PL248968B1 - A pair of oligonucleotide primers for detection and a method for detecting the dominant and recessive allele of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line obtained by crossing Avena sterilis Wahl No. 8 x Avena sativa in common oat (Avena sativa L.) plants - Google Patents
A pair of oligonucleotide primers for detection and a method for detecting the dominant and recessive allele of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line obtained by crossing Avena sterilis Wahl No. 8 x Avena sativa in common oat (Avena sativa L.) plantsInfo
- Publication number
- PL248968B1 PL248968B1 PL449128A PL44912824A PL248968B1 PL 248968 B1 PL248968 B1 PL 248968B1 PL 449128 A PL449128 A PL 449128A PL 44912824 A PL44912824 A PL 44912824A PL 248968 B1 PL248968 B1 PL 248968B1
- Authority
- PL
- Poland
- Prior art keywords
- iowa
- subline
- pair
- dominant
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Przedmiot wynalazku stanowi para oligonukleotydowych starterów do wykrywania allelu dominującego i recesywnego genu odporności na rdzę koronową z sublinii wyodrębnionej z linii Iowa X270/X434, uzyskanej w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa w roślinach owsa o sekwencjach nr 1 i 2 przedstawionych na liście sekwencji. Przedmiotem wynalazku jest ponadto sposób identyfikacji allelu dominującego i recesywnego genu odporności na rdzę koronową z sublinii wyodrębnionej z linii Iowa X270/X434, uzyskanej w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa w roślinach owsa, w którym polimorficzny fragment DNA sprzężony z badanym genem amplifikowany jest w reakcji PCR z zastosowaniem pary starterów, po czym dokonuje się detekcji produktu amplifikacji, a parę starterów stanowi para oligonukleotydów o sekwencjach nr 1 i 2 przedstawionych na liście sekwencji, przy czym stosuje się marker 821. W wyniku PCR amplifikowany jest fragment DNA o długości 106 par zasad o sekwencji nr 3 przedstawionej na liście sekwencji w obecności allelu dominującego lub fragmentu DNA o długości 115 par zasad o sekwencji nr 4, przedstawionej na liście sekwencji w obecności allelu recesywnego.The invention is a pair of oligonucleotide primers for detecting the dominant and recessive alleles of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa in oat plants with sequences no. 1 and 2 presented in the sequence listing. The invention also provides a method for identifying the dominant and recessive alleles of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa in oat plants, in which a polymorphic DNA fragment linked to the gene under study is amplified in a PCR reaction using a pair of primers, followed by detection of the amplification product, and the pair of primers is a pair of oligonucleotides with sequences no. 1 and 2 presented in the sequence list, where marker 821 is used. As a result of PCR, a DNA fragment of 106 base pairs in length is amplified with sequence no. 3 presented in the sequence list in the presence of a dominant allele or a DNA fragment of 115 base pairs in length with sequence no. 4 presented in the sequence list in the presence of a recessive allele.
Description
Opis wynalazkuDescription of the invention
Przedmiot wynalazku stanowi para oligonukleotydowych starterów do wykrywania allelu dominującego i recesywnego genu odporności na rdzę koronową pochodzącego z sublinii wyodrębnionej z linii Iowa X270/X434, uzyskanej w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa, w roślinach owsa o sekwencjach nr 1 i 2, przedstawionych na liście sekwencji.The subject of the invention is a pair of oligonucleotide primers for detecting the dominant and recessive allele of the crown rust resistance gene derived from a subline isolated from the Iowa X270/X434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa, in oat plants with sequences No. 1 and 2, presented in the sequence listing.
Owies (Avena sativa L.) ma coraz większe znaczenie gospodarcze z uwagi na jego walory prozdrowotne. Polska jest czwartym producentem na świecie tego zboża, a jednym z głównych czynników ograniczających plonowanie są choroby wywoływane przez patogeny grzybowe. Pojawiającą się rokrocznie chorobą grzybową będącą przyczyną znaczących strat w plonach jest rdza koronowa powodowana przez grzyb Puccinia coronata Cda. f. sp. avenae P. Syd. & Syd. Polskie odmiany owsa mają bardzo wysoki potencjał plonowania jednak charakteryzują się niską odpornością na choroby, w tym rdzę koronową (Sowa, S., Paczos-Grzęda, E., 2020. A study of crown rust resistance in historical and modern oat cultivars representing 120 years of Polish oat breeding. Euphytica 216, 1-10; Koroluk A. Paczos-Grzęda E., Sowa S., Boczkowska M., Toporowska J. 2022. Diversity of Polish oat cultivars with a glance at breeding history and perspectives. Agronomy-Basel Vol. 12 (10)2423). Gen odporności z sublinii wyodrębnionej z linii Iowa X270/X434, uzyskanej w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa może być z powodzeniem wykorzystywany w hodowli odpornościowej owsa, stanowiąc obiecujący pod względem efektywności i trwałości samodzielny gen odporności, jak również komponent piramid genowych w nowych odmianach (Paczos-Grzęda, E., Róg, S., Koroluk, A., Okoń, S., Ostrowska, A., Ociepa, T., Erdzik, P., Chrząstek, M., Kowalczyk K., 2014. Virulence structure of Puccinia coronata f. sp. avenae in Central and South Eastern Poland 2020; Paczos-Grzęda, E., Sowa, S., 2019, Virulence structure and diversity of Puccinia coronata f. sp. avenae P. syd. & syd. in Poland during 2013 to 2015. Plant Dis. 103, 1559-1564; Sowa, S., Paczos-Grzęda, E., 2017. Puccinia coronata f. sp. avenae virulence in south-eastern Poland in 2014. Folia Pomer. Univ, Technol. Stetin., Agric., Aliment. Pisc., Zootech. 336:43, 157-166; Sowa, S., Paczos-Grzęda, E., 2021. Virulence structure of Puccinia coronata f. sp. avenae and effectiveness of Pc resistance genes in Poland during 2017-2019. Phytopathology Vol. 111, No. 7 s. 1158-1165). Wprowadzanie do materiałów hodowlanych odporności warunkowanej monogenicznie można wspomagać wykorzystując markery molekularne. Bazujące na metodzie PCR markery DNA są kluczowym elementem współczesnej hodowli molekularnej. Markery stanowią szczególnie użyteczne narzędzie w hodowli odpornościowej umożliwiając pewną i szybką identyfikację form zawierających określone allele genów na wczesnym etapie rozwoju rośliny.Oats (Avena sativa L.) are becoming increasingly important economically due to their health benefits. Poland is the world's fourth-largest producer of this cereal, and one of the main factors limiting yields is diseases caused by fungal pathogens. Crown rust, caused by the fungus Puccinia coronata Cda. f. sp. avenae P. Syd. & Syd., is a fungal disease that appears annually and causes significant yield losses. Polish oat varieties have a very high yield potential, however, they are characterized by low resistance to diseases, including crown rust (Sowa, S., Paczos-Grzęda, E., 2020. A study of crown rust resistance in historical and modern oat cultivars representing 120 years of Polish oat breeding. Euphytica 216, 1-10; Koroluk A. Paczos-Grzęda E., Sowa S., Boczkowska M., Toporowska J. 2022. Diversity of Polish oat cultivars with a glance at breeding history and perspectives. Agronomy-Basel Vol. 12 (10)2423). The resistance gene from the subline isolated from the Iowa X270/X434 line, obtained as a result of crossing A. sterilis Wahl No. 8 x A. sativa can be successfully used in resistance breeding of oats, constituting a promising independent resistance gene in terms of effectiveness and durability, as well as a component of gene pyramids in new varieties (Paczos-Grzęda, E., Róg, S., Koroluk, A., Okoń, S., Ostrowska, A., Ociepa, T., Erdzik, P., Chrząstek, M., Kowalczyk K., 2014. Virulence structure of Puccinia coronata f. sp. avenae in Central and South Eastern Poland 2020; Paczos-Grzęda, E., Sowa, S., 2019, Virulence structure and diversity of Puccinia coronata f. sp. avenae P. syd. & syd. in Poland during 2013 to 2015. Plant Dis. 103, 1559-1564; Sowa, S., Paczos-Grzęda, E., 2017. Puccinia coronata f. sp. avenae virulence in southeastern Poland in 2014. Folia Pomer. Univ, Technol. Stetin., Agric., Aliment. Pisc., Zootech. 336:43, 157-166; Sowa, S., Paczos-Grzęda, E., 2021. Virulence structure of Puccinia coronata f. sp. avenae and effectiveness of Pc resistance genes in Poland during 2017-2019. Phytopathology Vol. 111, No. 7 pp. 1158-1165). The introduction of monogenic resistance into breeding materials can be supported by the use of molecular markers. PCR-based DNA markers are a key element of modern molecular breeding. Markers are a particularly useful tool in resistance breeding, enabling reliable and rapid identification of forms containing specific gene alleles at an early stage of plant development.
Celem wynalazku było znalezienie takiej pary oligonukleotydów, która umożliwiłaby jednoczesną identyfikację allelu dominującego i recesywnego genu odporności na rdzę koronową z sublinii wyodrębnionej z linii Iowa X270/X434, uzyskanej w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa, w roślinach owsa zarówno w stadium siewki, jak i rośliny dorosłej.The aim of the invention was to find a pair of oligonucleotides that would enable simultaneous identification of the dominant and recessive alleles of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa, in oat plants both at the seedling and adult plant stages.
Przedmiot wynalazku stanowi para oligonukleotydowych starterów do wykrywania allelu dominującego i recesywnego genu odporności na rdzę koronową z sublinii wyodrębnionej z linii Iowa X270/X434, uzyskanej w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa, w roślinach owsa o sekwencjach nr 1 i 2, przedstawionych na liście sekwencji.The subject of the invention is a pair of oligonucleotide primers for detecting the dominant and recessive allele of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa, in oat plants with sequences No. 1 and 2, presented in the sequence listing.
Sposób identyfikacji allelu dominującego i recesywnego genu odporności na rdzę koronową z sublinii wyodrębnionej z linii Iowa X270/X434, uzyskanej w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa w roślinach owsa, w którym to sposobie polimorficzny fragment DNA sprzężony z badanym genem amplifikowany jest w reakcji PCR z zastosowaniem pary starterów, po czym dokonuje się detekcji produktu amplifikacji, charakteryzuje się tym, że parę starterów stanowi para oligonukleotydów o sekwencjach nr 1 i 2, przedstawionych na liście sekwencji, przy czym stosuje się marker 821, przedstawiony na Fig. 1-2, o długości 106 pz związany z obecnością w roślinach owsa allelu dominującego (sekwencja nr 3 na liście sekwencji) lub o długości 115 pz związany z obecnością w roślinach owsa allelu recesywnego (sekwencja nr 4 na liście sekwencji) genu odporności na rdzę koronową pochodzącego z sublinii wyodrębnionej z linii Iowa X270/X434, uzyskanej w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa.Method of identifying the dominant and recessive alleles of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line obtained by crossing A. sterilis Wahl No. 8 x A. sativa in oat plants, in which a polymorphic DNA fragment coupled to the gene under investigation is amplified in a PCR reaction using a pair of primers, and then the amplification product is detected, characterized in that the pair of primers is a pair of oligonucleotides with sequences No. 1 and 2, presented in the sequence list, wherein marker 821 is used, presented in Fig. 1-2, of 106 bp length associated with the presence in oat plants of a dominant allele (sequence No. 3 in the sequence list) or of 115 bp length associated with the presence in oat plants of a recessive allele (sequence No. 4 in the sequence list) of the crown rust resistance gene derived from a subline isolated from the Iowa X270/X434 line, obtained as a result of crossing A. sterilis Wahl No. 8 x A. sativa.
Fig. 1 przedstawia produkty PCR uzyskane w wyniku amplifikacji DNA roślin pokolenia F2 populacji 634 (sublinia Iowa X270/X434 x ‘Bingo’) oraz 635 (sublinia Iowa Χ270/Χ434 x ‘Kasztan’) po włączeniu do reakcji pary starterów nr 1 i 2, przedstawionych na liście sekwencji.Figure 1 shows the PCR products obtained by DNA amplification of F2 generation plants of populations 634 (Iowa subline X270/X434 x ‘Bingo’) and 635 (Iowa subline Χ270/Χ434 x ‘Chestnut’) after incorporating primer pairs no. 1 and 2, presented in the sequence list, into the reaction.
1-24 - numery roślin populacji 634 (sublinia Iowa Χ270/Χ434 x ‘Bingo’) zaznaczone pod względem fenotypu: numery 1-10 - homozygoty odporne; numery 11-20 - homozygoty wrażliwe na porażenie; numery 21-24 - heterozygoty; 25-45 - numery roślin populacji 635 (sublinia Iowa X270/X434 x ‘Kasztan’) zaznaczone pod względem fenotypu: numery 25-34 - homozygoty odporne; numery 35-44 - homozygoty wrażliwe na porażenie; numer 45 - heterozygota; formy rodzicielskie badanych populacji: P1 - Avena sterilis Wahl No. 8 x Iowa isolines X270/X434, P2 - ‘Bingo’, P3 - ‘Kasztan’.1-24 - plant numbers from population 634 (Iowa subline Χ270/Χ434 x ‘Bingo’) marked with respect to the phenotype: numbers 1-10 - homozygotes resistant; numbers 11-20 - homozygotes susceptible to infection; numbers 21-24 - heterozygotes; 25-45 - plant numbers from population 635 (Iowa subline X270/X434 x ‘Chestnut’) marked with respect to the phenotype: numbers 25-34 - homozygotes resistant; numbers 35-44 - homozygotes susceptible to infection; number 45 - heterozygote; parental forms of the examined populations: P1 - Avena sterilis Wahl No. 8 x Iowa isolines X270/X434, P2 - ‘Bingo’, P3 - ‘Chestnut’.
Fig. 2 przedstawia produkty PCR uzyskane w wyniku amplifikacji DNA roślin pokolenia F2 populacji 634 (sublinia Iowa Χ270/Χ434 x ‘Bingo’) oraz 635 (sublinia Iowa Χ270/Χ434 x ‘Kasztan’) po włączeniu do reakcji pary starterów nr 1 i 2, przedstawionych na liście sekwencji.Figure 2 shows the PCR products obtained by amplification of DNA from F2 generation plants of populations 634 (Iowa subline Χ270/Χ434 x ‘Bingo’) and 635 (Iowa subline Χ270/Χ434 x ‘Chestnut’) after incorporating primer pairs no. 1 and 2, presented in the sequence list, into the reaction.
46-93 - numery roślin populacji 635 (sublinia Iowa Χ270/Χ434 x ‘Kasztan’) zaznaczone pod względem fenotypu: numery 46-68 - homozygoty odporne; numery 69-91 - homozygoty wrażliwe na porażenie; numery 92-93 - heterozygoty; 94-141 - numery roślin populacji 634 (sublinia Iowa X270/X434 x ‘Bingo’) zaznaczone pod względem fenotypu: numery 94-106 - homozygoty odporne; numery 107-127 - homozygoty wrażliwe na porażenie; numery 128-141 - heterozygoty.46-93 - plant numbers of population 635 (Iowa subline Χ270/Χ434 x ‘Chestnut’) marked with respect to phenotype: numbers 46-68 - homozygotes resistant; numbers 69-91 - homozygotes susceptible to infection; numbers 92-93 - heterozygotes; 94-141 - plant numbers of population 634 (Iowa subline X270/X434 x ‘Bingo’) marked with respect to phenotype: numbers 94-106 - homozygotes resistant; numbers 107-127 - homozygotes susceptible to infection; numbers 128-141 - heterozygotes.
W pierwszym etapie wytworzono 2 populacje mieszańcowe 634 (‘sublinia Iowa Χ270/Χ434 x Bingo’) i 635 (sublinia Iowa Χ270/Χ434 x ‘Kasztan’), w których dawcą genu odporności na rdzę koronową owsa jest sublinia Iowa X434, będąca formą mieszańcową uzyskaną w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa. Następnie za pomocą testu fizjologicznego prowadzonego na liniach pokolenia F3 zidentyfikowano rośliny homozygotyczne, dominujące - odporne; rośliny heterozygotyczne - segregujące pod względem odporności na rdzę koronową oraz rośliny hom ozygotyczne, recesywne - wrażliwe na porażenie w stosunku ilościowym 1:2:1 odpowiadającym dziedziczeniu monogenicznemu. Po wyizolowaniu DNA z roślin o przeciwstawnych fenotypach (odpornych/porażonych) oraz heterozygot poddano je komercyjnej analizie polimorfizmu DArTseq (Diversity Array Technologies Ltd. Canberra, Australia) polegającej na sekwencjonowaniu zredukowanej reprezentacji genomu. Wyniki uzyskano w postaci macierzy binarnych dla 90 roślin. Po przyporządkowaniu segregacji fenotypów i genotypów do segregacji markerów DArTseq zidentyfikowano sekwencje DArTseq, które po zlokalizowaniu na genomie odmiany owsa zwyczajnego Sang (https://wheat.pw.usda.gov/blast/; Kamal, N., Tsardakas-Renhuldt, N., Bentzer, J. et al. 2022. The mosaic oat genome gives insights into a uniquely healthy cereal crop. Nature 606, 113-119) wydłużono na końcach 5’ oraz 3’ i stały się one podstawą do zaprojektowania odpowiednich par starterów nr 1 i 2, przedstawionych na liście sekwencji.In the first stage, two hybrid populations were generated: 634 ('Iowa subline Χ270/Χ434 x Bingo') and 635 (Iowa subline Χ270/Χ434 x 'Chestnut'), in which the donor of the oat crown rust resistance gene is the Iowa X434 subline, a hybrid form obtained by crossing A. sterilis Wahl No. 8 x A. sativa. Then, using a physiological test conducted on F3 generation lines, homozygous, dominant plants were identified as resistant; heterozygous plants were identified as segregating for crown rust resistance; and homozygous, recessive plants were identified as susceptible to the disease in a 1:2:1 ratio, corresponding to monogenic inheritance. After DNA isolation from plants with opposing phenotypes (resistant/infected) and heterozygotes, they were subjected to commercial DArTseq polymorphism analysis (Diversity Array Technologies Ltd., Canberra, Australia), which involves sequencing a reduced representation of the genome. The results were obtained in the form of binary arrays for 90 plants. After assigning the segregation of phenotypes and genotypes to the segregation of DArTseq markers, DArTseq sequences were identified, which, after being located on the genome of the common oat variety Sang (https://wheat.pw.usda.gov/blast/; Kamal, N., Tsardakas-Renhuldt, N., Bentzer, J. et al. 2022. The mosaic oat genome gives insights into a uniquely healthy cereal crop. Nature 606, 113-119), were extended at the 5' and 3' ends and became the basis for designing the appropriate primer pairs no. 1 and 2, presented in the sequence list.
Z udziałem oligonukleotydowych starterów nr 1 i 2, przedstawionych na liście sekwencji, uzyskano kodominujący marker 821 (Fig. 1-2), który w prosty i szybki sposób identyfikuje rośliny owsa posiadające allel dominujący i/lub recesywny genu odporności na rdzę koronową z sublinii wyodrębnionej z linii Iowa Χ270/Χ434, uzyskanej w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa. Marker 821 opracowany w oparciu o wyniki analizy segregacji produktu 821 o długości 106 pz lub 115 pz, wykazywał sprzężenie genetyczne z locus genu odporności na rdzę koronową z sublinii wyodrębnionej z linii Iowa X270/X434, ma charakter specyficzny, bazuje na reakcji PCR oraz generuje łatwe w interpretacji i powtarzalne wyniki umożliwiając jego zastosowanie w selekcji wspomaganej markerami.Using oligonucleotide primers No. 1 and 2, presented in the sequence list, a codominant marker 821 was obtained (Fig. 1-2), which simply and quickly identifies oat plants carrying the dominant and/or recessive allele of the crown rust resistance gene from the subline isolated from the Iowa Χ270/Χ434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa. Marker 821, developed based on the results of segregation analysis of the 106 bp or 115 bp product 821, showed genetic linkage with the crown rust resistance gene locus from the subline isolated from the Iowa X270/X434 line, is specific, based on PCR, and generates easy-to-interpret and reproducible results, enabling its use in marker-assisted selection.
Przeprowadzone badania markera 821 wykazały, że jest on znacznikiem kodominującym zarówno allelu dominującego, jak i recesywnego genu odporności na rdzę z sublinii wyodrębnionej z linii Iowa X270/X434, uzyskanej w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa w owsie zwyczajnym.The studies on marker 821 showed that it is a codominant marker of both the dominant and recessive alleles of the rust resistance gene from the subline isolated from the Iowa X270/X434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa in common oats.
Zastosowanie kodominującego markera 821 może być przydatne do identyfikacji genu odporności na rdzę koronową z sublinii wyodrębnionej z linii Iowa Χ270/Χ434, uzyskanej w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa obecnego w materiałach hodowlanych owsa. Podstawową zaletą opracowanego systemu identyfikacji jest możliwość określenia w bardzo krótkim czasie genotypu rośliny już w stadium kilkudniowej siewki, niezależność od warunków środowiska oraz fazy rozwojowej rośliny, a także niezależność od obecności bądź braku porażenia określonym izolatem Puccinia coronata f. sp. avenae.The use of the codominant marker 821 may be useful for identifying the crown rust resistance gene from a subline isolated from the Iowa Χ270/Χ434 line, obtained by crossing A. sterilis Wahl No. 8 x A. sativa present in oat breeding materials. The primary advantage of the developed identification system is the ability to determine the plant genotype in a very short time, already at the stage of a few-day-old seedling, independence from environmental conditions and the plant development stage, and independence from the presence or absence of infection with a specific isolate of Puccinia coronata f. sp. avenae.
Sposób identyfikacji markera 821Marker identification method 821
Materiał:Material:
DNA izolowane z liści owsa przy wykorzystaniu komercyjnie dostępnych zestawów.DNA isolated from oat leaves using commercially available kits.
PL 248968 Β1PL 248968 Β1
Skład mieszaniny w reakcji PCR (Polymerase Chain rection):Composition of the mixture in the PCR (Polymerase Chain Reaction) reaction:
Sekwencje starterów:Primer sequences:
Sekwencja nr 1: 821_F2 5' GTCGATGCAGCCGACGTGG 3’Sequence No. 1: 821_F2 5' GTCGATGCAGCCGACGTGG 3'
Sekwencja nr 2: 821_R2a 5’ GCCTTCTTCCGCCAAGGA 3’Sequence No. 2: 821_R2a 5' GCCTTCTTCCCGCCAAGGA 3'
Startery projektowano przy użyciu programu Primer 3,0.Primers were designed using Primer 3.0.
Warunki amplifikacji DNADNA amplification conditions
Reakcję PCR przeprowadzono w termocyklerach: SimpliAmp (Applied Biosystems) lub ProFlex (Applied Biosystems)The PCR reaction was performed in thermal cyclers: SimpliAmp (Applied Biosystems) or ProFlex (Applied Biosystems)
Profil termiczny reakcji PCR: 94°C - 4 min., 37 cykli (94°C - 30 s., 60°C - 30 s., 72°C - 45 s.), 72°C-7 min.PCR reaction thermal profile: 94°C - 4 min., 37 cycles (94°C - 30 s., 60°C - 30 s., 72°C - 45 s.), 72°C-7 min.
Identyfikacja markera 821:Marker 821 identification:
Elektroforeza na 1,5% żelu agarozowym zawierającym 0,5 pg/ml bromku etydyny w buforze TBE (pH 8,0) przy napięciu 100 V przez 2 godziny. Jako wzorzec długości fragmentów DNA użyto GeneRuler™ 50 bp plus DNA Ladder (ThermoFisher Scientific, USA). Wizualizacji markera dokonano wykorzystując system Uvidoc HD6 (Uvitec, Cambridge, UK).Electrophoresis was carried out on a 1.5% agarose gel containing 0.5 pg/ml ethidium bromide in TBE buffer (pH 8.0) at 100 V for 2 hours. GeneRuler™ 50 bp plus DNA Ladder (ThermoFisher Scientific, USA) was used as a DNA fragment length standard. Marker visualization was performed using the Uvidoc HD6 system (Uvitec, Cambridge, UK).
Wyniki:Results:
Testowanie markera 821 na osobnikach populacji 634 (sublinia Iowa Χ270/Χ434 x ‘Bingo’) oraz 635 (sublinia Iowa Χ270/Χ434 x ‘Kasztan’) wykazało wysoką zgodność segregacji z allelem dominującym i recesywnym odporności na rdzę koronową owsa. Spośród 300 testowanych roślin reprezentujących populacje 634 (‘sublinia Iowa Χ270/Χ434 x Bingo’) i 635 (sublinia Iowa Χ270/Χ434 x ‘Kasztan’), wybrano losowo 141 roślin oraz formy rodzicielskie: ‘Bingo’, ‘Kasztan’ i Pc51U (sublinia Iowa Χ270/Χ434). Na 141 testowanych roślin 89% zostało właściwie zakwalifikowanych. Spośród 141 testowanych roślin 72 pochodziły z populacji 634 (‘sublinia Iowa Χ270/Χ434 x Bingo’) i stwierdzono w nich 12,50% niedopasować genotypu z fenotypem (Fig. 2), 69 spośród 141 testowanych roślin pochodziło z populacji 635 ('sublinia Iowa Χ270/Χ434 x ‘Kasztan’) i stwierdzono w nich 10,14% niedopasować genotypu z markerem (Fig. 2). Obecność allelu dominującego o wielkości 106 pz stwierdzono w Pc51U sublinii Iowa Χ270/Χ434, zaś w formach rodzicielskich ‘Bingo’ i ‘Kasztan’ stwierdzono obecności allelu recesywnego w postaci amplikonu o wielkości 115 pz. Na elektroforegramie przedstawiono amplifikowane fragmenty DNA po włączeniu do analizy pary starterów nr 1 i 2, przedstawionych na liście sekwencji, świadczące o obecności w badanych genotypach allelu dominującego lub recesywnego genu odporności na rdzę koronową z sublinii wyodrębnionej z linii Iowa Χ270/Χ434, uzyskanej w wyniku krzyżowania A. sterilis Wahl No. 8 x A. sativa.Testing of marker 821 on individuals from populations 634 (Iowa subline Χ270/Χ434 x ‘Bingo’) and 635 (Iowa subline Χ270/Χ434 x ‘Chestnut’) showed high concordance segregating with the dominant and recessive alleles for oat crown rust resistance. From 300 tested plants representing populations 634 (‘Iowa subline Χ270/Χ434 x Bingo’) and 635 (Iowa subline Χ270/Χ434 x ‘Chestnut’), 141 plants were randomly selected, along with the parental forms ‘Bingo’, ‘Chestnut’, and Pc51U (Iowa subline Χ270/Χ434). Of the 141 tested plants, 89% were correctly classified. Of the 141 plants tested, 72 were from population 634 ('Iowa subline Χ270/Χ434 x Bingo') and showed a 12.50% genotype-phenotype mismatch (Fig. 2), 69 of the 141 plants tested were from population 635 ('Iowa subline Χ270/Χ434 x 'Chestnut') and showed a 10.14% genotype-marker mismatch (Fig. 2). A dominant allele of 106 bp was found in Pc51U of the Iowa subline Χ270/Χ434, while a recessive allele in the form of a 115 bp amplicon was found in the parental forms 'Bingo' and 'Chestnut'. The electropherogram shows amplified DNA fragments after including primer pairs No. 1 and 2 in the analysis, presented in the sequence list, proving the presence in the tested genotypes of the dominant or recessive allele of the crown rust resistance gene from the subline isolated from the Iowa Χ270/Χ434 line, obtained as a result of crossing A. sterilis Wahl No. 8 x A. sativa.
PL 248968 Β1PL 248968 Β1
LISTA SEKWENCJISEQUENCE LIST
Sekwencja nr 1 (Starter 821F2)Sequence No. 1 (Starter 821F2)
5’ GTCGATGCAGCCGACGTGG 3’5' GTCGATGCAGCCGACGTGG 3'
Sekwencja nr 2 (Starter 821_R2a)Sequence No. 2 (Starter 821_R2a)
5’ GCCTTCTTCCGCCAAGGA 3'5' GCCTTCTTCGCCAAGGA 3'
Sekwencja nr 3 - allel dominujący - 106 pzSequence no. 3 - dominant allele - 106 bp
5' GTCGATGCAGCCGACGTGGCGGCACGCCTGGAGCAGCCGCCCCAGCTGGCC5' GTCGATGCAGCCGACGTGGCGGCACGCCTGGAGCAGCCGCCCCAGCTGGCC
GTCCTCCATCTCCCCGAGGCACACCGCGCAATGCTCCTCCTTGGCGGAAGAAGGTCCTCCATCTCCCCGAGGCACACCGCGCAATGCTCCTCCTTGGCGGAAGAAG
GC 3’GC 3'
Sekwencja nr 4 - allel recesywny - 115 pzSequence no. 4 - recessive allele - 115 bp
5’ GTCGATGCAGCCGACGTGGAACACGTGGCGGCACGCCTGGAGCAGCCGCCC CAGCTGGCCGTCCTCCATCTCCCCGAGGCACACCGCGCAATGCTCCTCCTTGGC5' GTCGATGCAGCCGACGTGGAACACGTGGCGGCACGCCTGGAGCAGCCGCCC CAGCTGGCCGTCCTCCATCTCCCCGAGGCACACCGCGCAATGCTCCTCCTTGGC
GGAAGAAGGC 3’GGAAGAAGGC 3’
Claims (3)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL449128A PL248968B1 (en) | 2024-07-03 | 2024-07-03 | A pair of oligonucleotide primers for detection and a method for detecting the dominant and recessive allele of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line obtained by crossing Avena sterilis Wahl No. 8 x Avena sativa in common oat (Avena sativa L.) plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL449128A PL248968B1 (en) | 2024-07-03 | 2024-07-03 | A pair of oligonucleotide primers for detection and a method for detecting the dominant and recessive allele of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line obtained by crossing Avena sterilis Wahl No. 8 x Avena sativa in common oat (Avena sativa L.) plants |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| PL449128A1 PL449128A1 (en) | 2024-12-30 |
| PL248968B1 true PL248968B1 (en) | 2026-02-16 |
Family
ID=98772964
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PL449128A PL248968B1 (en) | 2024-07-03 | 2024-07-03 | A pair of oligonucleotide primers for detection and a method for detecting the dominant and recessive allele of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line obtained by crossing Avena sterilis Wahl No. 8 x Avena sativa in common oat (Avena sativa L.) plants |
Country Status (1)
| Country | Link |
|---|---|
| PL (1) | PL248968B1 (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PL422536A1 (en) * | 2017-08-11 | 2019-02-25 | Uniwersytet Przyrodniczy W Lublinie | A pair of starter oligonucleotides for detecting, and the method for detecting of the recessive allele of immunity gene Pc39 to crown rust in the plants of common oat (Avena sativa L.) |
| PL422537A1 (en) * | 2017-08-11 | 2019-02-25 | Uniwersytet Przyrodniczy W Lublinie | A pair of starter oligonucleotides for detecting, and the method for detecting of the dominant allele of immunity gene to crown rust Pc39 in the plants of common oat (Avena sativa L.) |
| PL438755A1 (en) * | 2021-08-16 | 2023-02-20 | Uniwersytet Przyrodniczy W Lublinie | Pair of oligonucleotide primers for detection and method for detecting the allele of the dominat and recessive crown rust resistance gene from the subline of the hybrid form Avena sativa 'Pendek' x Avena sterilis CW-486 in oat plants (Avena sativa L.) |
| PL440928A1 (en) * | 2022-04-13 | 2023-10-16 | Uniwersytet Przyrodniczy W Lublinie | Pair of oligonucleotide primers for the detection and method of detecting the allele of the dominant crown rust resistance gene from the subline of the hybrid form A. sterilis PI 296244 x A. sativa TAM-O-312 in oat plants (Avena sativa L.) |
-
2024
- 2024-07-03 PL PL449128A patent/PL248968B1/en unknown
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PL422536A1 (en) * | 2017-08-11 | 2019-02-25 | Uniwersytet Przyrodniczy W Lublinie | A pair of starter oligonucleotides for detecting, and the method for detecting of the recessive allele of immunity gene Pc39 to crown rust in the plants of common oat (Avena sativa L.) |
| PL422537A1 (en) * | 2017-08-11 | 2019-02-25 | Uniwersytet Przyrodniczy W Lublinie | A pair of starter oligonucleotides for detecting, and the method for detecting of the dominant allele of immunity gene to crown rust Pc39 in the plants of common oat (Avena sativa L.) |
| PL438755A1 (en) * | 2021-08-16 | 2023-02-20 | Uniwersytet Przyrodniczy W Lublinie | Pair of oligonucleotide primers for detection and method for detecting the allele of the dominat and recessive crown rust resistance gene from the subline of the hybrid form Avena sativa 'Pendek' x Avena sterilis CW-486 in oat plants (Avena sativa L.) |
| PL440928A1 (en) * | 2022-04-13 | 2023-10-16 | Uniwersytet Przyrodniczy W Lublinie | Pair of oligonucleotide primers for the detection and method of detecting the allele of the dominant crown rust resistance gene from the subline of the hybrid form A. sterilis PI 296244 x A. sativa TAM-O-312 in oat plants (Avena sativa L.) |
Also Published As
| Publication number | Publication date |
|---|---|
| PL449128A1 (en) | 2024-12-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230366039A1 (en) | Genetic markers for myb28 | |
| EP2240588B1 (en) | Gray leaf spot tolerant maize and methods of production | |
| US10337072B2 (en) | Copy number detection and methods | |
| PL245140B1 (en) | A pair of oligonucleotide primers for the detection and method of detecting the allele of the dominant crown rust resistance gene from the subline of the hybrid form A. sterilis PI 296244 x A. sativa TAM-O-312 in oat plants (Avena sativa L.) | |
| PL233477B1 (en) | A pair of starter oligonucleotides for detecting, and the method for detecting of the recessive allele of immunity gene Pc39 to crown rust in the plants of common oat (Avena sativa L.) | |
| PL245142B1 (en) | A pair of oligonucleotide primers for the detection and method of detecting the recessive allele of the crown rust resistance gene from the subline of the hybrid form A. sterilis PI 296244 x A. sativa TAM-O-312 in oat plants (Avena sativa L.) | |
| PL243633B1 (en) | A pair of oligonucleotide primers for the detection and method of detecting the recessive allele of the crown rust resistance gene from the subline of the hybrid form Avena sativa 'Pendek' x Avena sterilis CW-486 in oat plants (Avena sativa L.) | |
| PL233478B1 (en) | A pair of starter oligonucleotides for detecting, and the method for detecting of the dominant allele of immunity gene to crown rust Pc39 in the plants of common oat (Avena sativa L.) | |
| KR101883117B1 (en) | SNP marker for selecting tomato cultivars resistant to tomato Bacterial wilt and use thereof | |
| KR101788989B1 (en) | Marker for selecting brown planthopper-resistant rice cultivar and uses thereof | |
| US20030194730A1 (en) | Novel FISSR-PCR primers and methods of identifying genotyping diverse genomes of plant and animal systems including rice varieties, a kit thereof | |
| PL244512B1 (en) | A pair of oligonucleotide primers for the detection and method of detecting the dominant allele of the crown rust resistance gene from the subline of the hybrid form Avena sativa 'Pendek' x Avena sterilis CW-486 in oat plants (Avena sativa L.) | |
| RU2717017C2 (en) | Molecular markers for blackleg resistance gene rlm2 in brassica napus and methods of use thereof | |
| KR100781206B1 (en) | SSR Primer Isolated from Sesame Plant and Its Use | |
| PL233476B1 (en) | Two pairs of starter oligonucleotides for detecting the presence of alleles of the dominating or recessive immunity gene to crown rust Pc39 in the genome of common oat (Avena sativa L.), combination of two starter pairs and method for detecting of the of gene Pc39 alleles system | |
| US20260076322A1 (en) | Brassica cytoplasmic male sterility (cms) fertility restorer nucleic acids, markers, methods, and zygosity assays | |
| PL244887B1 (en) | A pair of oligonucleotide primers for the detection and method of detecting the allele of the dominant crown rust resistance gene from the subline of the hybrid form A. sterilis PI 296244 x A. sativa TAM-O-312 in oat plants (Avena sativa L.) | |
| US20140115732A1 (en) | Diagnostic Molecular Markers for Seed Lot Purity Traits in Soybeans | |
| PL249382B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the dominant allele of the crown rust resistance gene from a subline isolated from the Iowa X270/X434 line obtained by crossing Avena sterilis Wahl No. 8 x Avena sativa in common oat (Avena sativa L.) plants | |
| PL248967B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the recessive allele of the crown rust resistance gene from the subline isolated from the Iowa X270/X434 line obtained by crossing Avena sterilis Wahl No. 8 x Avena sativa in common oat (Avena sativa L.) plants | |
| PL243632B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the presence of the dominant and recessive allele of the crown rust resistance gene from the subline of the hybrid form Avena sativa 'Pendek' x Avena sterilis CW-486 in the genome of common oats (Avena sativa L.) | |
| PL248751B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the recessive allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) | |
| PL248718B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) | |
| PL249317B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the recessive allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) | |
| PL248720B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) |