PL248968B1 - A pair of oligonucleotide primers for detection and a method for detecting the dominant and recessive allele of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line obtained by crossing Avena sterilis Wahl No. 8 x Avena sativa in common oat (Avena sativa L.) plants - Google Patents

Abstract

The invention is a pair of oligonucleotide primers for detecting the dominant and recessive alleles of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa in oat plants with sequences no. 1 and 2 presented in the sequence listing. The invention also provides a method for identifying the dominant and recessive alleles of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa in oat plants, in which a polymorphic DNA fragment linked to the gene under study is amplified in a PCR reaction using a pair of primers, followed by detection of the amplification product, and the pair of primers is a pair of oligonucleotides with sequences no. 1 and 2 presented in the sequence list, where marker 821 is used. As a result of PCR, a DNA fragment of 106 base pairs in length is amplified with sequence no. 3 presented in the sequence list in the presence of a dominant allele or a DNA fragment of 115 base pairs in length with sequence no. 4 presented in the sequence list in the presence of a recessive allele.

Description

Description of the invention

The subject of the invention is a pair of oligonucleotide primers for detecting the dominant and recessive allele of the crown rust resistance gene derived from a subline isolated from the Iowa X270/X434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa, in oat plants with sequences No. 1 and 2, presented in the sequence listing.

Oats (Avena sativa L.) are becoming increasingly important economically due to their health benefits. Poland is the world's fourth-largest producer of this cereal, and one of the main factors limiting yields is diseases caused by fungal pathogens. Crown rust, caused by the fungus Puccinia coronata Cda. f. sp. avenae P. Syd. & Syd., is a fungal disease that appears annually and causes significant yield losses. Polish oat varieties have a very high yield potential, however, they are characterized by low resistance to diseases, including crown rust (Sowa, S., Paczos-Grzęda, E., 2020. A study of crown rust resistance in historical and modern oat cultivars representing 120 years of Polish oat breeding. Euphytica 216, 1-10; Koroluk A. Paczos-Grzęda E., Sowa S., Boczkowska M., Toporowska J. 2022. Diversity of Polish oat cultivars with a glance at breeding history and perspectives. Agronomy-Basel Vol. 12 (10)2423). The resistance gene from the subline isolated from the Iowa X270/X434 line, obtained as a result of crossing A. sterilis Wahl No. 8 x A. sativa can be successfully used in resistance breeding of oats, constituting a promising independent resistance gene in terms of effectiveness and durability, as well as a component of gene pyramids in new varieties (Paczos-Grzęda, E., Róg, S., Koroluk, A., Okoń, S., Ostrowska, A., Ociepa, T., Erdzik, P., Chrząstek, M., Kowalczyk K., 2014. Virulence structure of Puccinia coronata f. sp. avenae in Central and South Eastern Poland 2020; Paczos-Grzęda, E., Sowa, S., 2019, Virulence structure and diversity of Puccinia coronata f. sp. avenae P. syd. & syd. in Poland during 2013 to 2015. Plant Dis. 103, 1559-1564; Sowa, S., Paczos-Grzęda, E., 2017. Puccinia coronata f. sp. avenae virulence in southeastern Poland in 2014. Folia Pomer. Univ, Technol. Stetin., Agric., Aliment. Pisc., Zootech. 336:43, 157-166; Sowa, S., Paczos-Grzęda, E., 2021. Virulence structure of Puccinia coronata f. sp. avenae and effectiveness of Pc resistance genes in Poland during 2017-2019. Phytopathology Vol. 111, No. 7 pp. 1158-1165). The introduction of monogenic resistance into breeding materials can be supported by the use of molecular markers. PCR-based DNA markers are a key element of modern molecular breeding. Markers are a particularly useful tool in resistance breeding, enabling reliable and rapid identification of forms containing specific gene alleles at an early stage of plant development.

The aim of the invention was to find a pair of oligonucleotides that would enable simultaneous identification of the dominant and recessive alleles of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa, in oat plants both at the seedling and adult plant stages.

The subject of the invention is a pair of oligonucleotide primers for detecting the dominant and recessive allele of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa, in oat plants with sequences No. 1 and 2, presented in the sequence listing.

Method of identifying the dominant and recessive alleles of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line obtained by crossing A. sterilis Wahl No. 8 x A. sativa in oat plants, in which a polymorphic DNA fragment coupled to the gene under investigation is amplified in a PCR reaction using a pair of primers, and then the amplification product is detected, characterized in that the pair of primers is a pair of oligonucleotides with sequences No. 1 and 2, presented in the sequence list, wherein marker 821 is used, presented in Fig. 1-2, of 106 bp length associated with the presence in oat plants of a dominant allele (sequence No. 3 in the sequence list) or of 115 bp length associated with the presence in oat plants of a recessive allele (sequence No. 4 in the sequence list) of the crown rust resistance gene derived from a subline isolated from the Iowa X270/X434 line, obtained as a result of crossing A. sterilis Wahl No. 8 x A. sativa.

Figure 1 shows the PCR products obtained by DNA amplification of F2 generation plants of populations 634 (Iowa subline X270/X434 x ‘Bingo’) and 635 (Iowa subline Χ270/Χ434 x ‘Chestnut’) after incorporating primer pairs no. 1 and 2, presented in the sequence list, into the reaction.

1-24 - plant numbers from population 634 (Iowa subline Χ270/Χ434 x ‘Bingo’) marked with respect to the phenotype: numbers 1-10 - homozygotes resistant; numbers 11-20 - homozygotes susceptible to infection; numbers 21-24 - heterozygotes; 25-45 - plant numbers from population 635 (Iowa subline X270/X434 x ‘Chestnut’) marked with respect to the phenotype: numbers 25-34 - homozygotes resistant; numbers 35-44 - homozygotes susceptible to infection; number 45 - heterozygote; parental forms of the examined populations: P1 - Avena sterilis Wahl No. 8 x Iowa isolines X270/X434, P2 - ‘Bingo’, P3 - ‘Chestnut’.

Figure 2 shows the PCR products obtained by amplification of DNA from F2 generation plants of populations 634 (Iowa subline Χ270/Χ434 x ‘Bingo’) and 635 (Iowa subline Χ270/Χ434 x ‘Chestnut’) after incorporating primer pairs no. 1 and 2, presented in the sequence list, into the reaction.

46-93 - plant numbers of population 635 (Iowa subline Χ270/Χ434 x ‘Chestnut’) marked with respect to phenotype: numbers 46-68 - homozygotes resistant; numbers 69-91 - homozygotes susceptible to infection; numbers 92-93 - heterozygotes; 94-141 - plant numbers of population 634 (Iowa subline X270/X434 x ‘Bingo’) marked with respect to phenotype: numbers 94-106 - homozygotes resistant; numbers 107-127 - homozygotes susceptible to infection; numbers 128-141 - heterozygotes.

In the first stage, two hybrid populations were generated: 634 ('Iowa subline Χ270/Χ434 x Bingo') and 635 (Iowa subline Χ270/Χ434 x 'Chestnut'), in which the donor of the oat crown rust resistance gene is the Iowa X434 subline, a hybrid form obtained by crossing A. sterilis Wahl No. 8 x A. sativa. Then, using a physiological test conducted on F3 generation lines, homozygous, dominant plants were identified as resistant; heterozygous plants were identified as segregating for crown rust resistance; and homozygous, recessive plants were identified as susceptible to the disease in a 1:2:1 ratio, corresponding to monogenic inheritance. After DNA isolation from plants with opposing phenotypes (resistant/infected) and heterozygotes, they were subjected to commercial DArTseq polymorphism analysis (Diversity Array Technologies Ltd., Canberra, Australia), which involves sequencing a reduced representation of the genome. The results were obtained in the form of binary arrays for 90 plants. After assigning the segregation of phenotypes and genotypes to the segregation of DArTseq markers, DArTseq sequences were identified, which, after being located on the genome of the common oat variety Sang (https://wheat.pw.usda.gov/blast/; Kamal, N., Tsardakas-Renhuldt, N., Bentzer, J. et al. 2022. The mosaic oat genome gives insights into a uniquely healthy cereal crop. Nature 606, 113-119), were extended at the 5' and 3' ends and became the basis for designing the appropriate primer pairs no. 1 and 2, presented in the sequence list.

Using oligonucleotide primers No. 1 and 2, presented in the sequence list, a codominant marker 821 was obtained (Fig. 1-2), which simply and quickly identifies oat plants carrying the dominant and/or recessive allele of the crown rust resistance gene from the subline isolated from the Iowa Χ270/Χ434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa. Marker 821, developed based on the results of segregation analysis of the 106 bp or 115 bp product 821, showed genetic linkage with the crown rust resistance gene locus from the subline isolated from the Iowa X270/X434 line, is specific, based on PCR, and generates easy-to-interpret and reproducible results, enabling its use in marker-assisted selection.

The studies on marker 821 showed that it is a codominant marker of both the dominant and recessive alleles of the rust resistance gene from the subline isolated from the Iowa X270/X434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa in common oats.

The use of the codominant marker 821 may be useful for identifying the crown rust resistance gene from a subline isolated from the Iowa Χ270/Χ434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa present in oat breeding materials. The primary advantage of the developed identification system is the ability to determine the plant genotype in a very short time, already at the stage of a few-day-old seedling, independence from environmental conditions and the plant development stage, and independence from the presence or absence of infection with a specific isolate of Puccinia coronata f. sp. avenae.

Marker identification method 821

Material:

DNA isolated from oat leaves using commercially available kits.

PL 248968 Β1

Composition of the mixture in the PCR (Polymerase Chain Reaction) reaction:

DNA 10-50 ng 2x PCR Master Mix (Thermo Fisher Scientific) lx Starter 82l_F2 (sequence no. 1) 0.1 -0.5 μM Primer 821_R2a (sequence no. 2) OJ -0.5 μM H ₂ O Depending on the volume of the final PCR mixture

Primer sequences:

Sequence No. 1: 821_F2 5' GTCGATGCAGCCGACGTGG 3'

Sequence No. 2: 821_R2a 5' GCCTTCTTCCCGCCAAGGA 3'

Primers were designed using Primer 3.0.

DNA amplification conditions

The PCR reaction was performed in thermal cyclers: SimpliAmp (Applied Biosystems) or ProFlex (Applied Biosystems)

PCR reaction thermal profile: 94°C - 4 min., 37 cycles (94°C - 30 s., 60°C - 30 s., 72°C - 45 s.), 72°C-7 min.

Marker 821 identification:

Electrophoresis was carried out on a 1.5% agarose gel containing 0.5 pg/ml ethidium bromide in TBE buffer (pH 8.0) at 100 V for 2 hours. GeneRuler™ 50 bp plus DNA Ladder (ThermoFisher Scientific, USA) was used as a DNA fragment length standard. Marker visualization was performed using the Uvidoc HD6 system (Uvitec, Cambridge, UK).

Results:

Testing of marker 821 on individuals from populations 634 (Iowa subline Χ270/Χ434 x ‘Bingo’) and 635 (Iowa subline Χ270/Χ434 x ‘Chestnut’) showed high concordance segregating with the dominant and recessive alleles for oat crown rust resistance. From 300 tested plants representing populations 634 (‘Iowa subline Χ270/Χ434 x Bingo’) and 635 (Iowa subline Χ270/Χ434 x ‘Chestnut’), 141 plants were randomly selected, along with the parental forms ‘Bingo’, ‘Chestnut’, and Pc51U (Iowa subline Χ270/Χ434). Of the 141 tested plants, 89% were correctly classified. Of the 141 plants tested, 72 were from population 634 ('Iowa subline Χ270/Χ434 x Bingo') and showed a 12.50% genotype-phenotype mismatch (Fig. 2), 69 of the 141 plants tested were from population 635 ('Iowa subline Χ270/Χ434 x 'Chestnut') and showed a 10.14% genotype-marker mismatch (Fig. 2). A dominant allele of 106 bp was found in Pc51U of the Iowa subline Χ270/Χ434, while a recessive allele in the form of a 115 bp amplicon was found in the parental forms 'Bingo' and 'Chestnut'. The electropherogram shows amplified DNA fragments after including primer pairs No. 1 and 2 in the analysis, presented in the sequence list, proving the presence in the tested genotypes of the dominant or recessive allele of the crown rust resistance gene from the subline isolated from the Iowa Χ270/Χ434 line, obtained as a result of crossing A. sterilis Wahl No. 8 x A. sativa.

PL 248968 Β1

SEQUENCE LIST

Sequence No. 1 (Starter 821F2)

5' GTCGATGCAGCCGACGTGG 3'

Sequence No. 2 (Starter 821_R2a)

5' GCCTTCTTCGCCAAGGA 3'

Sequence no. 3 - dominant allele - 106 bp

5' GTCGATGCAGCCGACGTGGCGGCACGCCTGGAGCAGCCGCCCCAGCTGGCC

GTCCTCCATCTCCCCGAGGCACACCGCGCAATGCTCCTCCTTGGCGGAAGAAG

GC 3'

Sequence no. 4 - recessive allele - 115 bp

5' GTCGATGCAGCCGACGTGGAACACGTGGCGGCACGCCTGGAGCAGCCGCCC CAGCTGGCCGTCCTCCATCTCCCCGAGGCACACCGCGCAATGCTCCTCCTTGGC

GGAAGAAGGC 3’

Claims (3)

Patent claims 1. A pair of oligonucleotide primers for detecting the dominant and recessive alleles of the crown rust resistance gene from the subline isolated from the Iowa Χ270/Χ434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa in common oat plants with sequence numbers 1 and 2, presented in the sequence list. 2. A method for identifying the dominant and recessive alleles of the crown rust resistance gene from a subline isolated from the Iowa Χ270/Χ434 line obtained by crossing A. sterilis Wahl No. 8 x A. sativa in common oat plants, wherein a polymorphic DNA fragment linked to the gene under study is amplified in a PCR reaction using a pair of primers, followed by detection of the amplification product, characterized in that the pair of primers is a pair of oligonucleotide primers with sequences no. 1 and 2, shown in the sequence list, wherein marker 821, shown in Fig. 1-2, is used. 3. The method according to claim 2, characterized in that as a result of the PCR reaction, a DNA fragment of 106 base pairs in length with sequence No. 3 shown in the sequence list in the presence of a dominant allele or a DNA fragment of 115 base pairs in length with sequence No. 4 shown in the sequence list in the presence of a recessive allele is amplified.