NZ242813A - Neurotrophin -4 (nt-4), its use as a pharmaceutical, diagnostic kits, chimeric preproproteins, vectors, recombinant nt-4 - Google Patents

Description

2 <••- : 1 1 J Patents Form 5 Priority Dai<Kv):a\JS.V9X(..J.S.fcfrV,.3.?>b.fcl aajslax, 2Q\.ch..\3.V, Compete Spc^jii^OrtiiOc. Filttci: aalsjaa, ..•iaAu. i?).c.iafc».i35.|.ia,».S'.;..Qsn.fei./.i.p:, £oI&i.w./m£; .SOI.M 33./S3.;. .BJtei.tc3S.j.lR; £.<n ,\.QO.i 2..(?..»,i ] .©. .x.

Publication Date: .2 .5. SEP .1998 P.O. Journal No-. .l.MrP.?.

THERAPEUTIC AND DIAGNOSTIC METHODS RASED ON NEUROTROPHIN- 4 EXPRESSION We, REGENERON PHARMACEUTICALS, INC., a Research and Development company incorporated under the laws of the State of New York, United States of America of 777 Old Saw Mill River Road, Tarrytownf New York 10591, United States of America; FINN HALLBOOK, a Swedish c- izen of Geijersgatan 48A, S-75231 Uppsala, Sweden; CARLOS FERNANDO IBANEZ MOLINER, a Spanish citizen of Tangvagen 29, S-12638 Hagersten, Sweden; HAKAN BENGT PERSSON, a Swedish citizen of Vreta Gard, S-14743 Tumba, Sweden do hereby declare the invention, for which we pray that a patent may be granted to us, and the method by which it is to be performed, to be particularly N.Z. No.

NEW ZEALAND Patents Act 1953 COMPLETE SPECIFICATION described in and by the following statement:- - 1 - (Followed by 1A) - 1A - n / ft % % THERAPEUTIC AND DIAGNOSTIC METHODS BASED ON NEUROTROPHIN-4 EXPRESSION 1. INTRODUCTION The present invention relates to neurotrophm-4 (NT-4), a newly characterized member of the BDNF/NGF/NT-3 gene family and the therapeutic and diagnostic methods of utilizing neurotrophin-4 in the treatment of neurological disorders. 2. BACKGROUND OF THE INVENTION The nerve growth factor family includes 0-nerve growth factor (NGFJ, brain-derived neurotrophic factor (BDNF), and neurotrophin-3 (NT-3), also known as hippocampus-derived neurotrophic factor (HDNF).

This family of proteins plays an important: role in both the developing and the adult vertebrate nervous system, where they support neuronal survival.

Based on the amino acid sequence of the 2Q mouse NGF protein (Angeletti, et al., 1973, Biochemistry 12:100-115) DNA sequences coding for mouse and human NGF have been isolated (Scott et al., 1983, Nature 2SZ'538-540; Ullrich et al., 1983, Nature 303:821-825). Comparison of mouse and human NGF 25 showed that the protein is conserved within mammals and in support of this, NGF-like activities have been isolated from several species (Harper and Thoenen, 1981, Ann. Rev. Pharmacol. Toxicol. 21:205-229).

Subsequently, DNA sequences from bull (Meier et al., 1986, EMBO J. £:1489-1493); chick (Meier et al., 1986, EMBO J. 1:1489-1493; Ebendal et al., 1986, EMBO J. :1483-1487; Wion et al., 1986, FEBS Letters 203:82-86; cobra (Selby et al., 1987, J. Neurosci. Res. 18:293-298); rat (Whittemore et al., 1988, J.

Neurosci. Res. £0:403-410); and guinea pig (Schwarz et al., 1989, Neurochem. 52:1203-1209) NGFs were also ; .n* : ¥ - ' A ^ ^ A tit',,**. . I •V' 1 A ul.i'.'V ton- j Ik 3 2 - determined. Brain-derived neurotrophic factor (BDNF) was first isolated from pig brain (Barde et al., 1982, EMBO J. 1:549-553) and subsequently cloned as a cDNA from this tissue (Leibrock et al., 1989 Nature 5 241:149-152). The gene for NT-3 has been isolated from mouse (Hohn et al., 1990, Nature, 344: 339-341), rat (Maisonpierre et al., 1990, Science 247: 1446-1451; Ernfors et al., 1990, Proc. Natl. Acad. Sci. USA 87: 5454-5458), and human (Rosenthal et al., 1990, 10 Neuron 4.: 767-773), using degenerate oligonucleotides based on the sequence similarity between the other two factors. The three factors show approximately 55% amino acid similarity to each other, and most sequence differences are present in five regions that contain 15 amino acid motifs characteristic of each protein. The neurotrophic activity in vitro of two of these proteins have recently been shown to be acquired by specific combinations of these variable regions. of peripheral sympathetic and neural crest-derived sensory neurons (reviewed in Thoenen and Barde, 1980, Physiol. Rev., ££: 1284-1325; Levi-Montalcini, 1987, Science, 237: 1154-1162). No activity has been seen for BDNF in peripheral sympathetic neurons, but this 25 factor supports in vivo the survival of both placode and neural crest-derived sewory neurons (Hofer and Barde, 1988, Nature, 331: 261-262). The neurons sensitive to NT-3 jja vivo remain to be identified. However, in explanted chick ganglia or dissociated 30 neuronal cultures In vitro, the three factors support both overlapping and unique sets of neuronal populations, suggesting that NT-3 exerts both specific and overlapping neurotrophic activities also in vivo (Hohn et al., 1990, Nature, 344: 339-341; Maisonpeirre 35 et al., 1990, Science, 2A1'- 1446-1451; Ernfors et al., NGF supports the development and maintenance ' -15 VJN1992 ^ 2 4 3 1990, Proc. Natl. Acad. Sci. USA, £7: 5454-5458; Rosenthal et al., 1990, Neuron 767-773). All three factors are expressed in specific sets of neurons in the brain, with the highest levels of mRNA for all three factors in the hippocampus (Ayer-LeLievre et al., 1988, Science 240: 1339-1341; Ernfors et al., 1990, Proc. Natl. Acad. Sci. USA, 31: 5454-5458; Ernfors et al., 1990, Neuron £: 511-526; Watmore et al., 1991, Neurol. 109: 141-152; Hofer et al., 1990, EMBO J., Sl' 2459-2464; Phillips et al., 1990, Science, 250: 290-294). In the brain, NGF has been shown to support basal forebrain cholinergic neurons (reviewed in Whittemore and Seiger, 1987, Brain Res., 434: 439-464; Thoenen et al., 1987, Rev. Physiol. Biochem. 15 Pharmacol., 105; 145-178; Ebendal, 1989, Prog. Growth Factor Res. 1: 143-159) and BDNF has been shown to stimulate the survival of these neurons in vitro (Alderson et al., 1990, Neuron jj: 297-306).

The effects of the three proteins are 20 mediated by their interaction with specific receptors present on sensitive cells. Molecular clones have been isolated for the rat, human, and chicken NGF receptor (NGF-R), and nucleotide sequence analysis of these clones has shown that the NGF-R contains one 25 plasma membrane-spanning domain, a cytoplasmic region, and an extracellular cysteine-rich amino-terminal domain (Johnson et al., 1986, Cell, £7: 545-554; Radeke et al., 1987, Nature, 325: 593-597; Large et al., 1989, Neuron 2: 1123-1134). The NGF-R shows a low but significant sequence similarity to the receptor for a tumor necrosis factor (Schall et al., 1990, Cell, £1: 361-370) as well as to the lymphocyte surface antigens CD40 (Stamenkovic et al., 1989, EMBO J., 8: 1403-1410) and 0X40 (Mallett et al., 1990, EMBO J., 2.' 1063-1068). The NGF-R can occur in two *, „ < y "2 JUN1992rr f " A s L K I 4 apparent, states, known as the low and high affinity states (Sutter, et al. , 1979, J. Biol. Chem., 254: 5972-5982; Landreth and Shooter, 1980, Proc. Natl. Acad. Sci. USA, 21* 4751-4755; Schechter and Bothwell, 5 1991, Cell 24.: 867-874). The gene for the NGF-R appears to encode a protein that forms part of both the low and the high affinity states of the receptor (Hempstead et al..- 1989, Science, 212: 373-375), though only the high affinity receptor has been jo proposed to mediate the biological activity of NGF. Both BDNF (Rodriguez-Tebar et al., 1990, Neuron, 4,: 487-492) and NT-3 (Ernfors et al.,' 1990, Proc. Natl. Acad. Sci. USA, SI: 5454-5458) can interact with the low affinity NGF-R, suggesting that the low affinity 15 NGF-R may be, in an as yet unknown way, involved in mediating the biological effects of all three factors. its receptor have been shown to be synthesized in the target area and in the responsive neurons, 20 respectively, at the time when the growing axon reaches its target (Davies et al., 1987, Nature, 326; 353-358). In agreement with this, the level of NGF mRNA in the developing chick embryo reaches a maximum at embryonic day 8 (E8) (Ebandai and Persson, 1988, 25 Development, 102: 101-106), which coincides with the time of sensory innervation. However, in the chick, NGF-R mRNA is maximally expressed at early embryonic stages prior to neuronal innervation (Ernfors et al., 1988, Neuron, l, 983-996), and in the E8 chick embryo 30 high levels of NGF-R mRNA have been detected in the mesenchyme, somites, and neural tube cells (Hallbook et al., 1990, Development, 108: 693-704; Heuer et al., 1990, Dev. Biol., 137: 287-304; Heuer 1990, Neuron, 5: 283-296). This observation, together with the fact that NGF mRNA is expressed in the E3 chick embryo at In the developing nervous system, NGF and a, m * 2 4 2 B 1 3 relatively high levels (Ebendal and Persson, 1988, Development, 102: 101-106), indicates that NGF may play a role in early development that is distinct from its function as a neurotrophic factor. In agreement 5 with this possibility, NGF has recently been shown to control proliferation and differentiation of E14 rat embryonic striatal precursor cells in culture (Cattaneo and McKay, 1990, Nature, 347; 762-765). In the chick embryo BDNF and NT-3 mRNA are maximally 10 expressed at E4,5, and BDNF has been shown to control the differentiation of avian neural crest cells in vitro (Kalcheim and Gendreau, 1988, Dev. Brain Res., 41: 79-86).

Moreover, evidence for a non-neuronal 15 function of NGF has also been presented. The still unexplained high levels of NGF found in the male mouse submandibular gland may indicate other functions for NGF (Levi-Montalcini, 1987, Science, 237: 1154-1162).

In the adult rat, NGF has been shown to induce DNA 20 synthesis and to stimulate IgM secretion in B-cells (Otten et eil., 1989, Proc. Natl. Acad. Sci. USA 86: 10059-10063). Additionally, NGF is present in sufficient quantity in guinea pig prostate such that Rubin and Bradshaw (1981, J. Neur. Res. 6: 451-464) were successful in isolating and characterizing substantially pure NGF from this exocrine tissue. The high level of NGF in pig prostate support the hypothesis that this neurotrophic actor functions in a non-neuronal capacity not yet understood (Bradshaw, 1978, Ann. Rev. Biochem. 42:191-216; Harper, et al., 1979, Nature 279:160-162; Harper and Thoenen, 1980, J.

Neurochem. 24:893-903).

Furthermore, NGF mRNA is expressed in spermatocytes and early spermatids in the adult rat testis (Ayer-LeLievre et al., 1988, Proc. Natl. Acad.

° . II \ *2 JUN!992rr l *- 2 4 ti » \ 3 6 Sci. USA, S£: 2628-2632), and the NGF protein is present in germ cells of all stages from spermatocytes to spermatozoa (Olson et al., 1987, Cell Tissue Res., 248: 275-286; Ayer-LeLievre et al., 1988a, Proc. Natl.

Acad. Sci. USA &§.: 2628-2632). NGF-R mRNA has also been detected in the adult rat testis, where it is expressed in Sertoli cells under negative control of testosterone, and in the testis NGF has been suggested to control meiosis and spenaiation (Persson et al., 10 1990, Science, 247: 704-707). neurotrophin-4 (NT-4), a newly characterized member of 15 the BDNF/NGF/NT-3 gene family. acid molecules encoding NT-4. Such molecules may comprise a sequence substantially as set forth for NT-4 in Figure 1 [SEQ ID N0:1 (NT-4, viper), SEQ ID 20 NO:2 (NT-4, Xenoousl1. Figure 4 (SEQ ID NO:43), Figure 8 (SEQ ID NO:49), Figure 14 (SEQ ID NO:61), Figure 15 (SEQ ID NO:63), Figure 17 (SEQ ID NO:69), Figure 18 (SEQ ID NO:75), Figure 20 (SEQ ID NO:93) and Figure 21 (SEQ ID NO:116) or may comprise a sequence that is at 25 least about seventy percent homologous to such sequence. protein or peptide molecules which comprise a sequence substantially as set forth for NT-4 in Figure 2 [SEQ 30 ID NO:22 (NT-4, viper), SEQ ID NO:23 (NT-4, Xenoous)]. Figure 4 (SEQ ID NO:44), Figure 8 (SEQ ID N0:50), Figure 14 (SEQ ID NO:62), Figure 15 (SEQ ID NO:64), Figure 17 (SEQ ID N0:70), Figure 18 (SEQ ID NO:76), Figure 20 (SEQ ID NO:94), or Figure 21 (SEQ ID NO:117) 3. SUMMARY OF THE INVENTION The present invention relates to The present invention provides for nucleic The present invention also provides for or may comprise a sequence that is at least about seventy percent homologous to such sequence.

The present invention further provides for expression of biologically active NT-4 molecules in 5 prokaryotic and eukaryotic systems.

The present invention further provides for the prodxiction of NT-4 in quantities sufficient for therapeutic and diagnostic applications. Likewise, anti-NT-4 antibodies may be utilized in therapeutic 10 and diagnostic applications. For most purposes, it is preferable to use NT-4 genes or gene products from the same species for therapeutic or diagnostic purposes, although cross-species utility of NT-4 may be useful in specific embodiments of the invention. 15 The present invention further provides for therapeutic and diagnostic applications based on NT-4 expression by disclosing detectable levels of NT-4 expression in human skeletal muscle, prostate, thymus and testes. 4. DESCRIPTION OF THE FIGURES FIGURE 1. Alignments of DNA sequences of the isolated fragments coding for NGF, BDNF, NT-3 and the novel neurotrophic factor NT-4 from different 25 species.

(A) Schematic representation of the mouse preproNGF molecule. The hatched box indicates the signal sequence (SS), black bars denote proteolytic cleavage sites and the shaded box represents the mature NGF. Regions used for the degenerate primers are indicated by arrows. The upstream primer was from the region coding for lysine 50 to threonine 56 and the downstream primer includes tryptophan 99 to aspartic acid 105. The amplified region comprises DNA 2 /, -r? Q 1 sequences from base pair (bp) 168 to 294 in the mature NGF molecules and in all members of the NGF family described so far, this region is located in one exon.

(B) Alignment of nucleotide sequences for NGF, BDNF, NT-3 and NT-4 isolated from different species. The fragments correspond to amino acids 57 to 98 in the mature mouse NGF. Identical bases are indicated by dots. The numbering 10 refers to nucleotides in the sequences of mouse mature NGF (Scott et al., 1983, Nature 300:538-540). SEQ in NO:l (NT-4, viper), SEQ ID NO:2 (NT-4, Xenopus). SEQ ID NO:3 (NGF, human), SEQ ID NO:4 (NGF, rat), SEQ ID N0:5 (NGF, chicken), SEQ 15 ID NO:6 (NGF, viper), SEQ ID NO:7 (NGF, Xenopusl.

SEQ ID NO:8 (NGF, salmon), SEQ ID NO:9 (BDNF, human), SEQ ID NO:10 (BDNF, rat), SEQ ID NO:11 (BDNF, chicken), SEQ ID NO:12 (BDNF, viper), SEQ ID NO:13 (BDNF, Xenopus). SEQ ID NO:14 (BDNF, 20 salmon), SEQ ID NO:15 (BDNF, ray), SEQ ID NO:16 (NT-3, human), SEQ ID NO:17 (NT-3, rat), SEQ ID NO:18 (NT-3, chicken), SEQ ID NO:19 (NT-3, Xenppus). SEQ ID NO:20 (NT-3, salmon), SEQ ID NO:21 (NT-3, ray).

FIGURE 2. Alignment of amino acid sequences deduced for NGF, BDNF, NT-3 and NT-4 from different species. The numbering of the amino acids (single letter code) is taken from the mature mouse NGF (Scott et al., 1983, Nature 300:538-30 540). Identical amino acids are indicated with dots. Positions that show conservative amino acid replacements in all species variants of the same factor are underlined. The broken line indicates that the corresponding sequence was not isolated. Bars represent variable regions in the Is6 ^ "2 JUN199 £L different molecules (R59 to S67 and D93 to A98). SEQ ID NO:22 (NT-4, viper), SEQ ID NO:23 (NT-4, Xenopus). SEQ ID NO:24 (NGF, human), SEQ ID NO:25 (NGF, rat), SEQ ID NO:26 (NGF, chicken), SEQ ID 5 NO:27 (NGF, viper), SEQ ID NO:28 (NGF, Xenopus).

SEQ ID NO:29 (NGF, salmon), SEQ ID N0:30 (BDNF, human), SEQ ID NO:31 (BDNF, rat), SEQ ID NO:32 (BDNF, chicken), SEQ ID NO:33 (BDNF, viper), SEQ ID NO:34 (BDNF, Xenopus). SEQ ID NO:35 (BDNF, 10 salmon), SEQ ID NO:36 (BDNF, ray), SEQ ID NO:37 (NT-3, human), SEQ ID NO:38 (NT-3, rat), SEQ ID NO:39 (NT-3, chicken), SEQ ID N0:40 (NT-3, Xenopus). SEQ ID NO:41 (NT-3, salmon), SEQ ID NO:42 (NT-3, ray).

FIGURE 3. Deduced phylogeny of members of the NGF family. Phylogenetic trees showing speciation of NGF (A), BDNF (B), and NT-3 (C) were constructed using analysis of nucleotide sequences. Human NT-3 was used as a reference point in (A) and 20 (B), human NGF and human BDNF were used in (C).

The scale bar in (A) represents a branch length corresponding to a relative difference score of 20. The same scale was used in (B) and (C). (D) shows a phylogram of the evolutionary 25 relationship between the different members of the NGF family. The data were compiled from deduced amino acid sequences. The scale bar represents a branch length of 20. All trees shown are unrooted so that the branches are measured 30 relative to one another with no outside reference. Abbreviations: chi, chicken; hum, human; sal, salmon; vip, viper; xen, Xenopus.

FIGURE 4. Sequence of Xenopus NT-4 and Comparison to NGF, BDNF, and NT-3.

'I if 'J 1 (A) A potential translation start site is boxed. A putative signal cleavage site is indicated by the arrow labeled SC. Amino acids within the signal sequence that are identical between Xenopus NT—4 and pig and rat BDNF are indicated with stars. A consensus sequence for N-glycosylation is underlined, and the arrow indicates the presumptive start of the mature NT-4 protein. (SEQ ID NO:43 and SEQ ID NO:44) (B) Amino acid (single-letter code) sequence comparison of Xenopus NT-4 (SEQ ID NO:45) with mouse NGF (Scott et al., 1983, Nature 300: 538-540) (SEQ ID NO:46), mouse BDNF (Hofer et al., 1990, EMBO J. £: 2459-2464) (SEQ ID NO:47), and mouse NT-3 (Hohn et al., 1990, Nature 344: 339- 341) (SEQ ID NO:48J. Identical amino acid replacements compared with the NT-4 amino acid sequence are shown by dots. Sequences that differ between NGF, BDNF, and NT-3 also differ in 20 the sequence of the NT-4 protein.

FIGURE 5. Transient expression of the Xenopus NT-4 protein in COS cells and its interaction with NGF—Rs on PC12 cells.

(A) SDS-PAGE of conditioned media from in vivo 25 labeled COS cell cultures (3 x 104 cpm loaded in each lane) transfected with the rat NGF gene, a control plasmid without insert, or the Xenopus NT-4 gene. Shown is an autoradiograph of the dried gel after an overnight exposure to X-ray 30 film.

(B) Serial dilutions of transfected COS cell medium containing equal amounts of NT-4 (open circles) or NGF (closed circles) protein were assayed for their ability to displace ,2SI-NGF from its receptor on PC12 cells. Binding assays were v 'S "-'idi* \"2 JUN/992? // 2 4 ,1 - 1 3 performed at 37°C using 1.5 x 10® M ,25I-NGF and 1 x 104 cells per ml. Medium from mock-transfected cells failed to displace binding of 125I-NGF from PC12 cells. Each point represents the mean + SD of triplicate determinations.

FIGURE 6. Stimulation of neurite outgrowth from chicken embryonic ganglia.

(A, B, and C) Neurite outgrowth elicited in dorsal root ganglia with recombinant NT-4 protein (A), recombinant NGF (B), and BDNF protein (C). (D) The response of dorsal root ganglia to conditioned medium from mock-transfected cells. (E and F) Stimulation of neurite outgrowth from sympathetic ganglia in response to NT-4 (E) or NGF (F).

(G, H, and I) Nodose ganglia stimulated with recombinant NT-4 (G), NT-3 (H), and BDNF (I) proteins. All figures are bright-field micrographs of ganglia after 1.5 days in culture.

FIGURE 7. Detection of NT-4 mRNA in different Xenopus tissues.

(A) Poly(A)+ RNA (10 ng per slot) from the indicated tissues of adult female Xenopus was electrophoresed in a formaldehyde-containing agarose gel, blotted onto a nitrocellulose filter, and hybridized to a 500 bp Hindi fragment from the 3* exon of the Xenopus NT-4 gene. For comparison, the filter was also hybridized to a 180 bp PCR fragment from the Xenopus NGF gene (lane marked heart, NGF). The filter hybridized to the NT-4 probe was exposed for 2 days; the filter hybridized to the NGF probe was exposed for 2 weeks. A prolonged 2 week exposure of the filter hybridized to the NT-4 probe did not reveal NT-4 mRNA in any tissues other than thr 3 ovary, which includes oocytes of different stages. The lane labeled CNS includes brain and spinal cord.

(B) Poly (A)+ RNA (10 ng) from Xenopus ovary was analyzed for the expression of the four members of the NGF family. Each filter was hybridized with the indicated probes obtained by labeling of PCR fragments from their respective Xenopus genes. The location of the labeled PCR fragments in the 3' exon of their genes is shown in Figure 1A. The filters were washed at high stringency and exposed to X-ray films for 5 days.

FIGURE 8. Nucleotide sequence of Xenopus NT-4 with restriction endonuclease cleavage sites (SEQ ID NO:49 and SEQ ID N0:50).

FIGURE 9. NT-4 mRNA expression in the Xenopus laevis ovary. Ovary from adult Xenopus laevis was sectioned in a cryostat (14 /*m thick sections) and the sections were then hybridized to the indicated 48-mer oligonucleotides labeled with 3SS-dATP using terminal deoxynucleotidyl transferase.

(A) Hybridization using a Xenopus NT-4 mRNA specific oligonucleotide with the sequence •CCCACAAGCTTGTTGGCATCTATGGTCAGAGCCCTCACATAAGACTGTTTTGC3•. (SEQ ID NO:95) (B) Hybridization using a control oligonucleotide of similar length and G+C content. After hybridization, sections were washed in lx SSC at 55°C followed by exposure to X-ray film for 10 days. Shown in the figure are photographs of the developed X-ray films. Note the intense labeling over many small cells with the NT-4 probe and the absence of labeling with the control probe. Arrows point at large (stage VI) oocytes 2 h • > 1 3 which are not labeled with either of the two probes. Scale bar. 2 mm.

FIGURE 10. Bright-field illumination of emulsion autoradiographs showing NT-4 mRNA expressing oocytes in the Xenopus ovary. Sections hybridized to the Xenopus NT-4 mRNA specific (A,B) or control (C) probe as described in FIG. 9 were coated with Kodak NTB2 emulsion, exposed for 5 weeks, developed and lightly counterstained with cresyl violet This figure shows bright-field photomicrographs of the developed sections. Note in panel A the-intense NT-4 mRNA labeling over small size oocytes (stages I and II) and the absence of labeling over large size (stages V and VI) oocytes. Panel B shows a higher magnification of the boxed in area in panel A. Note the intense labeling of the cytoplasm of the stage II oocytes shown in the picture.

(C) No labeling can be seen using the control probe. Abbreviations: n, nucleus; fc, follicle cells; pi, pigmented layer. Scale bar in A, 50 urn; in B and C, 15 pun.

FIGURE 11. Levels of NT-4 mRNA in oocytes at different stages of oogenesis. Emulsion autoradiographs (shown in figure 10) of sections hybridized with the Xenopus NT-4 mRNA specific probe were used to count the number of grains over an area unit. The area unit chosen was about one hundredth of a stage I oocyte. Fifteen area units were analyzed in 10 different oocytes of the indicated stages. Error bars show S.D.

FIGURE 12. Northern blot analysis of NT-4 mRNA expression during oogenesis in Xenopus laevis. Ovaries from two adult Xenopus laevis were dissected out and treated with remove follicle cells and release the oocytes. The oocytes were then grouped in the indicated groups following the stages described by Dumont, 1972, J. Morphol. 136: 153-180. Total ovary and 5 the released follicle cells were also included in the analysis. Total cellular RNA was then prepared and a 40 ^g/slot of RNA was electrophoresed in a formaldehyde-containing 1% agarose gel. This was blotted onto a 10 nitrocellulose filter and hybridized to a 600bp HincII fragment from the 3'exon of the Xenopus NT-4 gene. The filter was washed at high stringency and exposed for five days to a X-ray film. Note the marked decreased in the level of NT-4 mRNA in 15 stages V and VI oocytes.

FIGURE 13. (A) The xNT-4 partial amino acid sequence (SEQ ID NO:51) indicating positions where degenerate oligonucleotides were synthesized and utilized to prime the amplification of human and 20 rat genomic DNA via the polymerase chain reaction.

Arrows indicate oligonucleotides representing sense and antisense degenerate oligonucleotides. A set of degenerate oligonucleotides to primer 2Z represent amino acids 184-189 of rBDNF (SEQ ID 25 NO:52). The partial Xenopus NT-4 amino acid sequence represented is from amino acid 167 -amino acid 223, as described in Figure 4, supra. (B) Degenerate oligonucleotides used for cloning of human and rat NT-4. Oligonucleotide 3Z in 30 Figure 13 is comprised of a mixture of 3Z and 3Z' in order to allow for the degeneracy of the serine codon. 2Y (SEQ ID NO:53), 2Z (SEQ ID NO:54), 3Y (SEQ ID NO:55), 3Z (SEQ ID NO:56), (SEQ ID NO:57) and 4Z (SEQ ID NO:58). (C) Cloning tails 2 4 2 8 15 for degenerate oligonucleotides 3'(SEQ ID N0:59) and 5'(SEQ ID NO:60).

FIGURE 14. DNA sequence of the isolated fragment encoding a portion of rat NT-4 (SEQ ID NO:61).

The predicted open reading frame for the peptide encoded by the rNT-4 nucleic acid fragment is represented by the single letter code (SEQ ID NO:62). Sequence inside brackets is part of PCR primer.

FIGURE 15. DNA sequence of the isolated fragment encoding a portion of human NT-4 (SEQ ID NO:63). The predicted open reading frame for the peptide encoded by the hNT-4 nucleic acid fragment is represented by the single letter code. (SEQ ID 15 NO:64) Sequence inside brackets is part of PCR primer.

FIGURE 16. Alignment of amino acid sequences deduced from representative neurotrophins. Amino acids are indicated using the single letter code.

Identical amino acids are indicated with dots.

Dashed lines indicate a 7 amino acid insertion within the conserved region of both rNT-4 (SEQ ID NO:62) and hNT-4 (SEQ ID NO:64). xNT-4 (SEQ ID NO:65), rNGF (SEQ ID NO:66), rBDNF (SEQ ID NO:67), 25 rNT-3 (SEQ ID NO:68). x<*Xenopus, r»rat, h»human.

Sequence inside brackets is part of PCR primer.

FIGURE 17. (A) DNA sequence of an isolated fragment encoding a portion of human NT-4 (SEQ ID NO:69). The predicted peptide encoded by the 192 bp hNT-4 30 nucleic acid fragment is represented by the single letter code (SEQ ID NO:70). Sequence inside brackets is part of PCR primer.

(B) Oligonucleotide sequence of the 5'-end primer, termed hNT4-511 [containing a sequence (SEQ ID 35 NO:71) encoding ETRCKA (SEQ ID NO:72)], used in ./«* o ■h '.'a* - - r- \ \ "2 JUN/992" V- A. the primary amplification of human genomic DNA along with the 3'-end primer, termed 4Z (SEQ ID NO:58) [containing a nucleotide sequence encoding WIRIDT]. (C) Oligonucleotide sequence of the 5 5'-end primer used to amplify the primary PCR reaction product. The primer, termed hN^'S1'' [containing a sequence (SEQ ID NO:73) encoding DNAEEG (SEQ ID N0:74)] was utilized with the 3' primer, 4Z (SEQ ID NO:58), to obtain a fragment of 10 162 bp (plus bp of cloning tail). The 162 bp PCR fragment was then utilized in a patch PCR reaction using our previously utilized upstream PCR fragment (termed 2YZ3Z) to generate the single fragment of 192 bp plus cloning tail shown in (A). 15 Additional 3' extended nucleic acid sequence information was obtained following the subcloning and sequencing of this fragment.

FIGURE 18. DNA sequence of the portion of the isolated human genomic phage clone 7-2 encoding human NT-4 20 (SEQ ID NO:75). The predicted hNT-4 protein encoded by the genomic clone 7-2 is represented by the one-letter symbols for amino acids (SEQ ID NO:76). The boxed region represents the predicted cleavage site of the hNT-4 preprotein. Arrows 25 indicate conserved residues in the presequence.

The underlined region (N-R-S) represents a consensus sequence for n-glycosylation. The circled region represents the initiating methionine. The splice acceptor site is located 30 at base pair 461-462 (AG) of SEQ ID NO:75, representing the 3*-end of the intron.

FIGURE 19. Alignment of amino acid sequences deduced from representative neurotrophins (SEQ ID NOS. 77-92) Amino acids are indicated using the single letter code. Amino acids identical to those • 1 c ^ *2 JUN/992 ■ L •••} encoded by the human genomic phage clone 7-2 (SEQ ID NO:77) are indicated with an asterik. Dashed lines represent breaks in homologous amino acids as compared to the protein encoded by SEQ ID 5 NO:77.

FIGURE 20. DNA sequence of the isolated fragment encoding a portion of the human genomic phage clone, 2-1 (SEQ ID NO:93). The predicted open reading frame for the peptide encoded by the 10 isolated nucleic acid fragment is represented by the single letter code (SEQ ID NO:94).

FIGURE 21. DNA sequence of the isolated fragment encoding a portion of the human genomic phage clone, 4-2 (SEQ ID NO:116). The predicted open 15 reading frame for the peptide encoded by the isolated nucleic acid fragment is represented by the single letter code (SEQ ID NO:117).

FIGURE 22. Northern blot analysis of human NT-4 mRNA expression. Tissue specific mRNA from human was 20 purchased from Clontech. RNA's (10 nq) were fractionated by electrophoresis through a 1% agarose-formaldehyde gel followed by capillary transfer to a nylon membrane (MagnaGraph, Micron Separations Inc.) with 10X SSC (pH 7). RNAs were 25 UV-cross-linked to the membranes by exposure to ultraviolet light (Stratlinker, Stratagene, Inc.) and hybridized at 65°C with the radiolabeled probe (a 680bp Xhol-Notl fragment containing the complete coding region of HG7-2 NT-4 (see Example 30 Section 9, infra) in the presence of 0.5 M NaP04 (pH 7), 1% bovine serum albumin (Fraction V, Sigma), 7% SDS, 1 mM EDTA (Mahmoudi and Lin, 1989, Biotechniques 7:331-333), and 100 nq/ml sonicated, denatured salmon sperm DNA. The filter was washed 35 at 65°C with 2X SSC, 0.1% SDS and subjected to rv L h autoradiography overnight with one intensifying screen (Cronex, DuPont) and X-ray film (XAR-5, Kodak) at -70°c. Ethidium bromide staining of the gel demonstrated that equivalent levels of total 5 RNA were being assayed for the different samples (as in Maisonpierre et al., 1990, Science 247:1446-1451).

Lane 1: fetal liver poly(A)+ mRNA; Lane 2: fetal brain poly(A)+ mRNA; Lane 3: prostate poly"A* 10 mRNA; Lane 4: muscle poly (A)+ mRNA; Lane 5: intestine poly(A)+ mRNA; Lane 6: kidney poly(A)+ mRNA; Lane 7: liver poly(A)+ mRNA; Lane 8: spleen poly(A)+ mRNA; Lane 9: thymus poly(A)+ mRNA; Lane 10: ovary poly (A)+ mRNA; Lane 11: 15 testes poly(A)+ mRNA; Lane 12: placenta poly(A)+ mRNA; Lane 13: brain poly(A)* mRNA; Lane 14: brain total RNA.

FIGURE 23. COS supernatants from transfected cell lines; Q1 (pCMX-HG7-2Q), N7 (pCMX-hNT3/hNT4) and 20 XI (pCMX-xNT4/hNT4) were tested in volumes of nl, 50 fil and 250 /j1 for neurite promoting activity in ORG explants. A supernatant from a mock transfected COS cell line was utilized as a control.

FIGURE 24. COS supernatants from Q1 (pCMX-HG7-2Q), and M (pCMX-HG7-2M) cell lines were tested for their survival-promoting activity on DRG associated cells. Volumes tested ranged from 5 jil to 250 /x 1 in a total volume of 2 ml.

FIGURE 25. Motor neuron enriched cultures isolated from E14 rat embryos were treated with two dilutions of COS cell supernatants from the M cell line (pCMX-HG7-2M). Biological activity was measured by choline acetyltransferase (CAT) activity as described in Fonnum, 1975, J. 2 JUN1992 r > Neurochem. 2A'407-409. Both a mock transfected COS cell line (MOC COS) and an untreated motor neuron (C-NT) are presented as controls.

. DETAILED DESCRIPTION OF THE INVENTION The present invention provides for NT-4 genes and proteins. It is based, at least in part, on the cloning, characterization, and expression of the NT-4 gene. provides for recombinant nucleic acid molecules that encode NT-4. Such molecules comprise a sequence substantially as set forth in Figure l (SEQ ID N0:l) for viper, Figure 1 (SEQ ID NO:2), Figure 4 (SEQ ID 15 NO:43) or Figure 8 (SEQ ID NO:49) for Xenopus NT-4, Figure 14 (SEQ ID NO:61) for rat NT-4, Figure 15 (SEQ ID NO:63), Figure 17 (SEQ ID NO:69) or Figure 18 (SEQ ID NO:75) for human NT-4, Figure 20 (SEQ ID NO:93) and Figure 21 (SEQ ID NO:116) for a human NT-4 like 20 sequence, or a sequence that is at least about seventy percent homologous to any such sequence, in which homology refers to sequence identity (£.£. a sequence that is 70 percent homologous to a second sequence shares 70 percent of the same nucleotide residues with 25 the second sequence). detailed in Example Section 8 and Figure 15 (SEQ ID NO:63, SEQ ID NO:64) herein, the nucleotide and amino acid sequence for a portion of a human neurotrophin 30 molecule is determined. In another aspect of the present invention detailed in Example Section 9 and Figure 17 (SEQ ID NO:69, SEQ ID NO:70) and Figure 18 (SEQ ID NO:75, SEQ ID NO:76) herein, the nucleotide and amino acid sequence for the entire human neurotrophin molecule is determined. In another In particular, the present invention In a particular aspect the present invention /' aspect of the present invention detailed in Example Section 9 and Figure 20 (SEQ ID MO:93, SEQ ID NO:94) and Figure 21 (SEQ ID NO:116, SEQ ID NO:117) herein, th^ nucleotide and amino acid sequence for a portion of a human genomic phage clones, 2-1 and 4-2, respectively, which are similar but not identical to the nucleotide and amino acid sequence described in Figure 18 (SEQ ID NO:75), are detailed. TOiils such human neurotrophin molecule is referred to herein as human neurotrophin-4, it should be understood that such a molecule may be the human homologue of the Xenopus neurotrophin-4 described herein, or alternatively, a distinct yet homologous neurotrophin molecule. Similarly, the molecule referred to herein 15 as rat NT-4 may be the rat homologue of NT-4, or alternatively, a distinct yet homologous neurotrophin molecule. The methods and compositions of the present invention do not depend on any single nomenclature.

The present invention also provides for 20 substantially purified NT-4 protein or peptide molecules. Such molecules may comprise a sequence substantially as set forth in Figure 2, (SEQ ID NO:l and SEQ ID NO:2), Figure 4 (SEQ ID NO:44) Figure 8 (SEQ ID NO:50), Figure 14 (SEQ ID NO:62), Figure 15 25 (SEQ ID NO:64) Figure 17 (SEQ ID N0:70), Figure 18 (SEQ ID NO:76), Figure 20 (SEQ ID NO:94) and Figure 21 (SEQ ID NO:117) for NT-4, or a sequence that is at least about seventy percent homologous to any such sequence. In additional nonlimiting specific embodiments of the invention, a substantially purified protein or peptide comprises the sequence KCNPSGSTTR (SEQ ID NO:96). In another embodiment of the invention, a substantially purified peptide or protein comprises the sequence RGCRGVD (SEQ ID NO:97). In yet another embodiment of the invention, a substantially o .V ■•£ - - of - 2 JUNf992 v/ i / purified peptide or protein comprises the sequence KQWIS (SEQ ID NO:98). In a further embodiment of the invention, a substantially purified peptide or protein comprises the sequence KQSYVR (SEQ ID NO:99). In yet g another embodiment of the invention, a substantially purified peptide or protein comprises the sequence GPGXGGG (SEQ ID NO:100) , where X represents one of the set of 20 amino acids. In a related embodiment of the invention, a substantially purified peptide or protein 10 comprises the sequence GPGVGGG (SEQ ID NO:101) or GPGAGGG (SEQ ID NO:102). In a further embodiment of the invention, a substantially purified peptide or protein comprises the sequence ESAGE (SEQ ID NO:103). In yet a further embodiment of the invention, a 15 substantially purified peptide or protein comprises the sequence DNAEE (SEQ ID NO:104). may be produced by chemical synthesis using standard techniques or may be produced using the NT-4-encoding 20 nucleic acid molecules of the invention, using prokaryotic or eukaryotic expression systems known to one skilled in the art, such as those described in PCT application PCT/US90/04916, filed August 29, 1990, published as WO 91/03569, which is incorporated by 25 reference in its entirety herein, or as exemplified infra (see Section 6.2.4., infra. and Figure 5) for transient expression in COS cells. use of NT-4 in promoting the growth and/or survival of 30 cells of the nervous system, in particular, but not limited to, cells of dorsal root ganglion or neural placode derivatives (see Section 6.2.4., infra. and Figure 6, for example). portions of NT-4 nucleic acid or amino acid sequence, The proteins and peptides of the invention The present invention also provides for the The present invention also provides for - 22 2 4G 1 3 substantially as set forth for NT-4 in Figure 1, 2, 4, 8, 14, 15, 17, 18, 20 or 21 (SEQ ID NO'S listed, supra) that are not identical to portions of BDNF, NGF, or NT-3 of substantially the same size.

The present invention further provides for a eukaryotic or prokaryotic cell that contains recombinant nucleic acid that encodes NT-4 and that expresses recombinant NT-4 protein. In a specific embodiment the cell is a eukaryotic cell, such as a COS cell. Accordingly, the present invention also provides for recombinant NT-4 protein or peptide that is produced by inserting recombinant nucleic acid encoding NT-4 into a cell (e.g., by transfection, transduction, electroporation, microinjection, etc.) 15 under conditions which permit expression of NT-4 and then isolating NT-4 from the cell.

In addition, the present invention provides for molecules produced by PCR using, for example, the following oligonucleotides as primers: 20 5'CAGTATTTTTACGAAACC (SEQ ID NO:105) and 3'GTCTTGTTTGGCTTTACA (SEQ ID NO:106) for human NT-4 and 5'CAGTATTTTTACGAGACG (SEQ ID NO:107) and 3 *CGATTGTTTGGCTTTACA (SEQ ID NO:108) for rat NT-4, and using any suitable genomic or cDNA as template. In a 25 specific embodiment of the invention, these primers may be used in conjunction with human cDNA as template to produce fragments of the human NT-4 gene that are suitable for cloning.

The production and use of derivatives, analogues, and peptides related to NT-4 are also envisioned, and within the scope of the present invention. Such derivatives, analogues, or peptides which have the desired neurotrophic activity, immunogenicity or antigenicity can be used, for example therapeutically, or in immunoassays, for v 'O' ^ o 23 - 2/> T immunization, etc. Derivatives, analogues, or peptides related to NT-4 can be tested for the desired activity by procedures known in the art. peptides of the invention can be produced by various methods known in the art. The manipulations which result in their production can occur at the gene or protein level. For example, the cloned NT-4 gene can be modified by any of numerous strategies known in the 10 art (Haniatis, T., 1982, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). The NT-4 sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic 15 modification if desired, isolated, and ligated in vitro. In the production of the gene encoding a derivative, analogue, or peptide related to NT-4, care should be taken to ensure that the modified gene remains within the same translational reading frame as 20 NT-4, uninterrupted by translational stop signals, in the gene region where the desired NT-4-specific activity is encoded. in vitro or in vivo, to create and/or destroy 25 translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification. Any technique for mutagenesis known in 30 the art can be used, including but not limited to, in vitro site-directed mutagenesis (Hutchinson, C., et al., 1978, J. Biol. Chem. 253:6551), use of TAB® linkers (Pharmacia), etc. coding region of NT-4 may be utilized to construct The NT-4 related derivatives, analogues, and Additionally, the NT-4 gene can be mutated As discussed infra, the prepro or mature neurotrophin based chimeric genes. For example, neurotrophin genes, including but not limited to NGF, BDNF and NT-3, can provide the prepro region for construction of neurotrophin prepro/NT-4 mature coding 5 region chimeric genes.

Manipulations of the NT-4 sequence may also be made at the protein level. Any of numerous chemical modifications may be carried out by Known techniques, including but not limited to specific 10 chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.

In addition, analogues and peptides related 15 to NT-4 can be chemically synthesized. For example, a peptide corresponding to a portion of NT-4 which mediates the desired neurotrophic activity can be synthesized by use of a peptide synthesizer.

The present invention further provides for a 20 method of treating fertility disorders related to ovarian/'oocyte dysfunction. As shown in the examples infra, in particular, Section 7, NT-4 is involved in the maturation of oocytes. The discussion of Section 7.3 demonstrates that NT-4 is produced by oocytes, is 25 concentrated in immature rather than mature oocytes, and appears to play a role in oogenesis. The putative function of NT-4 protein in the ovary appears to be coupled to events occurring in the pre-vitellogenic and early/mid vitellogenic oocyte.

It has been established that other members of the BDNF/NGF/NT-3 gene family, in particular NGF, are involved in meiotic maturation (Nebrada et al., 1991, Science, 252: 558-563). Because NT-4 has exhibited properties similar to NGF (see Section 6, infra) it may be used as a factor involved in the "V V * % JtJN J992 *)) v. „ / 2 4 2 8 1 regulation of oocyte development. These properties of NT-4 can be exploited to provide a method for treating infertility disorders and/or other ovarian dysfunctions associated with oogenesis.

Therefore, in accordance with the invention a method of treating infertility disorders and/or other ovarian dysfunctions comprising administering a therapeutically effective amount of NT-4 or an NT-4 related peptide in a pharmaceutically effective carrier is provided. A therapeutically effective amount is one which induces proper maturation of an oocyte and/or ovulation. For example, a therapeutically effective dose may be one sufficient to maintain circulating serum levels of NT-4 at a 15 concentration of from about 1 to 100 x 10"10M.

Establishing additional effective doses is within the purview of one skilled in the art.

Effective doses of NT-4 or an NT-4 related peptide formulated in suitable pharmacological 20 carriers may be administered by any appropriate route including but not limited to injection (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, etc.), by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal 25 and intestinal mucosa, etc.); etc.

In addition, NT-4 or NT-4 peptide may be used in any suitable pharmacological carrier, linked to a carrier or targeting molecule (e.g., antibody, hormone, growth factor, etc.) and/or incorporated into liposomes, microcapsules, and controlled release preparation prior to administration in vivo.

Each respective mammalian NT-4 DNA sequence can be utilized as a "P-labelled probe to isolate a respective genomic and cDNA clone via the procedures outlined in the Materials and Methods portion u... :.-a» 2 4 2 3 1 3 Section 8, infra. The rtt NT-4 and human NT-4 gene fragments may be utilized directly (as 32P-labelled probes) or indirectly (to deduce a PCR strategy as described infra) to isolate other mammalian NT-4 5 genomic and cDNA clones, based on the unique nature of the 7 amino acid insertion in the rNT-4 and hNT-4 coding region, or other unique aspects of the rat or human NT-4 coding region. information disclosed by the rat and human NT-4 sequence may be utilized in, although is not limited to, the various manipulations discussed for Xenopus NT-4. For example, th«i proteins and peptides of mammalian NT-4, subsequent to characterization of the 15 full length gene as discussed in Example Section 9, may be produced using the respective mammalian NT-4 molecules in a prokaryotic or a eukaryotic expression system known to one skilled in the art, such as those described in PCT application PCT/US90/04916, filed 20 August 29, 1990, published as W091/03569, or as exemplified infra (see Section 6.2.4., supra. and Figure 5) for transient expression in COS cells. Additional functions for mammalian NT-4, as described infra for Xenopus NT-4, include, but are not limited 25 to: the promotion of growth and/or survival of cells of the nervous system, in particular, but not limited to, cells of dorsal root ganglion or neural placode derivacives (see Section 6.2.4., and Figure 6, for example), treating fertility disorders related to 30 ovarian/oocyte dysfunction (see Section 7), the treatment of infertility disorders and/or other ovarian dysfunction associated with oogenesis (see Section 6), the treatment of motor neuron diseases (see Section 10), the treatment of an epitheliac hyperplasia such as benign prostatic hypertrophy (see Any mammalian NT-4 gene isolated via the 2 4 2 0 i! 3 27 Section 10}, the treatment of impotence as related to prostate gland function (see Section 10) and, therefore, the therapeutically effective amounts of mammalian NT-4 for the treatment of said disorders as 5 formulated in suitable pharmacological carriers to provide a pharmaceutical composition may be administered by any appropriate route including but not limited to injection (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, etc.), 10 by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) ; etc'.

NT-4 or NT-4 peptide may be used in any suitable 15 pharmacological carrier, linked to a carrier or targeting molecule (e.g., antibody, hormone, growth factor, etc.) and/or incorporated into liposomes, microcapsules, and controlled release preparation prior to administration in vivo-20 In addition, the present invention, which relates to nucleic acids encoding NT-4 and to proteins, peptide fragments, or derivatives produced therefrom, as well as antibodies directed against NT-4 protein, peptides, or derivatives, may be utilized to 25 diagnose or monitor the progression of diseases and disorders of the nervous system which are associated with alterations in the pattern of NT-4 expression. Such alterations can be a decrease or increase relative to that in normal patients, preferably, or in 3° other samples taken from the patient, or in samples from the same patient taken at an earlier time.

In various embodiments of the invention, NT-4 genes and related nucleic acid sequences and subsequences, including complementary sequences, may be used in diagnostic hybridization assays. The NT-4 In addition, rat, human or other mammalian 2/ A ^ 4 & o nucleic acid sequences, or subsequences thereof comprising about 15 nucleotides, can be used as hybridization probes. Hybridization assays can be used to detect, prognose, diagnose, or monitor 5 conditions, disorders, or disease states associated with changes in NT-4 levels. For example, the data presented in Example Section 10 discloses tissue specific expression of human NT-4 In skeletal muscle as well as the prostate gland, thymus and testes. The ^q level of expression of human NT-4 in the muscle tissue may be indicative of the presence or absence of neuronal degradation. Therefore, poly(A)+ mRNA or total RNA from a tissue sample of a patient could be assayed for the presence of human NT-4 mRNA in 15 skeletal muscle tissue. Additionally, the data presented in Example Section 10 discloses tissue specific expression of NT-4 in the human prostate gland. DNA sequences encoding NT-4 or a portion thereof, as well as NT-4 protein or a peptide may be 20 useful as a therapeutic agent to treat prostate disease.

In a similar method, diagnostic assays can be immunoassays. Thus, antibodies can be used in immunoassays to quantitate the level of NT-4 in a 25 sample from a patient, in order to detect, prognose, diagnose, or monitor conditions, disorders, or disease states associated with changes in NT-4 levels.

The immunoassays which can be used include but are not limited to competitive and non-competitive 30 assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich1* immunoassays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation , assays, immunoradiometric assays, fluorescent L 4 < j | 3 immunoassays, protein A immunoassays, and Immunoelectrophoresis assays, to name but a few.

Anti NT-4 antibody fragments or derivatives containing the binding domain may also be used in such assays.

Antibody fragments which contain the idiotype of the molecule can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')2 fragment which can be produced by pepsin digestion of the antibody molecule; the Fab1 fragments which can be generated by reducing the disulfide bridges of and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent. 15 Diagnostic kits are also provided. For example, such a kit can comprise in a suitable container an NT-4 specific probe. In one embodiment, the probe is an antibody specific for NT-4. In another embodiment, the probe is a nucleic acid 20 (molecular probe) capable of hybridizing to an NT-4 nucleic acid sequence. The probe can be detectably labeled; alternatively, the kit can further comprise a labeled specific binding partner for the probe.

The above-described hybridization assays and 25 immunoassays can also be used to quantitate NT-4 levels as an indication of therapeutic efficacy, by comparing the levels in patient samples before and after treatment of a disorder, particularly, a motor neuron disease.

In an analogous fashion, the expression of human NT-4 mRNA in muscle tissue leads to potential methods of treating motor neuron disorders comprising administering to a patient in need of such treatment an effective amount of an NT-4 factor to support the survival, growth, and/or differentiation of motor J(J^/992 r j 2 4 a 1 3 neurons. Expression of NT-4 mRNA in human muscle suggests further avenues for diagnosing and treating neuron disorders. Retrograde axonal transport may be characteristic of NT-4. The specific retrograde 5 transport of NT-4 can be used to indicate whether neurons are responsive to NT-4 in normal or diseased states. Therefore, the present invention provides for a method of diagnosing NT-4 related peripheral nervous system disorders comprising injecting a detectably 10 labeled NT-4 protein or peptide into a peripheral nerve and determining whether the labeled NT-4 protein or peptide is retrogradely transported, in which a failure to be retrogradely transported positively correlates with lack of responsiveness to NT-4 and 15 indicates the presence of a peripheral nervous system disorder that is NT-4 related. Analogous methods may be used to diagnose a central nervous system disorder. Evaluation of retrograde transport may be performed by any method known in the art, including but not limited 20 to MRI, CAT, or scintillation scanning. Such methods may be used to identify the location of a nervous system lesion, as retrograde transport should substantially diminish upon reaching the lesion. retrograde evaluation comprising in a container a detectably labeled NT-4 protein, derivative or fragment. Such a label can be a radioactive isotope, or other label known in the art. treat diseases and disorders of the nervous system which may be associated with alterations in the pattern of NT-4 expression or which may benefit from exposure to NT-4 or anti-NT-4 antibodies (or fragments thereof containing the binding domain). We show that human NT-4 is expressed in skeletal muscle (See The invention further provides kits for such The present invention may be utilized to 2 31 Example Section 10, infra). Based on this discovery, the invention provides for the treatment of motor neuron diseases. A wide array of neurological disorders may affcct motor neurons. Upper motor 5 neurons, for example, are predominantly affected by cerebrovascular accidents, neoplasms, infections and trauma. Lower motor neurons, or anterior horn cells, are secondarily affected by these processes, but in addition are subject to a number of disorders in which 10 anterior horn cell loss is the primary feature, including amyotrophic lateral sclerosis, infantile and juvenile spinal muscular atrophy, poliomyelitis and the post-polio syndrome, hereditary motor and sensory neuropathies, and toxic motor neuropathies (e.g. 15 vincristine). The disorders of motor neurons which can be treated according to the present invention include but are not limited to the foregoing. Methods of formulation and administration of NT-4 protein, derivatives, fragments, or antibodies thereto which 20 can be used include but are not limited to those disclosed supra or known in the art.

The invention may also be utilized to treat benign prostatic hypertrophy (BPH), a common yet poorly understood condition ocurring mostly in males over 25 50 years of age. The proliferation of the prostrate during BPH may be induced by a growth factor such as NT-4 through an autocrine loop phenomenon. Synthesis and excretion of NT-4 would be followed by transport of NT-4 back into the prostate cell via a specific 30 receptor on the prostate cell membrane. Autocrine loops have been defined for various growth factor molecules and tumor cell lines. In some cases, these autocrine loops have been experimentally defined by the use of antisense approaches for the disruption of the autocrine loop. Therefore, a therapeutic 2428 1 application of the present invention includes the use of a nucleic acid anti-sense to human NT-4 or a portion thereof to inhibit translation of NT-4 mRNA in the prostate, (for procedures which can be used, see g copending U.S. Application Serial No. 07/728,784 filed July 3, 1991 (corresponding to WO 93/00909 and incorporated by reference herein in its entirety). For example, a patient suffering a prostate localized disease characterized by increased transcription in prostate tissue of an NT-4 10 gene relative to that of transcription levels of the NT-4 gene in the prostate of normal patients could be administered an effective amount of an oligonucleotide to treat a prostate disease, preferably benign prostatic hypertrophy. The oligonucleotide should be 15 at least 6 nucleotides in length, complementary to a least a portion of the RNA transcript of the NT-4 gene and, hence, being capable of hybridizing to the NT-4 transcript. Additionally, anti-NT-4 antibodies may be utilized to inhibit binding of NT-4 to its specific 20 receptor on the prostate cell membrane. A therapeutically effective amount of either an NT-4 antisense nucleic acid or an anti-NT--4 antibody may be delivered in any fashion described supra. other prostate related dysfunctions, specifically impotence. Such a malady may be the direct or indirect result of inadequate levels of NT-4 in the prostate. Therefore, both the detection of the dysfunction as well as treating the patient for 30 impotence via application of a therapeutically effective amount of NT-4 protein or a functional fragment or derivative of NT-4 may be delivered by any method described supra.

The invention may also be utilized to treat The present invention discloses the ^ detection of NT-4 expression in human thymus ti 2 4 2 8 1 Therefore, the invention may also be utilized to treat immunological disorders affecting neuromuscular transmission, including but not limited to myasthenia gravis, an acquired autoimmune disorder associated 5 with the acetylcholine receptor (AChR) within the postsynaptic folds at the neuromuscular junction. The disease manifests itself as weakness and muscular fatigue due to blockage of post-synaptic AChR or muscle membranes by binding of antibodies specific to 10 the AChR. (See, e.g.. Drachman, 1983, Trends Neurosci. 6:446-451). Treatment of such immunological mediated neurological disorders may include therapeutic applications of the NT-4 protein or a functional fragment or derivative of NT-4, delivered 15 by any of the methods described supra. of treating motor neuron disorders comprising administering, to a patient in need of such treatment, an effective amount of an NT-4 protein, derivative or 20 peptide fragment capable of supporting the survival, growth and/or differentiation of motor neurons as demonstrated in an in vitro culture system. of neurotrophic factor may desirably be determined on 25 a case by case basis, as motor neurons from different tissue sources or from different species may exhibit different sensitivities to neurotrophic factor. For any particular culture, it may be desirable to construct a dose response curve that correlates 30 neurotrophic factor concentration and motor neuron response. To evaluate motor neuron survival, growth, and/or differentiation, one can compare motor neurons exposed to an NT-4 protein, derivative or peptide fragment to motor neurons not exposed to an NT-4 protein, derivative or peptide fragments, using, for The present invention provides for a method In in vitro embodiments, effective amounts 2 4 2 8 1 34 eyimple, vital dyes to evaluate survival, phase-contrast microscopy and/or neurofilament stain to measure neurite sprouting, or techniques that measure the bioactivity of motor neuron-associated compounds, 5 such as choline acetyltransferase (CAT), or any other methods known in the art. CAT activity may be measured, for example, by harvesting and lysing treated and untreated motor neurons in a 20 mH Tris-HCi (pH 8.6) solution containing about 0.1% 10 Triton X-100, removing an aliquot of several microliters, and measuring for CAT activity using, as a substrate, 0.2 m.l [1 - 7C] acetyl-CoA, 300 mM NaCl, 8 mM choline bromide, 20 mM EDTA, and 0.1 mM neostigmine in 50 mK NaH2P04 (pH 7.4) buffer, using the 15 micro-Fonnum procedure as described in Fonnum, 1975, J. Neurochem. 24.:407-409, incorporated by reference in its entirety herein. the invention, motor neurons may be prepared, and 20 cultured in vitro. as follows. At least a portion of a spinal cord, preferably obtained from an embryonic organism such as a rat, may be aseptically obtained and separated from the bulb, sensory ganglia, and adhering meninges. The ventral segments of the cord 25 may then be isolated, as motor neurons are localized in the ventral (anterior) horns of the spinal cord. Ventral cord segments may be diced into small pieces and incubated in about 0.1% trypsin and 0.01% deoxyribonuclease type 1 in calcium and magnesium-free 30 phosphate buffered saline (PBS) at 37°C for about 20 minutes. The trypsin solution may then be removed, and the cells may be rinsed and placed in fresh medium, such as 45% Eagle's minimum essential (MEM), 45% Ham's nutrient mixture F12, 5% heat inactivated fetal calf serum, 5% heat inactivated horse serum, In a specific, non-limiting embodiment of 2. 4 i G '1 3 glutamine (2 mM), penicillin G (0.5 U/ml), and streptomycin (0.5 jig/ml) . The tissue may be mechanically dissociated by gentle trituration through a Pasteur pipet, and the supernatants pooled and 5 filtered through a nylon filter (e.g. Nitex, Tetko; 40 nm). The filtered cell suspension may then be fractioned using a modification of the method set forth in Schnaar and Schaffner (1981, J. Neurosci. 1:204-217). All steps are desirably carried out at 10 4°c- Metrizamide may be dissolved in F12:MEM medium (1:1) and a discontinuous gradient may be established that consists of a 18* metrizamide cushion (e.g. 0.5 ml), 3 ml of 17% metrizamide, 3 ml of 12% metrizamide, and 3 ml of 8% metrizamide. The filtered 15 cell suspension (e.g. 2.5 ml) may be layered over the step gradient and the tube may be centrifuged at 2500 g for about 15 minutes using a swing-out rotor (e.g. Sorvall HB4). Centrifugation may be expected to result in three layers of cells: fraction I (at 0-8% 20 interface), fraction II (at 8-12% interface) and fraction III (at 12-17% interface). Fraction I, enriched for motor neurons, may be removed in a small volume (e.g. about 1 ml) and rinsed twice with a serum-free defined medium such as 50% F12 and 50% MEM 25 supplemented with glutamine (2 mM), insulin (5 /zg/ml) , transferrin (100 ng/nl), progesterone (20 nM), putrescine (100 nH), and sodium selenite (30 nM, see Bottenstein and Sato, 1979, Proc. Natl. Acad. Sci. U.S.A. 7^:514-517). Viable cell count may then be 30 obtained by hemocytometer counting in the presence of trypan blue. The motor neuron enriched cell suspension may then be plated at a density of about 100,000 cells/cm2 in tissue culture wells (preferably 6 mm) precoated with poly L-ornithine (e.g. 10 /xg/ml) and laminin (e.g. 10 /xg/ml) . An NT-4 protein, 36 derivative or peptide factor may then be added. For example, in specific embodiments, NT-4 may be added to achieve a final concentration of between about 0.01 and 100 ng/ml, and preferably about 50 ng/ml. The 5 motor neuron cultures may then be maintained in serum-free defined medium at 37#c in a 95% air/5% C02 atmosphere at nearly 100% relative humidity. the NT-4 related recombinant nucleic acid sequence, 10 such as contained in bacteriophage HG7-2, HG4-2, and/or HG2-1, may be utilized to construct chimeric prepro/mature NT-4-genes. For example, when it is desired to express a mature NT-4 protein, derivative or peptide fragment in vivo or in vitro, one can fuse 15 the pre-pro region of a distinct neurotrophic gene to the mature coding region of the NT-4 related sequence. The neurotrophic genes which can provide the prepro region include but are not limited to NGF, BDNF, and NT-3. Such a chimeric construct may promote increased 20 stability of the chimeric mRNA transcript in relation to a wild type NT-4 mRNA transcript, may increase translational efficiency or may generate a more suitable template for proteolytic processing to a mature, biologically active neurotrophin protein or 25 peptide fragment, thus increasing expression. One of ordinary skill in the art possesses the requisite knowledge to construct such chimeric nucleic acid sequences, given the published DNA sequences of other neurotrophin genes such as NGF (Scott et al., 1983, 30 Nature 302; 538-540; Ullrich et al., 1983, Nature 303:821-825)f BDNF (Leibrock et al., 1989, Nature 341:149-152) and NT-3 (Hohn et al., 1990, Nature 344:339-341; Maisonpierre et al., 1990 Science 247:1446-1451; Ernfors et al., 1990, Proc. Natl. Acad. 35 Sci. USA £7:5454-5458; Rosenthal et al., 1990,.

In a further embodiment of the invention 2 4 2.8 1 37 Neuron 4:767-773), as well as guidance as to strategies for generating a fusion junction (for example, see Darling et al., 1983, Cold Spring Harbor Symposium Quantative Biology 427-434; Edwards et 5 al., 1988, J. Biol. Chem. 263:6810-6815: Suter et al., 1991, EMBO J. 12:2395-2400). In another embodiment, chimeric constructions fusing the pre-pro region of an NT-4 related recombinant nucleic acid, such as contained in bacteriophage HG7-2, HG4-2 and HG2-1, to 10 the mature regions of other neurotrophins, can also be used to promote efficient expression of such other neurotrophins, as discussed supra. of detecting or measuring NT-4 activity. As described 15 in Example 12, we have discovered that trkB is a functional receptor for NT-4. Based on this discovery, the invention provides methods for detecting or measuring NT-4 activity comprising exposing a cell that expresses trkB to a test agent, 20 and detecting or measuring binding of the test agent to trkB, in which specific binding to trkB positively correlates with NT-4 activity in the test agent. In a specific embodiment, the cell that expresses trkB is a transfected cell such as a 3T3 fibroblast, which 25 expresses recombinant trkB, such that the survival of the cell is dependent upon exposure to neurotrophin-4 or BDNF. Thus detecting of binding of the test agent can be carried out by observing the survival of such transfected cells.

The present invention also provides methods 2 4 ? P- 1 3 li L-n J 6. EXAMPLE: EVOLUTIONARY STUDIES OF THE NERVE GROWTH FACTOR FAMILY REVEAL A NOVEL MEMBER ABUNDANTLY EXPRESSED IN XENOPUS OVARY 6. 1. MATERIALS AND METHODS 6. 1. 1. D^A PREPARATION Genomic DNA was isolated by standard procedures (Davis et al., 1986, "Basic Methods In Molecular Biology", Elsevier, New York)) from human leukocytes and from liver of Sprague-Dawley rat, frog (Xenopus laevis) and ray (Raia clavata). Genomic DNA was also obtained from salmon (Salmon) and from the elephant snake (Vipera lebetina). The DNA was precipitated with ethanol, collected using a glass hook, washed in 80% ethanol, dried and dissolved in water to a final concentration of 1 mg/ml. Salmon DNA (Sigma, St. Louis, MO) was dissolved in water, extracted twice with phenol and once with chloroform, and precipitated with ethanol. 6. 1. 2. POLYMERASE CHAIN REACTIONS, MOLECULAR CLONING AND DNA SEQUENCING Six separate mixtures of 28-m«r oligonucleotides representing all possible codons corresponding to the amino acid sequence XQYFYET (SEQ ID NO:110) (5'-oligonucleotide) and WRFIRID (SEQ ID NO:111) (3'-oligonucleotide) (Fig. 1A) were synthesized on an Applied Biosystero A381 DNA synthesizer. The 5*oligonucleotide contained a synthetic EcoRI site and the 3'-oligonucleotide contained a synthetic Hindlll site (Knoth et al., 1988, Nucl. Acids Res. 25.51093; Nunberg et al., 1989 J. Virology £2,: 3240-3249) . Each mixture of oligonucleotides was then used to prime the amplification of 0.8 nq of genomic DNA using the polymerase chain reaction (PCR) (Tag DNA polymerase, It 39 Promega) (Saiki et al., I985f Science 230:1350-1354)♦ The PCR products were restricted with Hindlll and EcoRI. analyzed on a 2* agarose gel and cloned into plasmid Bluescript KS+ (Stratagene, La Jolla,CA). The 5 size of the amplified region plus primers is 179 base pairs (bp) for NGF and 182 bp for BDNF and NT-3. As a result of internal EcoRI sites in some cases, shorter fragments of 144 bp and 95 bp were also isolated. The cloned DNA fragments were sequenced using the dideoxy 10 nucleotide chain termination method (Sanger et al., 1977, Proc. Natl. Acad. Sci. U.S.A. 74.:5463-5467) with T7 DNA polymerase (Pharmacia, Uppsala). Between 2 and 2 0 independent clones were sequenced for each gene and species, and altogether more than 200 independent 15 clones were sequenced.

Xenopus genomic library prepared by insertion of Mbol-digested genomic DNA in the BamHI site of phase XEMBL-3 were screened using conventional procedures 20 with a 182 bp PCR fragment of Xenopus NT-4 labeled with [a-32P]dCTP by nick translation to a specific activity of approximately 5 x 10* cpm/jig.

Hybridization was carried out in 4 x SSC (1 x SSC is 150 mM NaCl, 15 mM sodium citrate (pH 7.0)), 40% 25 formamide, l x Denhardts solution, 10% dextran sulfate at 42°C. The filters were washed at 55°C in 0.1 x SSC, 0.1% SDS and exposed to Kodak XAR-5 films at -70°C. Eight phage clones were isolated, and a hybridizing 1.5 kb PstI fragment from one of these 30 clones was subcloned in the plasmid pBS-KS (Stratagene). The nucleotide sequence of the subcloned fragment was determined by the dideoxy chain termination method (Sanger et al., 1977, Proc. Natl. Acad. Sci. U.S.A. 74:5463-5467).

Approximately 2,000,000 clones from a 2. 4 L* o 6 3 6. 1. 3. COMPUTER ANALYSIS OF THE SEQUENCE DATA DNA and amino acid sequence comparisons and alignments shown in Table I were performed on a VAX computer using UWGCG software (Devereux et al., 1984, 5 Nucl. Acids Res. 22*387-395). The results of comparing amino acid sequences using the UWGCG programs are presented as percent amino acid similarity or nucleotide identity between the sequences, taking conservative aiiino acid changes into 10 consideration (Gribskov and Burgess, 1986, Nucl. Acids Res. JL4.56745-6763; Schwartz and Dayhoff, 1979, "An Atlas of Protein Sequence and Structure", ed., Natl. Biomed. Res. Found., Washington D. C., pp. 353-358). Phylogenetic Analysis Using Parsimony (FAVP version 15 3.Of) was used for the construction of the phylograms (Felsenstein, 1988; Annu. Rev. Gene. 22:521-555? Swofford and Olsen, 1990, in "Molecular Systematics,•• Hills and Moritz, Eds., Sunderland, MA., Sinaver Assoc., Inc. pp. 441-501). Searches for the most 20 probable trees were run using both exhaustive and heuristic (branch swapping) algorithms. 6. 1. 4. PRODUCTION OF RECOMBINANT PROTEIN, BINDING ASSAY TO PC12 CELLS, AND ASSAYS OF NEUROTROPHIC ACTIVITIES For transient expression of recombinant proteins in COS cells, appropriate DNA fragments were cloned in the vector pXM (Yang et al., 1986, Cell 47:3-10). For NT-4 the sequenced 1.5 kb Pstl fragment from Xenopus was cloned in pXM, and for NGF a 771 bp BstEII—Pstl fragment from the 3* exon of the rat NGF gene was used (Halbook et al., 1988, Development 108:693-704). To express BDNF protein, a PCR-amplified fragment containing the prepro-BDNF coding sequence from the mouse BDNF gene (Hofer et al., 1990, EMBO J. 2:2459-2464) was also subcloned in pXM. For NT-3, a jf~7 fe o'| s** 2 J(JN J99- n 1 k 2 S 1 3 1020 bp rat cONA clone was inserted in pXM (Ernfors et al., 1990, Proc. Natl. Acad. Sci. U.S.A. 87:5454-5458). grown to about 70% confluency were transfected with 25 nq of plasmid DNA per 100 mm dish using the DEAE-dextran-chloroquine protocol (Luthman and Magnusson, 1983, Nucl. Acids Res. 17:1295-1305). Transfected cells were then grown in complete medium (DMEM plus 10 10% FCS), and conditioned medium was collected 3 days after transfection. Dishes (35 mm) transfected in parallel were grown over the third night after transfection in the presence of 200 /xCi/ml [35S] cysteine (Amersham, UK) . Aliquots (10-20 n 1 each) 15 of the iji vivo labeled conditioned media were analyzed by SDS-PAGE in 13% polyacrylaimide gels. The gels were treated with EnHance (New England Nuclear, Boston, HA), dried, and exposed to Kodak XAR5 films with intensifying screens for 24-48 hr at 80°C. 20 Autoradiographs were scanned in a Shimadzu densitometer, and the relative amounts of the different recombinant proteins were estimated by calculating the area corresponding to each protein relative to that obtained with rat NGF. The absolute 25 amount of rat NGF protein was assessed by quantitative immunoblotting of conditioned media using stiandards of purified mouse NGF and was used to determine the protein concentration in the samples containing the other recombinant proteins.

PC12 cells (Greene and Tischler, 1976, Proc. Natl. Acad. Sci. U.S.A. 21:2424-2428), mouse NGF was labeled with ,25I by the chloramine-T method to an average activity of 7 x 107 cpm/nq. Steady-sate binding was COS cells (Gluzman, 1981, Cell 2:175-182) For binding assay of recombinant proteins to measured in competition assays performed at 37°C or Ik L 0 1 3 0°C using 1 x 104 cells per ml, 1.5 x 10*» M 12SI-NGF; and serial dilutions of conditioned media containing equivalent amounts of NGF or NT-4. All components were added at the same time, and cells were collected 5 by centrifugation after equilibrium was reached (1-3 hr incubation). Control experiments using medium from mock-transfected COS cells showed that other proteins present in the conditioned medium had no effect on the binding of l2SI-NGF to PC12 cells. Nonspecific binding 10 was measured in a parallel incubation to which at least a 1000-fold excess of unlabeled NGF was added. All results were corrected for this nonspecific binding which was always less than 10% of the total binding.

The biological activities of the different proteins were measured by the ability of transfected COS cell conditioned media, containing equal amounts of recombinant protein, to stimulate neurite outgrowth from explanted sympathetic, nodose, and dorsal root 20 ganglia from E9 chicken embryos (Ebendal, 1984, "Organizing Principles of Neural Development, S. Sharms, ed., New York: Plenum Publishing Corp., pp. 93-107; Ebendal, 1989, "Use of Collagen Gels to Bioassay Nerve Growth Factor Activity in Nerve Growth 25 Factors", R. A. Rush, ed. (Chichester: John Wiley & Sons, pp. 81-93). Serial dilutions of conditioned medium were assayed and the fiber outgrowth was scored. 6. 1. 5. RNA PREPARATIONS AND BLOT ANALYSIS The indicated tissues from adult female Xenopus were dissected and frozen in liquid nitrogen. The brain and spinal cord were pooled. Several lobes of the ovary were dissected out, including oocytes of different stages. The frozen tissue samples were 43 - homogenized in 4 M guanidine isothiocyanate, 0.1 M jS-mercaptoethanol, 0.025 M sodium citrate (pH 7.0) and homogenized three times for 15 s with a Polytron.

Each homogenate was layered over a 4 ml cushion of 5.7 5 M CsCl in 0.025 M sodium citrate (pH 5.5) and centrifuged at 15°C in a Beckman SW41 rotor at 35,000 rpm for 76 hr (Chirgwin et al., 1979# Biochemistry 78:5294-5299). Poly(A)+ RNA was purified by oligo(dT)-cellulose chromatography (Aviv and Leder, 10 1972, Proc. Natl. Acad. Sci. U.S.A. ££:1408-1412), and the recovery of RNA was quantified spectrophotometrically before use in RNA blot analysis. Poly(A)'1' R'.JA (10 ng) from each sample was electrophoresed in a 1% agarose gel containing 0.7% 15 formaldehyde. UV-transillumination of the stained gel was used to confirm that all samples contained similar amounts of intact RNA. The gel was then transferred to a nitrocellulose filter. The filter was hybridized to the indicated DNA probes. The probes were labeled 20 with [a-"P]dCTP by nick translation to a specific activity of around 5 x 10J cpm/jzg, and the hybridization was carried out as described above. Filters were washed at high stringency (0.1 x SSC, 0.1% SDS, 54°C) and exposed to Kodak XAR-5 films. 6. 2. Rsswrs DNA fragments coding for NGF, BDNF and NT-3 from human, rat, snake, frog, and fish were isolated using the PCR technique with degenerate primers from conserved regions in these three proteins located between lysine 50 and threonine 56 for the upstream primer and between tryptophan 99 to aspartic acid 105 for the downstream primer (Fig. 1A). The amplified region contains three of the six cysteine residues and covers approximately one third of the mature molecules. A comparison of the amplified region in already characterized NGF molecules from different species shows that it contains two variable regions, arginine 59 to serine 67 and aspartic acid 93 to 5 alanine 98. A hydrophilic stretch believed to be exposed on the surface of the molecules (Bradshaw, 1978, Ann. Rev. Biochem. 42:191-216), as well as the highly conserved regions glycine 68 to tryptophan 76 and threonine 85 to threonine 91 are also included in ,Q the amplified region. The BDNF and NT-3 molecules have an extra amino acid between positions 94 and 95 of the mouse NGF protein which is also included in the amplified region. of mouse NGF, BDNF and NT-3 proteins were compared in order to calculate how representative the amplified region is of the complete molecule. The entire mature molecules show 65/57% similarity (amino acid sequence similarity/nucleotide sequence identity) between NGF 20 and BDNF, 70/61% similarity between NGF and NT-3 and 68/58% similarity between BDNF and NT-3. When comparing the region isolated in this study, the similarity between NGF and BDNF is 62/53%, that between NGF and NT-3 is 67/58%, and that between BDNF 25 and NT-3 69/60%. This strongly suggests that the region isolated in this study is representative for the entire molecule and that it can be used to monitor the evolutionary relationships among the different factors. Pairwise sequence comparison were performed 30 (Table I) taking conservative amino acid replacements into consideration, using the comparison matrix of Schwartz and Dayhoff (1979, "In Atlas of Protein Sequence and Structure, M.O. Dayhoff, ed., Washington, D.C., Natl. Biomed. Res. Found., pp. 353-358).

Therefore, comparisons of amino acid sequences given The sequences of the entire mature molecule 2 3 below and shown in Table I indicate percent similarity, not identity. Phylogenetic trees were constructed using parsimony analysis (Felsenstein, 1988, Ann. Rev. Genet. 22.:521-565; Swofford and Olsen, 5 1990, "In Molecular Systematics, D. M. Hills and C. Moritz, eds., Sunderland, MA:Sinauer Assoc., Inc., pp. 411-501). As shown below, all isolated DNA fragments with predicted amino acid sequences related to.those of NGF, BDNF, and NT-3 contained conserved cysteine 10 residues at the correct positions. This was used as an initial criterion for a sequence to be considered as a member of the nerve growth factor gene family. 6. 2. 1. NGF, BDNF AND HDNF/NT-3 ARE HIGHLY 15 CONSERVED DURING EVOLUTION 6. 2. 1. 1. NERVE GROWTH FACTOR The nucleotide sequence (Fig. IB [human (SEQ ID NO:3), rat (SEQ ID NO:4), chicken (SEQ ID NO:5), viper (SEQ ID NO:6), Xenopus (SEQ ID NO:7), salmon 2Q (SEQ ID NO:8)] and the predicted amino acid sequence of the isolated fragments coding for NGF are highly conserved from fish to human (Fig. 2 [human (SEQ ID NO:24) , rat (SEQ ID NO:25), chicken (SEQ ID NO.-26), viper (SEQ ID NO:27), Xenopus (SEQ ID N0:28), salmon 25 (SEQ ID NO:29]). Most of the non-conservative amino acid changes were found in the variable regions arginine 59 to serine 67 and aspartic acid 93 to alanine 98 (Fig. 2). The similarity between the Xenopus and human NGF sequences is 93/79% (Table I). 30 Xenopus and chicken NGF are identical except for one conservative change from lysine 62 to arginine 62 (Fig. 2). The sequences of viper and salmon NGF contain 11 and 19 amino acid differences (out of 42), respectively, compared with hvunan NGF while all other 35 species only showed four differences. None of the NGF amino acid sequences isolated contained the extra li amino acid residue present in BDNF and NT-3 between glutamic acid 94 and lysine 95 of the human NGF sequences.

The interspecies relationships of the 5 different NGF sequences were analyzed by the construction of a phylogenetic tree (Figure 3A). The salmon NGF sequence appears to have diverged more than the NGF sequences isolated from other species. No NGF sequence could be isolated from ray using the 10 described PCR technique, suggesting that ray NGF sequences say be above the mismatch tolerance of the primers used in our PCR protocol. Alternatively, the absence of NGF in cartilaginous fishes would imply that NGF appeared after the splitting of the branch 15 leading to the evolution of the bony fishes (some 450 million years ago) but before amphibians and higher vertebrates evolved from this branch (about 400 million years ago). <r>, A ft ft NGF TABM I Hum Rat Chi Vip Xen Sal 1 Hum - 95 93 86 93 69 1 Rat 87 — 88 87 88 69 1 Chi 80 73 • 90 100 74 1 Vip 73 72 75 «. 90 67 Xen 79 73 83 76 • 74 Sal 60 61 60 51 53 — Ray X X X X X X NT-3 BDNF Hum Rat Chi Xen Sal Ray — 100 100 100 81 88 91 _ 100 100 81 88 81 83 — 95 81 86 X X X X X X 73 79 86 • 86 90 67 64 71 71 74 76 73 71 72 71 - Hum Rat Chi Vip Xen Sal Ray — 100 95 86 95 100 93 91 — 95 86 95 100 93 88 84 — 91 91 95 93 83 78 85 .. 88 86 84 73 82 85 82 95 88 82 80 83 75 78 — 99 77 76 78 74 74 78 - Nucleotide identities & amino acid similarities were calculated with a VAX computer (software package from the UWGCG; Devereux et al., 1984, Nucl. Acids Res. 12: 389-395) according to the comparison matrix of Schwartz and Dayhoff (1979, Washington, D.c. Nat'l Biomed. Res. Found, pp. 353-358), taking conservative amino acid changes into consideration. The figurss below the diagonals show percent nucleotide identity. The figures above the diagonals show the percent amino acid similarity. X indicated that the sequences were not isolated from those species (NGF) from ray and NT-3 from viper). Hum, human; Chi, chicken; Vip, viper; Sal, salmon; Xen, Xenopus. 2 9 " fan ' K *■:=.. '- 6. 2. 1. 2. BRAIN-DERIVED NEUROTROPHIC FACTOR DNA sequences similar to that of human BDNF were found in all species investigated (Fig. IB [SEQ ID NOS:1-21, listed supra). The similarity in amino acid and nucleotide sequences between ray, the most primitive species investigated, and human are 93/77% (Table I). Only two non-conservative changes were seen outside the variable regions, whereas ten Similar changes were found in the two variable regions (Fig. 2). In Xenopus. (SEQ ID NO:34) leucine 90 is replaced by a phenylalanine as a result of a single base pair mutation, C to T in the first position of the codon, and in salmon (SEQ ID NO:35), tryptophan 77 is replaced by tyrosine as a result of a double mutation, changing the codon from TGG to TAT (Fig. IB [SEQ ID NO:14]). All isolated sequences contained an extra amino acid residue at position 96, compared with NGF (Fig. 2 [SEQ ID NO:24-29]). The BDNF sequences from different species appeared as a homogenous group of sequences when analyzed by the parsimony method (Figure 3B). sequences for human (SEQ ID NO:16 and 37), rat (SEQ ID NO:17 and 38), chicken (SEQ ID NO:18 and 39), Xenopus (SEQ ID NO:i9 and 40), salmon (SEQ ID N0:20 and 41), and ray NT-3 are highly similar (Figs. IB, Figure 2).

Most of the changes are silent mutations resulting from changes in the third position of the codons, usually transitions that preserve the pyrimidine or purine feature of the base pair. Only non-conservative amino acid changes were found within the two variable regions and no amino acid replacements were seen outside the two variable region 6. 2. 1. 3.. NEUROTROPHIN-3 The nucleotide and predicted amino acid L Hi Vj> *3 i salmon sequence lacks Asp-94 which is present in all other NT-3 molecules (Fig. 2) and has a longer distance from the branching point in the phylogenetic tree than NT-3 sequences from other species (Figure 5 3C) . 6. 2. 1. 4. A NOVEL MEMBER OF THE NERVE SRQWTH factqr <?ewe family Additional DNA fragments were isolated from viper (SEQ ID N0:1) and Xenopus (SEQ ID N0:2), and the predicted ammo acid sequences (SEQ ID NO: 22 and SEQ ID NO:23, respectively) revealed that these fragments contained all three cysteine residues in the same positions as in NGF, BDNF and NT-3 (Fig. IB, Fig. 2). A comparison with the sequences of Xenopus NGF, BDNF and lO NT-3 indicated that this new sequence is related, but not identical, to the sequences of the other members of the NGF family. The gene including this sequence was therefore named neurotrophin-4 (NT-4). Comparison of 2Q the nucleotide and amino acid sequences show that Xenopus and viper NT-4 are 91/73% similar. This similarity is in the same range as the one seen between Xenopus and viper NGF and BDNF (Table I). As for the other members of the NGF family, non-conservative amino 25 acid changes were only seen in the two variable regions (Fig. 2). 6. 2c 1. 5. COMPARISON AND PHYLOGENY OF THE MEMBERS IN THE NERVE GROWTH FACTOR GENE FAMILY ^ A comparison of the phylogenetic trees for NGF, BDNF, and NT-3 showed longer branches in the NGF tree, indicating a higher rate of evolutionary change (Figures 3A-3C). The relationship of each member of the NGF family to the other members was studied by the construction of a phylogram comparing the deduced amino acid sequences for the four members of the family. The C. phylogram showed that NGF is more closely related to NT-3 than to BDNF and NT-4 (Figure 3D). NT-3 is as related to NGF as to BDNF. NT-4 is clearly more related to BDNF than to the other two members. 6. 2. 2. STRUCTURAL FEATURES OF THE NT-4 PROTEIN To enable a more detailed characterization of the NT-4 gene and its gene product, we screened a Xenopus genomic library with the NT-4 PCR fragment and 10 isolated a phage clone containing a 16 kb insert. From this insert, a 1.5 kb Pstl fragment was subcloned and sequenced Figure 4A (SEQ ID NO:43). The nucleotide sequence contained an open reading frame encoding a 236 amino acid protein (SEQ ID NO:44) that showed several 15 structural features characteristic of the other members of the NGF family. The amino terminus of the predicted NT-4 protein contains an 18 amino acid putative signal sequence in which a region of 4 amino acids is identical to the corresponding regions in pig and rat BDNF 20 (Leibrock et al. 1989, Nature 341. 149-152; Maisonpierre, et al., 1990, Science, 247. 1446-1451). A potential signal cleavage site, which is also identical to the one proposed for BDNF (Figure 4A), follows. A potential cleavage site for a 123 amino acid mature NT-4 25 protein is found after amino acid 113 in the prepro-NT-4 protein. A single predicted N-glycosylation site (Asn-Lys-Thr) is located 8 amino acids before the putative cleavage site.

A comparison of the mature NT-4 protein to 30 the mature BDNF, NT-3, and NGF proteins from T.ouse revealed 60%, 58% and 51% amino acid identity, respectively. Included in the mature NT-4 protein are all 6 cysteine residues involved in the formation of disulphide bridges [Figure 4B (SEQ ID NO:45-48)]. The regions that are identical between NGF, BDNF, and NT-3 A *A. y ..... ; i " 2 JUN1992 r / "V 9 ft 9 n 1 X L, h w s CJ are also similar in the NT-4 protein. Most sequence differences betveen the NT-4 protein and the other three proteins were found within the same variable regions previously identified in the other members of the 5 family. 6. 2. 3. BINDING TO THE NGF-R AND NEUROTROPHIC ACTIVITY OF NT-4 The 1.5 kb Xenopus Pstl fragment was. cloned in the expression vector pXM (Yang et al., 1986, Cell 47; 3-10) and transiently expressed in COS cells. SDS-PAGE of conditioned media from transfected cells labeled with [35 -S] cysteine showed an NT-4 protein with an Mr of 14K (Figure 5A). NGF protein produced and labeled in parallel dishes migrated somewhat faster than the NT-4 Id protein. This difference in mobility is most likely due to variations in the charge of the two proteins.

Similar mobility differences have also been observed for NGF proteins with identical sizes from different 2Q species.

Conditioned media from transfected COS cells containing equal amounts of rat NGF and Xenopus NT-4 protein were tested for their ability to compete for binding of 1J5I-labeled NGF to its receptor on PC12 cells. 25 binding assays were done at 37"C and under conditions in which 80* of the ,23I-NGF associated to the cells is bound to the low affinity NGF-R (Sutter et al., 1979, J. Biol. Chem. 254. 3972). Similar concentrations of NGF and NT-4 (6xlO-10M) were required to displace 50* of the 12SI-NGF 30 from the PC12 cells, indicating that the two proteins bind to the low affinity NGF-R with a similar affinity (Figure 5B). At higher concentrations, the NT-4 protein was less efficient in displacing ,25I-NGF, suggesting that in this case the remaining I2SI-NGF associated with the 35 cells was bound to high affinity or internalized f'N -A "2 JUfv 1992 9 A o o C, o receptors. The fact that this difference could not be seen in a parallel assay performed at 0°C in which no membrane mobilization or internalization occurs suggests that the NT-4 protein is not able to compete with NGF 5 for internalization, a process known to be mediated exclusively through the high affinity receptors (Olender and Stach, 1980, J. Biol. Chem. 255., 9338-9343; Bernd and Greene, 1984; J. Biol. Chem. 259. 15509-15516; Hosang and Shooter, 1987, HKBO J. 6, 1197-1202). cells was tested for its ability to promote neurite growth from explanted embryonic chick ganglia. A clear stimulation of neurite outgrowth from explanted chicken dorsal root ganglia was &jen (Figure 6A). Comparison of 15 dose-response curves using equal amounts of NT-4 and NGF protein revealed that the activity obtained with NT-4 was lower than that seen with NGF (Figures 5A and 5B). Recombinant NT-4 and BDNF proteins stimulated neurite outgrowth in the dorsal root ganglia to a similar extent 20 (Figures 6A and 6C). The NT-4 protein elicited a weak, but consistent, neurite outgrowth from the nodose ganglia (Figure 6G), whereas no activity could be detected in sympathetic ganglia (Figure 6E). This is in contrast to NGF, which markedly stimulates neurite 25 outgrowth from sympathetic ganglia (Figure 6F), and NT-3, which showed a clear activity in the nodose ganglia (Figure 6H). As for NT-4, the neurite outgrowth-promoting activity of BDNF in the nodose ganglia (Figure 61) was lower than the activity seen 30 with NT-3. 6. 2. 4. EXPRESSION OF NT-4 mRNA IN DIFFERENT XENOPUS TISSUES Polyade.nylated RNA was prepared from 11 35 different Xenopus tissues and used for Northern blot analysis. Hybridization with the Xenopus NT-4 probe The NT-4 protein transiently expressed in COS - /"S / L CC,.' revealed high levels of two NT-4 transcripts of 2.3 kb and 6.0 kb in the ovary (Figure 7A). In contrast, the level of NT-4 mRNA was below the detection limit in all other tissues analyzed. Hybridization with the Xenopus 5 NGF probe showed a 1.3 kb NGF mRNA in the heart (Figure 7A) and brain. However, the amount of NGF mRNA in these tissues was on the order of 100 times lower than the level of NT-4 mRNA in the ovary. NGF mRNA was also detected in the ovary, though the amount of NGF mRNA was 10 approximately 100 times lower than the level of NT-4 mRNA in this tissue (Figure 7B). The levels of BDNF and NT-3 mRNAs in ovary were both below the detection limit (Figure 7B) . 6. 3. DISCUSSION We have used the polymerase chain reaction (PCR) in combination with degenerate oligonucleotide primers to isolate the genes for different members in the NGF family from different species. A comparison of 20 the nucleotide and amino acid sequences of the entire mature NGF, BDNF and NT-3 proteins revealed similarities that are the same as those obtained by comparing the region of the genes analyzed in this study. Hence, this region appears to be representative for the rest of the 25 gene and can therefore be used to study the evolutionary conservation of the entire mature protein.

The NGF, BDNF and NT-3 genes from different species include regions which show complete identity between fish and mammals, as well as regions with lower 30 similarity. A comparison of NGF sequences from different species with the corresponding sequences of BDNF or NT-3 showed that the NGF gene is less conserved in vertebrates than both BDNF and HDNF/NT-3. The two latter genes appear to be equally conserved in all species studied, except in salmon, in which NT-3 is less 2 6.9 r •' x umt y ts-S g conserved than BDNF. In this context, it is interesting to speculate about the fact that the molecular clock seems sped up in some branches, notably NGF, and not in others. It is generally believed that there is a 5selective force that preserves the correct tertiary structure of a protein (Dickerson, 1971, J. Mol.

Evol. 1, 26-45; Kimura & Ohta, 1974, Proc. Natl. Acad.

Sci. USA, 21: 2848-2852). The difference in the evolutionary conservation of the three factors suggests 10 that there has been a higher selective pressure on BDNF and NT-3 than on the NGF gene. Environmental changes have been proposed to lead to changes in the selective pressure altering the performance optimum of a specific gene product (Kimura 1983, in "Evolution of Genes and 15 Proteins", pp. 208-233). In this context, it is possible that the more extensive evolutionary changes seen in NGF compared to BDNF and NT-3 reflect the fact that the function of NGF has changed more during evolution. Structure-function studies of NGF have shown 20 that this molecule can tolerate considerable structural changes without loss or modification of its activity profile, suggesting that the lower degree of evolutionary conservation of NGF could be due to a more stable structure of this protein, which is therefore 25 less easily perturbed by substitutions. Another possible explanation is that the regions of the genome where the genes for the different factors are located have different general mutation rates. Different mutation rates have been shown for non-coding regions of 30 the genome (Wolfe, et al., 1989, Nature, 337: 283-285) but it is less clear if this can lead to an increased number of changes in coding regions.

Salmon NGF and NT-3 are notably more different when compared with these molecules in other species. Some amino acids including the threonine 82 (- \ — I 2/ n A i T 55 and the histidine-threonine-phenylalanine at position 85 to 87 in NGF, as well as the absence of the amino acid between positions 94 and 95 (compared to the two other proteins), are consistent features of the NGF protein. g The fact that the isolated salmon sequence contains all of these NGF specific motifs argues that it is not an additional member of the family, but rather represents salmon NGF. In contrast to all other NT-3 sequences studied, salmon NT-3 lacks the amino acid in position 10 95. Since the extra amino acid is present in ray NT-3, it is likely that the common ancestor of ray and salmon had an ancestral NT-3 sequence which included the extra amino acid in position 95. Therefore, the changes in the salmon NT-3 molecule must have occurred after this 15 gene split from the common ancestor. Most of the changes in the amino acids of the salmon sequence are in the same regions that vary, to a lesser degree, also in the other species, strongly suggesting that the isolated salmon NGF or NT-3 sequences are not pseudogenes. The 20 greater divergence of salmon NGF and NT-3, compared with the other species, probably reflects the high degree of evolutionary expansion of the bony fishes.

NGF family probably existed 500 million years ago in the 25 primitive fishes, which were the ancestors of todays higher vertebrates. The gene family could have been formed by gene duplication, which is believed to be the most common mechanism whereby new genes evolve (Li, W., 1983, in "Evolution of Genes and Proteins, pp. 14-37). 30 Duplications of functional genes could have been facilitated, since all information required for the synthesis of a biologically active protein is contained within a 3' exon (Hallbook, et al., 1988, Mol. Cell. Biol. 8,: 452-456; Leibrock, et al., 1989, Nature, 341: 35 149-152; Hohn, et al., 1990, Nature, His 339-341). The The results in this study indicate that the 0 it 9 ? •x mm jj" B V - 56 formation of the family has involved several gene duplications (Figure 3D).

Since NT-4 is more closely related to BDNF than to NT-3 or NGF, it appears that NT-4 and BDNF were 5formed from a common ancestral gene. However, since no progenitor-like molecule for all four factors can be distinguished from the present data, the evolutionary relation of the putative BDNF/NT-4 ancestor to the ancestors of NGF and NT-3 cannot be definitely 10 established. The topology of the phylograms using data from "ferent species is in general agreement with the ccnr us evolutionary relationship among different species. However, for both NGF and BDNF, the chicken sequences show an earlier branching in the phylogram 15 than expected. Comparison of NT-4, NGF, and BDNF from viper and Xenopus revealed that the NT-4 sequences in these species have 11 amino acid replacements, compared with 9 and 8 replacements in NGF and BDNF, respectively. This suggests that in these species, NT-4 has diverged 20 with a rate that is comparable to, or faster than, the rate of NGF or BDNF divergence. in the NGF molecule do not abolish the biological activity, but in many cases these affect the amount of 25 protein produced, indicating that there are constraints other than the biological activity, such as protein stability, which may be important for the conservation of the NGF protein. In addition, the fact that all members of the NGF family can interact with the low 30 affinity NGF-R suggests that the complete conservation of certain regions in these factors may be due to constraints on these genes to retain proteins that can interact with the NGF-R. The basic mechanisms and strategies for the early ontogeny of the embryo are similar in all vertebrates and presumably involve genes Replacements of highly conserved amino acids 2 ?. A 10 57 that are conserved in all vertebrates. The evolutionary conservation of the neurotrophic factors is therefore consistent with the notion that they are important in early embryonic development in many different species. of NGF, BDNF, and NT-3, mRNA in the brain (Ernfors et al., 1990 J. Dev. Neurosci. S_, 57-66). It is a highly specialized structure derived from the archipallium, which first appeared in the brains of amphibians and 10 reptiles. The mammalian hippocampus is important for memory, learning and cognitive functions known to be associated with high neuronal plasticity (Crutcher and Collins, 1982, Science 277:67-68). These demands may have generated a selective pressure during phylogeny for 15 plasticity-promoting mechanisms, possibly medicated by neurotrophic factors. However, the results in this study clearly show that the duplication event of the genes for the neurotrophic factors preceded by far the formation of the hippocampus. This finding indicates 20 that the neurotrophic factors did not evolve as a consequence of the formation of the hippocampus and supports the notion that the neuronal plasticity in this brain region is at least in part due to these molecules.

The organization of the nervous system of 25 primitive vertebrates, i.e., cartilaginous fishes, shows some basic similarities to the nervous system of higher vertebrates. The cranial nerves and the somatic sensory and autonomic nervous systems in cartilaginous fishes are in general similar to those of higher vertebrates 30 (Young, J.Z., 1981, The Life of Vertebrates, New York Oxford University Press). It is therefore likely that the principles of neurotrophic interactions are the same in both primitive and higher vertebrates. The evolutionary conservation of the NGF-like neurotrophic factors also in primitive vertebrates suggests that "'TP J., .

The hippocampus contains the highest levels these factors first evolved in invertebrates and were later adapted to function in the development of the vertebrate nervous system.

Our study of the evolutionary conservation of g the NGF family led to the isolation of a novel member of this family, named neurotrophin-4 or NT-4, PCR fragments from the NT-4 gene were isolated from Xenopus and viper, and a genomic clone was subsequently isolated from Xenopus. Nucleotide sequence analysis of this clone 10 revealed an open reading frame for a 236 amino acid protein, which showed several structural features resembling those of- the three other members of the NGF family. These include the presence of a putative amino-terminal signal sequence and a potential N-glycosylation 15 site close to a proteolytic cleavage site that predicts a 123 amino acid mature NT-4 protein. The size of the mature NT-4 protein is 4 amino acids longer than that of BDNF and NT-3 and 5 amino acids longer than that the mature NGF protein. Within the mature NT-4 protein, all 20 6 cystein residues involved in the formation of disulphide bridges are conserved. The NT-4 protein differs from the other members of the family in the same regions that vary among the sequences of the three other family members. As for NGF, BDNF, and NT-3, the entire 25 prepro-NT-4 protein is encoded in one single exon.

Hence, both the gene organization and the structural features of the predicted protein indicate that the NT-4 gene is an additional member of the NGF family. The fact that the NT-4 gene was isolated from both reptiles 30 and amphibians suggests that it is present in several different species.

Both BDNF and NT-3 have been shown to interact with the low affinity NGF-R (Rodriguez-Tebar et al., 1990, Nueron 4.:487-492; Ernfors et al., 1990, Proc. 35 Natl. Acad. Sci. USA 87:5454-5458) . The Xenopiia^r.4 U 2 JU/v /9P2 ^ c i ? k 3 protein displaced ,M-NGF from its low affinity receptor on PC12 cells, indicating that the fourth member of this family can also interact with the low affinity NGF-R. The comparison of displacement curves obtained at 37°C 5and 0°C suggests that the NT-4 protein cannot compete for binding to the high affinity NGF-R. The protein encoded by the low affinity NGF-R gene appears to form part of both the low and the high affinity receptors (Hempstead et al., 1989, Science 243:373-375). The 10 mechanism by which two kinetically different receptors are formed from the same receptor gene is not known, although it has been proposed that the two states can be generated by the formation of a complex between the cytoplasmic domain of the receptor and an intracellular 15 protein (Radeke et al., 1987, Nature 325:593-597; Meakin and Shooter, 1991, Neuron j[:153-163). Alternatively, a high affinity receptor chain may be encoded by a separate gene and, similar to the interleukin-2 receptor (Hatakeyama et al., 1989, Science 744:55l-556) and the 20 platelet-derived growth factor receptor (Matsui et al., 1989, Science 243:800-804). the two receptor chains may form a dimer that constitutes the high affinity receptor. The fact that all four members of the NGF family can interact with the low affinity NGF-R suggests 25 that the low affinity state of the NGF-R may be, in an as yet unknown way, involved in mediating the biological effects of all these factors. In this context, it is interesting to note that the low affinity NGF-R gene has been shown to be expressed in many tissues of both 30 neuronal and nonneuronal origin not known to respond to NGF. These include mesenchyme, somites and neural tube cells in the early chick embryo (Hallbook et al., 1990, Development 108:693-704: Heuer et al., 1990a, Dev. Biol. 137:287-304; Heuer et al., 1990b, Neuron lj>:283-296) , as well as developing and regenerating spina.1 » P £ n' motorneurons (Ernfors et al., 1989, Neuron 2:1605-1613; Ernfors et al., 1991, J. Dev. Neurosci. 2:57-66). It would therefore be of interest to investigate whether the NT-4 protein is of functional importance in any of 5these tissues or neuronal populations.

The neurotrophic activity of the NT-4 protein was assayed on explanted chick embryonic ganglia, and as for the other three members of the NGF family, the NT-4 protein showed a clear stimulation of neurite outgrowth 10 from dorsal root ganglia. However, when compared to NGF, the NT-4 protein shoved lower activity in dorsal root ganglia. Both BDNF and NT-3 readily elicit neurite outgrowth in explanted nodose ganglia, though the response with NT-3 was consistently stronger than that 15 with BDNF. NGF strongly stimulates neurite outgrowth in sympathetic ganglia, and NT-3 also has activity in this ganglia, though it is much lower than that of NGF (Maisonpierre et al., 1990, Science 247:1446-1451: Ernfors et al., 1990, Proc. Natl. Acad. Sci. USA 20 £7:5454-5458). NT-4 showed weaker activity in nodose ganglia compared with NT-3 and no activity in the sympathetic ganglia. The spectrum of the biological activity of NT-4 on peripheral explanted ganglia resembles that of BDNF, which is in agreement with the 25 fact that NT-4 is structurally similar to BDNF.

Northern blot analysis of 11 different tissues from Xenopus showed high levels of NT-4 in the ovary) whereas the level of NT-4 mRNA was below the detection limit in all other tissues examined. Two NT-4 30 mRNAs of 2.3 kb and 6.0 kb were seen in the oocytes. The presence of two transcripts from the same gene has previously been observed for BNDF, in which case two mRNAs of 1.4 kb and 4.0 kb are present in the rat brain (Leibrock et al., 1989, Nature 341:149-152: Maisonpierre 2 4 2 8 1 3 1990a, Proc. Natl. Acad. Sci. USA 17:5454-5458). Hybridization to a Xenopus NGF probe revealed NGF mRNA in the Xenopus heart, most likely as a result of NGF mRNA expression in target tissues for neuronal 5 innervation. The level of NGF mRNA in the heart was, however, more than 100-fold lower than the level of NT-4 mRNA in the ovary. Since the high level of NT-4 mRNA in the ovary does not correlate with neuronal innervation, it appears unlikely that the NT-4 protein has only a 10 neurotrophic function in this case. Instead, the abundant expression of NT-4 mRNA in Xenopus ovary implies an additional and important nonneurotrophic function for the NT-4 protein. NGF mRNA was also detected in Xenopus ovary though at almost 100 times 15 lower levels than those of NT-4 mRNA; BDNF and NT-3 mRNAs were not detected in this tissue. mRNAs for two growth factors have been described as maternal mRNAs in Xenopus oocytes. One of these mRNAs encodes a protein with strong similarity to 20 basic fibroblast growth factor (Kimelman and Kirschner, 1987, Cell Si:869-877); the other mRNA encodes a protein homologous to transforming growth factor a (Weeks and Melton, 1987, Cell Si:861-867). These factors have been suggested to function as morphogens for the formation of 25 mesoderm and the subsequent induction of this tissue into the neural tube. In the rat, in situ hybridization studies have revealed NT-3 mRNA in the epithelium of secondary and tertiary follicles, and a role for NT-3 in oogenesis has been suggested (Ernfors et al., 1990, 30 Neuron 5:511-526). 2 4 28 1 3 7. EXAMPLE: IDENTIFICATION OF CELLS EXPRESSING NT-4 mRNA IN THE XENOPUS LAEVIS OVARY BY IN SITU HYBRIDIZATION 7.1. MATERIALS AND METHODS 7.1.1. ISOLATION, HANDLING AND CULTURE OF XENOPUS OOCYTES. EMBRYOS AND CELLS Male and female X. laevis frogs were maintained in the laboratory at 19°C. After immersion-anesthesia of the animals in 0.25% tricaine methane sulfonate (Sandoz, Switzerland), ovarian lobes were surgically removed, washed with modified Barth's saline Hepes (MBSH) (Gurdon and Wickens, 1983, Methods Enzymol, 101; 370-86)- and dissociated by overnight incubation at 20°C in calcium-free MBSH containing 2 mg/ml collagenase. crude separation of pre-vitellogenic and vitelloenic oocytes was obtained by differential sedimentation, and oocytes were further sorted manually under a dissecting microscope into the developmental classes described by Dumont (1972, supra). 2Q Synchronously cleaving embryos were obtained by in vitro fertilization essentially as described by Newport and Kirschner (1982).

^ Xenopus kidney cells were cultured in Leibowitz L,j medium diluted with distilled water 60:40 (v/v) and supplemented with 10 mM Hepes pH 7.35, 10 fM hypoxanthine (Sigma), 4 mM glutamine and 10% f«*al ^j#^T£/v, bovine serum (Gibco) at 20°C. Cultures were o^ equilibrated with air and kept in the dark. U& Zl t2j^ 7.1.2. IN SITU HYBRIDIZATION Fresh-frozen ovaries from adult Xenopus laevis frogs were sectioned (14 /i) in a cryostat (Leitz, Germany) and the sections were thawed onto poly-L-lysine (50 jig/ml) pretreated slides after which they were fixed in 10% formalin for 30 min and rinsed twice in PBS.

Dehydration was carried out in a graded series of 2 4 2 0 1 3 ethanol including a 5 min incubation in chloroform after which the slides were air dried. Two 53-mer oligonucleotides, one specific for Xenopus NT-4 mRNA (5•CCCACAAGCTTGTTGGCATCTATGGTCAGAGCCCTCACATAAGACTGTTTTGC 5 3' [SEQ ID NO:109]) and another one, as a control, specific for chicken BDNF mRNA (corresponding to amino acids 61 to 77 of the mature chicken BDNF protein (Hallbook et al., 1991, Neuron 6: 845-58 [contained within SEQ ID NOS.: 11 and 32]), were labeled at the 3* l0 end with a35S-dATP using terminal deoxyribonucleotidyl transferase (IBI, New Haven) to a specific activity of approximately lxlO9 cpm//x. Hybridization was performed at 42°c for 16 hours in 50% formamide, 4x SSC, lx Denhardts solution, 1% Sarcosyl, 0.02M NaP04 (pH 7.0), 15 10% dextransulphate, 0.5 mg/ml yeast tRNA, 0.06H DDT,0.l mg/ml sheared salmon sperm DNA and lxlO7 cpm/ml of 35S-labeled oligonucleotide probe. Sections were subsequently rinsed, washed 4 times (15 min. each) at 55°C in 1 x SSC, rinsed in water, dehydrated in a graded 20 series of ethanol and air-dried. The sections were exposed to X-ray film followed by coating in Kodak NTB-3 photo emulsion (diluted 1:1 in water), exposed for 5-6 weeks at -20°C, developed, fixed and counterstained with cresyl violet. 7.1.3 RNA BLOT ANALYSIS The indicated samples were homogenized in 4M guanidine isothiocyanate, 0.1M 0-mercaptoethanol, 0.025M sodium citrate pH 7.0 and homogenized 3 times for 15 30 seconds with a Polytrone. Each homogenate was layered over a 4ml cushion of 5.7M CsCl in 0.025M sodium citrate pH 5.5 and centrifuged at 15°C in a Beckman SW41 rotor at 35,000 rpm for 16 hrs. (Chirgwin et al., 1979, Biochemistry 2&: 5294-5299). Polyadenylated RNA (Poly(A)+ RNA) was purified by oligo (dT) cellu //V (L m2 JUft/992" 2 4 Z o - 64 chromatography (Aviv and Leder, 1972, PNAS £9: 1408-1412) and the recovery of RNA (40 ng) was quantified spectrophotometrically before use in RNA blot analysis. Total cellular RNA (40 fig) or where indicated 5 poly(A)+RNA (5 ng) from each sample was electrophoresed in a 1% agarose gel containing 0.7% formaldehyde. UV-transillumination of the stained gel was used to confirm that all samples contained similar amounts of intact RNA. The gel was then transferred to a nitrocellulose 10 filter. The filter was then hybridized to a 350bp HincII fragment from the 3• exon of the Xenopus NT-4 gene (Hallbook et al., 1991/ Neuron 845-858). The fragment was labeled with a-(32p)-dCTP by nick translation to a specific activity of around 5x10* cpm//xg 15 and the hybridization was carried out as described (Ernfors et al., 1988, Neuron A: 983-96). Filters were washed at high stringency (O.lxSSC, 0.1% SDS, 54®C) and exposed to Kodak AR-5 films at -70°C. 7.2 RESULTS laevis ovary were hybridized to a MS-dATP labeled oligonucleotide probe specific for Xenopus NT-4 mRNA. As a control for the specificity of the hybridization, 25 adjacent sections were hybridized to an oligonucleotide probe of the same length and GC-content complementary to mRNA for chicken brain-derived neurotrophic factor (BDNF). The NT-4 mRNA specific probe revealed an intense labeling over many cells scattered throughout 30 the ovary with a size (50-400 nm in diameter) corresponding to oocytes in early stages of oogenesis (Fig. 9A), No NT-4 mRNA could be detected over mature, post-vitellogenic stage VI oocytes (arrows in Fig. 9A).

The chicken BDNF mRNA specific control probe did not — label any cells in the Xenopus ovary.

Tissue sections through the adult Xenopus 2 4 2 0 1 J 65 Analysis of emulsion autoradiographs from the hybridized sections revealed an intense labeling over the cytoplasm of oocytes with a diameter of 50-200 tm (Fig. 10A and 10B) corresponding to stage I oocytes 5 according to Dumont, 1972, supra. The NT-4 mRNA specific probe also labeled oocytes with a larger diameter corresponding to stages II to IV, though the intensity of labeling over these cells was lower than that seen over stage I oocytes. In agreement with the 10 analysis of low magnification dark-field illuminations (Fig. 9), the emulsion autoradiographs did not show any labeling over more mature oocytes of stages V and VI. No labeling was seen over any cells after hybridization with the control BDNF probe (Fig. IOC). To enable a 15 more detailed determination of the level of NT-4 mRNA during oogenesis, the number of grains per an arbitrarily chosen area unit was counted. The area unit chosen corresponded to approximately one hundredth of the cross section area of a stage I oocyte. The result 20 of this analysis showed that the intensity of labeling over stage I oocytes was 1.7 and 4-3 times higher than over stage II/III and IV oocytes xaspectively (Fig. 11). The number of grains per area unit over stage V and VI oocytes was not significantly above the level of the 25 background labeling. 7.2.1 NORTHERN BLOT ANALYSIS OF NT-4 mRNA EXPRESSION DURING XENOPUS OOGENESIS AND EARLY DEVELOPMENT A fixed amount of total cellular RNA (40 ng) 30 prepared from different stages of oocytes as well as from a fraction enriched from follicle cells was analyzed by Northern blots using a Xenopus NT-4 specific probe (Hallbook et al., 1991 supra). In agreement with the results of the jja situ hybridization, the highest 35 levels of NT-4 transcripts with sizes of 2.3 kb and 6.0 kb was present in the smallest oocytes (stages &$) 2 JUN /9n o &m hi ly I w (Fig. 12). The level of NT-4 mRNA declined abruptly in more mature stage V and VI oocytes. A weak hybridization signal was seen in the follicle cell preparation which was probably due to a contamination 5with a small number of stage I and II oocytes. The same result was obtained when a fixed amount (5 M9) of polyadenylated RNA was analyzed from the difference samples shown in Fig. 12.

The results of the analysis of the NT-4 mRNA 10 expression in the ovary showed that NT-4 mRNA is restricted to immature oocytes. To test the possibility that expression of NT-4 mRNA is induced after fertilization, the level of NT-4 mRNA was assessed in developing Xenopus embryos by Northern blots of 15 polyadenylated RNA. A low level of NT-4 mRNA was found in Xenopus somatic A« cultured kidney cells which were also included in the analysis. However, no NT-4 mRNA could be detected in early embryos from the onset of cleavage divisions to the neurula stage. 7.3 DISCUSSION The abundant expression of NT-4 mRNA in the Xenopus ovary (Hallbook et al., 1991 supra) indicates that this member of the NGF family.plays a role in 25 oogenesis and/or early embryogenesis. Localization of cells expressing NT-4 mRNA in the ovary provided insights into the putative function of the NT-4 protein in the ovary. In amphibians, as in all other vertebrates, fertilization of the egg triggers a period of rapid cell 30 cleavage. This event is controlled by a class of soluble maternal mRNAs expressed during oogenesis and stored in the unfertilized egg for subsequent development (Davidson, 1986, Gene Activity in Early Development York, Academic Press). This class of maternal mRNAs includes two growth factors, basic fibroblast growth y vj 9 ?■ ' ? 1 3 L. -T u, I W factor (Kimelman and Kirschner, 1987, Cell, 5JL: 869-77) and transforming growth factor-/3 (Weeks and Melton, 1987, Cell, 51: 861-67), as well as several protooncogenes such as c-myc (Godeau et al., 1986, EMBO J., 5: 3571-77); (Vriz et al., 1989, EMBO J. &: 4091-97), c-fos (Mohun et al., 1989, Development, 107; 835-46), ras (Andeol et al., 1990, Dev. Biol., 139: 24-34), ets-2 (Chen et al., 1990, Science, 250: 1416-18) and c-mos (Sagata et al., 1988, Nature, 335: 519-25). Immature stage VI Xenopus oocytes are arrested in prophase of meiosis I and both c-mos (Sagata et al., 1988) and ets-2 (Chen et al., 1990) have been shown to function during reinitiation of meiotic division. The finding of high levels of NT-4 mRNA in stage I and II oocytes but a decreased level below the 15 detection limit of both Northern blots and in situ hybridization in stage V and VI oocytes strongly suggests that the NT-4 mRNA does not belong to the class of maternal mRNAs. This result also argues against a role of the NT-4 protein in the reinitiation of meiotic 20 division or in early embryogenesis. In agreement with this, addition of recombinant NT-4 protein to immature stage VI oocytes failed to induce germinal vesicle breakdown in vitro and no NT-4 mRNA was detected in Xenoous early embryos. Instead, the putative function of 25 the NT-4 protein in the ovary appears to be coupled to events occurring in the pre-vitellogenic and early mid vitellogenic oocyte. Both NGF (Ayer-LeLievre et al., 1988, PNAS 15: 2628-2632) the 75kD low-affinity NGF receptor (Persson et al., 1990, Science, 247: 704-707) 30 and the trkA high-affinity component of the NGF receptor (J.P. Merlo and H. Persson, unpublished) are expressed in the. testes where NGF has recently been shown to stimulate DNA synthesis at the onset of meiosis (Parvinen et al., 1991, submitted). Hence, it appears that the ^ ^ 35 neurotrophins do not only function as neurotrophic h \ "2 J(J/Vf992" id ^ l> o i v) factors but also play an important role in reproductive tissues. 8. EXAMPLE: ISOLATION AND CHARACTERIZATION OF NUCLEIC ACID FRAGMENTS ENCODING MAMMALIAN NT-4 8.1. MATERIAL? AND METHQPS 8.1.1. DNA PREPARATION Genomic DNA was isolated as described in 6.1.1, gqps-3. 8.1.2. POLYMERASE CHAIN REACTIONS, MOLECULAR CLONING AND DNA SEQUENCING Mixtures of 34-mer oligonucleotides (including tail) representing all possible codons corresponding to the amino acid sequences QYFFET (contained within SEQ ID NO:51) and QYFYET (SEQ ID NO:52) (5«-oligonucleotide) and, WISECK, CKAKQS and WIRIDT (each contained within SEQ ID NO:51) (3'-oligonucleotide) (Fig. 13) were 2Q synthesized, with linkers, as described in 6.1.2., supra. Together, 2Y (derived from xNT-4 [SEQ ID N0:50]) and 2Z (derived from BDNF/NT-3 [SEQ ID NO:51]) represent all known sequence for neurotrophins from all species in this region. A primary amplification of both rat and human 25 genomic DNA was carried out with Taq polymerase (Cetus) with cycles of 1 minute at 95°C, 2 minutes at 43°c and 2 minutes at 72°C. An aliquot from the primary PCR reactions was then reamplified using either the same primers as in the primary amplification or with new 30 nested degenerate oligonucleotide primers which would result in an expected size shift. PCR products from the reamplification procedure were purified as follows: bands of prospective size were gel purified, reamplified, and column purified using Stratagene "primerase" columns. 35 These were then digested to completion with EcoRI and Sail, analyzed and re-purified using Primerase co i £ A/ ^ /? I*! 4 k '-m2 \t r 2 k 2 G 1 3 (Stratagene) and ligated into EcoRI-Xhol digested Bluescript KS(-). Transformants were screened for pBS-KS containing an insert of the approximate predicted size. The cloned fragments were subjected to DNA sequence 5analysis as described in 6.1.2, supra. 8.1.3 ISOLATION OF FULL LENGTH GENOMIC AND CDNA CLONES ENCODING rNT-4 and hNT-4 A human ovary cDNA library in XGT-10 was 10 obtained from Clontech. A human hippocampus cDNA library in a:ZAPII was obtained from Stratagene. A human genomic DNA library in EMBL3/SP6/T7 was obtained from Clontech.

A rat brain cDNA library in X-ZAP was obtained from Stratagene.

Isolation of NT-4 clones can be carried out as follows: A cloned insert encoding the rNT-4 fragment (Fig. 14 [SEQ ID NO:61]) or the hNT-4 fragment (Fig. 15 [SEQ ID NO:63]) are labeled by PCR to a specific activity 20 of approximately 5x10s cpm/ng. Hybridization is carried out in hybridization solution consisting of 0.5 mg/ml salmon sperm DNA at 60°C. The filters are washed at 60°C in 2 x SSC, 0.1 % SDS and exposed to Kodak XAR-5 film at -70°C. Alternatively, oligonucleotides whose sequence 25 corresponds exactly to the desired mammalian neurotrophin can be used to generate probes (e. g. kinase labelling) and can be used to screen the same libraries by conventional methods. Positive phage are plaque purified and infected at low multiplicity in an appropriate 30 £. coli strain in liquid broth as described by Maniatis, et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). GT-10 and EMBL3/SP6/T7 phage are prepared as follows: Cultures are incubated overnight at 37° with constant rTT/v""^.

* "St 4,\ shaking. The overnight suspension is brought to ll^^aci \ f£' \ 2 4 2 3 1 3 70 and 8% PEG, mixed well and incubated overnight at 4°C to precipitate the bacteriophage. The bacteriophage are pelleted via centrifucation, resuspended in TM buffer (lOmM Tris-HCl, pH 7.5; lOmM MgCl2) , layered upon a CsCl 5 step gradient and centrifuged at appropriate speed and length of time to band the bacteriophage. The bacteriophage are removed, transferred to a fresh Eppendorf tube and lysed by the addition of 1 volume of formamide. EMBL-3 ONA is precipitated by the addition of 10 2 volumes of 100% ethanol. The EMBL-3 DNA is recovered by microcentrifugation, washed in 70% ethanol and resuspended in TE buffer (lOmM Tris-HCl, pH 7.5; ImM Na2-EDTA). The DNA is extracted several times with phenol:chloroform:isorayl alcohol (24:24:1), ethanol 15 precipitated, resuspended in TE buffer, digested with various restriction enzymes and electrophoresed through a 1% agarose gel. Subsequent to electrophoresis, the restricted DNA is transferred to nitrocellulose and hybridized to the ^P-labelled rNT-4 or hNT-4 probe, under 20 conditions described supra. The hybridizing band is subcloned into pBS-KS plasmid vector and subjected to DNA sequence analysis by the dideoxy chain termination method (Sanger, et al., 1977, Proc. Natl. Acad. Sci. U.S.A. 74: 5463-5467). follows: 200\ of ODmo^I.O XLl-Blue cells, 200X of the hi-titer phase stock, and lX of R408 helper phage (1x10 minutes pfu/ml) are combined. For a negative control, add no phage stock. Incubate 15 minutes at 37°C. Add 5 30 ml of 2XYT media, shake for 3 hours at 37°C. At the end of the 3 hours, the negative control should be cloudy and the samples clear. Samples are heated at 65°C for 30 minutes, spun at 4000g for 5 minutes. Supernatant contains phagemid stock. To rescue the phagemid, add The X-ZAP plasmid preparations are peformed as 0.5X of the stock to 200 of XLl-Blue cells V J(Jfr \ycj2 ■ 2 J 1 3 Incubate 37°C for 15 minutes. Plate 1-IOOX (preferably 10X) on LB ampicillin plates. Incubate 37#c x overnight and large colonies are picked. After plasmid DNA is purified, it is sequenced as above.

Lambda phage cDNA libraries are screened according to standard methods (Maniatis, et al., supra1 c,s described supra.

Positive plaques are purified, reisolated and subjected to DNA sequence analysis as described supra. 8.2. RESULTS AND PI?cys?lQN A region of the Xenopus NT-4 coding sequence was used as a model for synthesis of degenerate oligonucleotide primers. Figure 13 denotes that the 15 5'-oligonucleotide primer 2Y [SEQ ID NO:53] (QYFFET) and 3•-oligonucleotide primers, 3Y [SEQ ID NO:55] (WISECK), 3Z [SEQ ID NO:56] (CKAKQS) and 4Z [SEQ ID NO:58] (WIRIDT) were derived from the xNT-4 amino acid sequence. The 5•-oligonucleotide primer 2Z [SEQ ID NO:54] (QYFYET) is 20 derived from the homologous region of rBDNF. All possible combinations of these degenerate oligonucleotides were utilized to amplify DNA from both rat and human genomic DNA libraries. Since the primers represented by 3Y [SEQ ID NO:55] and 3Z [SEQ ID NO:56] of 25 xNT-4 are not conserved in the NGF/BDNF/NT-3 gene family, and therefore were not likely to amplify NGF, BDNF or NT-3, these two primers were utilized in the reamplification, or secondary PCR.

DNA fragments of the approximate expected 30 sizes were obtained from PCR amplification and reamplification of both the rat and human genomic libraries when the following primer combinations were utilized: (1) 2Y/3Z (primary PCR): 2Y, 2Z/3Y (secondary PCS) (2) 2Y/3Z (primary PCR): 2Y, 2Z/32 (secondary PC£$^E^\ o •V / // t V fc.V (3) 2Y/4Z (primary PCR): 2Y, 2Z/32 (secondary PCR) (4) 2Z/4Z (primary PCR): 2Y, 2Z/3Z (secondary PCR) The secondary PCR products of the approximate 5 expected size were electrophoresed through a 2% agarose gel, eluted by standard techniques, digested with EcoRI and Sail and ligated in EcoRI-XhoI digested pBS-KS DNA. Positive transformants were selected, and inserted fragments were subjected to DNA sequencing by the dideoxy 10 chain termination method (Sanger, et al., supra).

An open reading frame has been deduced for a portion of the rat NT-4 (Fig. 14 [SEQ ID NO:62]) and human NT-4 (Fig. 15 [SEQ ID NO:64]) amino acid coding sequence. Figure 16 illustrates the homologous region of 15 the rNT-4 (SEQ ID NO:62) and hNT-4 (SEQ ID NO:64) fragment to representative members of the NGF/BDNF/NT-3 gene family.

An open reading frame encoding a larger portion of human NT-4 than that disclosed in Figure 15 is 20 shown in Figure 17A (SEQ ID NO:69 and SEQ ID N0:70). Figure 17A presents additional 31 sequence information for ths 3' human NT-4 coding region. The 192 bp nucleic acid fragment was isolated as described supra in the Description of the Figures.

The actual size of the PCR products recovered from the reamplification procedure was larger than predicted due to the additional 7 amino acids in the rat NT-4 (GPGVGGG) [SEQ ID No:101] and human NT-4 (GPGAGGG) [SEQ ID NO:102] DNA fragment.

The 7 amino acid insertions of rNT-4 and hNT-4 are described as 'GPGXGGG* [SEQ ID NO:100], where X»V for rNT-4 and X»A for hNT-4. Valine and alanine possess nonpolar R group. Whether position four is conserved to contain a nonpolar R group at position 4 in other mammalian NT-4 proteins is not presently known, nor^ 2JUN 2 422 13 73 whether the 7bp insertion itself will be characteristic of other mammalian NT-4 genes. It is interesting to note that fish NGF has a 22 amino acid insertion in the same region as disclosed in the present invention. library in EMBL3 SP6/T7 (Clontech, K802 as host). A total of 1.25 x 106 pfu were plated on large NZY plates.

Duplicate lifts were made using Schleicher & Schuell nitrocellulose filters, and were hybridized to a 120 bp probe (from hNT-4 clone 17B, which was obtained from human genomic DNA using primers 2Z4Z followed by 2Z3Z), labelled by PCR using oligonucleotide primers 2Z/3Z. The filters were hybridized at 60°C with the radiolabelled probe (106 cpm/ ml) under the following hybridization conditions: 0.5 M NaP04, 1% BSA, 7% SDS, 1 mM EDTA, and 100 fjtg/ml salmon sperm DNA. The filters were then washed 2q at 60°C with 2xSSC and 0.1% SDS, and subjected to autoradiography. Following four days of exposure, positive signals were identified on the duplicate lifts. A total of seven plugs were picked, put into 1 ml SM buffer, shaken for 2 hr, and replated as follows: 1) 100 25 Ml of 10~3 dilution (1 Ml in 1 ml) , mixed with 100 Ml cells, and plated; an almost confluent plate was obtained; 2) 200 pi of 10's dilution, which gave isolated plagues. Duplicate lifts were made, and screened as described above with the hNT-4 120 bp probe. Following a 30 2 day exposure, many positives were identified on the confluent plate for plugs HG2, 4, and 7. A well-isolated positive was identified on both HG4-2 and HG7-2 plates. A single plaque for HG4-2 and HG7-2 was picked, put into 500 nl of SM buffer, and shaken for 2 hr, following which 35 ioo Ml of eluant was mixed with 100 pi cells and plated. 9. EXAMPLE: ISOLATION AND CHARACTERIZATION OF AN NT-4 HUMAN GENOMIC CLONE We have screened a human placenta genomic 2 4 2 3 1 3 The plate was then flooded with 3 ml SM buffer, and supernatant collected as the first high titer stock.

Three plates were then plated using 100 ix 1 of this first stock nixed with 100 cells. The plates were flooded 5 with 3 ml SM and shaken on rotator for 3 hr at room temperature. Supernatant was removed, spun to remove debris, following which chloroform was added, and this use: as the second high titer stock. Two nl of KG4-2 and HG7-2 high titer stock was spotted onto Schleicher & 1C Schuell nitrocellulose filter, and was found to hybridize to the rNT-4 180 bp probe [isolated from the plasmid containing an insert obtained by PCR from rat genomic DNA using primers designed based on our rat NT-4 clone sequence coding for the amino acid GELSVCD (SEQ ID 15 NO:112) (degenerate primer) and KAESAG (SEQ ID NO:113) (exact primer)]. Plate lysates and liquid lysates were prepared for HG4-2, HG7-2 and HG2-1. Phage DNA was made, an aliquot of which was run on agarose gel and subjected to Southern analysis. HG4-2, HG7-2 and HG2-1 were found 20 to hybridize to the rNT-4 180 bp probe (NaP04 hybridization as above, 65°C), and a 45mer oligonucleotide probe (GGAGGGGGCTGCCGGGGAGTGGACAGGAGGCACTGGGTATCTGAG) [SEQ ID NO:114] corresponding to amino acid GGGCRGVDRRHWVSE [SEQ 25 ID NO:115] coded for by human PCR fragment clone 17B (6xSSCt 45°C hybridization). The size of the insert for these three genomic clones is approximately 9-23 kb.

They both contain the coding exon of the gene(s) that is closely related to the probes used for the screening, 30 hNT4 (120 bp) and rNT4 (180 bp). The phage DNA for the genomic clones was digested with several restriction enzymes and subjected to Southern analysis. The appropriate fragment that hybridizes to the probe rNT4 (180 bp) can be subcloned into Bluescript vector. The size of DNA fragments to be subcloned are as follows: 2 4 28 1 75 clone 2-1 (1.0 kb Xhol fragment), clone 4-2 (4.0 kb Xhol fragment) and clone 7-2 (5.0 kb BamHI fragment).

Complete coding sequence can be obtained and this information can be used to identify the exon boundaries 5 to allow subcloning of this gene into an appropriate expression vector. performed on human genomic phage clone 7-2, which had been obtained by screening a human genomic library with a 10 PCR fragment derived from human genomic DNA using Xenopus NT-4 (see discussion, supra). Sequence analysis revealed that human phage clone 7-2 contains a sequence identical to the sequence of the PCR fragment used as a 15 probe to screen the genomic library. This sequence is contained within what appears to be an exon encoding a novel neurotrophic factor (Figure 18, SEQ ID NO:75 and SEQ ID NO:76).

(Figure 19, SEQ ID NC:77) with the known neurotrophins revealed that it shares features found in all the known neurotrophins (Figure 19, SEQ ID NOS:78-92). It contains a prepro region in which are conserved many of the identical amino acids conserved between the prepro 25 regions of previously defined neurotrophins.

Furthermore, this prepro region is preceded by a splice acceptor site localized in the same region as in other neurotrophin genes. The prepro region also contains a consensus glycosylation site at the appropriate position, 30 and terminates at a cleavage site which was very similar t2 the cleavage sites found in the other neurotrophins (Figure 18). The prepro region of 7-2 is unusual, however, due to its short length as compared to the prepro region of known neurotrophins. The decrease in . . length occurs in the N-termmal portion of the prepro To this end, nucleotide sequence analysis was degenerate oligonucleotides to the DNA sequence of Alignment of the protein encoded by this exon 2 /: :.1 1 3 region, which is the least conserved portion of prepros between family members. The mature region retains all 6 cysteines found in all previously identified neurotrophins. Many of the residues shared between 5 different members of the neurotrophin family are also conserved. Excluding the extensive sequence similarity shared by a PCR fragment derived from rat genomic DNA which may correspond to the rat equivalent of the protein encoded by the human 7-2 clone, computer alignments 10 revealed that the neurotrophin encoded by the 7-2 phage clone was most similar to that of Xenopus NT-4. This was true for both the prepro and mature regions. The protein encoded by the 7-2 clone is unusual, as compared to the known neurotrophins, due to the presence of an insertion 15 situated between the second and third cysteines in the mature region. additional human clones isolated in the same greening procedure that yielded clone 7-2 (see discussion, supra). 20 The sequence of these clones was similar to, but not identical to, that obtained from clone 7-2, raising the possibility that they encode novel neurotrophins more closely related to 7-2 than to the other known neurotrophins. The partial sequence of one of these 25 clones, clone 2-1, is presented in Figure 20 (SEQ ID HO:93 and SEQ ID NO:94). The sequence disclosed starts at a position corresponding to amino acid number 50 in the alignments depicted in Figure 19. Pa:, ^ial sequence of the other clone, clone 4-2, is presented in Figure 21 30 (SEQ ID NO:116 and SEQ ID NO:117).

. EXAMPLE: TISSUE SPECIFIC EXPRESSION OF HUMAN NT-4 A 680 bp Xhol-Notl fragment, containing the entire coding region of the human genomic NT-4 clone, HG7-2, was radiolabeled and utilized in Northern analysis Sequence analysis was also perform < d on two 2 4 4. H 1 3 of various hvunan tissue specific PolyA+ RNAs. The human tissue specific mRNAs were fractionated by electrophoresis through a 1% agarose-fcrmaldehyde gel followed by capillary transfer to a nylon membrane with 510X SSC. The RNAs were cross-linked to the membranes by exposure to ultraviolet light and hybridized at 65°C to the 680 bp Xhol-Notl radiolabeled NT-4 probe in the presence of 0.5M NaP04 (pH 7), 1% bovine serum albumin (Fraction V, Sigma), 7% SDS, l mM EDTA and 100 ng/ml 10 sonicated, denatured salmon sperm DNA. The filter was washed at 65°C with 2X SSC, 0.1* SDS and subjected to autoradiography overnight with one intensifying screen and X-ray film at -70°C. Ethidium bromide staining of the gel demonstrated that equivalent levels of total RNA 15 were being assayed for the different samples.

The human NT-4 probe hybridized strongly to mRNA from skeletal muscle, prostate, thymus, testes and placenta (Figure 22). The NT-4 probe hybridized to a larger transcript in skeletal muscle than prostate mRNA.

This data suggests that a small human NT-4 multigene family, possessing different expression levels as well as transcript sizes, may be present.

The high expression of human NT-4 in muscle tissue suggests that the present invention may be 25 utilized to treat disorders of the nervous system, specifically the wide array of neurological disorders affecting motor neurons (see discussion, supra).

Additionally, high expression of human NT-4 in prostate tissue suggests that the present invention may be 30 utilized to treat prostate disease, preferably BPH and impotency (see discussion, supra). Finally, expression of human NT-4 in thymus tissue suggests that the present invention may be utilized to treat immunological related disorders of nerve and muscle tissue, including but not o /. ^ ^ X L h K-J HO 78 - 11. EXAMPLE: CONSTRUCTION OF HUMAN NT-4 IN EUKARYOTIC EXPRESSION VECTORS AND THE MEASUREMENT OF BIOLOGICAL ACTIVITY OF RECOMBINANT HUMAN NT-4 11.1 MATERIALS ANP METHODS 11.1.1. CONSTRUCTION OF EUKARYOTIC EXPRESSION VECTORS ENCQPINg HUMAN NT-4 Two eukaryotic expression vectors containing the prepro precursor coding region of the human genomic clone HG7-2 were constructed in pCMX (NRRL Accession No. 10 B-18790). The first construction utilized the normal translation initiation site of pCMX (pCMX-HG7-2Q), while the other utilized the Kozak consensus translation initiation site (pCMX-HG7-2M). A 5 kb genomic fragment of HG7-2, containing the entire coding region cloned in the BamHI site of Bluescript, was amplified by PCR utilizing the following oligonucleotides: hNT4-5•XhoM:CGGTACCCTCGAGCCACCATGCTCCCTCTCCCCTCA [SEQ ID NO:118] hNT4-3 ' Not: CGGTACAAGCGGCCGCTTCTTGGGCATGGGTCTCAG [SEQ ID NO:119] hNT4-5 • XhoQ: CGGTACCCTCGAGCCACCCAGGTGCTCCGAGAGATG [SEQ ID NO:120] Oligonucleotide primer combinations of hNT4-5'XhoM and 25 hNT4-3•Not were used to construct pcMX-HG7-2M, while oligos hNT4-5*XhoQ and hNT4-3*Not were used to construct pCMX-HG7-2Q. The PCR fragment was digested with Xhol/Notl and subcloned into Xhol/Notl digested pCMX. 11.1.2. CONSTRUCTION OF CHIMERIC GENES FUSING A NEUROTROPHIN PREPRO REGION TO THE MATURE CQPINQ FfiglQN OF BPMAN NT-4 Two additional eukaryotic expression vectors encoding the mature portion of human NT-4 were 35 constructed. First, the prepro region of human NT-4 was replaced with the prepro region of Xenopus NT-4 // o ' (pCMX-xNT4/hNT4). Second, the prepro region of human NT-4 was replaced with the prepro region of human NT-3 (pCMX-hNT3/hNT4). The following oligonucleotides were utilized in the construction of pCMX-xNT4/hNT4 and 5pCMX-hNT3/hNT4: (1) 5'CDM8: GAGACCGGAAGCTTCTAGAGATC [SEQ ID NO:121] (2) hNT3/hNT4 fusion ("US" oligonucleotide): TGCAGTTTCGCTCACCCCCCGTTTCCGCCGTGATGT [SEQ ID NO:122] (3) hNT3/hNT4 fusion ("DS" oligonucleotide): ACATCACGGCGGAAACGGGGGGTGAGCGAAACTGCA [SEQ ID NO:123] (4) xNT4/hNT3 fusion ("DS" oligonucleotide): ACTTCCCGGCTAAAACGGGGGGTGAGCGAAACTGCA [SEQ ID NO:124] (5) xNT4/hNT4 fusion ("US" oligonucleotide): TGCAGTTTCGCrCACCCCCCGTTTTAGCCGGGAAGT [SEQ ID NO: 109] was amplified by PCR with the S'CDMS and hNT3/hNT4 fusion oligonucleotides as primers. The hNT-4 containing 20 plasmid (pCMX-HG7-2Q) was amplified by PCR with the hNT3/hNT4 fusion "DS" oligonucleotide and the hNT4-3'Notl oligonucleotide. The PCR fragment obtained was excised from the gel, and reamplified by PCR with the 5'CDM8 and hNT4-3'Notl oligonucleotides. The product was then 25 digested with Hindlll and Pstl and subcloned into Hindlll/Pstl digested pCMX-HG7-2Q. Therefore, the expression plasmid pCMX-hNT3/hNT4 contained the hNT3 prepro region fused to the mature coding region of human NT-4. Similarly, the human NT-4 expression plasmid 30 (pCMX-HG7-2Q) was amplified by PCR with the 5'CDM8 and xNT4/hNT4/fusion "US" oligonucleotides as primers, while PCMX-HG7-2Q was amplified with the xNT4/hNT4- fusion "DS" oligonucleotide and the hNT4-3'Notl oligonucleotide. The PCR fragment was excised from the gel, and reamplified with the 51CDM8 and the hNT4-3'Not oligonucleotides. The_ The hNT-3 containing plasmid vector (pC8-hNT3) Z 4 'i o 1 3 product was then digested with Hindlll and Pstl and subcloned into Hindlll/Pstl digested pCMX-HG7-2Q. Therefore, the resulting eukaryotic expression plasmid, pCMX-xNT4/hNT4 contains the Xenopus NT-4 prepro region 5 fused to the mature coding region of human NT-4. 11.1.3. EXPRESSION OF RECOMBINANT HVMAN NT-4 IN CQS CELLS COS M5 cells were set up at a density of 1.5 x 103 cells/well of a Costar 6 well dish in DMEM media supplemented with 10% FBS, glutamine and Na pyruvate (all from Irvine Scientific except FBS). refed with 2 ml/well of RPMI media containing 400 M9/nl DEAE-Dextran (Pharmacia) , 400 fiH chloroquine (Sigma), 4 mM glutamine (Irvine), 1 x ITS (insulin, transferrin, selenium, Sigma). To each well 2 ng of the appropriate DNA was added and mixed by swirling. Three separate constructs were used: pi~MX-xNT4, containing the prepro 2Q precursor of Xenopus NT-4; and two human NT-4 constructions, pCMX-HG7-2M and pCMX-HG7-2Q. After the addition of the DNA the plates were returned to 37°C, 5% C02 incubator for 3 hours 15 minutes. The media/DNA mixture was then aspirated and 2 ml/well of 10% DMSO in 2g PBS without Ca2+, Mg2+ was added for 2 minutes. The DMSO/PBS was aspirated and wells washed once with 10% FBS DMEM, then refed with 10% FBS DMEM. The next morning, plates to be bioassayed were washed once with Defined Media (DM) and refed 2 ml/well of DM. Three days post-30 transfection, supernatants were removed from cells and debris pelleted by microcentrifugation. Supernatants were transferred to fresh tubes and assayed for bioactivity.

The next day the cells were aspirated and Z 4 L b \ 11.1.4. PREPARATION OF ENRICHED MOTOR NEURON CULTURES Embryos (E14) from Sprague-Dawley rats (HSD or Zivic-Miller) were used for all experiments. Pregnant 5rats were sacrificed by carbon dioxide asphyxiation, and embryos were rapidly removed and placed in ice-cold medium for further dissection. Spinal cords were removed aseptically from rat embryos of 14 days gestation. The spinal cord was severed caudal to the bulb (at the level 10 of the first dorsal root ganglion), freed of sensory ganglia and adhering meninges. The cord was then subdivided into ventral and mediodorsal segments for separate cultures. The ventral spinal cord tissues were diced into small pieces and incubated in 0.1% trypsin 15 (GIBCO) and 0.01% deoxyribonuclease type 1 (Sigma) in PBS at 37°C for 20 minutes. Trypsin solution was then removed, rinsed and replaced with medium consisting of 45% Eagle*s minimum essential medium (MEM), 45% Ham's nutrient mixture F12 (F12), 5% heat inactivated fetal 20 calf serum (GIBCO), 5% heat inactivated horse serum (GIBCO), glutamine (2 mM), penicillin G (0.5 U/ml), and streptomycin (0.5 M9/ml). The tissue was then mechanically dissociated by gentle trituration through a Pasteur pipet, and the supernatants were pooled and 25 filtered through a nylon fiber (Nitex, Tetko; 40 nm). The filtered cell suspension were then subjected to a modification of the fraction procedure described by Schnaar and Schaffner (1981, J. Neurosci, .1:204-227). All steps were carried out at 4°C. Metrizamide was 30 dissolved in F12:MEM (1:1) medium, and a discontinuous gradient was established which consisted of a 18% metrizamide cushion (0.5 ml), 3 ml of 17% metrizamide, 3 ml of 12% metrizamide, and 3 ml of a 8% metrizamide was prepared. The filtered ventral spinal cord cell suspension (2.5 ml) obtained as described above was 2 4 2 8 1 3 layered over the step gradient, the tube was centrifuged at 2500 x g for 15 minutes using a swing-out rotor (Sorvall HB4). Centrifugation resulted in three layers of cells: fraction I (at 0-8% interface), fraction II (at 58-12% interface), and fraction III (at 12-17% interface). The cells from each interface were removed in a small volume (about l ml), rinsed twice with serum-free defined medium consisting of 50% F12 and 50% MEM, supplemented with glutamine (2 mM), insulin (5 ng/ml), transferrin 10 (100 Mg/ml), progesterone (20 nM), putrescine (100 mM), and sodium selenite (30 nM) (Bottenstein and Sato, 1979, Proc. Natl. Acad. Sci. 2£*514-517). Viable cell count was obtained by hemocytometer counting in the presence of trypan blue. Fractionated ventral spinal cord cells 15 (enriched with motor neurons) were then plated at a density of 100,000 cells/cm2 in 6 mm wells precoated with poly-L-ornithine (Sigma: 10 M9/ml) and laminin (GIBCO: 10 ng/ml). Treatment with COS cell supernatants containing NT-4 was COS cell was given on the day of 20 plating. Cultures were maintained in serum-free defined medium at 37 °C in 95% air/ 5% C02 atmosphere at nearly 100% relative humidity. On day 2 (48 hours), cells were harvested for measurements of choline acetyltransferase (CAT) as described in Fonnum, 1975, J. Neurochem. 24:407-25 409. 11.2 RESULTS 11.2.1. EUKARYOTIC EXPRESSION OF BIOLOGICALLY ACTIVE REC0MBINANAT 30 HVMftff NT-4 Plasmid DNA from each of the pCMX-based constructions (pCMX-HG7-2Q, PCMX-HG7-2M, pCMX-hNT3/hNT4 and pCMX-xNT4/hNT4) was prepared and individually transfected into COS cells. COS supernatants from each 35 transfected cell line were utilized in order to assess the biological activity of each respective recombj|na: IkZ3 13 form of NT-4. The volumes of COS supernatants tested were 10, 50 and 250 nl in a total volume of 2 ml. Q1 (pCMX-HG7-2Q), N7 (pCMX-hNT3/hNT4 fusion), and XI (pCMX-xNT4/hNT4) possessed neurite-promoting activity on ORG 5 explants (Figure 23). In addition, both Q (pCMX-HG7-2Q) and M (pCMX-HG7-2M) were examined for their survival-promoting activity on DRG dissociated cells. Volumes tested were 5-250 Ml in a total volume of 2 ml. When added to cultures of dissociated DRG neurons, COS 10 supernatant containing hNT4 promoted 30% neuronal survival compared to 10% survival with mock transfected COS supernatants (Figure 24).

The biological effect of human recombinant protein from supernatants of COS cells transfected with 15 pCMX-HG7-2M was tested on motor neuron enriched cultures prepared as described supra in Example Section 11.1.4. Treatment of motor neuron enriched cultures with pCMX-HG7-2M derived human NT-4 diluted to 1:5 resulted in a 2.9 fold increase in choline acetyltransferase (CAT) 20 activity after 48 hours as compared to untreated (C-NT) and mock transfected (MOC COS) controls (Figure 25). The increase in CAT activity dropped to 1.7 fold when a 1:50 dilution was tested, suggesting that it was a dose dependent response (Figure 25). 11.3 PlgCVSSIQE The present invention provides for the utilization of an In vitro eukaryotic expression system to express recombinant human NT-4. The present invention 30 discloses several strategies to express a biologically active form of recombinant human NT-4 in COS cells, in one example, the DNA sequence encoding NT-4 prepro precursor was amplified utilizing two PCR amplification strategies to yield pCMX-based expression plasmids containing either the pCMX translation initiation site , , 84 Ik l a i 3 (pCMX-HG7-2M) or a Kozak consensus translation site (pCMX-HG7-2Q). In another example, two chimeric neurotrophin genes fusing either the prepro region of Xenopus NT-4 (pCMX~xNT4/hNT4) or the prepro region of 5human NT-3 (pCMX-hNT3/hNT4) to the mature coding region of NT-4 were constructed for expression in COS cells (see Section 5, supra. for a discussion of the use of chimeric constructions to express NT-4 in vitro). human NT-4 in an in vitro eukaryotic expression system substantially increases the ease at which the production of human recombinant HT-4, peptides or derivatives thereof may be scaled up for both therapeutic and diagnostic applications discussed supra. in view of the 15 instant invention, one of ordinary skill in the art can readily construct a plasmid containing an identical DNA sequence as disclosed or a similar DNA sequence encoding a homologous yet distinct NT-4 like protein or derivative thereof. The skilled artisan can also pick and choose 20 between numerous DNA plasmid vectors known in the art to construct an expression plasmid for use in a eukaryotic expression system. He have demonstrated that recombinant human NT-4, whether produced as a full prepro precursor or via a neurotrophin-based chimeric construction, is 25 biologically active as demonstrated by the stimulating effect of recombinant NT-4 COS supernatants on neurite outgrowth in DRG explants and the bioactivity of cultured motor • neurons.

Expression of a biologically active form of * ? f v * / 1 k 3 12. EXAMPLE: TRKB IS A RECEPTOR FOR NEUROTROPHIN-4 ^ COS cell supernatants were also examined in a survival assay utilizing 3T3 fibroblasts. In this assay system, 3T3 fibroblasts, which do not express 5 neurotrophin receptor proteins, are transfected with mammalian expression vectors encoding either trkA or trkB. 3T3 fibroblast survival is dependent on the addition and receptor specific binding of the respective neurotrophic factor.

COS—M5 cells were cultured and transfected with either pCMX-HG7-2Q, pCMX-HG7-2M or pCMX-HG7-2Q as described in Example Section 11.1.3.

A full-length rat trkA cDNA clone was obtained from Dr. Eric Shooter of Stanford University. The rat 15 trkA cDNA was subcloned into the mammalian expression vector, pCMX, to generate pCMX-trkA.

A full-length rat trkB cDNA clone was obtained by screening a rat brain cDNA library in the lambda ZAP2 vector (Stratagene) with rat trkB-specific 20 oligonucleotides corresponding to the most 5' and 3' coding regions of trkB. The rat trkB cDNA was subcloned into pCMX to generate pCMX-trkB. 3T3 fibroblasts were cultured and tranisfected as described in Glass, et al., 1991.. Cell 66:405-413. 25 In this survival assay system, 3T3 fibroblasts, which do not express neurotrophin receptor proteins, have been transfected with trkA, a proto-oncogene encoding a tyrosine kinase receptor for NGF, or with trkB, a tyrosine kinase which serves as a functional 30 binding protein for BDNF and NT-3. The transfected cells are dependent upon the addition of the corresponding neurotrophin for survival, and thus may be used to assay for biological activity of neurotrophins. Addition of NT-4 containing COS cell supernatants in this bioassay indicated that viable cells remain after 48 hours only in X" /v [ai JU/V/992 / 3T3 trkB cultures (Table 2). Thus, these results demonstrate that NT-4 protein has biological activity in this system, and suggests that trkB, but not trkA, serves as a functional binding protein for NT-4. 2 423 TEPEE 2 Assay of COS Supernatants on 3T3 Cell Lines Expressing TrkA and TrkB Dilutions Mock HG7- HQ 7- taMT3/ 2Q 2M hHT4 1:5 1:10 3T3 1:20 1:50 1:5 1:10 3T3-trkA 1:20 1:50 1:5 + + + 1:10 - + + + 3T3-trkB 1:20 - + 1:50 + E/V> * July/992 .ft r f= . c r> 13. DEPOSIT OF MICROORGANISMS The following recombinant bacteriophage, containing a human genomic sequence related to neurotrophin-4, were deposited on August 22, 1991 (HG4-2 5 and HG7-2) and September 11, 1991 (HG2-1) with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852, and assigned the indicated accession number. Additionally, the chimeric gene construction, pCMX-hNT3/hNT4, wa.s deposited on 10 October 30, 1991 with the American Type culture Collection and assigned the indicated accession number.

PfrgteriQPhaqe ATCC Accession Number HG4-2 75069 HG7-2 75070 HG2-1 75098 pCMX-hNT3/hNT4 75133 The present invention is not to be limited in scope by the deposited microorganisms or the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within 25 the scope of the appended claims.

Various publications have been cited herein which are incorporated by reference in their entireties.

C SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: Ip and Yancopoulos (ii) TITLE OF INVENTION: Neurotrophin-4 (iii) NUMBER OF SEQUENCES: 124 (iv) CORRESPONDENCE ADDRESS: (A) ADDRESSEE: Pennie & Edmonds (B) STREET: 1155 Avenue of the Americas (C) CITY: New York (D) STATE: New York (E) COUNTRY: U.S.A.

(F) ZIP: 10036-2711 (v) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-JOS (D) SOFTWARE: Patentln Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATE: (C) CLASSIFICATION: (viii) ATTORNEY/AGENT INFORMATION: (A) NAME: Misrock, S. Leslie (B) REGISTRATION NUMBER: 18,872 (C) REFERENCE/DOCKET NUMBER: 6526-079 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 212 790-9090 (B) TELEFAX: 212 8698864/9741 (C) TELEX: 66141 PENNIE (2) INFORMATION FOR SEQ ID NO:l: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH; 130 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: CAAATGTAAT CCCGCTGGTG GAACTGTGGG TGGCTGCCGG GGTGTTGATC GACGCCATTG 60 GATCTCTGAG TGCAAGGCTA AACAGTCTTA CGTGAGGGCT CTGACTATGG ATTCTGACAA 120 GATTGTTGGC 130 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 130 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double {D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) f(M J jg —««,, m2 JUW/992 2 - 90 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2s CAAGTGCAAT CCATCAGGCA GCACCACTAG AGGATGCCGA GGTGTAGACA AAAAGCAATG 60 GATATCTGAG TGCAAAGCAA AACAGTCTTA TGTGAGGGCT CTGACCATAG ATGCCAACAA 120 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 127 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CAAGTGCCGG GACCCAAATC CCGTTGACAG CGGGTGCCGG GGCATTGACT CAAAGCACTG 60 GAACTCATAT TGTACCACGA CTCACACCTT TGTCAAGGCG CTGACCATGG ATGGCAAGCA 120 GGCTGCC 127 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 127 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: CAAGTGCCGG GCCCCAAATC CTGTAGAGAG TGGATGCCGG GGCATTGACT CCAAGCACTG 60 GAACTCATAC TGCACCACGA CTCACACCTT TGTCAAGGCG TTGACAACAG ACGACAAACA 120 GGCTGCC 127 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12"' base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: CAAGTGCAGG GACCCTAGGC CGGTGTCCAG CGGGTGCCGA GGGATCGATG CGAAGCATTG 60 GAACTCTTAC TGCACCACGA CACACACCTT CGTCAAAGCA CTGACCATGG AGGGCAAGCA 120 AGCAGCC 127 t £ /v > (2) INFORMATION FOR SEQ ID NO:6: GCTTGTGGGT 130 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 127 base pairs 2 4 5 n 1 3 91 (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: CAAGTGCAAA AATCCAAGTC CAGTATCAGG TGGGTGCAGG GGCATTGATG CCAAGCATTG 60 GAATTCGTAT TGCACCACAA CAGACACATT TGTCAGGGCA TTAACCATGG AAGGCAATCA 120 GGCATCT 127 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 127 baas pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: CAAATGCAGG GACCCAAAGC TAGTTTCAAG CGGATGCCGT GGGATTGATG CAAAGCATTG 60 GAACTCTTAT TGTACCACCA CGCACACCTT TGTCAAAGCA TTAACAATGG AAGGGAACCA 120 AGCAGCA 127 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 127 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: CACGTGCCGT GGCGCCCGGG CGGGCAGCTC TGGCTGCCTG GGCATCGACG GGCGACACTG 60 GAACTCCTAC TGCACCAACT CGCACACCTT CGTGCGGGCG CTGACTTCCT TTAAGGACCT 120 GGTGGCC 127 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 130 base pairs (8) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic^ (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: 2 4 2 8 CAAGTGCAAT CCCATGGGTT ACACAAAAGA AGGCTGCAGG GGCATAGACA AAAGGCATTG 60 GAACTCCCAG TGCCGAACTA CCCAGTCGTA CGTGCGttGCC CTTACCATGG ATAGCAAAAA 120 GAGAATTGGC 130 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 130 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:10: CAAGTGTAAT CCCATGGGTT ACACGAAGGA AGGCTGCAGG GGCATAGACA AAAGGCACTG 60 GAACTCGCAA TGCCGAACTA CCCAATCGTA TGTTCGGGCC CTTACTATGG ATAGCAAAAA 120 GAGAATTGGC 130 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 130 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: CAAATGCAAC CCCAAGGGGT ACACAAAGGA AGGCTGCAGG GGCATAGACA AGAGGCACTG 60 GAACTCACAG TGCCGAACTA CCCAGTCTTA CGTGACAGCT CTCACCATGG ATAACAAAAA 120 GAGAGTTGGC 130 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 130 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: CAAGTGCAGC ACGAAGGGTT ATGCAAAAGA AGGCTGTAGA GGCATAGACA GAATTCCCAG TGCCGAACTA CTCAGTCTTA CGTCCGCGCT CTCACCATGG GAGGATTGGA (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 130 base pairs AGAGGTACTG 60 ATAACAAAAA 120 130 *• I M 1 k i. G 1 3 93 (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: CAAATGCAAC CCTATGGGTT ACATGAAAGA AGGCTGCAGA GGCATAGACA AAAGGTACTG 60 GAACTCTCAG TGCCGAACTA CTCAGTCTTA CGTGCGGGCT TTCACCATGG ATAGCAGAAA 120 AAAAGTTGGT 130 (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 130 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: CAAATGTAAC CCTATGGGGT ACACAAAGGA GGGCTGCCGT GGAATAGACA AGAGGCATTA 60 TAACTCCCAA TGCAGGACAA CCCAGTCCTA CGTGCGAGCG CTCACCATGG ATAGCAAAAA 120 GAAGATTGGC 130 (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 130 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:IS: CAAATGTAAC CCCAAGGGTT TCACCAACGA AGGCTGCAGA GGGATAGACA AGAAACATTG 60 GAATTCGCAG TGTAGAACCA GCCAATCCTA TGTGCGAGCT CTAACCATGG ATAGTAGGAA 120 GAAGATTGGG 130 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 130 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: '2 GCGATGTAAG GAAGCCAGGC CGGTCAAAAA CGGTTGCAGG GGTATTGATG ATAAACACTG GAACTCTCAG TGCAAAACAT CCCAAACCTA CGTCCGAGCA CTGACTTCAG AGAACAATAA ACTCGTGGGC (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 130 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17s GAGGTGTAAA GAAGCCAGGC CAGTCAAAAA CGGTTGCAGG GGGATTGATG ACAAACACTG GAACTCTCAG TGCAAAACGT CGCAAACCTA CGTCCGAGCA CTGACTTCAG AAAACAACAA ACTCGTAGGC (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 130 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOt-OLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: AAGGTGTAAA GAAGCCAAAC CTGTTAAAAA TGGCTGCCGA GGCATTGACG ACAAGCACTG GAACTCCCAG TGCAAGACAT CCCAAACTTA CGTTAGAGCA TTGACTTCAG AAAACAATAA ACTTGTAGGC (2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 66 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: AAGGTGTAAA GAGGCAAGAC CTGTCAAAAA TGGCTGTCGA GGCATAGACG ACAAACACTG GAATTC (2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 128 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown 2 4 £. o 1 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ 10 NO:20: CAAGTGTCGG ACTGCCAAAC CTTTTAAGAG CGGCTGTCGC GGCATCGATG ACAAACACTG 60 GAACTCGCAG TGTAAGACCT CTCAGACGTA CGTCAGAGTC TCTGACGCAG GACCGTACCT 120 CTGTGCGC 128 (2) INFORMATION FOR SEQ ID NO:21s (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 130 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: CCGCTGCAAG GAGTCGAAGC CGGGCAAGAA CGGGTGCCGG GGCATCGACG ACAAACACTG GAACTCGCAG TGCAAGACCA GCCAGACCTA TGTCCGAGCG CTGAGCAAGG AGAACAATAA ATATGTGGGC (2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide 60 120 130 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: Lys Cys >,en Pro Ala Gly Gly Thr Val Gly Gly Cys Arg Gly Val Asp 15 10 15 Arg Arg His Trp lie Ser Glu Cys Lys Ala Lys Gin Ser Tyr Val Arg 20 25 30 Ala Leu Thr Met Asp Ser Asp Lys lie Val Gly 35 40 (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: Lya Cys Asn Pro Ser Gly Ser Thr Thr Arg Gly Cys Arg Gly Val Asp 2 4 3 1 3 10 Lya Lya Gin Trp lie Ser Glu Cya Lys Ala Lys Gin Ser Tyr 20 25 30 Ala Leu Thr He Asp Ala Asn Lya Leu Val Gly 35 40 Val Arg (2) INFORMATION FOR SEQ ID NO:24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: Lys Cys Arg Asp Pro Asn Pro Val Aap Ser Gly Cys Arg Gly lie Asp 15 10 15 Ser Lys His Trp Aan Ser Tyr Cya Thr Thr Thr His Thr Phe Val Lye 20 25 30 Ala Leu Thr Mist Asp Gly Lys Gin Ala Ala 35 40 (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NOi25: Lya Cys Arg Ala Pro Aan Pro Val Glu Ser Gly Cya Arg Gly He Ah* 15 10 15 Ser Lya His Trp Aan Ser Tyr Cya Thr Thr Thr His Thr Phe Val Lys Ala Leu Thr Thr Asp Asp Lys Gin Ala Ala 35 40 (2) INFORMATION FOR SEQ ID NO:26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 amino acids (8) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY t unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: v Lys Cya Arg Aap Pro Arg Pro Val Ser Ser Gly Cys Arg Gly lie Aap 15 10 15 2 k > 1 3 Ala Lya Hi8 Trp Aan Ser Tyr Cya Thr Thr Thr Hia Thr Phe Val Lya 20 25 30 Ala Leu Thr Met Glu Gly Lys Gin Ala Ala 35 40 (2) INFORMATION FOR SEQ ID NO:27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 amino acida (B) TYPE: amino acid (C) STRANDEDNESS: aingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: Lya Cys Lys Aan Pro Ser Pro Val Ser Gly Gly Cya Arg Gly lie Asp .1 5 10 15 Ala Lya Hia Trp Aan Ser Tyr Cya Thr Thr Thr Asp Thr Phe Val Arg 20 25 30 Ala Leu Thr Met Glu Gly Asn Gin Ala Ser 35 40 (2) INFORMATION FOR SEQ ZD NO:28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: aingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: ' Lya Cys Arg Aap Pro Lya Pro Val Ser Ser Gly Cys Arg Gly lie Asp 15 10 15 Ala Lye His Trp A8n Ser Tyr Cya Thr Thr Thr His Thr Phe Val Lys 20 2S 30 Ala Leu Thr Met Glu Gly Lya Gin Ala Ala 35 40 (2) INFORMATION FOR SEQ ID NO:29: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 amino acida (B) TYPE: amino acid (C) STRANDEDNESS: aingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29; JUN1992 Fjtf 1 .,- I £ Thr Cys Arg Cly Ala Arg Ala Gly Ser Ser Gly Cya Leu Gly lie Asp 15 10 15 Gly Arg His Trp Asn Ser Tyr Cys Thr Asn Ser His Thr Ph«i Val Arg 20 25 30 Ala Leu Thr ser Phe Lya Asp Leu Val Ala 35 40 (2) INFORMATION FOR SEQ ID NO:30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:30: Lya Cya Asn Pro Met Gly Tyr Thr Lya Glu Gly Cys Arg Gly lie Aap 15 10 15 Lya Arg Hi8 Trp Asn Ser Gin Cya Arg Thr Thr Gin Ser Tyr Val Arg 20 25 30 Ala Leu Thr Met Asp Ser Lys Lys Arg lie Gly 35 40 (2) INFORMATION FOR SEQ ID NO:31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: aingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31: Lya Cya Asn Pro Met Gly Tyr Thr Lya Glu Gly Cys Arg Gly lie Asp 1-5 10 15 Lya Arg Hia Trp Aan Ser Gin Cys Arg Thr Thr Gin Ser Tyr Val Arg 20 25 30 Ala Leu Thr Met Asp Ser Lys Lys Arg lie Gly 35 40 (2) INFORMATION FOR SEQ ID NO:32: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: aingle (D) TOPOLOGY: unknown 'A "2 J(J/V *il (ii) MOLECULE TYPE: peptide * _ / ■s f - » \t V 2 4 2 0 1 3 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32: Lys Cys Asn Pro Lys Gly Tyr Thr Lys Glu Gly Cys Arg Gly lie Asp 15 10 15 Lys Arg His Trp Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr Val Arg 20 25 30 Ala L<»u Thr Met Asp Asn Lys Lys Arg Val Gly 35 40 (2) INFORMATION FOR SEQ ID NO>33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33: Lys Cys Ser Thr Lys Gly Tyr Ala Lys Glu Gly Cys Arg Gly lie Asp 1 .5 10 15 Lys Arg Tyr Trp Asn Ser Gin Cys Arij Thr Thr Gin Ser Tyr Val Arg 20 25 30 Ala Leu Thr Met Asp Asn Lys Lys Arg lie Gly 35 40 (2) INFORMATION FOR SEQ ID NO:34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34: Lys Cys Asn Pro Met Gly Tyr Met Lys Glu Gly Cys Arg Gly lie Asp 15 10 15 Lys Arg Tyr Trp Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr Val Arg 20 25 30 Ala Phe Thr Met Asp Ser Arg LyB Lys Val Gly 35 40 (2) INFORMATION FOR SEQ ID NO:35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid o i 2f o n ^ 4, O (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35: Lya Cya Asn Pro Met Gly Tyr Thr Lya Glu Gly Cya Arg Gly lie Aap IS 10 15 Lya Arg Hia Tyr Aan Ser Gin Cya Arg Thr Thr Gin Ser Tyr Val Arg 20 25 30 Ala Leu Thr Met A8p Ser Lya Lya Lya lie Gly 35 40 (2) INFORMATION FOR SEQ ID NO:36: (i) SEQUENCE CHARACTERISTICS) (A) LENGTH: 43 amino acida (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36: Lys Cys Asn Pro Lys Gly Phe Thr Asn Glu Gly Cys Arg Gly lie Asp 1 5 10 IS Lys Lys His Trp Asn Ser Gin Cya Arg Thr Ser Gin Ser Tyr Val Arg 20 25 30 Ala Leu Thr Met Asp Ser Arg Lys Lys lie Gly 35 40 (2) INFORMATION FOR SSQ ID NO:37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37: Arg Cys Lys Glu Ala Arg P-*o Val Lya Aan Gly Cys Arg Gly lie Asp 15 10 IS Asp Lys His Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr Val Arg 20 25 30 Ala Leu Thr Ser Glu Asn Asn Lys Leu Val Gly // 40 I 2 42315 (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35: Lys Cys Asn Pro Met Gly Tyr Thr Lys Glu Gly Cys Arg Gly lie Asp 15 10 15 Lys Arg His Tyr Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr Val Arg 20 25 30 Ala Leu Thr Met Asp Ser Lys Lys Lys lie Gly 35 40 (2) INFORMATION FOR SEQ ID NO:36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36: Lys Cys Asn Pro Lys Gly Phe Thr Asn Glu Gly Cys Arg Gly lie Asp 1 5 10 15 Lys Lys His Trp Asn Ser Gin Cys Arg Thr Ser Gin Ser Tyr Val Arg 20 25 30 Ala Leu Thr Met Asp Ser Arg Lys Lys lie Gly 35 40 (2) INFORMATION FOR SEQ ID NO:37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (0) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37: Arg Cya Lya Glu Ala Arg Pro Val Lys Asn Gly Cys Arg Gly lie Asp 1 5 10 15 Asp Lys Hia Trp Aan Ser Gin Cys Lys Thr Ser Gin Thr Tyr Val Arg 20 25 30 Ala Leu Thr Ser Glu Asn Asn Lys Leu Val Gly 35 40 ■-& "On '9 ■ ^ <•> , ■v 2 H ^ ^ (2) INFORMATION FOR SEQ ID NO:38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: aingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38: Arg Cys Lys Glu Ala Arg Pro Val Lys Asn Gly Cys Arg Gly lie Asp 1 5 10 15 Asp Lys Hia Trp Aan Ser Gin Cys Ly8 Thr Ser Gin Thr Tyr Val Arg 20 25 30 Ala Leu Thr Ser Glu Asn Asn Lys Leu "**1 35 40 (2) INFORMATION FOR SEQ ID NO:39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE; amino acid (C) STRANDEDNESS: aingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39: Arg Cya Lya Glu Ala Lya Pro Val Lya Asn Gly Cys Arg Gly lie Asp 15 10 15 Asp Lya His Trp Aan Ser Gin Cys Lys Thr Ser Gin Thr Tyr Val Arg 20 25 30 Ala Leu Thr Ser Glu Aan Asn Lya Leu Val Gly 35 40 (2) INFORMATION FOR SEQ ID NO:40: (!) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 amino acids (E) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40: Arg Cya Lya Glu Ala Arg Pro Val Lya Asn Gly Cys Arg Gly lie Asp 15 10 15 Asp Lya Hia Trp Asn 20 2 4 (2) INFORMATION FOR SEQ ID NO:41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 amino acida (8) TYPE: amino acid (C) STRANDEDNESS: aingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41: Lys Cys Arg Thr Ala Lys Pro Phe Lys Ser Gly Cya Arg Gly lie Asp 15 10 IS Asp Lys His Trp Aan Ser Gin Cys Lys Thr Ser Gin Thr Tyr Val Arg 20 2S 30 Ala Leu Thr Gin Asp Arg Thr Ser Val Gly 35 40 (2) INFORMATION FOR SEQ ID NO:42: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42: Arg Cys Lys Glu Ser Lys Pro Gly Lys Asn Gly Cys Arg Gly lie Asp 1 5 10 15 Asp Lys His Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr Val Arg 20 2S 30 Ala Leu Ser Lys Glu Asn Asn Lys Tyr Val Gly 35 40 (2) INFORMATION FOR SEQ ID NO:43: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1302 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: join(529.•534, 538..1248) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43: CAATCATACT TATGAACAGC AGGGGGAGCC CTCGCCTTAC TTCCCAGCCA TGCAGAACTC 242 8 13 AAGCAGCTTT GTTTATGCCG ATCCCTAAGC AGCCCAGACC ACACTGAGCA TGTCCACAGT 120 CTTAGTCTTG CAAAGATGTT TAACAAAGTT ACAAGATGGT GACCCCCTGT AGCCAACTTT 180 GAAAGCATAA ATCATTTGTT TGATTAGGCT TGTGGTGCAG TAAGTTCATG TTTATATTTA 240 GCATACAAAA TACAGCATTT CTAGCCTTAT TCTATTTTAG ACTTTACCCT TTAATGCCCA 300 GTTCTGCCCA TTGCCTTATA GATGTTAAAG TCCCAATATC ACATTGGCAT CCTCGGCTGT 360 TTACAACAAA CATTAAAACT TGTACTTATA TTTAACATTC TGTTGTTCTT CCAATATTCC 420 AT CACACTTA GACCCTAAAA GAATTATATG TATATAATTT GCATAAATTA TATAATGGCA 480 GCCGTATTCT AATTCTGTTT TTTTTTTTTT TTTTTGCAGT GGTCTGAG GTG GAT 534 Val Asp 1 TAA GTA ATG ATC CTC CGC CTT TAT GCC ATG GTG ATC TCA TAC TGT TGT Val Met lie Leu Arg Leu Tyr Ala Met Val lie Ser Tyr Cya Cya 5 10 15 GCC ATC TGC GCT GCC CCC TTC CAG AGC CGG ACC ACA GAT TTG GAT TAT Ala lie Cya Ala Ala fro Phe Gin Ser Arg Thr Thr Asp Leu Aap Tyr 20 25 30 GGC CCC GAT AAA ACA TCA QAA GCC TCA GAC CGG CAA TCA GTT CCC AAC Gly Pro Aap Lya Thr Ser Glu Ala Ser Aap Arg Gin Ser Val Pro Aan 35 40 45 PAC TTC AGT CAT GTC CTG CAA AAT GGG TTC TTT CCA GAT TTG TCA TCC Asn Phe Ser Hia Val Leu Gin Aan Gly Phe Phe Pro Asp Leu Ser Ser 50 55 60 65 ACC TAT TCC AGC ATG GCT GGT AAG GAC TGG AAC CTA TAC TCA CCT AGA Thr Tyr Ser Ser Met Ala Gly Lys Asp Trp Aan Leu Tyr Ser Pro Arg 70 75 80 GTG ACT CTT TCA AGT GAG GAG CCT TCT GGA CCT CCA CTA CTT TTC TTG Val Thr Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu Phe Leu 85 90 95 TCA GAG GAG ACA GTG GTA CAT CCA GAA CCA GCC AAC AAG ACT TCC CGG Ser Glu Glu Thr Val Val His Pro Glu Pro Ala Aan Lys Thr Ser Arg 100 105 110 CTA AAA CGG GCA TCA GGA TCT GAT TCG GTC AGC TTG TCC CGT CGG GGA Leu Lya Arg Ala Ser Gly Ser Aap Ser Val Ser Leu Ser Arg Arg Gly 115 120 125 GAG CTC TCT GTG TGT GAC AGT GTC AAC GTC TGG GTT ACC GAT AA.A CGT Glu Leu Ser. Val Cya Aap Ser Val Aan Val Trp Val Thr Asp Lya Arg 130 135 140 145 ACA GCC GTG GAT GAT CGG GGT AAA ATA GTG ACT GTC ATG TCT GAG ATT Thr Ala Val Aap Aap Arg Gly Lya lie Val Thr Val Met Ser Glu He 150 155 160 CAG ACT CTA ACA GGA CCA CTC AAG CAA TAC TTC TTT GAG ACC AAG TGC Gin Thr Leu Thr Gly Pro Leu Lya Gin Tyr Phe Phe Glu Thr Lya Cya 16S 170 .17 5 AAT CCA TCA GGC AGC ACC ACT AGA GGA TGC CGA GGT GTA GAC AAA AAG Aan Pro Ser Gly Ser Thr Thr Arg Gly Cya Arg Gly Val Aap Lys Lys 180 185 190 CAA TGG ATA TCT GAG TGC AAA GCA AAA CAG TCT TAT GTG AGG GCT CTG Gin Trp lie Ser Glu Cys Lya Ala Lys Gin Ser Tyr Val Arg Ala Leu 195 200 205 582 630 678 726 774 822 870 918 966 1014 1062 1110 L 4 ' 1 3 ACC ATA GAT GCC AAC AAG CTT GTG GGT TGG CGT TGG ATC CGT ATT GAC. Thr lie Asp Ala Aan Lya Leu Val Gly Trp Arg Trp lie Arg lie hup 210 215 220 225 1206 ACA GCG TGT GTC TGT ACC TTG TTG AGT CGG ACA GGA AGG ACG Thr Ala Cya Val Cya Thr Leu Leu Ser Arg Thr Gly Arg Thr 230 235 1248 TAAAAGACGA GGGTTAGCAA AATAGAGAGA AGAGGTTGAT CCGTTGACCT GCAG 1302 (2) INFORMATION FOR SEQ ID NO:44: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 239 amino acida (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44i Val Aap Val Met lie Leu Arg Leu Tyr Ala Met Val lie Ser Tyr Cya 15 10 IS CyB Ala lie Cya Ala Ala Pro Phe Gin Ser Arg Thr Thr Aap Leu Asp 20 25 30 Tyr Gly Pro Aap Lya Thr Ser Glu Ala Ser Aap Arg Cln Ser Val Pro 35 40 45 Asn Asn Phe Ser Hie Val Leu Gin Aan Gly Phe Phe Pro Asp Leu Sar 50 55 60 Ser Thr Tyr Ser Ser Met Ala Gly Lya Asp Trp Asn Leu Tyr Ser Pro 65 70 75 80 Arg Val Thr Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu Phe 85 90 95 Leu Ser Glu Glu Thr Val Val His Pro Glu Pro Ala Asn Lya Thr Ser 100 105 110 Arg Leu Lya Arg Ala Ser Gly Ser Asp Ser Val Ser Leu Ser Arg Arg 115 110 125 Gly Glu Leu Ser Val Cys Aap Ser Val Asn Val Trp Val Thr Asp Tys 130 135 140 Arg Thr Ala Val Aap Aap Arg Gly Lya lie Val Thr Val Met Ser Glu 145 150 155 160 lie Gin Thr Leu Thr Gly Pro Leu Lya Gin Tyr Phe Phe Glu Thr Lya 165 170 175 Cya Aan Pro Ser Gly Ser Thr Thr Arg Gly Cys Ary Gly Val Asp Lys 180 185 190 Lya Gin Trp lie Ser Glu Cys Lya Ala Lys Gin Ser Tyr Val Arg Ala 195 200 205 Leu Thr lie Asp Ala Aan Lys Leu Val Gly Trp Arg Trp lie Arg lie 210 215 220 Asp Thr Ala Cya Val Cya Thr Leu Leu Ser Arg Thr Gly Arg Thr 225 230 235 (2) INFORMATION FOR SEQ ID NO:4S: ' ,/v g .. \ "2 JUN1992' af „ -o \ C V. 2 a ■: ^ (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 123 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45: Ala Ser Gly Ser Asp Ser Val Ser Leu Ser Arg Arg Gly Glu Leu Ser 15 10 15 Val Cys Asp Ser Val Asn Val Trp Val Thr Asp Lys Arg Thr Ala Val 20 25 30 Asp Asp Arg Gly Lys lie Val Thr Val Met Ser Glu lie Gin Thr Leu 35 40 45 Thr Gly Pro Leu Lys Gin Tyr Phe Phe Glu Thr Lys Cys Asn Pro Ser 50 55 60 Gly Ser Thr Thr Arg Gly Cya Arg Gly Vax Asp Lys Lys Gin Trp lie 65 70 75 80 Ser Glu Cys Lys Ala Lys Gin Ser Tyr Val Arg Ala Leu Thr lie Asp 85 90 95 Ala Asn Lys Leu Val Gly Trp Arg Trp lie Arg lie Asp Thr Ala Cys 100 105 110 Val Cys Thr Leu Leu Ser Arg Thr Gly Arg Thr 115 120 (2) INFORMATION FOR SEQ ID NO:46: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 118 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (d) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:46: Ser Ser Thr His Pro Val Phe His Met Gly Glu Phe Ser Val Cys Asp 1 5 10 15 Ser Val Ser Val Trp Val Gly Asp Lys Thr Thr Ala Thr Asp lie Lys 20 2S 30 Gly Lys Glu Val Thr Val Leu Ala Glu Val Asn lie Asn Asn Ser Val 35 40 45 Phe Arg Gin Tyr Phe Phe Glu Thr Lys Cys Arg Ala Ser Asn Pro Val 50 55 60 Glu Ser Gly Cys Arg Gly lie Asp Ser Lys His Trp Asn Ser Tyr Cys 65 70 75 80 t/V //'*• o\ Thr Thr Thr His Thr Phe Val Lys Ala Leu Thr Thr Asp Glu Lys Gin;'!, 85 90 95 Ala Ala Trp Arg Phe lie Arg lie Asp Thr Ala Cys Val Cys Val 100 105 110 Ser Arg Lys Ala Thr Arg 115 (2) INFORMATION FOR SEQ ID NO:47: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 119 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47: His Ser Asp Pro Ala Arg Arg Gly Glu Leu Ser Val Cys Asp Ser lie 15 10 15 Ser Glu Trp Val Thr Ala Ala Asp Lys Lys Thr Ala Val Aap Met Ser 20 25 30 Gly Gly Thr Val Thr Val Leu Glu Lya Val Pro Val Ser Lys Gly Gin 35 40 45 Leu Lys Gin Tyr Phe Tyr Glu Thr Lys Cys Asn Pro Met Gly Tyr Thr 50 55 60 Lys Glu Gly Cys Arg Gly lie Asp Lys Arg His Trp Asn Ser Gin Cys 65 70 75 80 Arg Thr Thr Gin Ser Tyr Val Arg Ala Leu Thr Met Asp Ser Lys Lys 85 90 95 Arg lie Gly Trp Arg Phe He Arg lie Asp Thr Ser Cys Val Cys Thr 100 105 110 Leu Thr lie Lys Arg Gly Arg 115 (2) INFORMATION FCV; SEQ ID NO: 48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 119 amino acids fB) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48: Tyr Ala Glu His Lys Ser His Arg Gly Glu Tyr Ser Val Cys Asp Ser 15 10 15 Glu Ser Leu Trp Val Thr Asp Lys Ser Ser Ala lie Asp lie Arg Gly 20 25 30 i i 2 4 Hia Gin Val Thr Val Leu Gly Glu lie Lys Thr Gly Aan Ser Pro Val 35 40 45 Lya Gin Tyr Phe Tyr Glu Thr Arg Cya Lya Glu Ala Arg Pro Val Lys 50 55 60 Aan Gly Cya Arg Gly lie Aap Aap Lya Hia Trp Asn Ser Gin Cys Lys 65 70 75 80 Thr Ser Gin Thr Tyr Val Arg Ala Leu Thr Ser Glu Asn Aan Lys Leu 85 90 95 Val Gly Trp Arg Trp He Arg II* Asp Thr Ser Cys Val Cys Ala Leu 100 105 110 Ser Arg Lys lie Gly Arg Thr 115 (2) INFORMATION FOR SEQ ZD NO:49: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1313 baae pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/XEY: CDS (B) LOCATIONS 552.. 1259 (xi) SEQUENCE DESCRZPTZON: SEQ ZD NO:49: CTGCAGGGAA ACAATCATAC TTATGAACAG CAGGGGGAGC CCTCGCCTTA CTTCCCAGCC ATGCAGAACT CAAGCAGCTT TGTTTATGCC GATCCCTAAG CAGCCCAGAC CACACTGAGC ATGTGCACAG TCTTAGTCTT GCAAAGATGT TTAACAAAGT TACAAGATGG TGACCCCCTG TAGCCAACTT TGAAAGCATA AATCATTTGT TTGATTAGGC TTGTGGTGCA GTAAGTTCAT GTTTATATTT AGCATACAAA ATACAGCATT TCTAGCCTTA TTCTATTTTA GACTTTACCC TTTAATGCCC AGTTCTGCCC ATTGCCTTAT AGATGTTAAA GTCCCAATAT CACATTGGCA TCCTCGGCTG TTTACAACAA ACATTAASAC TTGTACTTAT ATTTAACATT CTGTTGTTCT TCCAATATTC CATCACACTT AGACCCTAAA AGAATTATAT GTATATAATT TGCATAAATT ATATAATGGC AGCCGTATTC TAATTCTGTT TTTTTTTTTT TTTTTTGCAG TGGTCTGAGG TGGATTAAGT A ATG ATC CTC CGC CTT TAT GCC ATG GTG ATC TCA TAC TGT Met lie Leu Arg Lau Tyr Ala Met Val lie Ser Tvr Cya 1 5 10 TGT GCC ATC TGC GCT GCC CCC TTC CAG AGC CGG ACC ACA GAT TTG GAT Cya Ala lie Cys Ala Ala Pro Phe Gin Ser Arg Thr Thr Aap Leu A8p 15 20 25 TAT GGC CCC GAT AAA ACA TCA GAA CCC TCA GAC CGG CAA TCA GTT CCC Tyr Gly Pro Asp Lya Thr Ser Glu Ala Ser Asp Arg Gin Ser Val Pro 30 35 40 45 2 AAC AAC TTC ACT CAT GTC CTG CAA AAT GGG TTC TTT CCA GAT TTG TCA Asn Asn Phe Sar His Val Leu Gin Asn Gly Phe Phe Pro Asp Leu Ser 50 55 60 734 TCC ACC TAT TCC AGC ATG GCT GGT AAG GAC TGG AAC CTA TAC TCA CCT Ser Thr Tyr Ser Ser Met Ala Gly Lys Asp Trp Aan Leu Tyr Ser Pro 65 70 75 782 AGA GTG ACT CTT TCA AGT GAG GAG CCT TCT GGA CCT CCA CTA CTT TTC Arg Va* Thr Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu Phe 80 85 90 830 TTG TCA GAG GAG ACA GTG GTA CAT CCA GAA CCA GCC AAC AAG ACT TCC Leu Ser Glu Glu Thr Val Val His Pro Glu Pro Ala Aan Lya Thr Ser 95 100 105 878 CGG CTA AAA CGG GCA TCA GGA TCT GAT TCG GTC AGC TTG TCC CGT CGG Arg Leu Lya Arg Ala Ser Gly Ser Aap Ser Val Ser Leu Ser Arg Arg 110 115 120 125 926 GGA GAG CTC TCT GTG TGT GAC AGT GTC AAC GTC TGG GTT ACC GAT AAA Gly Glu Leu Ser Val Cya Asp Ser Val Asn Val Trp Val Thr Aap Lys 130 135 140 974 CGT ACA GCC GTG GAT GAT CGG GGT AAA ATA GTG ACT GTC ATG TCT GAG Arg Thr Ala Val Asp Asp Arg Gly Lya lie Val Thr Val Met Ser Glu 145 150 155 1022 ATT CAG ACT CTA ACA GGA CCA CTG AAG CAA TAC TTC TTT GAG ACC AAG lie Gin Thr Leu Thr Gly Pro Leu Lya Gin Tyr Phe Phe Glu Thr Lys 160 165 170 1070 TGC AAT CCA TCA GGC AGC ACC ACT AGA GGA TGC CGA GGT GTA GAC AAA Cya Asn Pro Ser Gly Ser Thr Thr Arg Gly Cys Arg Gly Val Aap Lys 175 180 185 1118 AAG CAA TGG ATA TCT GAG TGC AAA GCA AAA CAG TCT TAT GTG AGG GCT Lys Gin Trp lie Ser Glu Cya Lys Ala Lys Gin Ser Tyr Val Arg Ala 190 195 200 205 1166 CTG ACC ATA GAT GCC AAC AAG CTT GTG GGT TGG CGT TGG ATC CGT ATT Leu Thr He Asp Ala Aan Lys Leu Val Gly Trp Arg Trp lie Arg lie 210 215 220 12.14 GAC ACA GCG TGT GTC TGT ACC TTG TTG AGT CGG ACA GGA AGG ACG Asp Thr Ala Cys Val Cya Thr Leu Leu Ser Arg Thr Gly Arg Thr 225 230 235 1259 TAAAAGACGA GGGTTAGCAA AATAGAGAGA AGAGGTTGAT CCGTTGACCT GCAG 1313 (2) INFORMATION FOR SEQ ID NO:50: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 236 amino acida (8) TYPE: amino acid (0) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50: Met lie Leu Arg Leu Tyr Ala Met Val lie Ser Tyr Cya Cys Ala lie 15 10 15 Cys Ala Ala Pro Phe Gin Ser Arg Thr Thr Asp Leu Asp Tyr Gly Pro 20 25 30 Aap Lys Thr Ser Glu Ala Ser Asp Arg Gin Ser Val Pro Asn Asn Phe 35 40 45 !,r, C £ Ser His Val Leu Gin Asn Gly Phe Phe Pro Asp Leu Ser Ser Thr Tyr 50 55 60 Ser Ser Met Ala Gly Lys Asp Trp Aan Leu Tyr Ser Pro Arg Val Thr 65 70 75 80 Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu Phe Leu Ser Glu 85 90 95 Glu Thr Val Val His Pro Glu Pro Ala Asn Lys Thr Ser Arg Leu Lya 100 105 110 Arg Ala Ser Gly Ser Asp Ser Val Ser Leu Ser Arg Arg Gly Glu Leu 115 120 125 Ser Val Cys Asp Ser Val Asn Val Trp Val Thr Asp Lys Arg Thr Ala 130 135 140 Val Asp Asp Arg Gly Lys lie VaJ. Thr Val Met Ser Glu lie Gin Thr 145 150 155 160 Leu Thr Gly Pro Leu Lys Gin Tyr Phe Phe Glu Thr Lys Cys Asn Pro 165 170 175 Ser Gly Ser Thr Thr Arg Gly Cys Arg Gly Val Asp Lya Lys Gin Trp 160 185 190 lie Ser Glu Cys Lys Ala Lys Gin Ser Tyr Val Arg Ala Leu Thr lie 195 200 205 Asp Ala Asn Lys Leu Val Gly Trp Arg Trp lie Arg lie Asp Thr Ala 210 215 220 Cys Val Cys Thr Leu Leu Ser Arg Thr Gly Arg Thr 225 230 235 (2) INFORMATION FOR SEQ ID NO:51: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51: Gin Tyr Phe Phe Glu Thr Lys Cys Asn Pro Ser Gly Ser Thr Thr Arg 15 10 15 Gly Cys Arg Gly Val Asp Lys Lys Gin Trp lie Ser Glu Cys Lys Ala 20 25 30 Lya Gin Ser Tyr Val Arg Ala Leu Thr lie Asp Ala Asn Lys Leu Val 35 40 45 Gly Trp Arg Trp lie Arg lie Asp Thr 50 55 (2) INFORMATION FOR SEQ ID NO:52: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:S2: Gin Tyr Phe Tyr Glu Thr 1 5 (2) INFORMATION FOR SEQ ID NO:S3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53: CARTAYTTYT TYGARAC 17 (2) INFORMATION FOR SEQ ID NO:54: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54: CARTAYTTYT AYGARAC (2) INFORMATION FOR SEQ ID NO:55: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATUREi (A) NAME/KEY: modified_base (B) LOCATION: 9 (D) OTHER INFORMATION: /label- N /note* MN » I" (ix) FEATURE: (A) NAME/KEYt modified_base (B) LOCATION: 12 (D) OTHER INFORMATION: /label- N /note- "N « 1." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55; TTRCAYTCNS WNATCCA - Ill - (2) INFORMATION FOR SEQ ID NO:56: (i) SEQITCMCE CHARACTERISTICS: (A; LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: modified base (B) LOCATION: 9 (D) OTHER INFORMATION: /label® N /note* "N - I" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56 GAYTGYTTNG CYTTRCA (2) INFORMATION FOR SEQ ID NO:57: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: modified base (B) LOCATION: 9 ~ (D) OTHER INFORMATION: /label- N /note- "N » I" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57 CTYTGYTTNG CYTTRCA (2) INFORMATION FOR SEQ ID NO:58: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY. modified base (8) LOCATION: 6 (D) OTHER INFORMATION: /label- n /note- "N ■ I- (ix) FEATURE: (A) NAMl/KEY: modified base (B) LOCATION: 9 ~ (D) OTHER INFORMATION: /label- N /note- "N ■ I" (ix) FEATURE: (A) NAME/KEY: modified_base (B) LOCATION: 12 (D) OTHER INFORMATION: /label- N /note- "N * I" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58: GTRTCNATNC KNATCCA (2) INFORMATION FOR SEQ ID NO:59: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: .17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59: CCAAGCTTCT AGAATTC (2) INFORMATION FOR SEQ ID NO: 60: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60: GACTCGAGTC GACATCG (2) INFORMATION FOR SEQ ID NO:61: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 126 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..126 (Xi) SEQUENCE DESCRIPTION: i CAG TAT TTT TAC GAG ACG CGC TGC Gin Tyr Phe Tyr Glu Thr Arg Cys 1 5 GGC CCA GGT GTG GGC GGA GGG GGC Gly Pro Gly Val Gly Gly Gly Gly 20 TGG CTC TCA GAA TGT AAA GCC AAA Trp Leu Ser Glu Cys Lys Ala Lys 35 40 !EQ ID NO: 61: AAG GCC GAA AGC GCT CGG GAA GGT Lys Ala Glu Ser Ala Gly Glu Gly 10 15 TGT CGC GGC GTG GAT CGG AGG CAC Cys Arg Gly Val Asp Arg Arg Hia 25 30 CAA TCG Gin Ser (2) INFORMATION FOR SEQ ID NO:62: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 amino acids (F) TYPE: amino acid (. .< TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62: Gin Tyr Phe Tyr Glu Thr Arg Cys Lys Ala Glu Ser Ala Gly Glu Gly 15 10 15 Gly i'ro Gly Val Gly Gly Gly Gly Cys Arg Gly Val As,i Arg Arg His 20 25 30 Trp Leu Ser Glu Cys Lys Ala Lys Gin Ser 35 40 (2) INFORMATION FOR SEQ ID NO:63: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 126 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/XEY: CDS (B) LOCATION: 1..126 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:63: CAG TAT TTT TAC GAA ACC CG J TGC AAG GCT GAT AAC GCT GAG GAA GGT Gin Tyr Phe Tyr Glu Thr Arg Cys Lys Ala Asp Asn Ala Glu Glu Gly 1 5 10 15 GGC CCG GGG GCA GGT GGA GGG GGC TGC CGG GGA GTG GAC AGG AGG CAC Gly Pro Gly Ala Gly Gly Gly Gly Cys Arg Gly Val Asp Arg Arg His 20 25 30 TGG GTA TCT GAG TGT AAA GCC AAA CAA TCG Trp Val Ser Glu Cys Lys Ala Lys Gin Ser 35 40 (2) INFORMATION FOR SEQ ID NO:64: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64: Gin Tyr Phe Tyr Glu Thr Arg Cys Lys Ala Asp Asn Ala Glu Glu Gly IS 10 15 Gly Pro Gly Ala Gly Gly Gly Gly Cys Arg Gly Val Asp Arg Arg His 20 25 30 Trp Val Ser Glu Cys Lys Ala Lys Cln Ser 35 40 (2) INFORMATION FOR SEQ ID NO:65: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Mingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:65: Gin Tyr Phe Phe Glu Thr Lys Cya Asn Pro Ser Gly Ser Thr Thr Arg 15 10 IS Gly Cys Arg Gly Val Aap Lya Lya Gin Trp lie Ser Glu Cys Lye Ala 20 25 30 Lys Gin Ser 35 (2) INFORMATION FOR SEQ ID NO:66: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:66: Gin Tyr Phe Phe Glu Thr Lys Cys Arg Aii Pro Asn Pro Val Glu Ser 1 5 10 15 Gly Cys Arg Gly lie Asp Ser Lya Hia Trp Asn Ser Tyr Cys Thr Thr 20 25 30 Thr His Thr 35 (2) INFORMATION FOR SEQ ID NO:67: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67: G:<.n Tyr Phe Tyr Glu Thr Lys Cys Asn Pro Met Gly Tyr Thr Lys Glu 15 10 15 Gly Cys Arg Gly Ila Asp Lys Arg His Trp Asn Ser Gin Cys Arg Thr 20 2S 30 Thr Gin Ser 35 (2) INFORMATION FOR SEQ ID NO:68: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 amino acids £ 0 6 * 2 JL/A//992 o, f>, /. t h'J. s 3 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii} MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTIONt SEQ ZD NOt68: Gin Tyr Phe Tyr Glu Thr Arg Cya Lys Glu Ala Arg Pro Val Lya Asn 15 10 15 Gly Cys Arg Gly £la Aap Asp Lya His Trp Aan Ser Gin Cys Lys Thr 20 25 30 Ser Gin Thr 35 (2) INFORMATION FOR SEQ ID NO:69: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 192 base pairs (B) TYPE: nuclaic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..192 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:69: CAA TAT TTT TTC GAG ACC CGC TGC AAG GCT GAT AAC GCT GAG GAA GGT 48 Gin Tyr Phe Ph« Glu Thr Arg Cys Lya Ala Asp Asn Ma Glu Glu Gly 15 10 15 GGT CCG GGG GCA GGT GGA GGG GGC TGC CGG GGA GTG GAC AGG HGG CAC 96 Gly Pro Gly Ala Gly Gly Gly Gly Cya Arg Gly Val Aap Arg Arg Hia 20 25 30 TGG GTA TCT GAG TGC AAG GCC AAG CAG TCC TAT GTG CGC GCA TTG ACC 144 Trp Val Ser Glu Cys Lys Ala Lys Gin Ser Tyr Val Arg Ala Leu Thr 35 40 45 GCT GAT GCC CAG GGC CGT GTG GGC TGG CGA TGG ATC CGC ATC GAT ACG 192 Ala Asp Ala Gin Gly Arg Val Gly Trp Arg Trp lis Arg lis Asp Thr 50 55 60 (2) INFORMATION FOR SEQ ID NO:70: (i) SEQUENCE CHARACTEPTSTICS: (A) LENGTH: 64 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Gin Tyr Phe Phe Glu Thr Arg Cys Lya Ala 15 10 Gly Pro Gly Ala Gly Gly Gly Gly Cys Arg 20 25 Gly Val Asp Arg Arg Hia 30 #■»» ~(T '•>' jf Trp Val Ser Glu Cys Lya Ala Lya Gin Ser Tyr Val Arg Ala Leu Thr 35 40 45 Ala Asp Ala Gin Gly Arg Va' Gly Trp Arg Trp lie Arg lie Aap Thr 50 Si 60 (2) INFORMATION FOR SH ID NO: 71; (i) SEQUENCE CHARACTERISTICS; (A) LENGTH: 35 base pairs (B) TYPEt nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 18..35 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:71: GACTCGAGTC GACATCG GAA ACC CGC TGC AAG GCT 35 Glu Thr Arg Cys Lys Ala 1 5 (2) INFORMATION FOR SEQ ID NO:72: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (8) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:72: Glu Thr Arg Cys Lys Ala 1 5 (2) INFORMATION FOR SEQ ID NO:73: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (3) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 18..35 (Xi) SEQUENCE DESCRIPTION: SEQ ID .0:73: GACTCGAGTC GACATCG GAT AAC GCT GAG GAA GGT Asp Asn Ala Glu Glu Gly 1 5 (?) INFORMATION FOR SEQ ID NO:74: (i) SEQUENCE CHARACTERISTICS; 2 4 £ d 1 (A) LENGTH: 6 amino acids (B) TYPE: amino acid (0) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:74: Asp Asn Ala Glu Glu Gly 1 5 (2) INFORMATION FOR SEQ ID NO:75: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1404 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 460..1104 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7S: CTTGTCACCC AGGTGGCACC CGAGTGGTGC ACTCTCTGCT CACTGCAACC TCGGCCTCCT 60 GGGTTCGAGT GATTCTCCTA CCTCAGCCTA CTGAGTAGCT GGGATTACAG GCGTGCAGCA 120 CTATGCCCGG TTAATTTTGG TATTTTTGGT AGAGATGAGG TTTCACAATG TTGACCAGCT 180 GCTCTGGAAC TCCTGACCTC AAGTCATCCA CCTGCCTCAG CCTCCCAGAG TGCTGGGATT 240 AGAGGTGTGG GGCACAGTGC CTGGCCTGTA GTAGTTGAAT ATTTATTATT AATCTACAAG 300 TTGCGCATTA CGCAAGCCCT AGATATAGGG TCCCCCAAAC TTCTAGAACA AGGGCTTCCC 360 CACAATCCTG GCAGGCAAGC CTCCCCTGGG GTTCCCAACT TCTTTCCCCA CTGAAGTTTT 420 TACCCCCTTC TCTAATCCCA GCCTCCCTCT TTCTGTCTC CAG GTG CTC CGA GAG 474 Gin Val Leu Arg Glu 1 5 ATG CTC CCT CTC CCC TCA TGC TCC CTC CCC ATC CTC CTC CTT TTC CTC 522 Met Leu Pro Leu Pro Ser Cys Ser Leu Pro lie Leu Leu Leu Phe Leu 10 IS 20 CTC CCC AGT GTG CCA ATT GAG TCC CAA CCC CCA CCC TCA ACA TTG CCC 570 Leu Pro Ser Val Pro lie Glu Ser Gin Pro Pro Pro Ser Thr Leu Pro 25 30 35 CCT TTT CTG GCC CCT GAG TGG GAC CTT CTC TCC CCC CGA GTA GTC CTG 618 Pro Phe Leu Ala Pro Glu Trp Asp Leu Leu Ser Pro Arg Val Val Leu 40 . 45 50 TCT AGG GCT GCC CCT GCT GGG CCC CCT CTG CTC TTC CTG CTG GAG GCT 666 Ser Arg Gly Ala Pro Ala Gly Pro Pro Leu Leu Phe Leu Leu Glu Ala 55 60 65 GGG GCC TTT CGG GAG TCA GCA GGT GCC CCG GCC AAC CGC AGC CGG CGT O \ Gly Ala Phe Arg Glu Ser Ala Gly Ala Pro Ala Asn Arg Ser Arg Arg //. 70 75 80 85 'ig 1' -£aJU/V|992 f 70 75 80 85 GGG GTG AGC GAA ACT GCA CCA GCG AGT CGT CGG GGT GAG CTG GCT GTG Gly Val Ser Glu Thr Ala Pro Ala Ser Arg Arg Gly Glu Leu Ala Val p? v* , "J *•? £ £. 90 - 118 95 100 TGC GAT GCA GTC AGT GGC TGG GTG ACA GAC CGC CGG ACC GCT GTG GAC Cys Aep Ala Val Ser Gly Trp Val Thr Aap Arg Arg Thr Ala Val Asp 105 110 115 TTC CGT GGG CGC GAG GTG GAG GTG TTG GGC GAG GTG CCT GCA GCT GGC Leu Arg GXv Arg Glu Val Glu Val Leu Gly Glu Val Pro Ala Ala Gly 120 125 130 GGC AGT CCC CTC CGC CAG TAC TTC TTT GAA ACC CGC TGC AAG GCT GAT Gly Ser Pro Leu Arg Gin Tyr Phe Phe Glu Thr Arg Cys Lys Ala Asp 135 140 145 AAC GCT GAG GAA GGT GGT CCG GGG GCA GGT GGA GGG GGC TGC CGG GGA Aan Ala Glu Glu Gly Gly Pro Gly Ala Gly Gly Gly Gly Cys Arg Gly 150 155 160 165 GTG GAC AGG AGG CAC TGG GTA TCT GAG TGC AAG GCC AAG CAG TCC TAT Val Asp Arg A^g His Trp Val Ser Glu Cys Lys Ala Lys Gin Ser Tyr 170 175 180 GTG CGG GCA TTG ACC GCT GAT GCC CAG GGC CGT GTG GGC TGG CGA TGG Val Arg Ala Leu Thr Ala Asp Ala Gin Gly Arg Val Gly Trp Arg Trp 185 190 195 ATT CGA ATT GAC ACT GCC TGC GTC TGC ACA CTC CTC AGC CGG ACT GGC lie Arg lie Asp Thr Ala Cys Val Cys Thr Leu Leu Ser Arg Thr Gly 200 205 210 CGG GCC TGAGACCCAT GCCCAGGAAA ATAACAGAGC TGGATGCTGA GAGACCTCAG Arg Ala 215 810 858 906 954 1002 1050 1098 1154 GGATGGCCCA GCTGATCTAA GGACCCCAGT TTGGGAACTC ATCAAATAAT CACAAAATCA 1214 CAATTCTCTG ATTTGGAGCT OAATCTCTGC AGGATGGGTG AAACCACATG GGGTTTTGGA 1274 GGTTGAATAG GAGTTCTCCT GGAGCAACTT GAGGGTAATA ATGATGATGA TATAATAATA 1334 ATAGCCACTA TTTACTGAGT GTTTACTGTT TCTTATCCCT AATACATAAC TCCTCAGATC 1394 AACTCTCATG 1404 (2) INFORMATION FOR SEQ ID NO:76: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 215 amino acids (B) TYPE: amino acid (0) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:76: Gin Val Leu Arg Glu Met Leu Pro Leu Pro Ser Cys Ser Leu Pro lie 15 10 15 Leu Leu Leu Phe Leu Leu Pro Ser Val Pro lie Glu Ser Gin Pro Pro 20 25 30 Pro Ser Thr Leu Pro Pro Phe Leu Ala Pro Glu Trp Asp Leu Leu Ser 35 40 45 Pro Arg Val Val Leu Ser Arg Gly Ala Pro Ala Gly Pro Pro Leu Leu SO 55 60 Phe Leu Leu Glu Ala Gly Ala Phe Arg Glu Ser Ala Gly Ala Pro Ala 65 70 75 80 2 4 2 8 Asn Arg Ser Arg Arg Gly Val Ser Glu Thr Ala Pro Ala Ser Arg Arg 85 90 95 Gly Glu Leu Ala VaI Cys Asp Ala Val Ser Gly Trp Val Thr Asp Arg 100 105 110 Arg Thr Ala Val Asp Leu Arg Gly Arg Glu Val Glu Val Leu Gly Glu 115 120 125 Val Pro Ala Ala Gly Gly Ser Pro Leu Arg Gin Tyr Phe Phe Glu Thr 130 135 140 Arg Cys LyB Ala Asp Asn Ala Glu Glu Gly Gly Pro Gly Ala Gly Gly 145 150 155 160 Gly Gly Cys Arg Gly Val Asp Arg Arg His Trp Val Ser Glu Cys Lys 165 170 175 Ala Lys Gin Ser Tyr Val Arg Ala Leu Thr Ala Asp Ala Gin Gly Arg 180 185 190 Val Gly Trp Arg Trp lie Arg lie Asp Thr Ala Cys Val Cys Thr Leu 195 200 205 Leu Ser Arg Thr Gly Arg Ala 210 215 (2) INFORMATION FOR SEQ ID NO:77: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 214 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:77: Val Lau Arg Glu Met Leu Pro Leu Pro Ser Cys Ser Leu Pro lie Leu 15 10 15 Leu Leu Phe Leu Leu Pro Ser Val Pro lie Glu Ser Gin Pro Pro Pro 20 25 30 Ser Thr Leu Pro Pro Phe Leu Ala Pro Glu Trp Asp Leu Leu Ser Pro 35 40 45 Arg Val Val Leu Ser Arg Gly Ala Pro Ala Gly Pro Pro Leu Leu Phe 50 55 60 Leu Leu Glu Ala Gly Ala Phe Arg Glu Ser Ala Gly Ala Pro Ala Asn 65 70 75 80 Arg Ser Arg Arg Gly Val Ser Glu Thr Ala Pro Ala Ser Arg Arg Gly 85 90 95 Glu Leu Ala Val Cys Asp Ala Val Ser Gly Trp Val Thr Asp Arg Arg 100 105 110 Thr Ala Val Asp Leu Arg Gly Arg Glu Val Glu Val Leu Gly Glu Val 115 120 125 Pro Ala Ala Gly Gly Ser Pro Leu Arg Gin Tyr Phe Phe Glu Thr Arg 130 135 140 Cys Lys Ala Asp Asn Ala Glu Glu Gly Gly Pro Gly Ala Gly Gly Gly h.

L & / U 120 145 150 1S5 160 Gly Cys Arg Gly Val Asp Arg Arg His Trp Val Ser Glu Cys Lys Ala 165 170 175 Lys Gin Ser Tyr Val Arg Ala Leu Thr Ala Asp Ala Gin Gly Arg Val 180 185 190 Gly Trp Arg Trp lie Arg lie Asp Thr Ala Cys Val Cys Thr Leu Leu 195 200 205 Ser Thr Arg Gly Arg Ala (2) INFORMATION FOR SEQ ID NO:78: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 176 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:78: Ser Ser Thr Tyr Ser Ser Met Ala Gly Lys Asp Trp Asn Leu Tyr Ser 1 5 10 15 Pro Arg Val Thr Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu 20 25 30 Phe Leu Ser Glu Glu Thr Val Val His Pro Glu Pro Ala Asn Lys Thr 35 40 45 Ser Arg Leu Lys Arg Ala Ser Gly Ser Asp Ser Val Ser Leu Ser Arg 50 55 60 Arg Gly Glu Leu Ser Val Cys Asp Ser Val Asn Val Trp Val Thr Asp 65 70 75 80 Lys Arg Thr Ala Val Asp Asp Arg Gly Lys lie Val Thr Val Met Ser 85 90 ■ 95 Glu lie Gli> Thr Leu Thr Gly Pro Leu Lys Gin Tyr Phe Phe Glu Thr 100 105 110 Lys Cys Asn Pro Ser Gly Ser Thr Thr Arg Gly Cys Arg Gly Val Asp 115 120 125 Lys Lys Gin Trp lie Ser Glu Cys Lys Ala Lys Gin Ser Tyr Val Arg 130 135 140 Ala Leu Thr lie Asp Ala Asn Lys Leu Val Gly Trp Arg Trp lie Arg 145 150 155 160 lie Asp Thr Ala Cys Val Cys Thr Leu Leu Ser Arg Thr Gly Arg Thr 210 165 170 175 (2) INFORMATION FOR SEQ ID NO:79: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 177 amino acids (B) TYPE: fuTiino acid (C) STRANDEDNESS: single , V 2 420 1 3 t (D> TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:79: Glu Phe Gin Pro Met lie Ala Thr Aap Thr Glu Leu Leu Arg Gin Gin 15 10 15 Arg Arg Tyr Aan Ser Pro Arg Val Leu Leu Ser Asp Ser Thr Pro Leu 20 25 30 Glu Pro Pro Pro Leu Tyr Leu Met Glu Asp Tyr Val Gly Asn Pro Val 35 40 45 Val Ala Asn Arg Thr Ser Pro Arg Arg Lys Tyr Ala Glu His Lys Ser 50 55 60 His Arg Gly Glu Tyr Ser Val Cys Asp Ser Glu Ser Leu Trp Val Thr 65 70 75 80 Asp Lys Ser Ser Ala lie Asp lie Arg Gly His Gin Val Thr Val Leu 85 90 95 Gly Glu lie Lys Thr Gly Asn Ser Pro Val Lys Gin Tyr Phe Tyr Glu 100 105 110 Thr Arg Cys Lys Glu Ala Arg Pro Val Lys Asn Gly Cys Arg Gly lie 115 120 125 Asp Asp Lys His Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr Val 130 135 140 Arg Ala Leu Thr Ser Glu Asn Asn Lys Leu Val Gly Trp Arg Trp lie 145 150 155 160 Arg lie Asp Thr Ser Cys Val Cys Ala Leu Ser Arg Lys lie Gly Arg 165 170 175 Thr (2) INFORMATION FOR SEQ ID NO:80: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 175 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (0) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:80: Gin Pro Val lie Ala Met Asp Thr Glu Leu Leu Arg Gin Gin Arg Arg 15 10 15 Tyr Asn Ser Pro Arg Val Leu Leu Ser Asp Thr Thr Pro Leu Glu Pro 20 25 30 Pro Pro Leu Tyr Leu Met Glu Asp Tyr Val Gly Ser Pro Val Val Ala i/ % ^ E 40" 45 v"V ^ Asn Arg Thr Ser Arg Arg Lys Arg Tyr Ala Glu His Lya Ser His Arg /!/»> 50 55 60 \ * Gly Glu Tyr Ser Val Cys Asp Ser Glu Ser Leu Trp Val Thr Asp Lys O f / * 122 65 70 75 80 Ser Ser Ala lie Asp lie Arg Gly His Gin Val Thr Val Leu Cly Glu 85 90 95 lie Lys Thr Gly Asn Ser Pro Val Lys Gin Tyr Phe Tyr Glu Thr Arg 100 105 110 Cys Lys Glu Ala Arg Pro Vai Lys Asn Gly Gly Arg Gly lie Asp Asp 115 120 125 Lys His Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr Val Arg Ala 130 135 140 Leu Thr Ser Glu Asn Asn Lys Leu Val Gly Trp Arg Trp Xle Arg Xle 145 150 155 160 Asp Thr Ser Cys Val Cys Ala Leu Ser Arg Lys Xle Gly Arg Thr (2) INFORMATION FOR SEQ ID NO:81: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 178 amino acida (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:81: Glu Phe Gin Pro Met lie Ala Thr Asp Thr Glu Leu Leu Arg Gin Gin 1 5 10 15 Arg Arg Tyr Asn Ser Pro Arg Val Leu Leu Ser Asp Ser Thr Pro Leu 20 25 30 Glu Pro Pro Pro Lau Tyr Leu Met Glu Asp Tyr Val Gly Asn Pro Val 35 40 45 Val Thr Asn Aro rhir Ser Pro Arg Arg Ly3 Arg Tyr Ala Glu Hie Lya 50 55 60 Ser Hia Arg Gly Glu Tyr Ser Val Cya Asp Ser Glu Ser Leu Trp Val 55 70 75 80 Thr Asp Lys Ser Ser Ala lie Asp lie Arg Gly Hia Gin Val Thr Val 85 90 95 Leu Gly Glu lie Lys Thr Gly Asn Ser Pro Val Lys Gin Tyr Phe Tyr 100 105 110 Glu Thr Arg Cys Lya Glu Ala Arg Pro Val Lys Asn Gly Gly Arg Gly 115 120 125 lie Asp Asp Lys His Trp Asn Ser Gin Cys Lys Thr Ser Gin Thr Tyr 130 135 140 Val Arg Ala Leu Thr Ser Glu Asn Asn Lys Leu Val Gly Trp Arg Trp 145 150 155 160 Xle Arg lie Asp Thr Ser Cys Val Cys Ala Leu Ser Arg Lya lie Gly 165 170 175 165 170 175 (2) INFORMATION FOR SEQ ID NO:82: Arg Thr (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 160 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:82: Aap Leu Tyr Thr Ser Arg Val Met Leu Ser Ser Gin Val Pro Leu Glu 1 5 10 15 Pro Pro Leu Leu Phe Leu Leu Glu Glu Tyr Lys Asn Tyr Leu Asp Ala 20 25 30 AJ.a Asn Met Ser Met Arg Val Arg Arg His Ser Aap Pro Ala Arg Arg 35 40 4S Gly Glu Leu Ser Val Cys Asp Ser lie Ser Glu Trp Val Thr Ala Ala 50 55 60 Asp Lys Lya Thr Ala Val Asp Met Ser Gly Gly Thr Val Thr Val Leu 65 70 75 80 Glu Lys Val Pro Val Ser Lys Gly Gin Leu Lys Gin Tyr Phe Tyr Glu 85 90 95 Thr Lys Cys Asn Pro Met Gly Tyr Thr Lys Glu Gly Gly Arg Gly lie 100 105 110 Asp Lys Arg His Trp Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr Val 115 120 125 Arg Ala Leu Thr Mot Asp Ser Lys Lys Arg lie Gly Trp Arg Phe lie 130 135 140 Arg lie Asp Thr Ser Cys Val Cys Thr Leu Thr lie Lys Arg Gly Arg 145 150 155 160 INFORMATION FOR SEQ ID NO:83: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 160 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYP' i peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:83: Aap Leu Tyr Thr Ser Arg Val Met Leu Ser Ser Gin Val Pro Leu Glu 1 5 10 x 15 Pro Pro Leu Leu Phe Leu Leu Glu Glu Tyr Lys Asn Tyr Leu Asp Ala 20 25 30 Ala Asn Met Ser Met Arg Val Arg Arg His Ser Asp Pro Ala Arg Arg 35 40 45 Gly Glu Leu Ser Val Cys Asp Ser lie Ser Glu Trp Val Thr Ala Ala 50 55 60 Asp Lys Lys Thr Ala Val Aap Met Ser Gly Gly Thr Val Thr Val Leu 65 70 75 80 Glu Lya Val Pro Val Ser Lys Gly Gin Leu Lys Gin Phe Phe Tyr Glu /*. 1 3 * * as 90 95 Thr Lya Cya Aan Pro Met Gly Tyr Thr Lya Glu Gly Gly Arg Aap lie 100 105 110 Asp Lys Arg Hia Trp Aan Ser Gin Cys Arg Thr Thr Gin Ser Tyr Val 115 120 125 Arg Ala Leu Thr Met Aap Ser Lys Lys Arg lie Gly Trp Arg Phe lie 130 135 140 Arg lie Asp Thr Ser Cya Val Cya Thr Leu Thr lie Lya Arg Gly Arg 145 150 155 160 (2) INFORMATION FOR SEQ ID NO:84: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 160 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:84: Asp Leu Tyr Thr Ser Arg Val Met Leu Ser Ser Gin Val Pro Leu Glu 10 15 Pro Pro Lau Leu Phe Leu Leu Glu Glu Tyr Lys Aan Tyr Leu Aap Ala 20 25 30 Ala Aan Met ser Met Arg Val Arg Arg His Ser Aap Pro Ala Arg Arg 35 40 45 Gly Glu Leu Ser Val Cys Asp Ser lie Ser Glu Trp Val Thr Ala Ala 50 55 60 Asp Lys Lya Thr Ala Val Asp Met Ser Gly Gly Thr Val Thr Val Leu 65 70 75 80 Glu Lys Val Pro Val Ser Lys Gly Gin Leu Lya Gin Tyr Phe Tyr Glu 85 90 95 Thr Ly8 Cys Asn Pro Met Gly Tyr Thr Lys Glu Gly Gly Arg Asp lie 100 105 110 Asp Lys Arg His Trp Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr Val 115 120 125 Arg Ala Leu Thr Met Asp Ser Lys Lys Arg lie Gly Trp Arg Phe lie 130 135 140 Arg lie Asp Thr Ser Cya Val Cys Thr Leu Thr lie Lys Arg Gly Arg 145 ISO 155 160 (2) INFORMATION FOR SEQ ID NO:85: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 160 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8S: V a \ -5 pE/V> Aap Met Tyr Thr Ser Arg Val Met Leu Ser Ser Gin Val Pro Leu Glu 10 15 Pro Pro Leu Leu Phe Leu Leu Glu Glu Tyr Lys Asn Tyr Leu ABp Ala 20 25 30 Ala Asn Met Ser Met Arg Val Arg Arg His Ser Asp Pro Ala Arg Arg 35 40 45 Gly Glu Leu Ser Val Cys Asp Ser lis Ser Glu Trp Val Thr Ala Ala 50 55 60 Asp Lys Lys Thr Ala Val Asp Met Ser Gly Gly Thr Val Thr Val Leu 65 70 75 80 Glu Lya Val Pro Val Ser Lys Gly Gin Leu Lys Gin Tyr Phe Tyr Glu 85 90 95 Thr Lys Cys Aan Pro Met Gly Tyr Thr Lys Glu Gly Gly Arg Asp lie 100 105 110 Asp Lya Arg His Trp Asn Ser Gin Cys Arg Thr Thr Gin Ser Tyr Val 115 120 125 Arg Ala Leu Thr Met Asp Ser Lys Lys Arg lie Gly Trp Arg Phe Zle 130 135 140 Arg lie Asp Thr Ser Cys Val Cys Thr Leu Thr lie Lys Arg Gly Arg 145 150 155 160 (2) INFORMATION FOR SEQ ZD NO:86: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 180 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:86: .

Ala Ala Arg Val Thr Gly Gin Thr Arg Asn lie Thr Val Aap Pro Arg 15 10 15 Leu Phe Lys Lys Arg Arg Leu His Ser Pro Arg Val Leu Phe S<*r Thr 20 25 30 Gin Pro Pro Pro Thr Ser Ser Asp Thr Leu Asp Leu Asp Phe Gin Ala 35 40 45 Hia Gly Thr lie Pro Phe Aan Arg Thr His Arg Ser Lys Arg Ser Ser 50 55 60 Ser Hia Pro lie Phe His Arg Gly Glu Phe Ser Val Cys Asp Ser Val 65 70 75 80 Ser Val Trp Val Gly Asp Lys Thr Thr Ala Thr Asp lie Lys Gly Lys 85 90 95 Glu Val Met Val Leu Gly Glu Val Asn lie Asn Asn Ser Val Phe Lys ^ 100 105 110 V Gin Tyr Phe Phe Glu Thr Lys Cys Arg Asp Pro Asn Pro Val Asp Ser ^ 115 120 125 \ "2 A Gly Gly 130 Arg Asp lie Asp Ser 135 Lys His Trp Asn Ser 140 Tyr Cys Thr Thr Thr 145 His Thr Phe Val Lys 150 Ala Leu Thr Thr Asp 155 Glu Lys Gin Ala Ala 160 Trp Arg Phe lie Arg lie Asp Thr Ser Cys Val Cys Val Leu Ser Arg 165 170 175 Lys Ala Thr Arg 180 (2) INFORMATION FOR SEQ ID NO:87: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 180 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:87: Ala Ala Arg Val Thr Gly Gin Thr Arg Asn lie Thr Val Asp Pro Lys 1 5 10 15 Leu Phe Lys Lys Arg Arg Leu Arg Ser Pro Arg Val Leu Phe Ser Thr 20 25 30 Gin Pro Pro Pro Thr Ser Ser Asp Thr Leu Asp Leu Asp Phe Gin Ala 35 40 45 His Gly Thr lie Ser Phe Asn Arg Thr His Arg Ser Lys Arg Ser Ser 50 55 60 Thr His Pro Val Phe His Met Gly Glu Phe Ser Val Cys Asp Ser Val 65 70 75 80 Ser Val Trp Val Gly Asp Lys Thr Thr Ala Thr Asp lie Lya Gly Lys 85 90 95 Glu Val Thr Val Leu Gly Glu Val Asn lie Asn Asn Ser Val Phe Lys 100 105 110 Gin Tyr Phe Phe Glu Thr Lys Cys Arg Ala Pro Asn Pro Val Glu Ser 115 120 125 Gly Gly Arg Asp lie Asp Ser Lye His Trp Asn Ser Tyr Cys Th" Thr 130 135 140 Thr His Thr Phe Val Lys Ala Leu Thr Thr Asp Asp Lys Gin Ala Ala 145 150 155 160 Trp Arg Phe lie Arg lie Asp Thr Ser Cys Val Cys Val Leu Ser Arg 165 170 175 Lys Ala Ala Arg 180 (2) INFORMATION FOR SEQ ID NO:88: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 179 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown 2 4 20 1 3 (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:88: Ala Ala Arg Val Ala Gly Gin Thr Arg Asn lie Thr Val Asp Pro Arg 15 10 15 Phe Lya Lya Arg Arg Leu Arg Ser Pro Arg Val Leu Phe Ser Thr Gin 20 25 30 Pro Pro Arg Glu Ala Asp Thr Thr Gin Asp Leu Asp Phe Glu Val Gly 35 40 45 Gly Ala Ala Pro Phe Asn Arg Thr His Arg Ser Lys Arg Ser Ser Ser 50 55 60 His Pro lie Phe His Arg Gly Glu Phe Ser Val Cys Asp Ser Val Ser 65 70 75 80 Val Trp Val Gly Asp Lys Thr Thr Ala Thr Asp lie Lys Gly Lys Glu 85 90 95 Val Met Val Leu Gly Glu Val Asn lie Asn Asn Ser Val Phe Lys Gin 100 105 110 Tyr Phe Phe Glu Thr Lys Cys Arg Asp Pro Asn Pro Val Asp' Ser Gly 11S 120 125 Gly Arg Asp lie Asp Ser Lys His Trp Asn Ser Tyr Cys Thr Thr Thr 130 135 140 His Thr Phe Val Lys Ala Leu Thr Met Asp Gly Lys Gin Ala Ala Trp 145 150 155 160 Arg Phe lie Arg lie Asp Thr Ser Cys Val Cys Val Leu Ser Arg Lys 165 170 175 Ala Val Arg (2) INFORMATION FOR SEQ ID NO:89: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 163 amino acids (3) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:89: Phe Phe Lys Lys Lys Arg Phe Arg Ser Ser Arg Val Leu Phe Ser Thr 1 5 10 15 Gin Pro Pro Pro Glu Ser Arg Lys Gly Gin Ser Thr Gly Phe Leu Ser 20 25 30 Ser Ala Val Ser Leu Asn Arg Thr Ala Arg Thr Lys Arg Thr Ala His 35 40 45 Pro Val Leu His Arg Gly Glu Phe Ser Val Cys Asp Ser Val Ser Met 50 55 60 / O Trp Val Gly Asp Lys Thr Thr Ala Thr Asp lie Lys Gly Lys Glu Val y 65 70 75 80 /-* a * t »• .r- L " ^ Thr Val Leu Gly Glu Val Aan lie Asn Asn Asn val Phe Lys Gin Tyr 85 90 95 Phe Phe Glu Thr Lya Cys Arg Aap Pro Arg Pro Val Ser Ser Gly Gly 100 105 110 Arg Asp lie Asp Ala Lys His Trp Asn Ser Tyr Cys Thr Thr Thr His 115 120 125 Thr Phe Val Lys Ala Leu Thr Met Glu Gly Lys Gin Ala Ala Trp Arg 130 135 140 Phe 11a Arg He Asp Thr Ser Cys Val Cys Val Leu Ser Arg Lys Ser 145 150 155 160 Gly Arg Pro (2) INFORMATION FOR SEQ ID NO:90: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 124 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:90: His Arg Ser Lys Arg Ser Ser Glu Ser His Pro Val Phe His Arg Gly 15 10 15 Glu Phe Ser Val Cys Asp Ser lie Ser Val Trp Val Gly Asp Lys Thr 20 25 30 Thr Ala Thr Asp lie Lys Gly Lys Glu Val Met Val Leu Gly Glu Val 3S 40 45 Asn lie Asn Asn Ser Val Phe Lys Gin Tyr Pb Phe Glu Thr Lys Cys 50 55 60 Arg Asp Pro Asn Pro Val Asp Ser Gly Gly Arg Asp lie Asp Ala Lys 65 70 75 80 His Trp Asn Ser Tyr Cys Thr Thr Thr His Thr Phe Val Lys Ala Leu 85 90 95 Thr Met Asp Gly Lys Gin Ala Ala Trp Arg Phe lie Arg lie Asp Thr 100 105 110 Ser Cys Val Cys Val Leu Ser Arg Lys Thr Gly Gin 115 120 (2) INFORMATION FOR SEQ ID NO:91: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 164 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide O JIJNl992 Val Asp Pro Lys Leu Phe Gin Lys Arg Gin Phe Gin Ser Pro Arg Val ' ' <* ** ' \n , ox , -V ^ ,j^ (xi) SEQUENCE DESCRIPTION: SEQ ID NO:91: \ "2 2 u : 1 3 10 15 Leu Phe Ser Thr Gin Pro Pro Leu Leu Ser Arg Asp Glu Glu Ser Val 20 25 30 Glu Phe Leu Asp Asn Glu Asp Ser Leu Asn Arg Asn lie Arg Ala Lys 35 40 45 Arg Glu Asp His Pro Val His Asn Leu Gly Glu His Ser Val Cys Asp 50 55 60 Ser Val Ser Ala Trp Val Gly Lys Thr Thr Ala Thr Asp lie Lys Gly 65 70 75 80 Asn Thr Val Thr Val Met Glu Asn Val Asn Leu Asp Asn Lys Val Tyr 85 90 95 Lys Gin Tyr Phe Phe Glu Thr Lys Cys Arg Asn Pro Asn Pro Glu Pro 100 105 110 Ser Gly Gly Arg Asp lie Asp Ser Ser His Trp Asn Ser Tyr Cys Thr 115 120 125 Glu Thr Asp Gly Phe lie Lys Ala Leu Thr Met Glu Gly Asn Gin Ala 130 135 140 Ser Trp Arg Phe lie Arg lie Asp Thr Ser Cya Val Cys Val lie Thr 145 150 155 160 Lys Lys Lys Gly (2) INFORMATION FOR SEQ ID NO:92: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 196 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:92: Pro Ala Gly Ser Ser Pro Asp Pro Ser Ser Pro Val Val Asp Pro Lys 1 5 10 15 Leu Phe Ser Lys Arg His Tyr Pro Ser Pro Arg Val Val Phe Ser Glu 20 25 30 Val lie Pro Ser His Asp Val Leu Asp Gly Glu Gly Tyr Aap Phe Glu 35 40 45 Arg Val Arg Gly Leu Arg Val Arg Arg Lys Ala Val Ser His Thr Met 50 55 60 His Arg Gly Glu Tyr Ser Val Cys Asp Ser lie Asn Thr Trp Val Asn 65 70 75 80 Thr Lys Arg Ala Thr Asp Met Ser Gly Asn Glu Val Thr Val Leu Ser ^ _^ 85 90 95 //^T E *7% / © ■ His Val Thr Val Asn Aan Lya Val Lys Lys Gin Leu Phe Tyr Glu Thr /V 100 105 110 ihs> m Thr Cys Arg Ser Pro Thr Hia Arg Ser Ser Gly lie Val lie Gly Gly \ 115 120 125 \* f \f 0 ^ ' c. f :; / , "-J I Arg Ser Gly Gly 130 Gly Gly Arg Aap 145 Thr Asp lie Tyr Trp Arg Phe lie 180 Asn Ser Trp Ser 195 (2) INFORMATION FOR SEQ ZD NO:93: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 225 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..225 (xi) SEQUENCE DESCRIPTION: SEQ ZD NO:93: CGA GTG GTC CTG TCT AGG GGT GCC GCT GCC GGG CCC CCT CTG GTC TTC 48 Arg Val Val Leu Ser Arg Gly Ala Ala Ala Gly Pro Pro Leu Val Phe 15 10 15 Arg Gly Gly Ser Gin Gly 135 lie Asp Ser Arg Tyr Trp 150 Val Ser Ala Leu Thr Val 165 170 Arg Zle Asn Ala Ser Cys 185 Ser Lys Thr Gly Asn Ser 140 Asn Ser His Cys Thr Asn 155 160 Phe Lys Glu Gin Thr Ala 175 Cys Val Ser Arg Thr 190 CTG CTG GAG ACT GGA GCC TTT CGG GAG TCA GCA GGC GCC CGG GCC AAC Leu Leu Glu Thr Gly Ala Phe Arg Glu Ser Ala Gly Ala Arg Ala Asn 20 25 30 96 CGC AGC CAG CGA GGG GTG AGC GAT ACT TCA CCG GCG AGT CAT CAG GGT Arg Ser Gin Arg Gly Val Ser Asp Thr Ser Pro Ma Ser His Gin Gly 35 40 45 144 GAG CTG GCC CTG TGC GAT GCA GTC AGT GTC TGG GTG ACA GAC CCC TGG Glu Leu Ala Leu Cys Asp Ala Val Ser Val Trp Val Thr Asp Pro Trp 50 55 60 192 ACT GCT GTG GAC TTG GGT GTG CTC GAG GTC GAG Thr Ala Val Asp Leu Gly Val Leu Glu Val Glu 65 70 75 225 (2) INFORMATION FOR SEQ ZD NO:94: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 75 amino acids (8) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ZD NO:94: Arg Val Val Leu Ser Arg Gly Ala Ala Ala Gly Pro Pro Leu Val Phe 15 10 IS Leu Leu Glu Thr Gly Ala Phe Arg Glu Ser Ala Gly Ala Arg Ala Asn 20 25 30 V "2 '24-^1 3 Arg Ser Gin Arg Gly Val Ser Asp Thr Ser Pro Ala Ser His Gin Gly 35 40 45 Glu Leu Ala Leu Cya Aap Ala Val Ser Val Trp Val Thr Aap Pro Trp 50 55 60 Thr Ala Val Asp Leu Gly Val Leu Glu Val Glu 65 70 75 (2) INFORMATION FOR SEQ ID NO:95: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 53 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:95: CCCACAAGCT TGTTGGCATC TATGGTCAGA GCCCTCACAT AAGACTGTTT TGC 53 (2) INFORMATION FOR SEQ ID NO:96: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOCOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:96: Lys Cys Asn Pro Ser Gly Ser Thr Thr Arg 15 10 (2) INFORMATION FOR SEQ ID NO:97: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:97: Arg Gly Cys Arg Gly Val Asp 1 5 (2) INFORMATION FOR SEQ ID NO:98: (i) SEQUENCE CHARACTERISTICS: _ (A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:98: Lys Gin Trp lie Ser 1 5 (2) INFORMATION FOR SEQ ID NO:99: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:99: Lys Gin Ser Tyr Val Arg 1 5 (2) INFORMATION FOR SEQ ID NO;100: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:100 Gly Pro Gly Xaa Sly Gly Gly 1 5 (2) INFORMATION FOR SEQ ID NO:101: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:101 Gly Pro Gly Val Gly Gly Gly 1 5 (2) INFORMATION FOR SEQ ID NO:102: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:102 Gly Pro Gly Ala Gly Gly Gly 1 5 (2) INFORMATION FOR SEQ ID NO:103: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:103: Glu Ser Ala Gly Glu 1 S (2) INFORMATION FOR SEQ ID NO:104: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: S amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknrwn (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:104: Asp Asn Ala Glu Glu 1 5 (2) INFORMATION FOR SEQ ID NO:105: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:105: CAGTATTTTT ACGAAACC (2) INFORMATION FOR SEQ ID NO:106: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA (Xi) SEQUENCE DESCRIPTION: SEQ ID N0:106: ACATTTCGGT TTGTTCTG (2) INFORMATION FOR SEQ ID NO:107: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic aeid (C) STRANDEDNESS: Single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:107: CAGTATTTTT ACCACACG (2) INFORMATION FOR SEQ ID NO:108: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pair* (B) TYPE: nucleic acid (C) STRANDEDNESS: single jo) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:108: ACATTTCGGT TTGTTAGC (2) INFORMATION FOR SEQ ID NO:109: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:109: TGCAGTTTCG CTCACCCCCC GTTTTAGCCG GGAAGT (2) INFORMATION FOR SEQ ID NO:110: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (o) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:110: Lys Gin Tyr Phe Tyr Glu Thr 1 5 (2) INFORMATION FOR SEQ ID NO:111: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acida (8) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:111: Trp Arg Phe lie Arg lie Asp 1 5 (2) INFORMATION FOR SEQ ID NO:112: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:112: Gly Glu Leu Ser Val Cys Asp 1 5 (2) INFORMATION FOR SEQ ID NO:113: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:113: Lys Ala Glu Ser Ala Gly 1 5 (2) INFORMATION FOR SEQ ID NO:114: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 45 base pairs (8) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:114: GGAGCGGGCT GCCGGGGAGT GGACAGGAGG CACTGGGTAT CTGAG 45 (2) INFORMATION FOR SEQ ID NO:115: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:115: Gly Gly Gly Cys Arg Gly Val Asp Arg Arg His Trp Val Ser Glu 15 10 15 (2) INFORMATION FOR SEQ ID NO:116: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 582 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown L «- T .1:'... v.' § (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..396 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:116: GTA GTT TGT CCA ATT ATG TCA CAC CAC AGA AGT AAG GTT CCT TCA CAA 48 Val Val Cys Pro lie Met Ser His His Arg Ser Lys Val Pro Ser Gin IS 10 15 AGA TCC TCT AGA GTC GCG CCC GCG ACC TGC AGG CGC AGA ACT GGT AGG 96 Arg Ser Ser Arg Val Ala Pro Ala Thr Cys Arg Arg Arg Thr Gly Arg 20 25 30 TAT GGA AGA TCC CTC GAG GTG GAG GTG TTG GGC GAG GTG CCT CCA GCT 144 Tyr Gly Arg Ser Leu Glu Val Glu Val Leu Gly Glu Val Pro Pro Ala 35 40 45 GTC GGC AGT TCC CTC CGC CAG CAC TTC TTT GTT GCC CGC TTC GAG GCC 192 Val Gly Ser Ser Leu Arg Gin His Phe Phe Val Ala Arg Phe Glu Ala 50 55 60 GAT AAA TCT GAG GAA GGT GGC CCG GGG GTA GGT GGA GGG GCT GCC GCC 240 Asp Lys Ser Glu Glu Gly Gly Pro Gly Val Gly Gly Gly Ala Ala Ala 65 70 75 80 GGG GTG TGG ACC GGG GGG CAC TGG GTG TCT GAG TGC AAG GCC AAG CAG 288 Gly Val Trp Thr Gly Gly His Trp Val Ser Glu Cys Lys Ala Lys Gin 85 90 95 TCC TAT GTG CGG GCA TTG ACC GCT GAT GCC CAG GGC CGT GTG GAC TGG 336 Ser Tyr Val Arg Ala Leu Thr Ala Asp Ala Gin Gly Arg Val Asp Trp 100 105 110 CGA TGG ATT CAA ACT GGC ACA GCC TGT GTC TGC ACA CTC CTC AGC CGG 384 Arg Trp lie Gin Thr Gly Thr Ala Cys Val Cys Thr Leu Leu Ser Arg 115 120 125 ACT GGC TGG GCC TGAGACTTAT ACCCAGGAAC TGGTCAGGCA GAAAAAGAAC 436 Thr Gly Trp Ala 130 AGAGCTGGAT GCTGAGAGAC CTCAGGGTTG GCCCAGCTGC TCTACGGACG GACCCCAGTT 496 GGGGAACTCA TGAAATCATC ACAAAATCAC AACTCTCTGA ATTTGAGCTC AATCTCTGCA 556 GGATGGGTGC CACCACATGT GGTTTT 582 (2) INFORMATION FOR SEQ ID NO:117: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 132 amino acids (B) TYPE: amino acid [ o\ (D) TOPOLOGY: linear / / a si (ii) MOLECULE TYPE: protein \ 7 o!j * "1992 */} (xi) SEQUENCE DESCRIPTION: SEQ ID NO:117: Val Val Cys Pro lie Met Ser His His Arg Ser Lys Val Pro Ser Gin 15 10 15 Arg Ser Ser Arg val Ala Pro Ala Thr Cys Arg Arg Arg Thr Gly Arg 20 25 30 Tyr Gly Arg Ser Leu Glu Val Glu Val Leu Gly Glu Val Pro Pro Ala 35 40 45 Val Gly Ser Ser Leu Arg Gin His Phe Phe Val Ala Arg Phe Glu Ala 50 55 60 Asp Lys Ser Glu Glu Gly Gly Pro Gly Val Gly Gly Gly Ala Ala Ala 65 70 75 80 Gly Val Trp Thr Gly Gly His Trp Val Ser Glu Cys Lys Ala Lys Gin 85 90 95 Ser Tyr Val Arg Ala Leu Thr Ala Asp Ala Gin Gly Arg Val Asp Trp 100 105 110 Arg Trp lie Gin Thr Gly Thr Ala Cys Val Cys Thr Leu Leu Ser Arg 115 120 125 Thr Gly Trp Ala 130 (2) INFORMATION FOR SEQ ID NO:118: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:118: CGGTACCCTC GAGCCACCAT GCTCCCTCTC CCCTCA 36 (2) INFORMATION FOR SEQ ID NO:119: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) S (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:119: CGGTACAAGC GGCCGCTTCT TGGGCATGGG TCTCAG 36 (2) INFORMATION FOR SEQ ID NO:120: E /V / (i) SEQUENCE CHARACTERISTICS: // 0\ (A) LENGTH: 36 base pairs !(_J (B) TYPE: nucleic acid ^ _ji (C) STRANDEDNESS: single \ (D) TOPOLOGY: unknown JUNi992 ZjJ (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:120: CGGTACCCTC GAGCCACCCA GGTGCTCCGA GAGATG (2) INFORMATION FOR SEQ ID NO:121: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NOsl21: GAGACCGGAA GCTTCTAGAG ATC (2) INFORMATION FOR SEQ ID NO:122: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:122 TGCAGTTTCG CTCACCCCCC GTTTCCGCCG TGATGT (2) INFORMATION FOR SEQ ID NO:123: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:123 ACATCACGGC GGAAACGGGG GGTGAGCGAA ACTGCA (2) INFORMATION FOR SEQ ID NO:124: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:124 ACTTCCCGGC TAAAACGGGG GGTGAGCGAA ACTGCA 2428 1

Claims (54)

WHAT WE CLAIM IS:

1. A medicament comprising substantially purified neurotrophin-4 (NT-4) in a pharmaceutically acceptable carrier.

2. A medicament comprising substantially purified NT-4 related peptide in a pharmaceutically acceptable carrier.

3. A medicament according to claim 1 or claim 2, wherein the protein or peptide is purified from human NT-4.

4. A medicament comprising anti-NT-4 antibody in a pharmaceutically acceptable carrier.

5. A medicament comprising an oligonucleotide in a pharmaceutically acceptable carrier, said oligonucleotide (a) consisting of at least six nucleotides, (b) comprising a sequence complementary to at least a portion of an FNA transcript of the NT-4 gene; and (c) is hybridisable to the RNA transcript.

6. Use of NT-4 or NT-4 related peptides, or derivatives thereof for the manufacture of a medicament for the treatment of infertility disorders involving oocytes.

7. Use of NT-4 or NT-4 related peptides or derivatives thereof for the manufacture of a medicament for the treatment of NT-4 related motor neuron disorder.

8. The use according to claim 7, wherein the NT-4 related motor neuron disorder is selected from the group consisting of amyotrophic lateral sclerosis, progressive spinal muscular atrophy, infantile muscular atrophy, ^ poliomyelitis, post-polio syndrome, Chariot-Marie Tooth disease, nerve f trauma or nerve injury.

9. Use of NT-4 or NT-4 related peptides or derivatives thereof for the manufacture of a medicament for promoting motor neutron survival, growth, and/or differentiation comprising exposing motor neurons to a therapeutically effective concentration of the medicament that is capable of promoting the survival, growth, and/or differentiation of motor neurons.

10. The use according to claim 8, wherein motor neurons are exposed to the medicament in vivo.

11. The medicament according to claim 1, wherein the NT-4 protein is encoded by a recombinant nucleic acid sequence as contained in bacteriophage HG7-2 as deposited with ATCC and assigned accession number 75070.

12. Use of NT-4 according to any one of claims 6 to 9, wherein the NT-4 protein is encoded by a recombinant nucleic acid sequence as contained in bacteriophage HG7-2 as deposited with ATCC and assigned accession number 75070.

13. Use of NT-4 according to any one of claims 6 to 9, wherein the NT-4 protein, NT-4 peptide or derivative is encoded by a recombinant nucleic acid molecule which is at least substantially 70% homologous to the corresponding DNA sequence as contained in bacteriophage HG7-2 as deposited with ATCC and assigned accession number 75070.

14. Use of antisense oligonucleotides to NT-4 mRNA for the manufacture of a medicament for the treatment of prostate localised disease characterised by increased transcription in prostate tissue of an NT-4 gene, relative to transcriptional levels in prostate tissue of normal patients, comprising administering to a patient an effective amount of oligonucleotide said oligonucleotide ff Q r ' (a) consisting of at least six nucleotides, f/ v 141 2428 13 (b) comprising a sequence complementary to at least a portion of an RNA transcript of the NT-4 gene; and (c) is hybridisable to the RNA transcript.

15. Use according to claim 14 wherein the prostate localised disease is benign prostatic hypertrophy.

16. Use according to claim 14, wherein the oligonucleotide comprises a sequence which is 100% complementary to the corresponding portion of the RNA transcript encoded by the DNA sequence as contained in bacteriophage HG7-2 as deposited with the ATCC and assigned accession number 75070.

17. Use according to claim 16, wherein the oligonucleotide comprises a sequence which is at least substantially 70% complementary to the corresponding portion of the RNA transcript encoded by the DNA sequence as contained in bacteriophage HG7-2 as deposited with the ATCC and assigned accession number 75070.

18. Use of NT-4 or NT-4 related peptides or derivatives for the manufacture of a medicament for the treatment of an impotence disorder involving the human prostate.

19. Use according to claim 18, wherein the NT-4 protein is encoded by a recombinant nucleic acid molecule comprising the NT-4 related DNA sequences as contained in bacteriophage HG7-2 as deposited with the ATCC and assigned accession number 75070.

20. Use according to claim 19, wherein the NT-4 protein is encoded by a recombinant nucleic acid molecule which is at least substantially 70% homologous to the corresponding DNA sequence as contained in bacteriophage HG7-2 as deposited with the ATCC and assigjpreif^T'io5 .<' ^ *" ';accession number 75070. /V;V',c ass* V 242813 142

21. Use of NT-4 or NT-4 related peptides or derivatives for the manufacture of a medicament for the treatment of an NT-4 related immunological disorder affecting neuromuscular transmission.

22. Use according to claim 21, wherein the immunological disorder is myasthenia gravis.

23. Use according to claim 21, wherein the NT-4 protein is encoded by a recombinant nucleic acid moiecule comprising NT-4 related DNA sequence as contained in bacteriophage HG7-2 as deposited with the ATCC and assigned accession number 75070.

24. Use according to claim 21, wherein the NT-4 protein is encoded by a recombinant nucleic acid molecule which is at least substantially 70% homologous to the corresponding DNA sequence as contained in bacteriophage HG7-2 as deposited with the ATCC and assigned accession number 75070. -»>- 242813

25. A method of diagnosing a motor neuron disorder in a patient comprising the steps of: (a) determining a concentration of NT-4 in a patient sample by means of an immunometric assay utilizing an anti-NT-4 antibody; (b) calculating a difference in concentration of NT-4 in the patient sample from an average concentration of NT-4 in analogous samples from normal individuals; and (d) diagnosing a motor neuron disorder when the difference between the concentration of NT-4 in the patient sample and the concentration of NT-4 in an analogous sample from at least one normal individual positively correlates with the motor neuron disorder.

26. The method of claim 25 wherein the anti-NT-4 antibody is capable of binding to an NT-4 protein encoded by a recombinant nucleic acid molecule comprising the NT-4 related DNA sequence as contained in bacteriophage HG7-2 as deposited with the ATCC and assigned accession-ftunbeg- 75Q70. N.Z. PATENT OFFICE 13 FEB 1995 RECEIVD - 144 - 242 8 1

27. The method of claim 25 wherein the anti-NT-4 antibody is capable of binding to an NT-4 protein encoded by a recombinant nucleic acid molecule at least 70% homologous to the corresponding DNA sequence as contained in bacteriophage HG7-2 as deposited with the ATCC and assigned accession number 75070.

28. A diagnostic kit for detecting retrograde transport in a motor neuron comprising in a suitable container a detectably labeled NT-4 protein, derivative or peptide fragment.

29. The diagnostic kit of claim 28 wherein the detectably labeled NT-4 protein, derivative or peptide fragment is encoded by a recombinant nucleic acid molecule comprising the NT-4 related DNA sequence as contained in bacteriophage HG7-2 as deposited with the ATCC and assigned accession number 75070.

30. The diagnostic kit of claim 28 wherein the detectably labeled NT-4 protein, derivative or peptide fragment is encoded bv a nucleic acid fragment at least substantially 70% homologous to the corresponding DNA sequence as contained in bacteriophage HG7-2 as deposited with the ATCC and assigned accession number 75070.

31. A chimeric prepro protein comprising (a) an amino acid sequence of a prepro region of a neurotrophin other than NT-4; (b) an amino acid sequence of a prepro region of a mature form of em NT-4 related protein.

32. The chimeric prepro protein of claim 31 wherein the amino acid sequence of the mature form of an NT-4 related protein is encoded by a recombinant nucleic acid molecule comprising at least a portion of the DNA sequence encoding NT-4 as contained in bacteriophage HG7-2 as deposited with the ATCC and assigned accession number 75070. 242813

33. The chimeric prepro protein of claim 31 in which the neurotrophin other than NT-4 is nerve growth factor, brain-derived neurotrophic factor, or neurotrophin-3.

34. The chimeric prepro protein of claim 31 wherein the prepro region of the other than NT-4 neurotrophin is derived from Xenopus NT-4.

35. The chimeric prepro protein of claim 31 wherein the prepro region of the other than NT-4 neurotrophin is derived from human NT-3.

36. a nucleic acid molecule comprising a nucleotide sequence which encodes the chimeric prepro f protein of claim 31.

37. A DNA vector that is pCMX-hNT3/hNT4 as deposited with the ATCC, having accession number 75133.

38. A DNA vector that is pCMX-xNT4/hNT4.

39. The substantially pure recombinant NT-4 protein encoded by the DNA vector of claim 37.

40. The substantially pure recombinant NT-4 protein encoded by the DNA vector of claim 38.

41. A method of producing NT-4 comprising growing a recombinant cell containing the nucleic acid molecule of claim 35, tinder conditions such that the chimeric prepro protein is expressed and processed by the cell to produpo the mature.,..fjQna of KT-4. N.2. F'ATEWT Oi-HCf. 13 FEB 1995 RECEIVED - 146 - 242813

42. A medicament according to claim 1 substantially as herein described or exemplified.

43. A use according to cl.aim 7 substantially as herein described or exemplified.

44. a use according to claim 9 substantially as herein described or exemplified.

45. A use according to claim 14 substantially as herein described or exemplified.

46. A method according to claim 25 substantially as herein described or exemplified.

47. A diagnostic kit according to claim 28 substantially as herein described or exemplified.

48. a chimeric prepro protein according to claim 31 substantially as herein described or exemplified.

49. A nucleic acid according to claim acid according to claim 36 substantially as herein described or exemplified.

50. A DNA vector according to claim 37 substantially as herein described or exemplified.

51. A DNA vector according to claim 38 substantially as herein 13 FEB 1995 d . 1 242813

52. A substantially pure recombinant NT-4 protein according to claim 39 substantially as herein described or exemplified.

53. A use according to claim 21 substantially as herein described or exemplified.

54. A method according to claim 41 substantially as herein described or exemplified. REGENERON PHARMACEUTICALS, INC.; FINN HALLBOOK; CARLOS FERNANDO IBANEZ MOLINER; HAKEN BENGT PERSSON By Their Attorneys HENRY HUGHES Per:(^£R_<__ . n