phe Glu Thr Lys Cys Arg Asp Pro Arg Pro Will Be Gly Gly 100 105 110 Arg Asp Ile Asp Ala Lys HiS Trp Asn Ser Tyr Cys Thr Thr Thr Hb 115 120 125 Thr Phe Vai Lys Ala Leu Thr Met Glu Gly Lys Gin Ala Ala Trp Arg 130 135 140 Phe Ile Arg Ile Asp Thr Ser Cya Vai Cys Vai Leu Ser Arg Lys Ser 145 150 155 160 Gly Arg Pro (2) INFORMATION FOR SEQ. ID Nfi 90: (i) Sequence Characteristics (A) Length: 124 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 90:

His Arg Ser Lys Arg Ser Ser Glu Ser His Pro Val Phe His Arg Gly 1 5 10 15 Glu Phe Ser Val Cys Asp Ser Ile Ser Val Trp Val Gly Asp Lys Thr 20 25 30 Thr Ala Thr Asp Ile Lys Gly Lys Glu Val Met Val Leu Gly Glu Val 35 40 45 Asn Ile Asn Asn Ser Val Phe Lys Gin Tyr Phe Phe Glu Thr Lys Cys 50 55 60 Arg Asp Pro Asn Pro Val Asp Ser Gly Gly Arg Asp Ile Asp Ala Lys 65 70 75 80 His Trp Asn Ser Tyr Cye Thr Thr Thr His Thr Phe Val Lye Ala Leu 85 90 95 Thr Met Asp Gly Lys Gin Ala Ala Trp Arg Phe Ile Arg Ile Asp Thr 100 105 110 Ser Cys Val Cys val Leu Ser Arg Lys Thr Gly Gin 115 120 - 135-

73 993 6526-079-118 (2) INFORMATION FOR SEQ. ID Ns 91: (i) Sequence characteristics (A) Length: 164 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule type: Peptide of the Sequence: SEQ ID NOS: 91:

Val Aep Pro Lys Leu Phe Gin Lys Arg Gin Phe Gin Ser Pro Arg Val 1 5 10 15 Leu Phe Ser Thr Gin Pro Pro Leu Leu Ser Arg Asp Glu Glu Ser Val 20 25 30 Glu Phe Leu Asp Asn Glu Asp Ser Leu Asn Arg Asn Ile Arg Ala Lys 35 40 45 Arg Glu Asp His Pro Val His Asn Leu Gly Glu His Ser Val Cys Asp 50 55 60 Ser Val Ser Ala Trp Val Gly Lys Thr Thr Ala Thr Asp Ile Lys Gly 65 70 75 80 Asn Thr Val Thr Val Met Glu Asn Val Asn Leu Asp Asn Lye Val Tyr 85 90 95 Lye Gin Tyr Phe Phe Glu Thr Lys Cys Arg Asn Pro Asn Pro Glu Pro 100 105 110 Ser Gly Gly Arg Asp Ile Asp Ser Ser His Trp Asn Ser Tyr Cys Thr 115 120 125 Glu Thr Asp Gly Phe Ile Lys Ala Leu Thr Met Glu Gly Asn Gin Ala 130 135 140 Ser Trp Arg Phe Ile Arg Ile Asp Thr Ser Cys Val Cys Val Ile Thr 145 150 155 160 Lye Lye Lye Gly (2) INFORMATION FOR SEQ. ID Na 92: (i) Sequence Characteristics (A) Length: 196 amino acids (B) Type: amino acid. (C) Type of chain: single (D) Topology: not known -136- 73 993 6526-079-118 (ii) Molecule Type: Peptide (xi) Sequence Description: SEQ ID NO: 92:

Pro Ala Gly Ser Ser Pro Asp Pro Ser Ser Pro Go Asp Pro Lys 1 5 10 15 Leu Phe Ser Lys Arg His Tyr Pro Ser Arg Arg Will Go Ghe 20 25 30 Ile Ile Pro His His Asp Go Leu Asp Gly Glu Gly Tyr Asp Phe Glu 35 40 45 Arg Will Arg Arg Gly Leu Arg Will Arg Arg Lys Ala Will Be His Thr Met 50 55 60 Hie Arg Gly Glu Tyr Ser Vai Cye Asp Ser Ile Asn Thr Trp Val Asn 65 70 75 80 Thr Lys Arg Ala Thr Asp Met Ser Gly Asn Glu Va Thr Va Leu Ser 85 90 95 Hb Goa Thr Go Asn Asn Lys Go Lys Lys Gin Leu Phe Tyr Glu Thr 100 105 110 Thr Cye Arg Ser Pro Thr His Arg Ser Ser Gly Ile Val Ile Gly Gly 115 120 125 Arg Ser Gly Gly Arg Gly Gly Ser Gin Gly Ser Lys Thr Gly Asn Ser 130 135 140 Gly Gly Arg Asp Ile Asp Ser Arg Tyr Trp Asn Ser His Cys Thr Asn 145 150 155 160 Thr Asp Ile Tyr Will Be Ala Leu Thr Vai Phe Lys Glu Gin Thr Ala 165 170 175 Trp Arg Phe Ile Arg Ile Asn Ala Ser Cys Va Cys is going to be Arg Thr 180 185 190

Aen Ser Trp Ser 195 (2) INFORMATION FOR SEQ. ID N2 93: (i) Characteristics of Sequence (A) Length: 225 base pairs (B) Type: nucleic acid (C) Chain type: double (D) Topology: unknown (ii) Molecule type: DNA genomic) (ix) Structure:

(A) Name / Code: CDS (B) Location: 1..225 -137-73993 6526-079-118 (xi) Sequence description: SEQ ID NO: 93: CGA GTG GTC CTG TCT AGG GGT GCC GCT GCC GGG CCC CCT CTG GTC TTC 48 Arg Will Be Leu Ser Arg Gly Ala Ala Ala Gly Pro Pro Leu Vai Phe 1 5 10 15 CTG CTG GAG ACT GGA GCC TTT CGG GAG TCA GCA GGC GCC CGG GCC AAC 96 Leu Leu Glu Thr Gly Ala Phe Arg Glu Ser Ala Gly Ala Arg Ala Asn 20 25 30 CGC AGC CAG CGA GGG GTG AGC GAT ACT TCA CCG GCG AGT CAT CAG GGT 144 Arg Ser Gin Arg Gly Will Ser Asp Thr Ser Pro Ser His Gin Gly 35 40 45 GAG CTG GCC CTG TGC GAT GCA GTC AGT GTC TGG GTG ACA GAC CCC TGG 192 Glu Leu Ala Leu CyB Asp Ala Will Be Go Trp Go Thr Asp Pro Trp 50 55 60 ACT GCT GTG GAC TTG GGT GTG CTC GAG GTC GAG 225 Thr Ala Go Aap Leu Gly Go Leu Glu Go Glu 65 70 75 (2) INFORMATION FOR SEQ. ID NB 94: (i) Sequence Characteristics (A) Length: 75 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule Type: Protein (xi)

Arg Will Go Leu Will Arg Arg Gly Ala Ala Ala Gly Pro Pro Leu Vai Phe 15 10 15

Leu Leu Glu Thr Gly Ala Phe Arg Glu Ser Ala Gly Ala Arg Ala Asn 20 25 30 Arg Ser Gin 35 Arg Gly Will Be Asp 40 Thr Ser Pro Ala Ser 45 His Gin Gly Glu Leu 50 Ala Leu Cys Asp Ala 55 Will Go Trp Go 60 Thr Asp Pro Trp Thr 65 Ala Go Asp Leu Gly Go 70 Leu Glu Go Glu 75 (2) INFORMATION FOR SEQ. ID NB95: (i) Sequence Characteristics -138- -138-

73 993 6526-079-118 (A) Length: 53 base pairs (B) Type: nucleic acid (C) Chain type: simple (D) Topology: not known (ii) Molecule type: cDNA of the Sequence: SEQ ID NB: 95: CCCACAAGCT TGTTGGCATC TATGGTCAGA GCCCTCACAT AAGACTGTTT TGC 53 (2) INFORMATION FOR SEQ ID NO: ID N2 96: (i) Sequence Characteristics (A) Length: 10 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 96:

Lys Cys Asn Pro Ser Gly Ser Thr Thr Arg 15 10 (2) INFORMATION FOR SEQ. ID NB 97: (i) Characteristics of the Sequence (A) Length: 7 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: unknown (ii) Type of molecule: Peptide -139- - 139-

73 993 6526-079-118 (xi) Description of the Sequence: SEQ ID NO: 97:

Arg Gly Cys Arg Gly Go Asp 1 5 (2) INFORMATION FOR SEQ. ID No. 98: (i) Sequence Characteristics (A) Length: 5 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 98:

Lys Gin Trp Ile Ser 1 5 (2) INFORMATION FOR SEQ. ID NE 99: (i) Sequence Characteristics (A) Length: 6 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 99:

Lys Gin Ser Tyr Go Arg 1 5 (2) INFORMATION FOR SEQ. ID NB 100: (i) Sequence characteristics (A) Length: 7 amino acids -140-73 993 6526-079-118 (Β) Type: amino acid (C) Chain type: simple (D) Topology: ) Molecule Type: Peptide (xi) Sequence Description: SEQ ID NO: 100:

Gly Pro Gly Xaa Gly Gly Gly 1 5 (2) INFORMATION FOR SEQ. ID NB 101: (i) Characteristics of Sequence (A) Length: 7 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of the Sequence: SEQ ID NO: 101:

Gly Pro Gly Go Gly Gly Gly 1 5 (2) INFORMATION FOR SEQ. ID N2 102: (i) Characteristics of Sequence (A) Length: 7 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Type of molecule: 993 6526-079-118 (xi) Description of the Sequence: SEQ ID NO: 102

Gly Pro Gly Ala Gly Gly Gly 1 5 (2) INFORMATION FOR SEQ. ID No. 103: (i) Characteristics of the Sequence (A) Length: 5 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: Description of the Sequence: SEQ ID NB: 103

Glu Ser Ala Gly Glu 1 5 (2) INFORMATION FOR SEQ. ID NB 104: (i) Characteristics of the Sequence (A) Length: 5 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule type: Peptide of the Sequence: SEQ ID NOS: 104

Asp Asn Ala Glu Glu 1 5 (2) INFORMATION FOR SEQ. ID Ns 105: (i) Sequence Characteristics -142- 73 993 6526-079-118 (A) Length: 18 base pairs (B) Type: nucleic acid (C) Chain type: simple (D) topology: no (ii) Molecule Type: DNA (genomic) (xi) SEQ ID NO: 105: CAGTATTTTT ACGAAACC (2) INFORMATION FOR SEQ ID NO: ID NB 106: (i) Sequence Characteristics (A) Length: 18 base pairs (B) Type: nucleic acid (C) Type of chain: single (D) Topology: not known (ii) Type of molecule: cDNA xi) Description of the Sequence: SEQ ID No: 106:

ACATTTCGGT TTGTTCTG (2) INFORMATION FOR SEQ. ID Na 107: (i) Sequence Characteristics (A) Length: 18 base pairs (B) Type: nucleic acid (C) Type of chain: single (D) Topology: genomic) -143- 73 993 6526-079-118 (xi) SEQ ID NO: 107: CAGTATTTTT ACGAGACG (2) INFORMATION FOR SEQ ID NO: ID N2 108: (i) Sequence Characteristics (A) Length: 18 base pairs (B) Type: nucleic acid (C) Type of chain: simple (D) Topology: not known (ii) Molecule Type: cDNA xi) Description of the Sequence: SEQ ID NO: 108: ACATTTCGGT TTGTTAGC (2) INFORMATION FOR SEQ. ID N2 109: (i) Sequence Characteristics (A) Length: 36 base pairs (B) Type: nucleic acid (C) Type of chain: simple (D) Topology: genomic) (xi) Sequence Description: SEQ ID NO: 109: TGCAGTTTCG CTCACCCCCC GTTTTAGCCG GGAAGT (2) INFORMATION FOR SEQ. ID N 110: (i) Sequence Characteristics (A) Length: 7 amino acids (B) Type: amino acid (C) Chain type: single -144- 73 993 6526-079-118 (D) Topology: ) Molecule Type: Peptide (xi) Sequence Description: SEQ ID NO: 110:

Lys Gin Tyr Phe Tyr Glu Thr 1 5 (2) INFORMATION FOR SEQ. (C) Type of chain: simple (D) Topology: not known (ii) Type of molecule: Peptide (xi) Description of the Sequence: SEQ ID Ns: 111:

Trp Arg Phe Ile Arg Ile Asp 15 (2) INFORMATION FOR SEQ. ID N2 112: (i) Characteristics of Sequence (A) Length: 7 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 112:

Gly Glu Leu Ser Vai Cys Asp 1 5 -145- 73 993 6526-079-118 (2) INFORMATION FOR SEQ. ID No. 113: (i) Characteristics of the Sequence (A) Length: 6 amino acids (B) Type: amino acid (C) Chain type: simple (D) Topology: not known (ii) Molecule Type: Peptide of SEQ ID NO: 113:

Lys Ala Glu Ser Ala Gly 1 5 (2) INFORMATION FOR SEQ. ID No. 114: (i) Sequence Characteristics (A) Length: 45 base pairs (B) Type: nucleic acid (C) Type of chain: simple (D) Topology: not known (ii) Type of molecule: xi) Description of the Sequence: SEQ ID NOS: 114: GGAGGGGGCT GCCGGGGAGT GGACAGGAGG CACTGGGTAT CTGAG (2) INFORMATION FOR SEQ. ID NB 115: (i) Sequence Characteristics (A) Length: 15 amino acids. (D) Topology: not known (ii) Type of molecule: Peptide -146- 73 993 6526-079-118 (xi) Description of the Sequence: SEQ ID NO: 115:

Gly Gly Gly Cys Arg Gly Go Asp Arg Arg His Trp Go Be Glu 15 10 15 (2) INFORMATION FOR SEQ. NB 116: (i) Sequence characteristics (A) Length: 582 base pairs (B) Type: nucleic acid (C) Chain type: double (D) topology: unknown (ii) Molecule type: DNA genomic) (ix) Structure

(A) Name / Code: CDS (B) Location: 1..396 (xi) Description < SEQ ID NO: 116: GTA GTT TGT CCA ATT ATG TCA CAC AGA AGA AGA GTT CCT TCA CAA 48 Vai Cai Pro Ile Met His His Arg Ser Lys Go Pro Pro Gin 1 5 10 15 AGA TCC TCT AGA GTC GCG CCC GCG ACC TGC AGG CGC AGA ACT GGT AGG 96 Arg Ser Ser Arg Ala Pro Ala Thr Cys Arg Arg Arg Thr Gly Arg 20 25 30 TAT GGA AGA TCC CTC GAG GTG GAG GTG TTG GGC GAG GTG CCT CCA GCT 144 Tyr Gly Arg Ser Leu Glu Go Glu Go Leu Gly Go Pro Pro Ala 35 40 45 GTC GGC AGT TCC CTC CGC CAG CAC TTC TTT GTT GCC CGC TTC GAG GCC 192 Go Gly Ser Ser Leu Arg Gin His Phe Phe Goa Ala Arg Phe Glu Ala 50 55 60 GAT AAA TCT GAG GAA GGT GGC CCG GGG GTA GGT GGA GGG GCT GCC GCC 240 Asp Lys Ser Glu Glu Gly Gly Pro Gly Gly Gly Gly Gly Ala Ala Ala 65 70 75 80 GGG GTG TGG ACC GGG GGG CAC TGG GTG tct GAG TGC AAG GCC AAG CAG 288 Gly Vai Trp Thr Gly Gly His Trp Will Be Glu Cys Lys Ala Lys Gin 85 90 95 -147- --- - - -147- --- - - - - - 436 73 993 6526-079-118 TCC TAT GTG CGG GCA TTG ACC GCT GAT GCC CAG GGC CGT GTG GAC TGG 336

Ser Tyr Go Arg Ala Leu Thr Ala Asp Ala Gin Gly Arg Go Asp Trp 100 105 110 CGA TGG ATT CAA ACT GGC ACA GCC TGT GTC TGC ACA CTC CTC AGC CGG 384

Arg Trp Ile Gin Thr Gly Thr Ala Cys will Cys Thr Leu Leu Ser Arg 115 120 125 ACT GGC TGG GCC TGAGACTTAT ACCCAGGAAC TGGTCAGGCA GAAAAAGAAC Thr Gly Trp Ala 130 AGAGCTGGAT GCTGAGAGAC CTCAGGGTTG GCCCAGCTGC TCTACGGACG GACCCCAGTT 496 GGGGAACTCA TGAAATCATC ACAAAATCAC AACTCTCTGA ATTTGAGCTC AATCTCTGCA 556 GGATGGGTGC CACCACATGT GGTTTT 582 (2) INFORMATION FOR SEQ. ID No. 117: (i) Characteristics of Sequence (A) Compounding: 132 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule Type: Protein (xi) SEQ ID NO: 117:

Vai Cys Pro Ile Met His His Arg Ser Lys Val Pro Ser Gin 1 5 10 15 Arg Ser Ser Arg Val Pro Ala Thr Cys Arg Arg Arg Thr Gly Arg 20 25 30 Tyr Gly Arg Ser Leu Glu Vai Glu Vai Leu Gly Glu Val Pro Pro Ala 35 40 45 Go Gly Ser Ser Leu Arg Gin His Phe Phe Val Ala Arg Phe Glu Ala 50 55 60 Asp Lys Ser Glu Glu Gly Gly Pro Gly Go Gly Gly Gly Ala Ala Ala 65 70 75 80 Gly Vai Trp Thr Gly Gly His Trp Will Be Glu Cys Lys Ala Lys Gin 85 90 95 Ser Tyr goes Arg Ala Leu Thr Ala Asp Ala Gin Gly Arg Val Asp Trp 100 105 110 Arg Trp Ile Gin Thr Gly Thr Ala Cys Val Cys Thr Leu Leu Ser Arg 115 120 125

Thr Gly Trp Ala 130 -148-73993 6526-079-118 (2) INFORMATION FOR SEQ. ID N2 118: (i) Sequence Characteristics (A) Length: 36 base pairs (B) Type: nucleic acid (C) Type of chain: simple (D) Topology: genomic)

(xi) Description of the Sequence: SEQ ID NO: 118 CGGTACCCTC GAGCCACCAT GCTCCCTCTC CCCTCA (2) INFORMATION FOR SEQ ID NO: (B) Type: nucleic acid (C) Type of chain: single (D) Topology: not known (ii) Type of molecule: DNA (genomic) (xi) Sequence Description: SEQ ID NOS: 119 CGGTACAAGC GGCCGCTTCT TGGGCATGGG TCTCAG (2) INFORMATION FOR SEQ ID NO: ID N2 120: (i) Sequence Characteristics (A) Length: 36 base pairs (B) Type: nucleic acid (C) Type of chain: simple (D) Topology: genomic) -149- 73 993 6526-079-118 (xi) SEQ ID NO: 120 CGGTACCCTC GAGCCACCCA GGTGCTCCGA GAGATG (2) INFORMATION FOR SEQ ID NO: ID N2 121: (i) Sequence Characteristics (A) Length: 23 base pairs (B) Type: nucleic acid (C) Type of chain: simple (D) Topology: not known (ii) genomic) (xi) Sequence Description: SEQ ID No: 121 GAGACCGGAA GCTTCTAGAG ATC (2) INFORMATION FOR SEQ. ID N2 122: (i) Characteristics of the Sequence (A) Length: 36 base pairs (B) Type: nucleic acid (C) Type of chain: simple (D) Topology: genomic) (xi) Sequence description: SEQ ID No: 122 TGCAGTTTCG CTCACCCCCC GTTTCCGCCG TGATGT (2) INFORMATION FOR SEQ ID NO: ID N2 123: (i) Characteristics of Sequence (A) Length: 36 base pairs (B) Type: nucleic acid (C) Chain type: single -150- 73 993 6526-079-118 (D) Topology: no (ii) Molecule Type: DNA (genomic) (xi) Sequence Description: SEQ ID NO: 123: ACATCACGGC GGAAACGGGG GGTGAGCGAA ACTGCA (2) INFORMATION FOR SEQ ID NO: ID No. 124: (i) Sequence Characteristics (A) Length: 36 base pairs (B) Type: nucleic acid (C) Type of chain: single (D) Topology: genomic)

(xi) Description of the Sequence: SEQ ID NO: 124: ACTTCCCGGC TAAAACGGGG GGTGAGCGAA ACTGCA

Claims (37)

The use of NT-4 or a related peptide with NT-4 for the manufacture of a medicament for the treatment of an infertility disorder involving oocytes. Use according to claim 1, characterized in that the protein or peptide is derived from human NT-4. Use of an NT-4 protein, NT-4 peptide or derivative capable of supporting the survival, growth and / or differentiation of motor neurons, for the manufacture of a medicament for the treatment of an NT-related motor neuron disorder -4. Use according to claim 3, characterized in that the disorder is selected from the group consisting of lateral amyotrophic sclerosis, progressive spinal muscular atrophy, childhood muscular atrophy, polio, post-polio syndrome, Charlot-Marie Tooth disease, nerve trauma or nerve damage. Use according to claim 3, characterized in that the NT-4 protein is encoded by a recombinant nucleic acid sequence, such as contained in the bacteriophage HG7-2, as deposited in the ATCC under the accession number 75070. A process for promoting the survival, growth and / or differentiation of motor neurons, characterized in that the motor neurons are exposed to a therapeutically effective concentration of an NT-4 protein, NT-4 peptide or derivative which are capable of promoting survival , growth and / or differentiation of motor neurons. A method according to claim 6, characterized in that the NT-4 protein is encoded by a recombinant nucleic acid molecule comprising the DNA sequence, as contained in bacteriophage HG7-2, as deposited with ATCC with 73,993 Accession number 75070. 8. A method according to claim 6, characterized in that the NT-4 protein, NT-4 peptide or derivative is encoded by a recombinant nucleic acid molecule having a homology of at least about 70% with the corresponding DNA sequence, as contained in bacteriophage HG7-2, as deposited in ATCC accession number 75070. A method for diagnosing a motor neuron disorder in a patient comprising the steps of: (a) determining a concentration of NT-4 in a sample taken from a patient by means of an immunometric assay using an anti-NT-4 antibody ; (b) calculating the difference between the NT-4 concentration of the sample taken from the patient and the mean NT-4 concentration of analog samples from normal subjects; and (c) diagnosing a motor neuron disorder when the difference between the NT-4 concentration of the sample withdrawn from the patient and the NT-4 concentration of an analog sample of at least one normal individual correlates positively with the neurion disorder engines. A method according to claim 9, characterized in that the anti-NT-4 antibody is capable of binding to an NT-4 protein encoded by a recombinant nucleic acid molecule comprising the related NT-4 DNA sequence, such as as contained in bacteriophage HG7-2, as deposited in ATCC accession number 75070. A method according to claim 9, characterized in that the anti-NT-4 antibody is capable of binding to an NT-4 protein encoded by a recombinant nucleic acid molecule having a homology of at least 70% with the corresponding DNA sequence, as contained in bacteriophage HG7-2, as deposited with ATCC under the number 7503 733 6526-079-118 accession 75070. Use of an oligonucleotide which: (a) consists of at least six nucleotides; (b) comprises a sequence complementary to at least a portion of an RNA transcript of the NT-4? and (c) is hybridizable to the RNA transcript for the manufacture of a medicament for the treatment of a disease localized to the prostate characterized by increased transcription of an NT-4 gene into prostate tissue, relative to the levels of transcription in tissue of the prostate. of normal patients. Use according to claim 12, wherein the disease localized to the prostate is benign prostatic hypertrophy. Use according to claim 13, characterized in that the oligonucleotide comprises a sequence which is 100% complementary to the corresponding portion of the RNA transcript encoded by the DNA sequence, as contained in the bacteriophage HG7-2, as deposited in the ATCC with the access number 75070. Use according to claim 14, characterized in that the oligonucleotide comprises a sequence which is at least 70% complementary to the corresponding portion of the RNA transcript encoded by the DNA sequence, as contained in the bacteriophage HG7-2, as deposited in the ATCC under accession number 75070. Use of an NT-4 protein for the manufacture of a medicament for the treatment of an impotence disorder involving the human prostate. Use according to claim 16, characterized in that the NT-4 protein is encoded by a recombinant nucleic acid molecule comprising the related NT-4 DNA sequence, as contained in the bacteriophage HG7-2, such as -154 -154 73 993 6526-079-118 filed with the ATCC under accession number 75070. Use according to claim 16, characterized in that the NT-4 protein is encoded by a recombinant nucleic acid molecule having a homology of at least about 70% with the corresponding DNA sequence as contained in the bacteriophage HG7 -2, as deposited with the ATCC under accession number 75070. A diagnostic set for detecting retrograde transport in a motor neuron, characterized in that it comprises a detectably labeled NT-4 protein, derivative or peptidic fragment in a suitable container. A diagnostic kit according to claim 19, characterized in that the detectably labeled NT-4 protein, derivative or peptide fragment is encoded by a recombinant nucleic acid molecule comprising the related NT-4 DNA sequence as contained in bacteriophage HG7-2, as deposited with ATCC accession number 75070, A diagnostic kit according to claim 19, characterized in that the detectably labeled NT-4 protein, derivative or peptide fragment is encoded by a nucleic acid fragment having a homology of at least about 70% with the corresponding sequence of DNA, as contained in bacteriophage HG7-2, as deposited in ATCC accession no. 75070. Chimeric prepro protein, characterized in that it comprises; (a) an amino acid sequence of a prepro region of a neurotrophin other than NT-4; (b) an amino acid sequence of a prepro region of a mature form of a related protein with NT-4. The chimeric prepro protein according to claim 22, characterized in that the amino acid sequence of the mature form of an NT-4 related protein is encoded by a recombinant nucleic acid molecule comprising at least a portion of the DNA sequence encoding NT-4, as contained in bacteriophage HG7-2, as deposited in ATCC under accession number 75070. The chimeric prepro protein according to claim 22, wherein the neurotrophin other than NT-4 is nerve growth factor, brain derived neurotrophic factor or neurotrophin-3. Chimeric prepro protein according to claim 22, characterized in that the prepro region of neurotrophin other than NT-4 is derived from NT-4 xenopus. Chimeric prepro protein according to claim 22, characterized in that the prepro region of the neurotrophin other than NT-4 is derived from human NT-3. A nucleic acid molecule, characterized in that it comprises a nucleotide sequence encoding the chimeric prepro protein of claim 22. A DNA vector, characterized in that it is pCMX-hNT3 / hNT4 deposited with the ATCC under accession number 75133. A DNA vector, characterized in that it is pCMX-xNT4 / hNT4. Substantially pure recombinant NT-4 protein, characterized in that it is encoded by the DNA vector of claim 28. A substantially pure recombinant NT-4 protein, characterized in that it is encoded by the DNA vector of claim 29. Use of an NT-4 protein for the manufacture of a medicament for the treatment of an immune disorder, 73 993 6526-079-118 with NT-4, which affects neuromuscular transmission. Use according to claim 32, characterized in that the disorder is myasthenia gravis. Use according to claim 32, characterized in that the NT-4 protein is encoded by a recombinant nucleic acid molecule comprising the related NT-4 DNA sequence, as contained in the bacteriophage HG7-2, as deposited in the ATCC under accession number 75070. Use according to claim 32, characterized in that the NT-4 protein is encoded by a recombinant nucleic acid molecule having a homology of at least about 70% with the corresponding DNA sequence, such as contained in bacteriophage HG7 -2, as deposited with the ATCC under accession number 75070. A method of producing NT-4, comprising the growth of a recombinant cell containing the nucleic acid molecule of claim 26, under conditions such that the chimeric prepro protein is expressed and processed by the cell so as to produce the mature form of NT-4. A method for detecting or measuring NT-4 activity, characterized by comprising (a) exposing a cell expressing trkB to a test agent; and (b) detecting or measuring the specific binding of the test agent to trkB, correlating the trkB-specific binding positively with the NT-4 activity in the test agent. 21. MAi 1992 Lisbon, By REGENERON PHARMACEUTICALS, INC., FINN HALLBOOK, CARLOS FERNANDO IBANEZ MOLINER and HAKAN BENGT PERSSON = 0 FICIAL AGENT =