PL218878B1 - Method for producing vaccines using recombinant DNA technology immunological veterinary medicinal product for domestic pigeons - Google Patents
Method for producing vaccines using recombinant DNA technology immunological veterinary medicinal product for domestic pigeonsInfo
- Publication number
- PL218878B1 PL218878B1 PL397433A PL39743311A PL218878B1 PL 218878 B1 PL218878 B1 PL 218878B1 PL 397433 A PL397433 A PL 397433A PL 39743311 A PL39743311 A PL 39743311A PL 218878 B1 PL218878 B1 PL 218878B1
- Authority
- PL
- Poland
- Prior art keywords
- orf
- protein
- pigeons
- truncated form
- vector
- Prior art date
Links
- 241000272205 Columba livia Species 0.000 title claims description 19
- 230000001900 immune effect Effects 0.000 title claims description 9
- 229940126601 medicinal product Drugs 0.000 title claims description 9
- 238000004519 manufacturing process Methods 0.000 title claims description 8
- 229960005486 vaccine Drugs 0.000 title claims description 7
- 108020004511 Recombinant DNA Proteins 0.000 title description 2
- 241000745220 Pigeon circovirus Species 0.000 claims description 47
- 238000000034 method Methods 0.000 claims description 45
- 108090000623 proteins and genes Proteins 0.000 claims description 40
- 102000004169 proteins and genes Human genes 0.000 claims description 34
- 239000013598 vector Substances 0.000 claims description 30
- 241000272201 Columbiformes Species 0.000 claims description 16
- 201000010099 disease Diseases 0.000 claims description 16
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 claims description 16
- 241000211815 Livia Species 0.000 claims description 13
- 238000002965 ELISA Methods 0.000 claims description 12
- 108020004414 DNA Proteins 0.000 claims description 11
- 241001533384 Circovirus Species 0.000 claims description 10
- 101150061009 C1 gene Proteins 0.000 claims description 9
- 108010008038 Synthetic Vaccines Proteins 0.000 claims description 9
- 238000010367 cloning Methods 0.000 claims description 9
- 238000003752 polymerase chain reaction Methods 0.000 claims description 9
- 229940124551 recombinant vaccine Drugs 0.000 claims description 9
- ZRALSGWEFCBTJO-UHFFFAOYSA-N Guanidine Chemical compound NC(N)=N ZRALSGWEFCBTJO-UHFFFAOYSA-N 0.000 claims description 8
- 102000036639 antigens Human genes 0.000 claims description 8
- 108091007433 antigens Proteins 0.000 claims description 8
- 108090000565 Capsid Proteins Proteins 0.000 claims description 6
- 102100023321 Ceruloplasmin Human genes 0.000 claims description 6
- 241000588724 Escherichia coli Species 0.000 claims description 6
- 108020005202 Viral DNA Proteins 0.000 claims description 6
- 230000003321 amplification Effects 0.000 claims description 6
- 238000003317 immunochromatography Methods 0.000 claims description 6
- 238000010166 immunofluorescence Methods 0.000 claims description 6
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 6
- 239000000427 antigen Substances 0.000 claims description 5
- 238000002955 isolation Methods 0.000 claims description 5
- 210000000056 organ Anatomy 0.000 claims description 5
- 208000024891 symptom Diseases 0.000 claims description 5
- CHJJGSNFBQVOTG-UHFFFAOYSA-N N-methyl-guanidine Natural products CNC(N)=N CHJJGSNFBQVOTG-UHFFFAOYSA-N 0.000 claims description 4
- 101710172711 Structural protein Proteins 0.000 claims description 4
- SWSQBOPZIKWTGO-UHFFFAOYSA-N dimethylaminoamidine Natural products CN(C)C(N)=N SWSQBOPZIKWTGO-UHFFFAOYSA-N 0.000 claims description 4
- 238000001262 western blot Methods 0.000 claims description 4
- 241000271566 Aves Species 0.000 claims description 3
- 238000007399 DNA isolation Methods 0.000 claims description 3
- 101710132631 Protein C1 Proteins 0.000 claims description 3
- 108091036333 Rapid DNA Proteins 0.000 claims description 3
- 101710203837 Replication-associated protein Proteins 0.000 claims description 3
- 239000002671 adjuvant Substances 0.000 claims description 3
- 239000000969 carrier Substances 0.000 claims description 3
- 239000003085 diluting agent Substances 0.000 claims description 3
- 238000012869 ethanol precipitation Methods 0.000 claims description 3
- 230000028993 immune response Effects 0.000 claims description 3
- 239000002773 nucleotide Substances 0.000 claims description 3
- 125000003729 nucleotide group Chemical group 0.000 claims description 3
- 239000000126 substance Substances 0.000 claims description 3
- 241000345397 Columbid alphaherpesvirus 1 Species 0.000 claims description 2
- 241000204031 Mycoplasma Species 0.000 claims description 2
- 241000607142 Salmonella Species 0.000 claims description 2
- 125000003275 alpha amino acid group Chemical group 0.000 claims description 2
- 230000002255 enzymatic effect Effects 0.000 claims description 2
- 240000004808 Saccharomyces cerevisiae Species 0.000 claims 2
- 241000701447 unidentified baculovirus Species 0.000 claims 2
- 238000012790 confirmation Methods 0.000 claims 1
- 239000003814 drug Substances 0.000 claims 1
- 230000002708 enhancing effect Effects 0.000 claims 1
- 239000000463 material Substances 0.000 claims 1
- 229920001184 polypeptide Polymers 0.000 description 13
- 108090000765 processed proteins & peptides Proteins 0.000 description 13
- 102000004196 processed proteins & peptides Human genes 0.000 description 13
- 239000012634 fragment Substances 0.000 description 7
- 150000007523 nucleic acids Chemical group 0.000 description 6
- 101150040063 orf gene Proteins 0.000 description 5
- 239000003155 DNA primer Substances 0.000 description 4
- 230000001939 inductive effect Effects 0.000 description 4
- 206010062016 Immunosuppression Diseases 0.000 description 3
- 210000003608 fece Anatomy 0.000 description 3
- 230000001506 immunosuppresive effect Effects 0.000 description 3
- 238000000338 in vitro Methods 0.000 description 3
- 210000003097 mucus Anatomy 0.000 description 3
- 238000000746 purification Methods 0.000 description 3
- 108091008146 restriction endonucleases Proteins 0.000 description 3
- 210000000952 spleen Anatomy 0.000 description 3
- 238000010254 subcutaneous injection Methods 0.000 description 3
- 239000007929 subcutaneous injection Substances 0.000 description 3
- 108091093088 Amplicon Proteins 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- 101710189078 Helicase Proteins 0.000 description 2
- 101710118046 RNA-directed RNA polymerase Proteins 0.000 description 2
- 241000700605 Viruses Species 0.000 description 2
- 239000008280 blood Substances 0.000 description 2
- 210000004369 blood Anatomy 0.000 description 2
- 238000006243 chemical reaction Methods 0.000 description 2
- 238000007796 conventional method Methods 0.000 description 2
- 238000012631 diagnostic technique Methods 0.000 description 2
- 239000013604 expression vector Substances 0.000 description 2
- 239000002245 particle Substances 0.000 description 2
- 239000013615 primer Substances 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 208000030507 AIDS Diseases 0.000 description 1
- 235000009434 Actinidia chinensis Nutrition 0.000 description 1
- 244000298697 Actinidia deliciosa Species 0.000 description 1
- 235000009436 Actinidia deliciosa Nutrition 0.000 description 1
- 241001533399 Circoviridae Species 0.000 description 1
- 108020004705 Codon Proteins 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 206010012735 Diarrhoea Diseases 0.000 description 1
- 241000238631 Hexapoda Species 0.000 description 1
- 206010061218 Inflammation Diseases 0.000 description 1
- 150000001413 amino acids Chemical class 0.000 description 1
- 230000000890 antigenic effect Effects 0.000 description 1
- 230000036528 appetite Effects 0.000 description 1
- 235000019789 appetite Nutrition 0.000 description 1
- 230000001580 bacterial effect Effects 0.000 description 1
- 239000012620 biological material Substances 0.000 description 1
- 238000004113 cell culture Methods 0.000 description 1
- 229940028617 conventional vaccine Drugs 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 238000006911 enzymatic reaction Methods 0.000 description 1
- 210000003527 eukaryotic cell Anatomy 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 230000002538 fungal effect Effects 0.000 description 1
- 210000000987 immune system Anatomy 0.000 description 1
- 230000002163 immunogen Effects 0.000 description 1
- 230000001771 impaired effect Effects 0.000 description 1
- 238000001727 in vivo Methods 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 230000004054 inflammatory process Effects 0.000 description 1
- 238000002347 injection Methods 0.000 description 1
- 239000007924 injection Substances 0.000 description 1
- 230000001926 lymphatic effect Effects 0.000 description 1
- 238000001556 precipitation Methods 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 208000011580 syndromic disease Diseases 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 230000003612 virological effect Effects 0.000 description 1
- 230000004580 weight loss Effects 0.000 description 1
- 208000016261 weight loss Diseases 0.000 description 1
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
Przedmiotem wynalazku jest sposób wytwarzania szczepionki rekombinowanej przy użyciu technologii DNA immunologicznego produktu leczniczego weterynaryjnego dla gołębi domowych (Columbia livia) przeciwko cirkowirusowej chorobie wywoływanej przez cirkowirus gołębi pn. PiCV ang. Pigeon Circo Virus).The subject of the invention is a method for the production of a recombinant vaccine using DNA technology of the immunological veterinary medicinal product for domestic pigeons (Columbia Livia) against circovirus disease caused by the Northern pigeon circovirus. PiCV ang. Pigeon Circo Virus).
Czynnikiem etiologicznym cirkowirusowej choroby gołębi jest cirkowirus gołębi pn. PiCV (ang. Pigeon Circo Virus), mały pozbawiony otoczki zarazek o średnicy 14 - 20 nm o genomie wielkości ok. 2kb o jednoniciowym (ss) DNA (Todd D. 2000; Todd D. et alt. 2006). Należący do rodziny Circoviridae rodzaju Circovirus (Marlier D., Vindevogel H; 2006).The aetiological factor of pigeon circovirus disease is the Northern pigeon circovirus. PiCV (Pigeon Circo Virus), a small devoid of an envelope with a diameter of 14 - 20 nm with a genome of approx. 2 kb with single-stranded (ss) DNA (Todd D. 2000; Todd D. et al. 2006). Belongs to the Circoviridae family of the genus Circovirus (Marlier D., Vindevogel H; 2006).
Cirkowirusowa choroba gołębi występuje u osobników młodych najczęściej w wieku od 6 tygodnia życia do 1 roku życia gołębi (Soike D. 1997). Objawy kliniczne są zróżnicowane a u gołębi obserwuje się brak apetytu, spadek masy ciała, wodnistą biegunkę, zapalenie dróg oddechowych, słabe wyniki lotowe u gołębi pocztowych. Wirus wykazuje predylekcję do narządów limfatycznych uszkadzając torby Fabrycjusza doprowadza do upośledzenia funkcje układu immunologicznego a w konsekwencji immunosupresji, i zachorowaniami gołębi na schorzenia bakteryjne, grzybicze oraz wirusowe (Todd D. 2000). Cirkowiroza jest określana jako zespół nabytego braku odporności gołębi (Szeleszczuk P., Dolka B. 2009).Circoviral pigeon disease occurs most often in young pigeons from the age of 6 weeks to 1 year of age (Soike D. 1997). The clinical symptoms are varied and pigeons have a lack of appetite, weight loss, watery diarrhea, inflammation of the airways, poor racing performance in racing pigeons. The virus shows a predilection to lymphatic organs, damaging the Fabrizio's bags, leading to impaired immune system functions and, consequently, immunosuppression, and pigeons becoming ill with bacterial, fungal and viral diseases (Todd D. 2000). Circovirosis is defined as pigeons' acquired immunodeficiency syndrome (Szeleszczuk P., Dolka B. 2009).
Ostatnie doniesienia naukowe opisują nową wieloczynnikową jednostkę chorobową jako chorobę młodych gołębi (YPDS ang. Young pigeon disease syndrome); w której cirkowirus gołębi (PiCV) odgrywa ważną rolę w indukowaniu immunosupresji u zakażonych gołębi (Duchatel J.P., Szeleszczuk 2011).Recent scientific reports describe a new multifactorial disease entity as Young pigeon disease syndrome (YPDS); in which pigeon circovirus (PiCV) plays an important role in inducing immunosuppression in infected pigeons (Duchatel J.P., Szeleszczuk 2011).
Ze względu na trudności w namnażaniu zarazka w hodowlach komórkowych nie udało się dotychczas uzyskać konwencjonalnej szczepionki, która mogłaby być użyta do zapobiegania chorobie (Schmidt V., et alt 2008). Z powyższych względów twórcy podjęli próbę otrzymania szczepionki technologią rekombinacji DNA.Due to the difficulty of multiplication of the germ in cell culture, it has not been possible to obtain a conventional vaccine that could be used to prevent disease (Schmidt V., et al. 2008). For the above reasons, the inventors made an attempt to obtain a vaccine using recombinant DNA technology.
Znany jest z opisu publikacji (Daum I. et alt 2009) klonowanie i ekspresja białka kapsydu wirusa odpowiedniego do wykrywania testem ELISA przeciwciał u gołębi zakażonych cirkowirusem (PiCV).It is known from the publication description (Daum I. et al. 2009) the cloning and expression of a virus capsid protein suitable for the detection of antibodies in pigeons infected with circovirus (PiCV) by means of an ELISA test.
Twórcy wynalazku od chorych gołębi domowych z Polski wykazujących objawy choroby cirkowirusowej pobrali próbki krwi, kału, śluzu oraz śledziony a następnie wyizolowali z nich szczep wirusa PiCV, z którego następnie wyodrębnili DNA wirusowe.The inventors took samples of blood, faeces, mucus and spleen from sick domestic pigeons from Poland showing symptoms of circovirus disease, and then isolated from them a strain of PiCV virus, from which they then extracted viral DNA.
Ponadto twórcy zsekwencjonowali genom szczepu pochodzącego z Polski i wykazali silną homologie na poziomie nukleotydowym z innymi dostępnymi sekwencjami szczepów PiCV.Moreover, the inventors sequenced the genome of the strain originating in Poland and showed strong homology at the nucleotide level with other available PiCV strain sequences.
Sposób według wynalazku charakteryzuje się tym, że otrzymanie szczepionki obejmuje pobranie materiału biologicznego z narządów zakażonych gołębi domowych (Columbia livia), następnie izolację materiału genetycznego do izolacji całkowitego DNA wirusowego, następnie powielanie genu strukturalnego białka kapsydu (ORF C1) wirusa PiCV o wielkości 822 (lub jego skróconej formy np. 722 b) następnie subklonowanie białka ORF C1 lub jego skróconej formy genu ORF C1 do wektora pGEM -3Zf lub innych systemów ekspresyjnych i określenie sekwencji nukleotydów i aminokwasów białka lub skróconej formy genu ORF C1, wklonowanie skróconej formy genu ORF C1 do genomu wektora pQE-31 lub wektora pET -32a (lub innych systemów ekspresyjnych) i uzyskanie ekspresji rekombinowanego białka strukturalnego ORF C1 uzyskanego antygenu rekombinowanego białka ORF C1.The method according to the invention is characterized in that the preparation of the vaccine involves taking biological material from the organs of infected domestic pigeons (Columbia Livia), then isolating the genetic material to isolate total viral DNA, then amplifying the 822 PiCV capsid protein structural gene (ORF C1) (ORF C1) ( or its truncated form e.g. 722 b) then subcloning the ORF C1 protein or its truncated form of the ORF C1 gene into the pGEM -3Zf vector or other expression systems and determining the nucleotide and amino acid sequences of the protein or truncated form of the ORF C1 gene, cloning the truncated form of the ORF C1 gene into the genome of the pQE-31 vector or the pET -32a vector (or other expression systems) and expressing the recombinant ORF C1 structural protein of the obtained recombinant C1 ORF protein antigen.
Wynalazek dotyczy szczepionki zawierającej pełny antygen białka cirkowirusa PiCV ORF C1 lub jego skróconą formę indukującą odpowiedź immunologiczną u gołębi przeciwko cirkowirusowej chorobie gołębi wywoływanej przez PiCV indukującego immunosupresję u zakażonych gołębi domowych.The invention relates to a vaccine containing the complete antigen of the PiCV ORF C1 circovirus protein or a truncated form thereof inducing an immune response in pigeons against PiCV inducing immunosuppression in pigeon-infected pigeons.
Zakresem wynalazku objęte jest również wykorzystanie antygenu białka ORF C1 lub jego skróconej formy do celów diagnostycznych zakażenia gołębi cirkowirusem (PiCV) lub oceny właściwości immunogennych szczepionek przeznaczonych do immunoprofilaktyki cirkowirusowej choroby gołębi lub różnicowania gołębi szczepionych od zakażonych naturalnie.Also within the scope of the invention is the use of the ORF C1 protein antigen or its truncated form for the diagnostic purposes of pigeon circovirus (PiCV) infection or the evaluation of the immunogenic properties of vaccines intended for the immunoprophylaxis of pigeon circovirus disease or the differentiation of vaccinated pigeons from naturally infected pigeons.
Zakresem wynalazku objęty jest sposób, który obejmuje izolację i namnażanie DNA wirusowego i jego oczyszczanie.Included within the scope of the invention is a method which includes the isolation and propagation of viral DNA and the purification thereof.
Wynalazek również dotyczy przeciwciała mono lub poliklonalnego wytworzonego przy pomocy białka ORF C1 lub jego skróconej formy.The invention also relates to a mono or polyclonal antibody produced with the ORF C1 protein or a truncated form thereof.
PL 218 878 B1PL 218 878 B1
Wynalazek również dotyczy fragmentu kwasu nukleinowego obejmującego sekwencję genomu białka ORF1 C1 cirkowirusa PiCV przedstawioną jako sekwencja 1 (zostanie uzupełniona).The invention also relates to a nucleic acid fragment comprising the PiCV circovirus C1 ORF1 protein genome sequence shown as sequence 1 (to be completed).
Wynalazek dotyczy fragmentu kwasu nukleinowego, który wykazuje co najmniej 70% zgodności z sekwencją według wynalazku.The invention relates to a nucleic acid fragment which has at least 70% agreement with the sequence according to the invention.
Wynalazek również dotyczy fragmentu kwasu nukleinowego obejmującego sekwencję genomu białka ORF1 C1 cirkowirusa PiCV, który jest zdolny do specyficznej hybrydyzacji z fragmentem kwasu nukleinowego według wynalazku, korzystnie hybrydyzacji w ostrych warunkach.The invention also relates to a nucleic acid fragment comprising the genome sequence of the PiCV ORF1 protein C1 protein of the PiCV circovirus, which is capable of specifically hybridizing to the nucleic acid fragment of the invention, preferably under stringent conditions.
Wynalazek dotyczy fragmentu kwasu nukleinowego obejmującego całą lub część sekwencji według wynalazku kodującego epitop zdolny do indukowania odpowiedzi immunologicznej przeciwko cirkowirusowej chorobie gołębi (PiCV). Korzystnie epitop obejmuje 13-25 aminokwasów.The invention relates to a nucleic acid fragment comprising all or part of a sequence according to the invention encoding an epitope capable of inducing an immune response against pigeon circovirus disease (PiCV). Preferably, the epitope comprises 13-25 amino acids.
Polipeptyd kodowany przez fragment kwasu nukleinowego według wynalazku również wchodzi w zakres wynalazku. Sekwencje genu strukturalnego białka kapsydu (ORF C1) wirusa PiCV i jej fragmenty można korzystnie zastosować do ekspresji polipeptydów in vitro i in vivo przy użyciu odpowiednich wektorów.The polypeptide encoded by the nucleic acid fragment of the invention also falls within the scope of the invention. The PiCV capsid protein structural gene (ORF C1) sequences and fragments thereof can be advantageously used for in vitro and in vivo expression of polypeptides using suitable vectors.
Korzystnie wektor ekspresyjny wdraża polipeptyd w E. coli, komórkach owadzich lub eukariotycznych.Preferably, the expression vector implements the polypeptide in E. coli, insect or eukaryotic cells.
W zakres wynalazku wchodzi również polipeptyd wytworzony przez wektor ekspresyjny według wynalazku.Also included within the scope of the invention is the polypeptide produced by the expression vector of the invention.
Polipeptyd można wytworzyć in vitro przez ekspresję a następnie oczyścić konwencjonalnymi technikami. Szczepionka obejmuje w ten sposób otrzymany polipeptyd lub jego fragment z dopuszczonymi do stosowania w lecznictwie weterynaryjnym nośnikami lub rozcieńczalnikami oraz adiuwantami i substancjami wzmagającymi odpowiedź immunologiczną.The polypeptide can be produced in vitro by expression and then purified by conventional techniques. The vaccine thus comprises the obtained polypeptide or fragment thereof with veterinary-approved carriers or diluents, and with adjuvants and immune-enhancing substances.
W korzystnym sposobie antygen, epitop lub polipeptyd wykrywa w próbce przeciwciała, które są specyficzne dla PiCV. W innym korzystnym sposobie stosuje się metodę Western Blott, immunofluorescencji, ELISA lub rodzaj immunochromatografii.In a preferred method, the antigen, epitope or polypeptide detects antibodies in the sample that are specific for PiCV. Another preferred method uses Western Blott, immunofluorescence, ELISA, or a type of immunochromatography.
Antygeny i przeciwciała według wynalazku można zastosować w dowolnej znanej technice diagnostyki laboratoryjnej.The antigens and antibodies of the invention can be used in any known laboratory diagnostic technique.
Techniki diagnostyczne, które można korzystnie zastosować: technikę Western Biot, immunofluorescencji, ELISA i immunochromatografię.Diagnostic techniques which may advantageously be used: Western Biot, immunofluorescence, ELISA and immunochromatography.
Korzystnie, gdy izolacji materiału genetycznego dokonuje się na drodze izolacji całkowitego DNA wirusowego metoda tiocjanian guanidyny-fenol-chloroform-alkohol izoamylowy i precypitacji etanolem lub innym dowolnym zestawem do ekstrakcji DNA wirusowego.Preferably, isolation of genetic material is performed by isolation of total viral DNA by the guanidine thiocyanate-phenol-chloroform-isoamyl alcohol method and precipitation with ethanol or any other viral DNA extraction kit.
Korzystnie, gdy powielanie genu strukturalnego białka kapsydu (ORF C1) wirusa PiCV o wielkości 822 b (1166-1987) lub jego skróconej formy (1166-1870) dokonuje się przy zastosowaniu metody enzymatycznej amplifikacji, przy czym do amplifikacji materiału genetycznego w łańcuchowej reakcji polimerazy (PCR) stosuje się startery reakcji obejmujące pełny odcinek genu ORF C1 o wielkości ok. 822 (lub jego skróconej formy), zawierające sekwencję startową i kodon stop oraz jeśli trzeba sekwencję niezbędną do oczyszczania eksprymowanego białka.Preferably, the amplification of the PiCV capsid protein (ORF C1) gene of size 822 b (1166-1987) or its truncated form (1166-1870) is carried out using the enzymatic amplification method, the amplification of the genetic material in the polymerase chain reaction (PCR) reaction primers are used that include a complete segment of the C1 ORF gene of approximately 822 (or its truncated form), containing a start sequence and a stop codon, and if necessary the sequence necessary for purification of the expressed protein.
Korzystnie, gdy rekombinowane białko ORF C1 o wielkości ok. 822 lub jego skrócona forma, będące produktem ekspresji, poddaje się badaniu na obecność cząstek pseudowirusowych - VLP (virus-like particles).Preferably, the recombinant ORF C1 protein of approx. 822 size or its truncated form, being the expression product, is tested for the presence of pseudoviral particles - VLPs (virus-like particles).
Korzystnie, gdy ocenia się aktywność antygenową białka ORF C1 o wielkości ok. 822 lub jego skrócona forma w technice Western Blot, immunofluorescencji, ELISA i immunochromatografii.Preferably, the antigenic activity of the approximately 822 size C1 ORF protein or its truncated form is assessed by Western Blot, immunofluorescence, ELISA and immunochromatography.
Korzystnie, gdy ocenia się ilość białka ORF C1 o wielkości ok. 822 lub jego skrócona forma w technice ELISA, Western Blot, immunofluorescencji i immunochromatografii.Preferably, the amount of the ORF C1 protein of about 822 or its truncated form is assessed by ELISA, Western Blot, immunofluorescence and immunochromatography.
Korzystnie, gdy ocenia się tożsamość białka ORF C1 o wielkości ok. 822 lub jego skrócona forma w technice ELISA, Western Blot, immunofluorescencji i immunochromatografii.The identity of a C1 ORF protein of about 822 in size or its truncated form is preferably assessed by ELISA, Western Blot, immunofluorescence and immunochromatography.
Korzystnie, gdy wklonowania genu ORF C1 o wielkości ok. 822 lub jego skróconej formy dokonuje się za pośrednictwem wektora będącego składnikiem systemu pQE-31 (Qiagen) lub do wektora pET -32a (Novagen) lub do innego wektora.Preferably, the cloning of the approximately 822 size C1 ORF gene or its truncated form is performed using a vector component of the pQE-31 system (Qiagen) or into the pET -32a vector (Novagen) or into another vector.
Korzystnie, gdy pierwszy etap obejmuje klonowanie do wektora pGEM -3Zf (Promega) lub do innego wektora.Preferably, the first step comprises cloning into the pGEM -3Zf vector (Promega) or into another vector.
Korzystnie, gdy drugi etap obejmuje subklonowanie z wektora pGEM -3Zf do wektora pQE-31 (Qiagen) lub do wektora pET -32a (Novagen) lub do innego wektora.Preferably, the second step comprises subcloning from the pGEM -3Zf vector into the pQE-31 vector (Qiagen) or into the pET -32a vector (Novagen) or into another vector.
Korzystnie, gdy powielanie genu strukturalnego białka kapsydu (ORF C1) wirusa PiCV o wielkości 822 b lub jego skróconej formy dokonuje się przy zastosowaniu metody enzymatycznejPreferably, the amplification of the 822b size PiCV capsid protein (ORF C1) structural gene or its truncated form is performed using an enzymatic method.
PL 218 878 B1 amplifikacji, przy czym do amplifikacji materiału genetycznego w łańcuchowej reakcji polimerazy stosuje się startery reakcji obejmujące pełny odcinek genu ORF C1 o wielkości ok. 822 lub jego skróconej formy.In order to amplify the genetic material in the polymerase chain reaction, reaction primers are used which include a complete segment of the C1 ORF gene of approximately 822 or its truncated form.
Fw: AAAGGATCCTTACTTCCGCCTACGTCGCAAGGACFw: AAAGGATCCTTACTTCCGCCTACGTCGCAAGGAC
Rw: AAAAAGCTTTTCAGAATCCACAGCTGAGTCTGGG, zawierające sekwencję miejsca dla enzymów restrykcyjnych i sekwencję niezbędną do oczyszczania eksprymowanego białka.Rw: AAAAAGCTTTTCAGAATCCACAGCTGAGTCTGGG, containing the restriction enzyme site sequence and the sequence necessary for purification of the expressed protein.
P r z y k ł a d lP r z y k ł a d l
Od chorych gołębi domowych (Columbia livia), z Polski wykazujących objawy choroby cirkowirusowej z narządów pobrano próbki śledziony, krwi, kału i śluzu, z których izolowano materiał genetyczny wirusa PiCV metodą tiocjanian guanidyny-fenolchloroform-alkohol izoamylowy i precypitacji etanolem (wg Chomczyńskiego i Sacchi) [Chomczyński 1978] i/lub stosując zestaw do szybkiej izolacji DNA np. firmy A&A Biotechnology (mini kit).From sick domestic pigeons (Columbia Livia), from Poland showing symptoms of circovirus disease, the organs were sampled from spleen, blood, faeces and mucus, from which the genetic material of PiCV was isolated using the guanidine thiocyanate-phenolchloroform-isoamyl alcohol method and ethanol precipitation (according to Chomczyński and Sacchi ) [Chomczyński 1978] and / or using a kit for rapid DNA isolation, e.g. by A&A Biotechnology (mini kit).
Do otrzymania amplikonu użyto Starterów oligonukleotydowych Fw: AAAGGATCCTTACTTCCGCCTACGTCGCAAGGAC Rw: AAAAAGCTTTTCAGAATCCACAGCTGAGTCTGGGOligonucleotide primers Fw: AAAGGATCCTTACTTCCGCCTACGTCGCAAGGAC Rw: AAAAAGCTTTTCAGAATCCACAGCTGAGTCTGGG were used to obtain the amplicon.
Do otrzymania skróconego genomu ORF C1 wirusa PiCV powielano metodą PCR - łańcuchowej reakcji polimerazy wykorzystując do tego celu Starterów oligonukleotydowych podobnych do starterów opisanych w artykule I.Daum 2009. Avian Patology 38, 135-141 zmienione zostały sekwencje dla enzymów restrykcyjnych oraz oraz przesunięto część sekwencji.To obtain a shortened genome, the ORF C1 of the PiCV virus was amplified by the PCR method - polymerase chain reaction, using for this purpose oligonucleotide primers similar to those described in the article I. Daum 2009. Avian Patology 38, 135-141 the sequences for restriction enzymes were changed and part of the sequence shifted .
Skrócony gen ORF C1 wklonowano wg procedury producenta do wektora typu pGEM -3Zf (Promega), który jest przeznaczony do klonowania produktów przeznaczonych do późniejszego sekwencjonowania.The truncated C1 ORF gene was cloned according to the manufacturer's procedure into the pGEM -3Zf vector (Promega), which is intended for the cloning of products intended for subsequent sequencing.
W następnym etapie skrócony gen ORF C1 wirusa PiCV subklonowano do wektora pQE-31 (Qiagen) lub do wektora pET -32a (Novagen) lub do innego wektora i wprowadzono do genomu E. Coli w celu ekspresji białka.In the next step, the truncated PiCV ORF C1 gene was subcloned into the pQE-31 vector (Qiagen) or into the pET -32a vector (Novagen) or into another vector and inserted into the E. Coli genome for protein expression.
P r z y k ł a d IIP r z x l a d II
Od chorych gołębi domowych (Columbia livia), z Polski wykazujących objawy choroby cirkowirusowej z narządów pobrano próbki, śledziony, kiwi, kału i śluzu, z których izolowano materiał genetyczny wirusa PiCV metodą tiocjanian guanidyny-fenolchloroform-alkohol izoamylowy i precypitacji etanolem (wg Chomczyńskiego i Sacchi) [Chomczynski 1978] i/lub stosując zestaw do szybkiej izolacji DNA np. firmy A&A Biotechnology (mini kit).From sick domestic pigeons (Columbia Livia), from Poland showing symptoms of circoviral disease, samples were taken from the organs, spleen, kiwi, feces and mucus, from which the genetic material of PiCV was isolated using the guanidine thiocyanate-phenolchloroform-isoamyl alcohol method and ethanol precipitation (according to Chomczyński and Sacchi) [Chomczynski 1978] and / or using a rapid DNA isolation kit, e.g. from A&A Biotechnology (mini kit).
Do otrzymania amplikonu użyto Starterów oligonukleotydowych Fw: AAAGGATCCTTACTTCCGCCTACGTCGCAAGGAC Rw: AAAAAGCTTTTCAGAATCCACAGCTGAGTCTGGGOligonucleotide primers Fw: AAAGGATCCTTACTTCCGCCTACGTCGCAAGGAC Rw: AAAAAGCTTTTCAGAATCCACAGCTGAGTCTGGG were used to obtain the amplicon.
Do otrzymania skróconego genomu ORF C1 wirusa PiCV powielano metodą PCR - łańcuchowej reakcji polimerazy wykorzystując do tego celu Starterów oligonukleotydowych podobnych do starterów opisanych w artykule I.Daum 2009. Avian Patology 38, 135-141 zmienione zostały sekwencje dla enzymów restrykcyjnych oraz przesunięto część sekwencji.To obtain a shortened genome, the C1 ORF of the PiCV virus was amplified by the PCR method - polymerase chain reaction using for this purpose oligonucleotide primers similar to those described in the article I. Daum 2009. Avian Patology 38, 135-141 the sequences for the restriction enzymes were changed and part of the sequence shifted.
Skrócony gen ORF C1 wklonowano wg procedury producenta do wektora typu pGEM -3Zf (Promega), który jest przeznaczony do klonowania produktów przeznaczonych do późniejszego sekwencjonowania.The truncated C1 ORF gene was cloned according to the manufacturer's procedure into the pGEM -3Zf vector (Promega), which is intended for the cloning of products intended for subsequent sequencing.
W następnym etapie skrócony gen ORF C1 wirusa PiCV subklonowano do wektora pQE-31 (Qiagen) lub do wektora pET -32a (Novagen) lub do innego wektora i wprowadzono do genomu E. Coli w celu ekspresji białka.In the next step, the truncated PiCV ORF C1 gene was subcloned into the pQE-31 vector (Qiagen) or into the pET -32a vector (Novagen) or into another vector and inserted into the E. Coli genome for protein expression.
Polipeptyd wytworzony in vitro przez ekspresję w E. coli oczyszczono konwencjonalnymi technikami.The polypeptide produced in vitro by expression in E. coli was purified by conventional techniques.
P r z y k ł a d IIIP r x l a d III
Według przykładu II sporządzono szczepionkę rekombinowaną przy użyciu technologii DNA immunologiczny produkt leczniczy weterynaryjny dla gołębi domowych (Columbia livia) zawierającą polipeptyd lub jego fragment białko ORF C1 z dopuszczonymi do stosowania w lecznictwie weterynaryjnym nośnikami lub rozcieńczalnikami oraz adiuwantami i substancjami wzmagającymi odpowiedź immunologiczną.According to Example 2, a recombinant vaccine was prepared using DNA technology, an immunological veterinary medicinal product for domestic pigeons (Columbia livia) containing a polypeptide or fragment thereof ORF C1 protein with veterinary-approved carriers or diluents, as well as adjuvants and immune-enhancing substances.
P r z y k ł a d IVP r x l a d IV
Szczepionkę rekombinowaną sporządzoną przy użyciu technologii DNA zawierającą polipeptyd lub jego fragment białko ORF C1 według przykładu III podano dwukrotnie w odstępie 21 dni w iniekcjiRecombinant vaccine prepared using DNA technology containing the polypeptide or its fragment, ORF C1 protein according to Example 3 was administered twice 21 days apart by injection
PL 218 878 B1 podskórnej młodym gołębiom domowym w wieku 3 tygodni i uzyskano wzrost miana przeciwciał, które mierzono techniką ELISA.Subcutaneous injection to young domestic pigeons at the age of 3 weeks and an increase in antibody titer was obtained, which was measured by ELISA technique.
P r z k ł a d VP r z k ł a d V
Szczepionkę rekombinowaną sporządzoną przy użyciu technologii DNA zawierającą polipeptyd lub jego fragment białko ORF C1 według przykładu III podano dwukrotnie w odstępie 21 dni w iniekcji podskórnej młodym gołębiom domowym w wieku 3 tygodni i uzyskano wzrost miana przeciwciał, które mierzono techniką ELISA.Recombinant vaccine prepared using DNA technology containing the polypeptide or its fragment of the ORF C1 protein according to Example 3 was administered twice 21 days apart by subcutaneous injection to young domestic pigeons at 3 weeks of age and an increase in antibody titer was obtained, which was measured by ELISA technique.
P r z y k ł a d VIP r x l a d VI
Szczepionkę rekombinowaną sporządzoną przy użyciu technologii DNA zawierającą polipeptyd lub jego fragment białko ORF C1 według przykładu III podano w iniekcji podskórnej gołębiom domowym dorosłym i uzyskano wzrost miana przeciwciał, które mierzono techniką ELISA.A recombinant vaccine prepared using DNA technology containing the polypeptide or its fragment of the ORF protein C1 according to Example 3 was administered subcutaneously to adult domestic pigeons and an increase in antibody titer was obtained, which was measured by ELISA technique.
P r z y k ł a d VIIExample VII
Szczepionkę rekombinowaną sporządzoną przy użyciu technologii DNA zawierającą polipeptyd lub jego fragment białko ORF C1 oraz antygen wybrany z grupy złożonej z Salmonella spp, Mycoplasma spp., Paramyksowirus ptasi - 1 (PMV -1), Herpeswirus gołębi -1 (PiHV) lub ich kombinacje podano w odstępie w iniekcji podskórnej młodym oraz dorosłym gołębiom domowym i uzyskano wzrost miana przeciwciał, które mierzono techniką ELISA.Recombinant vaccine prepared using DNA technology, containing a polypeptide or its fragment, ORF C1 protein and an antigen selected from the group consisting of Salmonella spp, Mycoplasma spp., Paramyxovirus - 1 (PMV -1), Pigeon herpesvirus -1 (PiHV) or combinations thereof are given with an interval of subcutaneous injection to young and adult domestic pigeons and an increase in the titre of antibodies was obtained, which was measured by the ELISA technique.
PUBLIKACJEPUBLICATIONS
Daum I., et alt. Cloning and expression of a truncated pigeon circovirus capsid protein suitable for antibody detection in infected pigeons. Avian Pathol. 2009, 38, 135-141.Daum I., et al. Cloning and expression of a truncated pigeon circovirus capsid protein suitable for antibody detection in infected pigeons. Avian Pathol. 2009, 38, 135-141.
Duchatel J. P. et alt. New data on the transmission of pigeon circovirus. Vet. Rec. 2005, 157, 413-415.Duchatel J. P. et al. New data on the transmission of pigeon circovirus. Vet. Rec. 2005, 157, 413-415.
Duchatel J. P. et alt. Observations on detection, excretion and transmission of pigeon circovirus in adult, young and embryonic pigeons. Avian Pathol. 2006, 35, 30-34).Duchatel J. P. et al. Observations on detection, excretion and transmission of pigeon circovirus in adult, young and embryonic pigeons. Avian Pathol. 2006, 35, 30-34).
Duchatel J.P., L'infection du pigeon par le circovirus Ann. Med. Vet. 153, 211, 2009Duchatel J.P., L'infection du pigeon par le circovirus Ann. Med. Vet. 153, 211, 2009
Duchatel, J.P., Szeleszczuk P. Young pigeon disease syndrome. Med.Wet.67,291,2011Duchatel, J.P., Szeleszczuk P. Young pigeon disease syndrome. Med Wet. 67, 291, 2011
Duchatel, J.P., et alt. Pigeon circovirus: Baculovirus expression of the capsid protein gene, specific antibody and viral load measured by RT polymerase chain reaction. website: www.isrvma.orgDuchatel, J.P., et al. Pigeon circovirus: Baculovirus expression of the capsid protein gene, specific antibody and viral load measured by RT polymerase chain reaction. website: www.isrvma.org
Marlier D, Vindevogel H; Viral infection of pigeons Vet,J. 172,40,2006Marlier D, Vindevogel H; Viral infection of pigeons Vet, J. 172,40,2006
Schmidt, V. et alt., Experimental infection of domestic pigeons with pigeon circovirus. Av,.Diseases 52, 380, 2008.Schmidt, V. et alt., Experimental infection of domestic pigeons with pigeon circovirus. Av, Diseases 52, 380, 2008.
Soike D.; Circovirus infection bei Tauben. Tierarztl. Prax. 25, 52-54, 1997Soike D .; Circovirus infection bei Tauben. Tierarztl. Prax. 25, 52-54, 1997
Szeleszczuk P., Dolka B., Cirkowiroza czyli AIDS gołębi czy można się uchronić przed zagrożeniem VI Sympozjum naukowe, Aktualne problemy w hodowli gołębi pocztowych. Sosnowiec 2009.Szeleszczuk P., Dolka B., Cirkowiroza or AIDS of pigeons is it possible to protect oneself from the threat 6th Scientific Symposium, Current problems in breeding racing pigeons. Sosnowiec 2009.
Todd D.; Circoviruses; lmmunosuppressive threats to avian species: A review. Avian Pathol. 2000, 29, 373-394.Todd D .; Circoviruses; lmmunosuppressive threats to avian species: A review. Avian Pathol. 2000, 29, 373-394.
Todd D. et alt. Sequence comparision of pigeon circoviruses . Res in Vet. Sci, 84,311, 2008,Todd D. et al. Sequence comparision of pigeon circoviruses. Res in Vet. Sci, 84,311,2008,
Wieliczko A.i wsp.; Zakażenia cirkowirusowe gołębi. Medycyna Wet. 61, 94-97. 2005Wieliczko A. et al; Cirovirus infections in pigeons. Wet medicine. 61, 94-97. 2005
Woods L., i wsp. Circovirus-like infection in a pigeon. J. Vet. Diagn. Invest. 1993, 5, 609-612.Woods L., et al. Circovirus-like infection in a pigeon. J. Vet. Diagn. Invest. 1993, 5, 609-612.
Woods L. i wsp., A retrospective study of circovirus; infection in pigeons; nine cases (19861993). J. Vet. Diagn. lnvest. 1994, 6, 156-164.Woods L. et al., A retrospective study of circovirus; infection in pigeons; nine cases (19861993). J. Vet. Diagn. Invest. 1994, 6, 156-164.
Claims (14)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL397433A PL218878B1 (en) | 2011-12-15 | 2011-12-15 | Method for producing vaccines using recombinant DNA technology immunological veterinary medicinal product for domestic pigeons |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL397433A PL218878B1 (en) | 2011-12-15 | 2011-12-15 | Method for producing vaccines using recombinant DNA technology immunological veterinary medicinal product for domestic pigeons |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| PL397433A1 PL397433A1 (en) | 2013-06-24 |
| PL218878B1 true PL218878B1 (en) | 2015-02-27 |
Family
ID=48671832
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PL397433A PL218878B1 (en) | 2011-12-15 | 2011-12-15 | Method for producing vaccines using recombinant DNA technology immunological veterinary medicinal product for domestic pigeons |
Country Status (1)
| Country | Link |
|---|---|
| PL (1) | PL218878B1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106191079A (en) * | 2015-09-24 | 2016-12-07 | 内蒙古金凯默生物科技有限公司 | The rhabdovirus system expression of a kind of pigeon circovirus Cap protein of recombinating and the application of this albumen |
-
2011
- 2011-12-15 PL PL397433A patent/PL218878B1/en unknown
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106191079A (en) * | 2015-09-24 | 2016-12-07 | 内蒙古金凯默生物科技有限公司 | The rhabdovirus system expression of a kind of pigeon circovirus Cap protein of recombinating and the application of this albumen |
Also Published As
| Publication number | Publication date |
|---|---|
| PL397433A1 (en) | 2013-06-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2129390B1 (en) | Turkey herpesvirus vectored recombinant containing avian influenza genes | |
| CN109762792B (en) | A chimeric strain of porcine reproductive and respiratory syndrome virus and its application | |
| CN111019910B (en) | F genotype mumps virus attenuated strain and construction method and application | |
| CN111560354A (en) | Recombinant novel coronavirus and its preparation method and application | |
| EP2560985B1 (en) | Nucleic acid sequences of a fish virus and the use thereof | |
| CN113293145B (en) | New measles virus live vector corona vaccine | |
| CN113293148B (en) | Construction of H gene replaced chimeric measles attenuated strain | |
| WO2022188783A1 (en) | Construction of f gene-replaced chimeric measles attenuated strain | |
| CN105816871A (en) | Infectious hematopoietic necrosis (IHN) nucleic acid vaccines for Chinese rainbow trout and application thereof | |
| CN107164409A (en) | CDV sensitive cell line SLAM MDCK and its construction method and application | |
| CN112940084A (en) | Serum type4 avian adenovirus subunit vaccine and application thereof | |
| JP7213507B2 (en) | Recombinant porcine parvovirus antigen protein and use thereof | |
| PL218878B1 (en) | Method for producing vaccines using recombinant DNA technology immunological veterinary medicinal product for domestic pigeons | |
| Mansoor et al. | Molecular characterization of fowl adenovirus serotype 4 (FAV-4) isolate associated with fowl hydropericardium-hepatitis syndrome in Pakistan | |
| Yang et al. | Biological and molecular characterization of feline caliciviruses isolated from cats in South Korea | |
| CN109943576A (en) | A kind of recombinant rabies virus of chimeric canine distemper virus principal immune gene and its application | |
| CN101092631B (en) | A kind of modified porcine circovirus type 2 ORF2 gene and its application | |
| CN101215575A (en) | Recombinant Adenovirus and Vaccine of Capsid Protein Gene of Rabbit Viral Hemorrhagic Disease Virus | |
| KR102365039B1 (en) | Suspension Cell Culture Adapted Vaccine Strain Derived from Foot-and-mouth disease virus of A/ASIA/Sea-97 Lineage and Method of Preparing the Same | |
| CN111676244B (en) | Measles and rubella combined vaccine using measles virus as carrier | |
| KR20150044954A (en) | Modified human rotaviruses and uses therefor | |
| CN111004783A (en) | Recombinant orf virus for expressing porcine circovirus type 2 CAP protein, preparation method and application thereof | |
| CN120796206B (en) | A recombinant porcine rotavirus simultaneously expressing different G-type VP7, its construction method and application | |
| CN115992099B (en) | Porcine parvovirus strain and application thereof | |
| US20250197454A1 (en) | Virus-like particle containing capsid proteins connected by linker |