CN113293148B - Construction of H gene replaced chimeric measles attenuated strain - Google Patents

Construction of H gene replaced chimeric measles attenuated strain Download PDF

Info

Publication number
CN113293148B
CN113293148B CN202110262340.1A CN202110262340A CN113293148B CN 113293148 B CN113293148 B CN 113293148B CN 202110262340 A CN202110262340 A CN 202110262340A CN 113293148 B CN113293148 B CN 113293148B
Authority
CN
China
Prior art keywords
virus
measles virus
leu
strain
measles
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110262340.1A
Other languages
Chinese (zh)
Other versions
CN113293148A (en
Inventor
安祺
朱凤才
田大勇
解丽霞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Saierfusen Biotechnology Co ltd
Shanghai Qingsai Biotechnology Co ltd
Original Assignee
Beijing Saierfusen Biotechnology Co ltd
Shanghai Qingsai Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Saierfusen Biotechnology Co ltd, Shanghai Qingsai Biotechnology Co ltd filed Critical Beijing Saierfusen Biotechnology Co ltd
Priority to CN202110262340.1A priority Critical patent/CN113293148B/en
Publication of CN113293148A publication Critical patent/CN113293148A/en
Priority to PCT/CN2022/079777 priority patent/WO2022188784A1/en
Application granted granted Critical
Publication of CN113293148B publication Critical patent/CN113293148B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5254—Virus avirulent or attenuated
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18411—Morbillivirus, e.g. Measles virus, canine distemper
    • C12N2760/18421—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18411—Morbillivirus, e.g. Measles virus, canine distemper
    • C12N2760/18422—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18411—Morbillivirus, e.g. Measles virus, canine distemper
    • C12N2760/18423—Virus like particles [VLP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18411—Morbillivirus, e.g. Measles virus, canine distemper
    • C12N2760/18434—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention provides a construction method and application of a chimeric measles attenuated strain with H gene substitution. Specifically, the invention provides a chimeric measles virus attenuated strain, which is a strain with the preservation number of CCTCC NO: measles virus rMV/H (H1 a) V202074. The present invention also provides a vaccine composition comprising the chimeric measles attenuated strain or a derivative virus strain thereof substituted with the H gene as an active ingredient, and a preparation method thereof. Compared with the existing measles vaccine strains in the market, the chimeric measles virus attenuated strain has better protection effect on the epidemic H1a genotype measles virus.

Description

Construction of H gene replaced chimeric measles attenuated strain
Technical Field
The invention belongs to the technical field of biological engineering, and particularly relates to a chimeric measles attenuated strain with H gene substitution, and a preparation method and application thereof.
Background
Measles is an acute systemic infectious disease caused by Measles Virus (MV) infection. The main clinical manifestations of measles patients are fever, conjunctival congestion, nasal discharge, cough, maculopapule of skin and measles mucomacules of oral mucosa, and even complications may occur: diarrhea, deafness, blindness, encephalitis, myocarditis, severe malnutrition, and the like.
Before the development of measles live attenuated vaccines, measles was a disease that severely compromised the life and health of infants. With the successful production of live attenuated vaccines, the incidence of measles is controlled to very low levels. However, in recent decades, the incidence of measles in europe, east asia and south asia has been rising repeatedly, and it is typical that the genotypes of the epidemic strains in different regions are different; meanwhile, measles virus is increasingly infected in humans, and the symptoms of measles in adults are usually more severe.
The only measles vaccine product currently on the market is the live attenuated vaccine. Inactivated measles vaccine causes severe antibody-dependent enhancement.
Aiming at measles epidemic situation repeated in recent decades, scientists have developed long-term and systematic research, and two main reasons are currently confirmed, namely, the vaccination intensity and coverage of the vaccine are not enough; second, the genotype of the circulating strain does not match the genotype of the vaccine strain.
The threat of measles to human beings does not disappear immediately, more intensive research is carried out, and the development of more effective vaccines has important significance on the control and even elimination of measles.
The probable reasons for the frequent local measles outbreak in the world and China in recent ten years are as follows: (i) insufficient immune coverage of the vaccine; (ii) The antibody titer is not high enough or the antibody decays too fast after part of the population is immunized; (iii) Although there is only one serotype, complete cross-protection between different genotypes of virus is not achieved, resulting in that when antibodies are reduced, it may no longer be possible to combat the infection with measles virus of other genotypes.
The H protein is the main immunogen protein of the measles virus, contains a plurality of neutralizing epitopes, and the neutralizing epitopes of the H proteins of different genotypes MV are slightly different; this is probably the reason why no complete cross-protection can be achieved with different genotype MV strains. Subunit vaccines based on H proteins can induce significant immune responses in vivo, but there are no products on the market.
Therefore, there is an urgent need in the art to develop an effective and highly safe epidemic prevention means for preventing measles virus.
Disclosure of Invention
The purpose of the present invention is to provide an effective and highly safe epidemic prevention means for preventing measles virus.
In a first aspect of the present invention, there is provided an attenuated strain of chimeric measles virus, which has a accession number of CCTCC NO: measles virus rMV/H (H1 a) V202074.
In another preferred embodiment, the attenuated strain of the chimeric measles virus is obtained by replacing the nucleotide sequence of the measles virus genome of wild type A genotype, corresponding to the H gene sequence shown in SEQ ID NO. 6, with the nucleotide sequence of the H1a genotype H gene shown in SEQ ID NO. 3.
In another preferred embodiment, the genome of said attenuated strain of chimeric measles virus has the nucleotide sequence shown in SEQ ID NO. 5 from the N gene to the L gene.
In a second aspect of the invention there is provided a derivative virus strain derived from the attenuated strain of a chimeric measles virus as described in the first aspect of the invention, having one or more of the following properties:
(a) High replication capacity: the replication capacity and the preservation number are CCTCC NO: measles virus rMV/H (H1 a) from V202074 is comparable in replication capacity in vitro; wherein, the equivalent replication capacity means that the replication rate is the rate of the nucleic acid with the preservation number of CCTCC NO: the replication rate of measles virus rMV/H (H1 a) of V202074 is 80% or more, preferably 90% or more, and more preferably 100% or more;
(b) High immunogenicity: immunogenicity and preservation number are CCTCC NO: measles virus rMV/H (H1 a) from V202074 is relatively immunogenic; wherein, the immunogenicity is equivalent, namely the titer of the induced neutralizing antibody is the value of CCTCC NO: measles virus rMV/H (H1 a) of V202074 induces neutralizing antibody titers of 80% or greater, preferably 90% or greater, more preferably 100% or greater;
(c) The H gene in the genome is replaced by the H gene derived from the H1a genotype measles virus compared to the wild type a genotype measles virus vaccine strain.
In another preferred embodiment, the H gene derived from the H1a genotype measles virus includes: coding sequence of the H1a genotype measles virus H protein, and the 5'UTR and 3' UTR in the H1a genotype measles virus H gene.
In another preferred embodiment, the derived virus strain has a replication capacity significantly higher than that of the wild type A genotype measles virus vaccine strain.
In another preferred embodiment, said "replication capacity is significantly higher" means that the replication rate of said derivative virus strain is more than or equal to 1.5 times, preferably more than or equal to 2 times, more preferably more than or equal to 3 times, more preferably more than or equal to 10 times, more preferably more than or equal to 50 times, most preferably more than or equal to 100 times the replication rate of the wild type A genotype measles virus vaccine strain.
In another preferred embodiment, the derived virus strain has a replication rate in Vero-slam cells greater than or equal to 10 times, preferably greater than or equal to 50 times, more preferably greater than or equal to 100 times that of the A-genotype measles virus vaccine strain.
In another preferred embodiment, said derivative virus strain has a replication rate in Vero cells which is greater than or equal to 1.5 times, preferably greater than or equal to 2 times, more preferably greater than or equal to 3 times that of the A genotype measles virus vaccine strain.
In another preferred embodiment, said replication comprises in vivo and in vitro replication of the virus.
In another preferred embodiment, said replication is replication in a host cell.
In another preferred embodiment, the host cell is selected from the group consisting of: vero cells, vero-Slam cells, CEF cells; preferably Vero-Slam cells.
In another preferred embodiment, the derived virus strain is significantly more immunogenic than the wild type a genotype measles virus vaccine strain.
In another preferred embodiment, the "immunogenicity is significantly higher" means that the derived virus strain induces a neutralizing antibody titer which is at least 2 times, preferably at least 2.5 times, more preferably at least 5 times higher than the neutralizing antibody titer induced by the wild type A genotype measles virus vaccine strain.
In another preferred embodiment, the neutralizing capacity of the derivative virus strain against H1a virus is higher than or comparable to the neutralizing capacity of H1a genotype virus against H1a genotype virus; preferably, the neutralizing titer of the derivative virus strain against H1a virus is greater than or equal to 90%, preferably greater than or equal to 100%, more preferably greater than or equal to 120% of the neutralizing titer of H1a genotype virus against H1a genotype virus.
In another preferred embodiment, the genome of the derivative virus strain comprises the following nucleotide sequence: the sequence identity to the nucleotide sequence depicted in SEQ ID NO. 5 is not less than 85%, preferably not less than 90%, more preferably not less than 95% (e.g., not less than 85%, not less than 86%, not less than 87%, not less than 88%, not less than 89%, not less than 90%, not less than 91%, not less than 92%, not less than 93%, not less than 94%, not less than 95%, not less than 96%, not less than 97%, not less than 98% or not less than 99%).
In another preferred example, the sequence of the H gene in the genome of said wild type A genotype measles virus, corresponding to that shown in SEQ ID NO 6, is replaced by the nucleotide sequence of the H1a genotype measles virus H gene shown in SEQ ID NO 3.
In a third aspect of the invention there is provided a virus-like particle comprising an attenuated strain of a chimeric measles virus according to the first aspect of the invention or a derivative strain of a virus according to the second aspect of the invention.
In a fourth aspect of the invention, there is provided a vaccine composition comprising:
(i) An attenuated strain of a chimeric measles virus according to the first aspect of the invention, a derivative virus strain according to the second aspect of the invention, or a virus-like particle according to the third aspect of the invention; and
(ii) A vaccine acceptable carrier.
In another preferred embodiment, the carrier is a pharmaceutically acceptable carrier.
In another preferred embodiment, the pharmaceutically acceptable carrier comprises a liquid, preferably water, saline or a buffer.
In another preferred embodiment, the carrier further comprises auxiliary substances, preferably fillers, lubricants, glidants, wetting or emulsifying agents, pH buffering substances and the like.
In another preferred embodiment, the vector further comprises a cell transfection reagent.
In another preferred embodiment, the vaccine composition is a bivalent vaccine or a multiple vaccine.
In another preferred embodiment, the vaccine composition further comprises a vaccine component derived from one or more pathogens selected from the group consisting of: mumps, rubella, encephalitis B, hepatitis A, chickenpox, polio or combinations thereof.
In another preferred embodiment, the vaccine components comprise inactivated strains, attenuated strains, or proteins, nucleic acids, and the like.
In another preferred embodiment, the vaccine composition further comprises an adjuvant.
In another preferred embodiment, the adjuvant comprises: particulate and non-particulate adjuvants.
In another preferred embodiment, the particulate adjuvant is selected from the group consisting of: an aluminum salt, a water-in-oil emulsion, an oil-in-water emulsion, a nanoparticle, a microparticle, a liposome, an immunostimulatory complex, or a combination thereof.
In another preferred embodiment, the non-particulate adjuvant is selected from the group consisting of: muramyl dipeptide and its derivatives, saponin, lipid A, cytokine, derivative polysaccharide, bacterial toxin, microorganism and its product such as mycobacteria (Mycobacterium tuberculosis, bacillus Calmette-Guerin), bacillus pumilus, bordetella pertussis, propolis, or combinations thereof.
In another preferred embodiment, the vaccine composition has a dose of virus of not less than 3.5lgCCID per dose 50 。
In another preferred embodiment, the vaccine composition is in an injectable dosage form.
In a fifth aspect of the invention, there is provided a method for preparing an attenuated strain of chimeric measles virus comprising the steps of:
(i) Constructing a chimeric measles virus recombinant plasmid comprising a nucleotide sequence selected from the group consisting of: the H gene corresponding to the nucleotide sequence shown as SEQ ID NO. 6 of the genome of the wild type A genotype measles virus was replaced by the nucleotide sequence shown as SEQ ID NO. 3; or a nucleotide sequence having a sequence identity of not less than 85%, preferably not less than 90%, more preferably not less than 95% (e.g., not less than 85%, not less than 86%, not less than 87%, not less than 88%, not less than 89%, not less than 90%, not less than 91%, not less than 92%, not less than 93%, not less than 94%, not less than 95%, not less than 96%, not less than 97%, not less than 98% or not less than 99%) to the nucleotide sequence shown in SEQ ID NO. 5;
(ii) Obtaining three helper plasmids respectively containing the N gene, the P gene and the L gene in the measles virus; and
(iii) (ii) co-transfecting host cells with the recombinant plasmid obtained in (i) and the three helper plasmids, respectively, culturing for 2-4 days (preferably 3 days), lysing the cells, inoculating to new cells, and culturing until cytopathy is observed, thereby obtaining the attenuated strain of the chimeric measles virus.
In another preferred embodiment, the host cell is selected from the group consisting of: BSR-T7 cells, 293T cells, vero cells, slam/Vero cells, or combinations thereof.
In a sixth aspect of the invention, there is provided the use of an attenuated strain of a chimeric measles virus according to the first aspect of the invention, a derivative virus strain according to the second aspect of the invention or a virus-like particle according to the third aspect of the invention, for the preparation of a vaccine composition for the prevention of measles.
In another preferred embodiment, the measles are measles of H1a genotype or a genotype.
In another preferred embodiment, the measles are measles of the H1a genotype.
In a seventh aspect of the invention, there is provided a method of preparing a vaccine composition comprising the steps of:
(i) The preservation number is CCTCC NO: passaging or culturing measles virus rMV/H (H1 a) of V202074 or a derivative virus strain according to claim 2 to produce an attenuated vaccine strain;
(ii) (ii) mixing said attenuated vaccine strain prepared in step (i) with an immunologically acceptable carrier to thereby produce a vaccine composition.
In an eighth aspect of the present invention, there is provided an inoculation method for preventing measles, comprising the steps of: a subject in need thereof is vaccinated with an attenuated strain of a chimeric measles virus according to the first aspect of the invention, a derivative virus strain according to the second aspect of the invention, a virus-like particle according to the third aspect of the invention, or a vaccine composition according to the fourth aspect of the invention.
In another preferred example, the subject is a subject susceptible to measles of 8 months or older.
In another preferred example, the inoculation mode comprises subcutaneous injection inoculation.
In another preferred embodiment, the vaccination dose is 0.3-0.7mL (preferably 0.4-0.6mL, more preferably 0.5 mL) L, and the viral load is not less than 3.5lgCCID 50 。
It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be repeated herein, depending on the space.
Drawings
FIG. 1 shows a backbone diagram of a chimeric virus gene.
FIG. 2 shows the restriction map of the chimeric virus.
FIG. 3 shows the sequencing and alignment of the chimeric viruses.
Figure 4 shows the chimeric virus electron microscopy identification results.
Figure 5 shows the multistep growth characteristics of the chimeric virus in Vero cells.
FIG. 6 shows the multistep growth characteristics of the chimeric viruses in Vero-Slam cells.
FIG. 7 shows the multistep growth characteristics of the chimeric viruses in Vero-Slam cells.
FIG. 8 shows the results of an immunogenicity analysis of the chimeric virus.
Detailed Description
The present inventors have conducted extensive and intensive studies and extensive screening to develop a chimeric measles attenuated strain and a strain derived therefrom for the first time. Specifically, the inventor uses the genome of the A genotype vaccine strain as a frame, replaces the H gene with the H gene of the H1a genotype measles virus, constructs and rescues to obtain the chimeric virus; the experimental result shows that the chimeric virus obtained by the invention can show the growth characteristics of typical H1a genotype measles virus and can generate higher immunity to the H1a genotype virus in organisms. By applying the strategy, the attenuated live vaccine aiming at measles viruses of various epidemic genotypes can be quickly prepared, and compared with the traditional weakening process, the attenuated live vaccine is more efficient and higher in safety. The present invention has been completed based on this finding.
Term(s)
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
As used herein, the term "comprising" or "includes" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …," or "consisting of ….
As used herein, the term "polynucleotide" refers to a chain compound formed by the polymerization of nucleotides.
As used herein, the term "vaccine" refers to a biological product made against infection by a wide variety of pathogenic microorganisms for prophylactic or therapeutic vaccination. Vaccines are roughly classified into attenuated live vaccines, inactivated vaccines, recombinant protein vaccines, vector vaccines, nucleic acid vaccines, and the like; attenuated live vaccines are preferred herein.
As used herein, the term "serotype" refers to a method of classification of a pathogen: typically, the immunogenicity of a virus or bacterium, e.g., if the serotypes are the same, is generally consistent between different strains of the same serotype.
As used herein, the term "genotype" refers to the classification of a virus or bacterium at the genetic level, which is more refined than serotype classification.
As used herein, the term "cross-protective insufficiency" refers to the inability of one of the serotypes as a vaccine to completely protect against challenge by the other serotype, which is referred to as cross-protective insufficiency. Herein, a phenomenon is involved: there are many viruses (such as measles virus, mumps virus, etc.), which have only one serotype, but there is also a certain phenomenon of incomplete cross-protection among different genotypes.
Measles Virus (Measles Virus, MV)
MV belongs to the genus Morbillivirus (Paramyxoviridae) of the family Paramyxoviridae, and has spherical viral particles with a diameter of about 120nm to 250nm. The MV genome is single negative strand RNA and has a total length of about 16kb. The genome is sequentially N-P/C/V-M-F-H-L from the 3 'end to the 5' end, and 6 structural and functional proteins are respectively coded: nucleoprotein (N), phosphorylated protein (P), membrane protein (M), fusion protein (F), hemagglutinin glycoprotein (H), and RNA-dependent RNA polymerase (L).
MV, although it has only one serotype, has a number of genotypes. WHO recently identified a total of 24 genotypes of measles virus. The genotypes of measles epidemic strains in different regions are different, the H1a subtype is the main genotype of measles epidemic strains in China, and the G genotype is the main genotype of Europe. Existing studies have also demonstrated that MVs of different genotypes have slightly different immunogenicity and cannot achieve cross-protection.
The H protein is the main immunogen protein of the measles virus, contains a plurality of neutralizing epitopes, and the neutralizing epitopes of the H proteins of different genotypes MV are slightly different; this is probably the reason why no complete cross-protection can be achieved with different genotype MV strains.
In measles viruses of genotype A and H1a, there is a separate H protein. The H proteins of the two have certain homology. The amino acid sequences are respectively shown as SEQ ID NO 1 and SEQ ID NO 2.
Amino acid sequence of protein H of a genotype a measles virus:
MSPQRDRINAFYKDNPHPKGSRIVINREHLMIDRPYVLLAVLFVMSLSLIGLLAIAGIRLHRAAIYTAEIHKSLSTNLDVTNSIEHQVKDVLTPLFKIIGDEVGLRTPQRFTDLVKFISDKIKFLNPDREYDFRDLTWCINPPERIKLDYDQYCADVAAEELMNALVNSTLLETRTTNQFLAVSKGNCSGPTTIRGQFSNMSLSLLDLYLSRGYNVSSIVTMTSQGMYGGTYLVEKPNLSSKRSELSQLSMYRVFEVGVIRNPGLGAPVFHMTNYLEQPVSNDLSNCMVALGELKLAALCHGEDSITIPYQGSGKGVSFQLVKLGVWKSPTDMQSWVPLSTDDPVIDRLYLSSHRGVIADNQAKWAVPTTRTDDKLRMETCFQQACKGKIQALCENPEWAPLKDNRIPSYGVLSVDLSLTVELKIKIASGFGPLITHGSGMDLYKSNHNNVYWLTIPPMKNLALGVINTLEWIPRFKVSPNLFTVPIKEAGEDCHAPTYLPAEVDGDVKLSSNLVILPGQDLQYVLATYDTSRVEHAVVYYVYSPGRSFSYFYPFRLPIKGVPIELQVECFTWDQKLWCRHFCVLADSESGGHITHSGMVGMGVSCTVTREDGTNRR(SEQ ID NO:1)
amino acid sequence of the H protein of H1a genotype measles virus:
MSPQRDRINAFYKDNPHSKGSRIVINREHLMIDRPYVLLAVLFVMFLSLIGLLAIAGIRLHRAAIYTAEIHKSLSTNLDVTNSIEHQVKDVLTPLFKIIGDEVGLRTPQRFTDLVKFISDKIKFLNPDREYDFRDLTWCINPPERIKLNYDQYCADVAAEELMNALVNSTLLETRTTNQFLAVSKGNCSGPTTIRGQFSNMSLSLLDLYLSRGYNVSSIVTMTSQGMYGGTYLVEKPNLNSKGSELSQLSMYRVFEVGVIRNPGLGAPVFHMTNYFEQPISKDLSNCMVALGELKLAALCHGGDSITIPYQGSGKGVSFQLVKLGVWKSPTDMHSWVPLSTDDPVIDRLYLSSHRGVITDNQANWAVPTTRTDDKLRMETCFQQACKGKIQALCENLEWAPLKDSRIPSYGVLSVDLSLAAEPKIKIASGFGPLITHGSGMDLYKSNHNNVYWLTIPPMKNLALGVINTLEWIPRLKVSPNLFTVPIKEAGEDCHAPTYLPAEVDGDVKLSSNLVILPGQDLQYVLATYDTSRVEHAVVYYVYSPSRSFSYFYPFRLPIKGTPIELQVECFTWAQRLWCRHFCVLADSESGRHITHSGMVGMEVSCTVNREDEANRR*(SEQ ID NO:2)
chimeric measles virus attenuated strains and derivative virus strains
As used herein, the terms "chimeric virus", "chimeric measles virus attenuated strain", "attenuated strain of the present invention", "measles virus rMV/H (H1 a)" are used interchangeably and refer to a virus having a deposition number of CCTCC NO: measles virus rMV/H (H1 a) V202074.
In the present invention, the provided attenuated strain of the chimeric measles virus is derived from a wild-type a genotype measles virus vaccine strain and on the basis thereof the H gene in the genome is replaced by the H gene derived from the H1a genotype measles virus.
Wherein the post-replacement region (or the new insertion sequence) in the attenuated strain of chimeric measles virus comprises not only the gene encoding the H protein of the H1a genotype measles virus but also the 5'UTR and 3' UTR sequences of the H gene in the H1a genotype measles virus, so that the H protein can be better expressed in the recombinant virus.
The introduced H1a genotype measles virus H gene sequence:
AGGGTGCAAGATCATCCACAATGTCACCACAACGAGACCGGATAAATGCCTTCTACAAAGACAACCCT CATTCCAAGGGAAGCAGGATAGTCATCAACAGAGAACATCTCATGATTGATAGACCCTATGTTTTGCTGGCTATTC TGTTCGTCATGTTTCTGAGCTTGATCGGGTTGCTGGCCATTGCAGGCATTAGGCTTCATCGGGCAGCTATCTACAC TGCAGAGATCCATAAAAGCCTCAGCACCAATCTAGATGTAACTAACTCAATCGAGCATCAGGTCAAGGATGTGCTT ACACCACTCTTCAAAATCATCGGTGATGAAGTGGGCCTGAGAACACCTCAGAGATTCACTGACCTAGTGAAATTCA TCTCTGACAAGATCAAATTCCTTAATCCGGATAGGGAGTATGACTTCAGAGATCTCACTTGGTGTATAAATCCGCC AGAGAGAATCAAATTGAATTATGATCAATACTGTGCAGATGTGGCTGCTGAAGAGCTCATGAATGCATTAGTGAAC TCAACTCTACTGGAGACCAGAACAACCAATCAGTTCCTAGCTGTCTCAAAGGGAAACTGCTCAGGGCCCACTACCA TCAGAGGTCAATTCTCAAACATGTCGCTGTCTCTGTTAGACTTATATTTAAGTCGAGGTTACAATGTGTCATCTAT AGTCACTATGACGTCCCAGGGAATGTACGGGGGAACTTACCTAGTTGAAAAGCCCAATCTGAACAGCAAAGGATCA GAATTATCACAACTGAGCATGTACCGAGTGTTTGAAGTAGGTGTTATAAGAAATCCAGGCTTGGGGGCTCCGGTGT TCCATATGACAAACTATTTTGAACAACCAATCAGTAAGGATCTCAGCAACTGCATGGTAGCTTTGGGGGAGCTCAA ACTCGCAGCCCTTTGTCACGGGGGAGATTCTATCACAATTCCCTATCAGGGATCAGGGAAAGGTGTCAGCTTCCAG CTCGTCAAGCTAGGTGTCTGGAAATCCCCAACCGACATGCATTCCTGGGTCCCCCTATCGACGGATGACCCAGTGA TAGACAGGCTCTACCTCTCATCTCACAGAGGTGTCATCACTGACAATCAAGCAAATTGGGCTGTTCCGACAACACG AACAGATGATAAGTTGCGGATGGAGACATGCTTCCAGCAGGCGTGCAAGGGCAAAATCCAAGCACTCTGTGAAAAT CTCGAGTGGGCACCGTTGAAGGACAGCAGGATTCCTTCATACGGGGTCTTGTCTGTCGACCTGAGTCTGGCAGCTG AGCCCAAAATCAAAATTGCTTCGGGATTCGGTCCATTGATCACTCACGGTTCAGGGATGGACCTATACAAATCCAA CCACAACAATGTGTATTGGCTGACTATCCCGCCAATGAAGAACTTAGCCTTAGGTGTAATCAACACATTGGAGTGG ATACCGAGACTCAAGGTTAGTCCCAACCTCTTCACTGTCCCAATTAAGGAAGCAGGCGAGGACTGCCACGCCCCAA CATACCTACCTGCGGAGGTGGATGGTGATGTCAAACTCAGTTCCAATCTGGTGATTCTACCTGGTCAAGATCTCCA ATATGTTTTGGCAACCTACGATACTTCCAGAGTTGAACATGCTGTGGTTTATTACGTTTACAGCCCAAGCCGCTCA TTCTCTTACTTTTATCCCTTTAGGTTACCTATAAAGGGGACCCCCATCGAATTACAAGTGGAATGCTTCACATGGG CCCAAAGACTCTGGTGCCGTCACTTCTGTGTGCTTGCTGACTCGGAATCTGGTAGACATATCACCCACTCTGGGAT GGTGGGCATGGAAGTCAGCTGCACAGTCAACCGGGAAGACGAAGCCAATCGCAGATAGGGCAGCCAGTGAACTAACAACATGATTTCACTCAGACATCAAGAATACCCACCAGTGTGAAATAGACATCAGAATTAAGAAAAA (SEQ ID NO:3, wherein the underlined part is the gene encoding the H1a genotype measles virus H protein)
H gene replaced in the genome of a genotype measles virus:
agggtgcaagatcatccacaatgtcaccacaacgagaccggataaatgccttctacaaagataacccccatcccaagggaagtaggatagtcattaacagagaacatcttatgattgatagaccttatgttttgctggctgttctgtttgtcatgtttctgagcttgatcgggttgctagccattgcaggcattagacttcatcgggcagccatctacaccgcagagatccataaaagcctcagcaccaatctagatgtaactaactcaatcgagcatcaggtcaaggacgtgctgacaccactcttcaaaatcatcggtgatgaagtgggcctgaggacacctcagagattcactgacctagtgaaattaatctctgacaagattaaattccttaatccggatagggagtacgacttcagagatctcacttggtgtatcaacccgccagagagaatcaaattggattatgatcaatactgtgcagatgtggctgctgaagagctcatgaatgcattggtgaactcaactctactggagaccagaacaaccaatcagttcctagctgtctcaaagggaaactgctcagggcccactacaatcagaggtcaattctcaaacatgtcgctgtccctgttagacttgtatttaggtcgaggttacaatgtgtcatctatagtcactatgacatcccagggaatgtatgggggaacttacctagtggaaaagcctaatctgagcagcaaaaggtcagagttgtcacaactgagcatgtaccgagtgtttgaagtaggtgttatcagaaatccgggtttgggggctccggtgttccatatgacaaactatcttgagcaaccagtcagtaatgatctcagcaactgtatggtggctttgggggagctcaaactcgcagccctttgtcacggggaagattctatcacaattccctatcagggatcagggaaaggtgtcagcttccagctcgtcaagctaggtgtctggaaatccccaaccgacatgcaatcctgggtccccttatcaacggatgatccagtgatagacaggctttacctctcatctcacagaggtgttatcgctgacaatcaagcaaaatgggctgtcccgacaacacgaacagatgacaagttgcgaatggagacatgcttccaacaggcgtgtaagggtaaaatccaagcactctgcgagaatcccgagtgggcaccattgaaggataacaggattccttcatacggggtcttgtctgttgatctgagtctgacagttgagcttaaaatcaaaattgcttcgggattcgggccattgatcacacacggttcagggatggacctatacaaatccaaccacaacaatgtgtattggctgactatcccgccaatgaagaacctagccttaggtgtaatcaacacattggagtggataccgagattcaaggttagtccctacctcttcactgtcccaattaaggaagcaggcgaagactgccatgccccaacatacctacctgcggaggtggatggtgatgtcaaactcagttccaatctggtgattctacctggtcaagatctccaatatgttttggcaacctacgatacttccagggttgaacatgctgtggtttattacgtttacagcccaagccgctcattttcttacttttatccttttaggttgcctataaagggggtccccatcgaattacaagtggaatgcttcacatgggaccaaaaactctggtgccgtcacttctgtgtgcttgcggactcagaatctggtggacatatcactcactctgggatggtgggcatgggagtcagctgcacagtcacccgggaagatggaaccaatcgcagatagggctgctagtgaaccaatcacatgatgtcacccagacatcaggcatacccactagtgtgaaatagacatcagaattaagaaaaa(SEQ ID NO:6)
preferably, the genomic sequence from the N gene to the L gene of the wild type A genotype measles virus is represented by SEQ ID NO 4, whereas the genomic sequence from the N gene to the L gene of the chimeric measles virus of the invention has the following nucleotide sequence: 5, wherein the H gene sequence shown as SEQ ID NO 6 in the genome of the wild type A genotype measles virus is replaced by the nucleotide sequence of the H1a genotype measles virus H gene shown as SEQ ID NO 3.
Furthermore, the present invention provides derivative virus strains derived from the attenuated strains of the chimeric measles viruses of the invention.
The derivative virus strains of the chimeric measles virus attenuated strains of the invention have one or more of the following properties:
(a) High replication capacity: the replication capacity and the preservation number are CCTCC NO: measles virus rMV/H (H1 a) from V202074 is comparable in replication capacity in vitro; wherein, the equivalent replication capacity means that the replication rate is the rate of the nucleic acid with the preservation number of CCTCC NO: the replication rate of measles virus rMV/H (H1 a) of V202074 is 80% or more, preferably 90% or more, more preferably 100% or more;
(b) High immunogenicity: immunogenicity and preservation number are CCTCC NO: measles virus rMV/H (H1 a) from V202074 is relatively immunogenic; wherein, the immunogenicity is equivalent, namely the titer of the induced neutralizing antibody is the value of CCTCC NO: the titer of neutralizing antibodies induced by measles virus rMV/H (H1 a) of V202074 is 80% or more, preferably 90% or more, more preferably 100% or more;
(c) The H gene in the genome is replaced by the H gene derived from the H1a genotype measles virus compared to the wild type a genotype measles virus vaccine strain.
The replication capacity of the derivative virus strain provided by the invention is obviously higher than that of a wild type A genotype measles virus vaccine strain. Wherein, the replication capacity is obviously higher than that of the derivative virus strain, namely the replication rate of the derivative virus strain is more than or equal to 1.5 times, preferably more than or equal to 2 times, more preferably more than or equal to 3 times, more preferably more than or equal to 10 times, more preferably more than or equal to 50 times, and most preferably more than or equal to 100 times of that of the wild type A genotype measles virus vaccine strain.
In one embodiment, the replication is performed in Vero-slam cells and the derivative virus strain has a replication rate greater than or equal to 10 times, preferably greater than or equal to 50 times, more preferably greater than or equal to 100 times that of the A-genotype measles virus vaccine strain.
In one embodiment, the replication is carried out in Vero cells and the derived viral strain has a replication rate greater than or equal to 1.5 times, preferably greater than or equal to 2 times, more preferably greater than or equal to 3 times that of the A-genotype measles virus vaccine strain.
Wherein said replication comprises in vivo and in vitro replication of the virus. Preferably, said replication is replication in a host cell. The host cell is selected from the group consisting of: vero cells, vero-Slam cells, CEF cells; preferably Vero-Slam cells.
In another embodiment, the derived virus strain is significantly more immunogenic than the wild type a genotype measles virus vaccine strain. Wherein, the immunogenicity is significantly higher than that of the derivative virus strain, which means that the titer of the neutralizing antibody induced by the derivative virus strain is more than or equal to 2 times, preferably more than or equal to 2.5 times, and more preferably more than or equal to 5 times of that induced by the wild type A genotype measles virus vaccine strain.
The neutralizing capacity of the derivative virus strain of the invention to H1a virus is higher than or equal to that of H1a genotype virus to H1a genotype virus; preferably, the neutralizing titer of the derivative virus strain against H1a virus is greater than or equal to 90%, preferably greater than or equal to 100%, more preferably greater than or equal to 120% of the neutralizing titer of H1a genotype virus against H1a genotype virus.
Preferably, the genome of the derivative virus strain comprises the following nucleotide sequence: the sequence identity to the nucleotide sequence depicted in SEQ ID NO. 5 is not less than 85%, preferably not less than 90%, more preferably not less than 95% (e.g., not less than 85%, not less than 86%, not less than 87%, not less than 88%, not less than 89%, not less than 90%, not less than 91%, not less than 92%, not less than 93%, not less than 94%, not less than 95%, not less than 96%, not less than 97%, not less than 98% or not less than 99%).
More preferably, the sequence of the H gene in the genome of said wild type A genotype measles virus, corresponding to that shown in SEQ ID NO 6, is replaced by the nucleotide sequence of the H1a genotype measles virus H gene shown in SEQ ID NO 3.
In the present invention, there is also provided a method for preparing the attenuated strain of the chimeric measles virus according to the invention, comprising the steps of:
(i) Constructing a chimeric measles virus recombinant plasmid comprising a nucleotide sequence selected from the group consisting of: the H gene corresponding to the nucleotide sequence shown as SEQ ID NO. 6 of the genome of the wild type A genotype measles virus was replaced by the nucleotide sequence shown as SEQ ID NO. 3; or a nucleotide sequence having a sequence identity of not less than 85%, preferably not less than 90%, more preferably not less than 95% (e.g., not less than 85%, not less than 86%, not less than 87%, not less than 88%, not less than 89%, not less than 90%, not less than 91%, not less than 92%, not less than 93%, not less than 94%, not less than 95%, not less than 96%, not less than 97%, not less than 98% or not less than 99%) to the nucleotide sequence shown in SEQ ID NO. 5;
(ii) Obtaining three helper plasmids respectively containing the N gene, the P gene and the L gene in the measles virus; and
(iii) (ii) co-transfecting host cells with the recombinant plasmid obtained in (i) and the three helper plasmids, respectively, culturing for 2-4 days (preferably 3 days), lysing the cells, inoculating to new cells, and culturing until cytopathy is observed, thereby obtaining the attenuated strain of the chimeric measles virus.
Preferably, the host cell is selected from the group consisting of: BSR-T7 cells, 293T cells, vero cells, slam/Vero cells, or combinations thereof.
Vaccine composition
In the present invention, there is provided a method of preparing a vaccine composition comprising the steps of:
(i) The preservation number is CCTCC NO: passaging or culturing measles virus rMV/H (H1 a) of V202074 or a derivative strain of claim 2 to produce an attenuated vaccine strain;
(ii) (ii) mixing said attenuated vaccine strain prepared in step (i) with an immunologically acceptable carrier to thereby produce a vaccine composition.
The vaccine composition provided by the invention comprises:
(i) An attenuated strain of a chimeric measles virus according to the first aspect of the invention, a derivative virus strain according to the second aspect of the invention, or a virus-like particle according to the third aspect of the invention; and
(ii) A vaccine acceptable carrier.
Preferably, the carrier is a pharmaceutically acceptable carrier. In one embodiment, the pharmaceutically acceptable carrier comprises a liquid, preferably water, saline or a buffer.
The carrier also contains auxiliary substances, preferably fillers, lubricants, glidants, wetting or emulsifying agents, pH buffering substances and the like. In a preferred embodiment, the vector further comprises a cell transfection reagent.
The vaccine composition of the invention is a bivalent vaccine or a multiple vaccine. Preferably, the vaccine composition further comprises a vaccine component derived from one or more pathogens selected from the group consisting of: mumps, rubella, encephalitis B, hepatitis A, chickenpox, poliomyelitis or a combination thereof.
In one embodiment, the vaccine components include inactivated strains, attenuated strains, or proteins, nucleic acids, and the like.
In the present invention, the vaccine composition further comprises an adjuvant. Preferably, the adjuvant comprises: particulate and non-particulate adjuvants. In a preferred embodiment, the particulate adjuvant is selected from the group consisting of: an aluminum salt, a water-in-oil emulsion, an oil-in-water emulsion, a nanoparticle, a microparticle, a liposome, an immunostimulatory complex, or a combination thereof. In another preferred embodiment, the non-particulate adjuvant is selected from the group consisting of: muramyl dipeptide and its derivatives, saponin, lipid A, cytokine, derivative polysaccharide, bacterial toxin, microorganism and its product such as mycobacteria (Mycobacterium tuberculosis, bacillus Calmette-Guerin), bacillus pumilus, bordetella pertussis, propolis, or combinations thereof.
In the present invention, preferably, the dose of the virus per dose of the vaccine composition is not less than 3.5lgCCID50. In a more preferred embodiment, the vaccine composition of the present invention is in an injectable dosage form.
Virus strain preservation
As used herein, "chimeric measles virus attenuated strain" and "measles virus rMV/H (H1 a)" of the present invention are used interchangeably and have been deposited at the chinese culture collection center (CCTCC) at 31/10/2020 at the addresses: china, wuhan university. The virus strain has a preservation number of CCTCC NO: v202074.
Use and vaccination methods of the chimeric measles virus attenuated strains of the invention
The attenuated strain of the chimeric measles virus according to the first aspect of the invention, the derivative virus strain according to the second aspect of the invention or the virus-like particle according to the third aspect of the invention all have the use for the preparation of a vaccine composition for the prevention of measles.
Preferably, the measles are H1a genotype or a genotype measles, preferably H1a genotype measles. In addition, the present invention provides an inoculation method for preventing measles, comprising the steps of: a subject in need thereof is vaccinated with an attenuated strain of a chimeric measles virus according to the first aspect of the invention, a derivative virus strain according to the second aspect of the invention, a virus-like particle according to the third aspect of the invention, or a vaccine composition according to the fourth aspect of the invention.
Preferably, the subject is susceptible to measles of 8 months or more.
In a preferred embodiment, the inoculation mode comprises subcutaneous injection inoculation. Preferably, the vaccination dose is 0.3-0.7mL (preferably 0.4-0.6mL, more preferably 0.5 mL) and the viral load is not less than 3.5lgCCID 50 。
The main advantages of the invention include:
1) Compared with the existing measles vaccine strains in the market, the chimeric virus has better protection effect on the epidemic H1a genotype measles virus.
2) By using a reverse genetic operation system, corresponding candidate vaccine strains can be obtained in a short time.
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.
Example 1: construction and identification of full-length cDNA of chimeric virus
As shown in FIG. 1, the framework of the chimeric measles virus is shown. A target plasmid was obtained by PCR amplification of an H gene fragment (containing 5'UTR of H gene and 3' UTR of H gene) using cDNA reverse-transcribed from a nucleic acid of H1a genotype measles virus as a template and specific primers MV-H-F and MV-H-R in Table 1, and PCR amplification of an H gene deletion vector using S191 full-length plasmid as a template and specific primers ZL-F and H-ZL-R. The success of the chimeric virus full-length cDNA clone was confirmed by enzyme digestion identification (see FIG. 2).
TABLE 1 primers related to amplification and detection of chimeric viruses
Figure BDA0002970545240000151
Example 2: chimeric virus rescue
Experimental methods and procedures:
extracting pMV, pMV/H (H1 a) full-length clone and helper plasmid in large quantity; it was co-transfected into cells for viral rescue. 293T cells were seeded in six-well plates for overnight culture, and wells with 80-90% cell confluence were selected for virus rescue.
The specific process is as follows: mixing the full-length plasmid pMV or pMV/H (H1 a) (4. Mu.g), helper plasmid pcDNA3.1-N (1.5. Mu.g), pcDNA3.1-P (0.2. Mu.g), pcDNA3.1-L (1.0. Mu.g), pCAGGS-T7 (1.0. Mu.g) and Lipofectamine TM 2000 transfection reagent (12. Mu.L) in 500. Mu.L DMEM medium, and incubating at 37 ℃ for 20min; cells were washed 3 times with PBS, and then the plasmid transfection reagent mixture was added to the cell wells and incubated for 6h at 37 ℃. Washing with PBS for 3 times, replacing with DMEM medium containing 2% fetal calf serum and 1% antibiotics, and culturing at 37 deg.C for 3-4 days; the cells are passaged according to 1:3, meanwhile, equal Vero-Slam cells are added, the culture is continued until the cells have confluent lesions, and cell supernatants are collected and identified.
Success of chimeric virus rescue was determined using sequencing and electron microscopy, respectively.
The cell supernatants with cell fusion were collected and inoculated with new cells to the cell fusion lesions, 200ul of cell supernatants were taken to extract total RNA, then DNA was removed with a DNA removal kit, specific fragments were amplified with specific primers H-C-F and H-C-R (as in Table 1) respectively and sequenced.
The results are shown in FIG. 3. The H gene in the recombinant virus is determined to be the H gene of the H1a genotype virus, which indicates that the replacement is successful.
Meanwhile, the virus is expanded and cultured, the virus supernatant is collected, clarified by centrifugation and concentrated by 100 times, and virus particles of the chimeric virus can be clearly observed through a transmission electron microscope, the particle size of the virus particles is equivalent to that of the parental virus rMV, and the result is shown in figure 4.
Example 3: in vitro characterization of chimeric viruses
To evaluate the growth characteristics of chimeric viruses in vitro, we studied multistep growth curves of chimeric viruses and their parental viruses in two cell lines, vero and Vero-Slam, respectively.
First, a cell suspension was prepared so that the cell concentration was 1.0X 10 5 -5.0×10 5 Between cells (unit), cells were arranged at 2X 10 5 One (unit)/well was seeded in 12-well plates.
And (3) after the cells grow to be about 90% in the next day, washing the cells by PBS, inoculating 1ml of virus at 0.01MOI, incubating for 1h at 37 ℃, discarding virus liquid, rinsing for 2 times by PBS, and changing maintenance liquid. Samples were then taken every 24 hours for 5 consecutive days. Subsequently, the virus titer was examined by the micro-cell pathology method.
The results are shown in FIGS. 5 and 6. The results show that the titer of rMV/H (H1 a) on the next day is only 1/10 of rMV, both in Vero cells and Vero-Slam cells. This may be due to replacement of the H protein; overall, however, the replacement of the H protein did not significantly affect the replication capacity of the chimeric virus.
In Vero cells, titers of chimeric viruses rMV/H (H1 a) and rMV started to rise rapidly from the second day after infection with the virus and reached a peak on the fourth day; and the titers did not differ significantly on day four. However, MV-1 titer was maintained at 2lgCCID 50 Per ml, which is more than 1000 times lower than that of the other two plants; and infectious virus titers could no longer be detected at day five post-infection. This indicates that the replication characteristics of the chimeric virus rMV/H (H1 a) are similar to rMV, but do not show much of the characteristics of the wild-type virus. As a result, as shown in FIG. 6, the replication ability of the chimeric virus in Vero-Slam cells was still similar to that of rMV. MV-1 is capable of rapid replication at days 1 and 2 post infection, up to a titer of 5lgCCID 50 Ml, virus titer did not increase and declined slowly starting on day three post-infection.
Meanwhile, in the example, the difference of the speed and the degree of cytopathic effect of the chimeric virus after H protein replacement is compared in Vero cells and Vero-Slam cells respectively.
The results are shown in FIG. 7, with rMV/H (H1 a) and rMV being highly similar in cytopathic condition in both cells, with no significant difference.
Example 4: evaluation of immunogenicity of chimeric viruses
To assess the immunogenicity of the chimeric viruses, in this example, evaluations were performed on a BALB/c mouse model.
Dividing female BALB/c mice 5 weeks old into 6 groups of 10 mice each, injecting 500ul 1.0 × 10 mice each abdominal cavity of immunized group 5 CCID 50 (units)/ml virus suspension, control group was injected with an equal volume of DMEM. Each group was immunized twice 28 days after the first immunization and orbital blood was collected 14 days after the second immunization. Centrifuge at 3000rpm for 10 min at 4 degrees overnight and serum was taken. The serum was inactivated at 56 ℃ for 30 min. Add 50. Mu.L of dilution sample to 96-well plate; dilute Using 96-well plateRelease (2-fold dilution), parallel to 4 wells, (50 μ L of sample dilution +50 μ L of test serum) 1; diluting the serum to be detected to 2048 as a negative control (50 muL diluted sample +50 muL serum to be detected), replacing the virus with the diluted sample, and mixing uniformly. Adding 50ul of 1000CCID50/mL virus into each hole of the serum test groups to be detected with different dilutions, adding samples from high concentration to low concentration, and mixing uniformly. Preparing Vero-SLAM cell suspension with cell concentration of 1.0X 10 5 -5.0×10 5 Between units, 100. Mu.L/Kong Jiayu were mixed in 96-well plates of serum and virus.
Cytopathic effects were observed on day 7 and recorded, and ED50 was calculated using the Reed/Muench method at the end of day 10.
The results are shown in FIG. 8. MV-1, being a virus of H1a genotype, has a higher neutralizing titer against serotoxic H1a genotype than against A genotype after immunization; the corresponding rMV is a genotype a virus, and sera as immunogens have higher neutralizing titers against the genotype a virus. Chimeric virus rMVH (H1 a) immune sera showed a trend consistent with MV-1 and higher neutralizing titers against H1a genotype viruses.
This indicates that the chimeric virus rMVH (H1 a) is a candidate vaccine strain against H1a genotype measles virus.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Shanghai Qingsai Biotechnology Co., ltd
Beijing saierfusen Biotechnology Co.,Ltd.
<120> construction of an H Gene-substituted chimeric measles attenuated Strain
<130> P2020-2298
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 617
<212> PRT
<213> Measles virus (Measles virus)
<400> 1
Met Ser Pro Gln Arg Asp Arg Ile Asn Ala Phe Tyr Lys Asp Asn Pro
1 5 10 15
His Pro Lys Gly Ser Arg Ile Val Ile Asn Arg Glu His Leu Met Ile
20 25 30
Asp Arg Pro Tyr Val Leu Leu Ala Val Leu Phe Val Met Ser Leu Ser
35 40 45
Leu Ile Gly Leu Leu Ala Ile Ala Gly Ile Arg Leu His Arg Ala Ala
50 55 60
Ile Tyr Thr Ala Glu Ile His Lys Ser Leu Ser Thr Asn Leu Asp Val
65 70 75 80
Thr Asn Ser Ile Glu His Gln Val Lys Asp Val Leu Thr Pro Leu Phe
85 90 95
Lys Ile Ile Gly Asp Glu Val Gly Leu Arg Thr Pro Gln Arg Phe Thr
100 105 110
Asp Leu Val Lys Phe Ile Ser Asp Lys Ile Lys Phe Leu Asn Pro Asp
115 120 125
Arg Glu Tyr Asp Phe Arg Asp Leu Thr Trp Cys Ile Asn Pro Pro Glu
130 135 140
Arg Ile Lys Leu Asp Tyr Asp Gln Tyr Cys Ala Asp Val Ala Ala Glu
145 150 155 160
Glu Leu Met Asn Ala Leu Val Asn Ser Thr Leu Leu Glu Thr Arg Thr
165 170 175
Thr Asn Gln Phe Leu Ala Val Ser Lys Gly Asn Cys Ser Gly Pro Thr
180 185 190
Thr Ile Arg Gly Gln Phe Ser Asn Met Ser Leu Ser Leu Leu Asp Leu
195 200 205
Tyr Leu Ser Arg Gly Tyr Asn Val Ser Ser Ile Val Thr Met Thr Ser
210 215 220
Gln Gly Met Tyr Gly Gly Thr Tyr Leu Val Glu Lys Pro Asn Leu Ser
225 230 235 240
Ser Lys Arg Ser Glu Leu Ser Gln Leu Ser Met Tyr Arg Val Phe Glu
245 250 255
Val Gly Val Ile Arg Asn Pro Gly Leu Gly Ala Pro Val Phe His Met
260 265 270
Thr Asn Tyr Leu Glu Gln Pro Val Ser Asn Asp Leu Ser Asn Cys Met
275 280 285
Val Ala Leu Gly Glu Leu Lys Leu Ala Ala Leu Cys His Gly Glu Asp
290 295 300
Ser Ile Thr Ile Pro Tyr Gln Gly Ser Gly Lys Gly Val Ser Phe Gln
305 310 315 320
Leu Val Lys Leu Gly Val Trp Lys Ser Pro Thr Asp Met Gln Ser Trp
325 330 335
Val Pro Leu Ser Thr Asp Asp Pro Val Ile Asp Arg Leu Tyr Leu Ser
340 345 350
Ser His Arg Gly Val Ile Ala Asp Asn Gln Ala Lys Trp Ala Val Pro
355 360 365
Thr Thr Arg Thr Asp Asp Lys Leu Arg Met Glu Thr Cys Phe Gln Gln
370 375 380
Ala Cys Lys Gly Lys Ile Gln Ala Leu Cys Glu Asn Pro Glu Trp Ala
385 390 395 400
Pro Leu Lys Asp Asn Arg Ile Pro Ser Tyr Gly Val Leu Ser Val Asp
405 410 415
Leu Ser Leu Thr Val Glu Leu Lys Ile Lys Ile Ala Ser Gly Phe Gly
420 425 430
Pro Leu Ile Thr His Gly Ser Gly Met Asp Leu Tyr Lys Ser Asn His
435 440 445
Asn Asn Val Tyr Trp Leu Thr Ile Pro Pro Met Lys Asn Leu Ala Leu
450 455 460
Gly Val Ile Asn Thr Leu Glu Trp Ile Pro Arg Phe Lys Val Ser Pro
465 470 475 480
Asn Leu Phe Thr Val Pro Ile Lys Glu Ala Gly Glu Asp Cys His Ala
485 490 495
Pro Thr Tyr Leu Pro Ala Glu Val Asp Gly Asp Val Lys Leu Ser Ser
500 505 510
Asn Leu Val Ile Leu Pro Gly Gln Asp Leu Gln Tyr Val Leu Ala Thr
515 520 525
Tyr Asp Thr Ser Arg Val Glu His Ala Val Val Tyr Tyr Val Tyr Ser
530 535 540
Pro Gly Arg Ser Phe Ser Tyr Phe Tyr Pro Phe Arg Leu Pro Ile Lys
545 550 555 560
Gly Val Pro Ile Glu Leu Gln Val Glu Cys Phe Thr Trp Asp Gln Lys
565 570 575
Leu Trp Cys Arg His Phe Cys Val Leu Ala Asp Ser Glu Ser Gly Gly
580 585 590
His Ile Thr His Ser Gly Met Val Gly Met Gly Val Ser Cys Thr Val
595 600 605
Thr Arg Glu Asp Gly Thr Asn Arg Arg
610 615
<210> 2
<211> 617
<212> PRT
<213> Measles virus (Measles virus)
<400> 2
Met Ser Pro Gln Arg Asp Arg Ile Asn Ala Phe Tyr Lys Asp Asn Pro
1 5 10 15
His Ser Lys Gly Ser Arg Ile Val Ile Asn Arg Glu His Leu Met Ile
20 25 30
Asp Arg Pro Tyr Val Leu Leu Ala Val Leu Phe Val Met Phe Leu Ser
35 40 45
Leu Ile Gly Leu Leu Ala Ile Ala Gly Ile Arg Leu His Arg Ala Ala
50 55 60
Ile Tyr Thr Ala Glu Ile His Lys Ser Leu Ser Thr Asn Leu Asp Val
65 70 75 80
Thr Asn Ser Ile Glu His Gln Val Lys Asp Val Leu Thr Pro Leu Phe
85 90 95
Lys Ile Ile Gly Asp Glu Val Gly Leu Arg Thr Pro Gln Arg Phe Thr
100 105 110
Asp Leu Val Lys Phe Ile Ser Asp Lys Ile Lys Phe Leu Asn Pro Asp
115 120 125
Arg Glu Tyr Asp Phe Arg Asp Leu Thr Trp Cys Ile Asn Pro Pro Glu
130 135 140
Arg Ile Lys Leu Asn Tyr Asp Gln Tyr Cys Ala Asp Val Ala Ala Glu
145 150 155 160
Glu Leu Met Asn Ala Leu Val Asn Ser Thr Leu Leu Glu Thr Arg Thr
165 170 175
Thr Asn Gln Phe Leu Ala Val Ser Lys Gly Asn Cys Ser Gly Pro Thr
180 185 190
Thr Ile Arg Gly Gln Phe Ser Asn Met Ser Leu Ser Leu Leu Asp Leu
195 200 205
Tyr Leu Ser Arg Gly Tyr Asn Val Ser Ser Ile Val Thr Met Thr Ser
210 215 220
Gln Gly Met Tyr Gly Gly Thr Tyr Leu Val Glu Lys Pro Asn Leu Asn
225 230 235 240
Ser Lys Gly Ser Glu Leu Ser Gln Leu Ser Met Tyr Arg Val Phe Glu
245 250 255
Val Gly Val Ile Arg Asn Pro Gly Leu Gly Ala Pro Val Phe His Met
260 265 270
Thr Asn Tyr Phe Glu Gln Pro Ile Ser Lys Asp Leu Ser Asn Cys Met
275 280 285
Val Ala Leu Gly Glu Leu Lys Leu Ala Ala Leu Cys His Gly Gly Asp
290 295 300
Ser Ile Thr Ile Pro Tyr Gln Gly Ser Gly Lys Gly Val Ser Phe Gln
305 310 315 320
Leu Val Lys Leu Gly Val Trp Lys Ser Pro Thr Asp Met His Ser Trp
325 330 335
Val Pro Leu Ser Thr Asp Asp Pro Val Ile Asp Arg Leu Tyr Leu Ser
340 345 350
Ser His Arg Gly Val Ile Thr Asp Asn Gln Ala Asn Trp Ala Val Pro
355 360 365
Thr Thr Arg Thr Asp Asp Lys Leu Arg Met Glu Thr Cys Phe Gln Gln
370 375 380
Ala Cys Lys Gly Lys Ile Gln Ala Leu Cys Glu Asn Leu Glu Trp Ala
385 390 395 400
Pro Leu Lys Asp Ser Arg Ile Pro Ser Tyr Gly Val Leu Ser Val Asp
405 410 415
Leu Ser Leu Ala Ala Glu Pro Lys Ile Lys Ile Ala Ser Gly Phe Gly
420 425 430
Pro Leu Ile Thr His Gly Ser Gly Met Asp Leu Tyr Lys Ser Asn His
435 440 445
Asn Asn Val Tyr Trp Leu Thr Ile Pro Pro Met Lys Asn Leu Ala Leu
450 455 460
Gly Val Ile Asn Thr Leu Glu Trp Ile Pro Arg Leu Lys Val Ser Pro
465 470 475 480
Asn Leu Phe Thr Val Pro Ile Lys Glu Ala Gly Glu Asp Cys His Ala
485 490 495
Pro Thr Tyr Leu Pro Ala Glu Val Asp Gly Asp Val Lys Leu Ser Ser
500 505 510
Asn Leu Val Ile Leu Pro Gly Gln Asp Leu Gln Tyr Val Leu Ala Thr
515 520 525
Tyr Asp Thr Ser Arg Val Glu His Ala Val Val Tyr Tyr Val Tyr Ser
530 535 540
Pro Ser Arg Ser Phe Ser Tyr Phe Tyr Pro Phe Arg Leu Pro Ile Lys
545 550 555 560
Gly Thr Pro Ile Glu Leu Gln Val Glu Cys Phe Thr Trp Ala Gln Arg
565 570 575
Leu Trp Cys Arg His Phe Cys Val Leu Ala Asp Ser Glu Ser Gly Arg
580 585 590
His Ile Thr His Ser Gly Met Val Gly Met Glu Val Ser Cys Thr Val
595 600 605
Asn Arg Glu Asp Glu Ala Asn Arg Arg
610 615
<210> 3
<211> 1958
<212> DNA
<213> Measles virus (Measles virus)
<400> 3
agggtgcaag atcatccaca atgtcaccac aacgagaccg gataaatgcc ttctacaaag 60
acaaccctca ttccaaggga agcaggatag tcatcaacag agaacatctc atgattgata 120
gaccctatgt tttgctggct attctgttcg tcatgtttct gagcttgatc gggttgctgg 180
ccattgcagg cattaggctt catcgggcag ctatctacac tgcagagatc cataaaagcc 240
tcagcaccaa tctagatgta actaactcaa tcgagcatca ggtcaaggat gtgcttacac 300
cactcttcaa aatcatcggt gatgaagtgg gcctgagaac acctcagaga ttcactgacc 360
tagtgaaatt catctctgac aagatcaaat tccttaatcc ggatagggag tatgacttca 420
gagatctcac ttggtgtata aatccgccag agagaatcaa attgaattat gatcaatact 480
gtgcagatgt ggctgctgaa gagctcatga atgcattagt gaactcaact ctactggaga 540
ccagaacaac caatcagttc ctagctgtct caaagggaaa ctgctcaggg cccactacca 600
tcagaggtca attctcaaac atgtcgctgt ctctgttaga cttatattta agtcgaggtt 660
acaatgtgtc atctatagtc actatgacgt cccagggaat gtacggggga acttacctag 720
ttgaaaagcc caatctgaac agcaaaggat cagaattatc acaactgagc atgtaccgag 780
tgtttgaagt aggtgttata agaaatccag gcttgggggc tccggtgttc catatgacaa 840
actattttga acaaccaatc agtaaggatc tcagcaactg catggtagct ttgggggagc 900
tcaaactcgc agccctttgt cacgggggag attctatcac aattccctat cagggatcag 960
ggaaaggtgt cagcttccag ctcgtcaagc taggtgtctg gaaatcccca accgacatgc 1020
attcctgggt ccccctatcg acggatgacc cagtgataga caggctctac ctctcatctc 1080
acagaggtgt catcactgac aatcaagcaa attgggctgt tccgacaaca cgaacagatg 1140
ataagttgcg gatggagaca tgcttccagc aggcgtgcaa gggcaaaatc caagcactct 1200
gtgaaaatct cgagtgggca ccgttgaagg acagcaggat tccttcatac ggggtcttgt 1260
ctgtcgacct gagtctggca gctgagccca aaatcaaaat tgcttcggga ttcggtccat 1320
tgatcactca cggttcaggg atggacctat acaaatccaa ccacaacaat gtgtattggc 1380
tgactatccc gccaatgaag aacttagcct taggtgtaat caacacattg gagtggatac 1440
cgagactcaa ggttagtccc aacctcttca ctgtcccaat taaggaagca ggcgaggact 1500
gccacgcccc aacataccta cctgcggagg tggatggtga tgtcaaactc agttccaatc 1560
tggtgattct acctggtcaa gatctccaat atgttttggc aacctacgat acttccagag 1620
ttgaacatgc tgtggtttat tacgtttaca gcccaagccg ctcattctct tacttttatc 1680
cctttaggtt acctataaag gggaccccca tcgaattaca agtggaatgc ttcacatggg 1740
cccaaagact ctggtgccgt cacttctgtg tgcttgctga ctcggaatct ggtagacata 1800
tcacccactc tgggatggtg ggcatggaag tcagctgcac agtcaaccgg gaagacgaag 1860
ccaatcgcag atagggcagc cagtgaacta acaacatgat ttcactcaga catcaagaat 1920
acccaccagt gtgaaataga catcagaatt aagaaaaa 1958
<210> 4
<211> 15894
<212> DNA
<213> Measles virus (Measles virus)
<400> 4
accaaacaaa gttgggtaag gatagttcaa tcaatgatca tcttctagtg cacttaggat 60
tcaagatcct attatcaggg acaagagcag gattagggat atccgagatg gccacacttt 120
taaggagctt agcattgttc aaaagaaaca aggacaaacc acccattaca tcaggatccg 180
gtggagccat cagaggaatc aaacacatta ttatagtacc aatccctgga gattcctcaa 240
ttaccactcg atccagactt ctggaccggt tggtgaggtt aattggaaac ccggatgtga 300
gcgggcccaa actaacaggg gcactaatag gtatattatc cttatttgtg gagtctccag 360
gtcaattgat tcagaggatc accgatgacc ctgacgttag cataaggctg ttagaggttg 420
tccagagtga ccagtcacaa tctggcctta ccttcgcatc aagaggtacc aacatggagg 480
atgaggcgga ccaatacttt tcacatgatg atccaattag tagtgatcaa tccaggttcg 540
gatggttcgg gaacaaggaa atctcagata ttgaagtgca agaccctgag ggattcaaca 600
tgattctggg taccatccta gcccaaattt gggtcttgct cgcaaaggcg gttacggccc 660
cagacacggc agctgattcg gagctaagaa ggtggataaa gtacacccaa caaagaaggg 720
tagttggtga atttagattg gagagaaaat ggttggatgt ggtgaggaac aggattgccg 780
aggacctctc cttacgccga ttcatggtcg ctctaatcct ggatatcaag agaacacccg 840
gaaacaaacc caggattgct gaaatgatat gtgacattga tacatatatc gtagaggcag 900
gattagccag ttttatcctg actattaagt ttgggataga aactatgtat cctgctcttg 960
gactgcatga atttgctggt gagttatcca cacttgagtc cttgatgaac ctttaccagc 1020
aaatggggga aactgcaccc tacatggtaa tcctggagaa ctcaattcag aacaagttca 1080
gtgcaggatc ataccctctg ctctggagct atgccatggg agtaggagtg gaacttgaaa 1140
actccatggg aggtttgaac tttggccgat cttactttga tccagcatat tttagattag 1200
ggcaagagat ggtaaggagg tcagctggaa aggtcagttc cacattggca tctgaactcg 1260
gtatcactgc cgaggatgca aggcttgttt cagagattgc aatgcatact actgaggaca 1320
agatcagtag agcggttgga cccagacaag cccaagtatc atttctacac ggtgatcaaa 1380
gtgagaatga gctaccgaga ttggggggca aggaagatag gagggtcaaa cagagtcgag 1440
gagaagccag ggagagctac agagaaaccg ggcccagcag agcaagtgat gcgagagctg 1500
cccatcttcc aaccggcaca cccctagaca ttgacactgc aacggagtcc agccaagatc 1560
cgcaggacag tcgaaggtca gctgacgccc tgcttaggct gcaagccatg gcaggaatct 1620
cggaagaaca aggctcagac acggacaccc ctatagtgta caatgacaga aatcttctag 1680
actaggtgcg agaggccgag ggccagaaca acatccgcct accatccatc attgttataa 1740
aaaacttagg aaccaggtcc acacagccgc cagcccatca accatccact cccacgattg 1800
gagccaatgg cagaagagca ggcacgccat gtcaaaaacg gactggaatg catccgggct 1860
ctcaaggccg agcccatcgg ctcactggcc atcgaggaag ctatggcagc atggtcagaa 1920
atatcagaca acccaggaca ggagcgagcc acctgcaggg aagagaaggc aggcagttcg 1980
ggtctcagca aaccatgcct ctcagcaatt ggatcaactg aaggcggtgc acctcgcatc 2040
cgcggtcagg gacctggaga gagcgatgac gacgctgaaa ctttgggaat ccccccaaga 2100
aatctccagg catcaagcac tgggttacag tgttattacg tttatgatca cagcggtgaa 2160
gcggttaagg gaatccaaga tgctgactct atcatggttc aatcaggcct tgatggtgat 2220
agcaccctct caggaggaga caatgaatct gaaaacagcg atgtggatat tggcgaacct 2280
gataccgagg gatatgctat cactgaccgg ggatctgctc ccatctctat ggggttcagg 2340
gcttctgatg ttgaaactgc agaaggaggg gagatccacg agctcctgag actccaatcc 2400
agaggcaaca actttccgaa gcttgggaaa actctcaatg ttcctccgcc cccggacccc 2460
ggtagggcca gcacttccgg gacacccatt aaaaagggca cagacgcgag attagcctca 2520
tttggaacgg agatcgcgtc tttattgaca ggtggtgcaa cccaatgtgc tcgaaagtca 2580
ccctcggaac catcagggcc aggtgcacct gcggggaatg tccccgagtg tgtgagcaat 2640
gccgcactga tacaggagtg gacacccgaa tctggtacca caatctcccc gagatcccag 2700
aataatgaag aagggggaga ctattatgat gatgagctgt tctctgatgt ccaagatatt 2760
aaaacagcct tggccaaaat acacgaggat aatcagaaga taatctccaa gctagaatca 2820
ctgctgttat tgaagggaga agttgagtca attaagaagc agatcaacag gcaaaatatc 2880
agcatatcca ccctggaagg acacctctca agcatcatga tcgccattcc tggacttggg 2940
aaggatccca acgaccccac tgcagatgtc gaaatcaatc ccgacttgaa acccatcata 3000
ggcagagatt caggccgagc actggccgaa gttctcaaga aacccgttgc cagccgacaa 3060
ctccaaggaa tgacaaatgg acggaccagt tccagaggac agctgctgaa ggaatttcag 3120
ctaaagccga tcgggaaaaa gatgagctca gccgtcgggt ttgttcctga caccggccct 3180
gcatcacgca gtgtaatccg ctccattata aaatccagcc ggctagagga ggatcggaag 3240
cgttacctga tgactctcct tgatgatatc aaaggagcca atgatcttgc caagttccac 3300
cagatgctga tgaagataat aatgaagtag ctacagctca acttacctgc caaccccatg 3360
ccagtcgacc caactagtac aacctaaatc cattataaaa aacttaggag caaagtgatt 3420
gcctcccaag gtccacaatg acagagacct acgacttcga caagtcggca tgggacatca 3480
aagggtcgat cgctccgata caacccacca cctacagtga tggcaggctg gtgccccagg 3540
tcagagtcat agatcctggt ctaggcgaca ggaaggatga atgctttatg tacatgtttc 3600
tgctgggggt tgttgaggac agcgattccc tagggcctcc aatcgggcga gcatttgggt 3660
tcctgccctt aggtgttggc agatccacag caaagcccga aaaactcctc aaagaggcca 3720
ctgagcttga catagttgtt agacgtacag cagggctcaa tgaaaaactg gtgttctaca 3780
acaacacccc actaactctc ctcacacctt ggagaaaggt cctaacaaca gggagtgtct 3840
tcaacgcaaa ccaagtgtgc aatgcggtta atctgatacc gctcgatacc ccgcagaggt 3900
tccgtgttgt ttatatgagc atcacccgtc tttcggataa cgggtattac accgttccta 3960
gaagaatgct ggaattcaga tcggtcaatg cagtggcctt caacctgctg gtgaccctta 4020
ggattgacaa ggcgataggc cctgggaaga tcatcgacaa tacagagcaa cttcctgagg 4080
caacatttat ggtccacatc gggaacttca ggagaaagaa gagtgaagtc tactctgccg 4140
attattgcaa aatgaaaatc gaaaagatgg gcctggtttt tgcacttggt gggatagggg 4200
gcaccagtct tcacattaga agcacaggca aaatgagcaa gactctccat gcacaactcg 4260
ggttcaagaa gaccttatgt tacccgctga tggatatcaa tgaagacctt aatcgattac 4320
tctggaggag cagatgcaag atagtaagaa tccaggcagt tttgcagcca tcagttcctc 4380
aagaattccg catttacgac gacgtgatca taaatgatga ccaaggacta ttcaaagttc 4440
tgtagaccgt agtgcccagc aatgcccgaa aacgaccccc ctcacaatga cagccagaag 4500
gcccggacaa aaaagccccc tccgaaagac tccacggacc aagcgagagg ccagccagca 4560
gccgacggca agcgcgaaca ccaggcggcc ccagcacaga acagccctga cacaaggcca 4620
ccaccagcca ccccaatctg catcctcctc gtgggacccc cgaggaccaa cccccaaggc 4680
tgcccccgat ccaaaccacc aaccgcatcc ccaccacccc cgggaaagaa acccccagca 4740
attggaaggc ccctccccct cttcctcaac acaagaactc cacaaccgaa ccgcacaagc 4800
gaccgaggtg acccaaccgc aggcatccga ctccctagac agatcctctc tccccggcaa 4860
actaaacaaa acttagggcc aaggaacata cacacccaac agaacccaga ccccggccca 4920
cggcgccgcg cccccaaccc ccgacaacca gagggagccc ccaaccaatc ccgccggctc 4980
ccccggtgcc cacaggcagg gacaccaacc cccgaacaga cccagcaccc aaccatcgac 5040
aatccaagac gggggggccc ccccaaaaaa aggcccccag gggccgacag ccagcaccgc 5100
gaggaagccc acccacccca cacacgacca cggcaaccaa accagaaccc agaccaccct 5160
gggccaccag ctcccagact cggccatcac cccgcagaaa ggaaaggcca caacccgcgc 5220
accccagccc cgatccggcg gggagccacc caacccgaac cagcacccaa gagcgatccc 5280
cgaaggaccc ccgaaccgca aaggacatca gtatcccaca gcctctccaa gtcccccggt 5340
ctcctcctct tctcgaaggg accaaaagat caatccacca cacccgacga cactcaactc 5400
cccaccccta aaggagacac cgggaatccc agaatcaaga ctcatccaat gtccatcatg 5460
ggtctcaagg tgaacgtctc tgccatattc atggcagtac tgttaactct ccaaacaccc 5520
accggtcaaa tccattgggg caatctctct aagatagggg tggtaggaat aggaagtgca 5580
agctacaaag ttatgactcg ttccagccat caatcattag tcataaaatt aatgcccaat 5640
ataactctcc tcaataactg cacgagggta gagattgcag aatacaggag actactgaga 5700
acagttttgg aaccaattag agatgcactt aatgcaatga cccagaatat aagaccggtt 5760
cagagtgtag cttcaagtag gagacacaag agatttgcgg gagtagtcct ggcaggtgcg 5820
gccctaggcg ttgccacagc tgctcagata acagccggca ttgcacttca ccagtccatg 5880
ctgaactctc aagccatcga caatctgaga gcgagcctgg aaactactaa tcaggcaatt 5940
gagacaatca gacaagcagg gcaggagatg atattggctg ttcagggtgt ccaagactac 6000
atcaataatg agctgatacc gtctatgaac caactatctt gtgatttaat cggccagaag 6060
ctcgggctca aattgctcag atactataca gaaatcctgt cattatttgg ccccagttta 6120
cgggacccca tatctgcgga gatatctatc caggctttga gctatgcgct tggaggagac 6180
atcaataagg tgttagaaaa gctcggatac agtggaggtg atttactggg catcttagag 6240
agcggaggaa taaaggcccg gataactcac gtcgacacag agtcctactt cattgtcctc 6300
agtatagcct atccgacgct gtccgagatt aagggggtga ttgtccaccg gctagagggg 6360
gtctcgtaca acataggctc tcaagagtgg tataccactg tgcccaagta tgttgcaacc 6420
caagggtacc ttatctcgaa ttttgatgag tcatcgtgta ctttcatgcc agaggggact 6480
gtgtgcagcc aaaatgcctt gtacccgatg agtcctctgc tccaagaatg cctccggggg 6540
tacaccaagt cctgtgctcg tacactcgta tccgggtctt ttgggaaccg gttcatttta 6600
tcacaaggga acctaatagc caattgtgca tcaatccttt gcaagtgtta cacaacagga 6660
acgatcatta atcaagaccc tgacaagatc ctaacataca ttgctgccga tcactgcccg 6720
gtagtcgagg tgaacggcgt gaccatccaa gtcgggagca ggaggtatcc agacgctgtg 6780
tacttgcaca gaattgacct cggtcctccc atatcattgg agaggttgga cgtagggaca 6840
aatctgggga atgcaattgc taagttggag gatgccaagg aattgttgga gtcatcggac 6900
cagatattga ggagtatgaa aggtttatcg agcactagca tagtctacat cctgattgca 6960
gtgtgtcttg gagggttgat agggatcccc gctttaatat gttgctgcag ggggcgttgt 7020
aacaaaaagg gagaacaagt tggtatgtca agaccaggcc taaagcctga tcttacggga 7080
acatcaaaat cctatgtaag gtcgctctga tcctctacaa ctcttgaaac acaaatgtcc 7140
cacaagtctc ctcttcgtca tcaagcaacc accgcaccca gcatcaagcc cacctgaaat 7200
tatctccggc ttccctctgg ccgaacaata tcggtagtta atcaaaactt agggtgcaag 7260
atcatccaca atgtcaccac aacgagaccg gataaatgcc ttctacaaag ataaccccca 7320
tcccaaggga agtaggatag tcattaacag agaacatctt atgattgata gaccttatgt 7380
tttgctggct gttctgtttg tcatgtttct gagcttgatc gggttgctag ccattgcagg 7440
cattagactt catcgggcag ccatctacac cgcagagatc cataaaagcc tcagcaccaa 7500
tctagatgta actaactcaa tcgagcatca ggtcaaggac gtgctgacac cactcttcaa 7560
aatcatcggt gatgaagtgg gcctgaggac acctcagaga ttcactgacc tagtgaaatt 7620
aatctctgac aagattaaat tccttaatcc ggatagggag tacgacttca gagatctcac 7680
ttggtgtatc aacccgccag agagaatcaa attggattat gatcaatact gtgcagatgt 7740
ggctgctgaa gagctcatga atgcattggt gaactcaact ctactggaga ccagaacaac 7800
caatcagttc ctagctgtct caaagggaaa ctgctcaggg cccactacaa tcagaggtca 7860
attctcaaac atgtcgctgt ccctgttaga cttgtattta ggtcgaggtt acaatgtgtc 7920
atctatagtc actatgacat cccagggaat gtatggggga acttacctag tggaaaagcc 7980
taatctgagc agcaaaaggt cagagttgtc acaactgagc atgtaccgag tgtttgaagt 8040
aggtgttatc agaaatccgg gtttgggggc tccggtgttc catatgacaa actatcttga 8100
gcaaccagtc agtaatgatc tcagcaactg tatggtggct ttgggggagc tcaaactcgc 8160
agccctttgt cacggggaag attctatcac aattccctat cagggatcag ggaaaggtgt 8220
cagcttccag ctcgtcaagc taggtgtctg gaaatcccca accgacatgc aatcctgggt 8280
ccccttatca acggatgatc cagtgataga caggctttac ctctcatctc acagaggtgt 8340
tatcgctgac aatcaagcaa aatgggctgt cccgacaaca cgaacagatg acaagttgcg 8400
aatggagaca tgcttccaac aggcgtgtaa gggtaaaatc caagcactct gcgagaatcc 8460
cgagtgggca ccattgaagg ataacaggat tccttcatac ggggtcttgt ctgttgatct 8520
gagtctgaca gttgagctta aaatcaaaat tgcttcggga ttcgggccat tgatcacaca 8580
cggttcaggg atggacctat acaaatccaa ccacaacaat gtgtattggc tgactatccc 8640
gccaatgaag aacctagcct taggtgtaat caacacattg gagtggatac cgagattcaa 8700
ggttagtccc tacctcttca ctgtcccaat taaggaagca ggcgaagact gccatgcccc 8760
aacataccta cctgcggagg tggatggtga tgtcaaactc agttccaatc tggtgattct 8820
acctggtcaa gatctccaat atgttttggc aacctacgat acttccaggg ttgaacatgc 8880
tgtggtttat tacgtttaca gcccaagccg ctcattttct tacttttatc cttttaggtt 8940
gcctataaag ggggtcccca tcgaattaca agtggaatgc ttcacatggg accaaaaact 9000
ctggtgccgt cacttctgtg tgcttgcgga ctcagaatct ggtggacata tcactcactc 9060
tgggatggtg ggcatgggag tcagctgcac agtcacccgg gaagatggaa ccaatcgcag 9120
atagggctgc tagtgaacca atcacatgat gtcacccaga catcaggcat acccactagt 9180
gtgaaataga catcagaatt aagaaaaacg tagggtccaa gtggttcccc gttatggact 9240
cgctatctgt caaccagatc ttataccctg aagttcacct agatagcccg atagttacca 9300
ataagatagt agccatcctg gagtatgctc gagtccctca cgcttacagc ctggaggacc 9360
ctacactgtg tcagaacatc aagcaccgcc taaaaaacgg attttccaac caaatgatta 9420
taaacaatgt ggaagttggg aatgtcatca agtccaagct taggagttat ccggcccact 9480
ctcatattcc atatccaaat tgtaatcagg atttatttaa catagaagac aaagagtcaa 9540
cgaggaagat ccgtgaactc ctcaaaaagg ggaattcgct gtactccaaa gtcagtgata 9600
aggttttcca atgcttaagg gacactaact cacggcttgg cctaggctcc gaattgaggg 9660
aggacatcaa ggagaaagtt attaacttgg gagtttacat gcacagctcc cagtggtttg 9720
agccctttct gttttggttt acagtcaaga ctgagatgag gtcagtgatt aaatcacaaa 9780
cccatacttg ccataggagg agacacacac ctgtattctt cactggtagt tcagttgagt 9840
tgctaatctc tcgtgacctt gttgctataa tcagtaaaga gtctcaacat gtatattacc 9900
tgacatttga actggttttg atgtattgtg atgtcataga ggggaggtta atgacagaga 9960
ccgctatgac tattgatgct aggtatacag agcttctagg aagagtcaga tacatgtgga 10020
aactgataga tggtttcttc cctgcactcg ggaatccaac ttatcaaatt gtagccatgc 10080
tggagcctct ttcacttgct tacctgcagc tgagggatat aacagtagaa ctcagaggtg 10140
ctttccttaa ccactgcttt actgaaatac atgatgttct tgaccaaaac gggttttctg 10200
atgaaggtac ttatcatgag ttaactgaag ctctagatta cattttcata actgatgaca 10260
tacatctgac aggggagatt ttctcatttt tcagaagttt cggccacccc agacttgaag 10320
cagtaacggc tgctgaaaat gttaggaaat acatgaatca gcctaaagtc attgtgtatg 10380
agactctgat gaaaggtcat gccatatttt gtggaatcat aatcaacggc tatcgtgaca 10440
ggcacggagg cagttggcca ccgctgaccc tccccctgca tgctgcagac acaatccgga 10500
atgctcaagc ttcaggtgaa gggttaacac atgagcagtg cgttgataac tggaaatctt 10560
ttgctggagt gaaatttggc tgctttatgc ctcttagcct ggatagtgat ctgacaatgt 10620
acctaaagga caaggcactt gctgctctcc aaagggaatg ggattcagtt tacccgaaag 10680
agttcctgcg ttacgaccct cccaagggaa ccgggtcacg gaggcttgta gatgttttcc 10740
ttaatgattc gagctttgac ccatatgatg tgataatgta tgttgtaagt ggagcttacc 10800
tccatgaccc tgagttcaac ctgtcttaca gcctgaaaga aaaggagatc aaggaaacag 10860
gtagactttt tgctaaaatg acttacaaaa tgagggcatg ccaagtgatt gctgaaaatc 10920
taatctcaaa cgggattggc aaatatttta aggacaatgg gatggccaag gatgagcacg 10980
atttgactaa ggcactccac actctagctg tctcaggagt ccccaaagat ctcaaagaaa 11040
gtcacagggg ggggccagtc ttaaaaacct actcccgaag cccagtccac acaagtacca 11100
ggaacgtgag agcagcaaaa gggtttatag ggttccctca agtaattcgg caggaccaag 11160
acactgatca tccggagaat atggaagctt acgagacagt cagtgcattt atcacgactg 11220
atctcaagaa gtactgcctt aattggagat atgagaccat cagcttgttt gcacagaggc 11280
taaatgagat ttacggattg ccctcatttt tccagtggct gcataagagg cttgagacct 11340
ctgtcctgta tgtaagtgac cctcattgcc cccccgacct tgacgcccat atcccgttat 11400
ataaagtccc caatgatcaa atcttcatta agtaccctat gggaggtata gaagggtatt 11460
gtcagaagct gtggaccatc agcaccattc cctatctata cctggctgct tatgagagcg 11520
gagtaaggat tgcttcgtta gtgcaagggg acaatcagac catagccgta acaaaaaggg 11580
tacccagcac atggccctac aaccttaaga aacgggaagc tgctagagta actagagatt 11640
actttgtaat tcttaggcaa aggctacatg atattggcca tcacctcaag gcaaatgaga 11700
caattgtttc atcacatttt tttgtctatt caaaaggaat atattatgat gggctacttg 11760
tgtcccaatc actcaagagc atcgcaagat gtgtattctg gtcagagact atagttgatg 11820
aaacaagggc agcatgcagt aatattgcta caacaatggc taaaagcatc gagagaggtt 11880
atgaccgtta ccttgcatat tccctgaacg tcctaaaagt gatacagcaa attctgatct 11940
ctcttggctt cacaatcaat tcaaccatga cccgggatgt agtcataccc ctcctcacaa 12000
acaacgacct cttaataagg atggcactgt tgcccgctcc tattgggggg atgaattatc 12060
tgaatatgag caggctgttt gtcagaaaca tcggtgatcc agtaacatca tcaattgctg 12120
atctcaagag aatgattctc gcctcactaa tgcctgaaga gaccctccat caagtaatga 12180
cacaacaacc gggggactct tcattcctag actgggctag cgacccttac tcagcaaatc 12240
ttgtatgtgt ccagagcatc actagactcc tcaagaacat aactgcaagg tttgtcctga 12300
tccatagtcc aaacccaatg ttaaaaggat tattccatga tgacagtaaa gaagaggacg 12360
agggactggc ggcattcctc atggacaggc atattatagt acctagggca gctcatgaaa 12420
tcctggatca tagtgtcaca ggggcaagag agtctattgc aggcatgctg gataccacaa 12480
aaggcttgat tcgagccagc atgaggaagg gggggttaac ctctcgagtg ataaccagat 12540
tgtccaatta tgactatgaa caattcagag cagggatggt gctattgaca ggaagaaaga 12600
gaaatgtcct cattgacaaa gagtcatgtt cagtgcagct ggcgagagct ctaagaagcc 12660
atatgtgggc gaggctagct cgaggacggc ctatttacgg ccttgaggtc cctgatgtac 12720
tagaatctat gcgaggccac cttattcggc gtcatgagac atgtgtcatc tgcgagtgtg 12780
gatcagtcaa ctacggatgg ttttttgtcc cctcgggttg ccaactggat gatattgaca 12840
aggaaacatc atccttgaga gtcccatata ttggttctac cactgatgag agaacagaca 12900
tgaagcttgc cttcgtaaga gccccaagtc gatccttgcg atctgctgtt agaatagcaa 12960
cagtgtactc atgggcttac ggtgatgatg atagctcttg gaacgaagcc tggttgttgg 13020
ctaggcaaag ggccaatgtg agcctggagg agctaagggt gatcactccc atctcaactt 13080
cgactaattt agcgcatagg ttgagggatc gtagcactca agtgaaatac tcaggtacat 13140
cccttgtccg agtggcgagg tataccacaa tctccaacga caatctctca tttgtcatat 13200
cagataagaa ggttgatact aactttatat accaacaagg aatgcttcta gggttgggtg 13260
ttttagaaac attgtttcga ctcgagaaag ataccggatc atctaacacg gtattacatc 13320
ttcacgtcga aacagattgt tgcgtgatcc cgatgataga tcatcccagg atacccagct 13380
cccgcaagct agagctgagg gcagagctat gtaccaaccc attgatatat gataatgcac 13440
ctttaattga cagagatgca acaaggctat acacccagag ccataggagg caccttgtgg 13500
aatttgttac atggtccaca ccccaactat atcacatttt agctaagtcc acagcactat 13560
ctatgattga cctggtaaca aaatttgaga aggaccatat gaatgaaatt tcagctctca 13620
taggggatga cgatatcaat agtttcataa ctgagtttct gctcatagag ccaagattat 13680
tcactatcta cttgggccag tgtgcggcca tcaattgggc atttgatgta cattatcata 13740
gaccatcagg gaaatatcag atgggtgagc tgttgtcatc gttcctttct agaatgagca 13800
aaggagtgtt taaggtgctt gtcaatgctc taagccaccc aaagatctac aagaaattct 13860
ggcattgtgg tattatagag cctatccatg gtccttcact tgatgctcaa aacttgcaca 13920
caactgtgtg caacatggtt tacacatgct atatgaccta cctcgacctg ttgttgaatg 13980
aagagttaga agagttcaca tttctcttgt gtgaaagcga cgaggatgta gtaccggaca 14040
gattcgacaa catccaggca aaacacttat gtgttctggc agatttgtac tgtcaaccag 14100
ggacctgccc accaattcga ggtctaagac cggtagagaa atgtgcagtt ctaaccgacc 14160
atatcaaggc agaggctatg ttatctccag caggatcttc gtggaacata aatccaatta 14220
ttgtagacca ttactcatgc tctctgactt atctccggcg aggatcgatc aaacagataa 14280
gattgagagt tgatccagga ttcattttcg acgccctcgc tgaggtaaat gtcagtcagc 14340
caaagatcgg cagcaacaac atctcaaata tgagcatcaa ggctttcaga cccccacacg 14400
atgatgttgc aaaattgctc aaagatatca acacaagcaa gcacaatctt cccatttcag 14460
ggggcaatct cgccaattat gaaatccatg ctttccgcag aatcgggttg aactcatctg 14520
cttgctacaa agctgttgag atatcaacat taattaggag atgccttgag ccaggggagg 14580
acggcttgtt cttgggtgag ggatcgggtt ctatgttgat cacttataaa gagatactta 14640
aactaaacaa gtgcttctat aatagtgggg tttccgccaa ttctagatct ggtcaaaggg 14700
aattagcacc ctatccctcc gaagttggcc ttgtcgaaca cagaatggga gtaggtaata 14760
ttgtcaaagt gctctttaac gggaggcccg aagtcacgtg ggtaggcagt gtagattgct 14820
tcaatttcat agttagtaat atccctacct ctagtgtggg gtttatccat tcagatatag 14880
agaccttgcc tgacaaagat actatagaga agctagagga attggcagcc atcttatcga 14940
tggctctgct cctgggcaaa ataggatcaa tactggtgat taagcttatg cctttcagcg 15000
gggattttgt tcagggattt ataagttatg tagggtctca ttatagagaa gtgaaccttg 15060
tataccctag atacagcaac ttcatctcta ctgaatctta tttggttatg acagatctca 15120
aggctaaccg gctaatgaat cctgaaaaga ttaagcagca gataattgaa tcatctgtga 15180
ggacttcacc tggacttata ggtcacatcc tatccattaa gcaactaagc tgcatacaag 15240
caattgtggg agacgcagtt agtagaggtg atatcaatcc tactctgaaa aaacttacac 15300
ctatagagca ggtgctgatc aattgcgggt tggcaattaa cggacctaag ctgtgcaaag 15360
aattgatcca ccatgatgtt gcctcagggc aagatggatt gcttaattct atactcatcc 15420
tctacaggga gttggcaaga ttcaaagaca accaaagaag tcaacaaggg atgttccacg 15480
cttaccccgt attggtaagt agcaggcaac gagaacttat atctaggatc acccgcaaat 15540
tctgggggca cattcttctt tactccggga acaaaaagtt gataaataag tttatccaga 15600
atctcaagtc cggctatctg atactagact tacaccagaa tatcttcgtt aagaatctat 15660
ccaagtcaga gaaacagatt attatgacgg ggggtttgaa acgtgagtgg gtttttaagg 15720
taacagtcaa ggagaccaaa gaatggtata agttagtcgg atacagtgcc ctgattaagg 15780
actaattggt tgaactccgg aaccctaatc ctgccctagg tggttaggca ttatttgcaa 15840
tatattaaag aaaactttga aaatacgaag tttctattcc cagctttgtc tggt 15894
<210> 5
<211> 15894
<212> DNA
<213> Measles virus (Measles virus)
<400> 5
accaaacaaa gttgggtaag gatagttcaa tcaatgatca tcttctagtg cacttaggat 60
tcaagatcct attatcaggg acaagagcag gattagggat atccgagatg gccacacttt 120
taaggagctt agcattgttc aaaagaaaca aggacaaacc acccattaca tcaggatccg 180
gtggagccat cagaggaatc aaacacatta ttatagtacc aatccctgga gattcctcaa 240
ttaccactcg atccagactt ctggaccggt tggtgaggtt aattggaaac ccggatgtga 300
gcgggcccaa actaacaggg gcactaatag gtatattatc cttatttgtg gagtctccag 360
gtcaattgat tcagaggatc accgatgacc ctgacgttag cataaggctg ttagaggttg 420
tccagagtga ccagtcacaa tctggcctta ccttcgcatc aagaggtacc aacatggagg 480
atgaggcgga ccaatacttt tcacatgatg atccaattag tagtgatcaa tccaggttcg 540
gatggttcgg gaacaaggaa atctcagata ttgaagtgca agaccctgag ggattcaaca 600
tgattctggg taccatccta gcccaaattt gggtcttgct cgcaaaggcg gttacggccc 660
cagacacggc agctgattcg gagctaagaa ggtggataaa gtacacccaa caaagaaggg 720
tagttggtga atttagattg gagagaaaat ggttggatgt ggtgaggaac aggattgccg 780
aggacctctc cttacgccga ttcatggtcg ctctaatcct ggatatcaag agaacacccg 840
gaaacaaacc caggattgct gaaatgatat gtgacattga tacatatatc gtagaggcag 900
gattagccag ttttatcctg actattaagt ttgggataga aactatgtat cctgctcttg 960
gactgcatga atttgctggt gagttatcca cacttgagtc cttgatgaac ctttaccagc 1020
aaatggggga aactgcaccc tacatggtaa tcctggagaa ctcaattcag aacaagttca 1080
gtgcaggatc ataccctctg ctctggagct atgccatggg agtaggagtg gaacttgaaa 1140
actccatggg aggtttgaac tttggccgat cttactttga tccagcatat tttagattag 1200
ggcaagagat ggtaaggagg tcagctggaa aggtcagttc cacattggca tctgaactcg 1260
gtatcactgc cgaggatgca aggcttgttt cagagattgc aatgcatact actgaggaca 1320
agatcagtag agcggttgga cccagacaag cccaagtatc atttctacac ggtgatcaaa 1380
gtgagaatga gctaccgaga ttggggggca aggaagatag gagggtcaaa cagagtcgag 1440
gagaagccag ggagagctac agagaaaccg ggcccagcag agcaagtgat gcgagagctg 1500
cccatcttcc aaccggcaca cccctagaca ttgacactgc aacggagtcc agccaagatc 1560
cgcaggacag tcgaaggtca gctgacgccc tgcttaggct gcaagccatg gcaggaatct 1620
cggaagaaca aggctcagac acggacaccc ctatagtgta caatgacaga aatcttctag 1680
actaggtgcg agaggccgag ggccagaaca acatccgcct accatccatc attgttataa 1740
aaaacttagg aaccaggtcc acacagccgc cagcccatca accatccact cccacgattg 1800
gagccaatgg cagaagagca ggcacgccat gtcaaaaacg gactggaatg catccgggct 1860
ctcaaggccg agcccatcgg ctcactggcc atcgaggaag ctatggcagc atggtcagaa 1920
atatcagaca acccaggaca ggagcgagcc acctgcaggg aagagaaggc aggcagttcg 1980
ggtctcagca aaccatgcct ctcagcaatt ggatcaactg aaggcggtgc acctcgcatc 2040
cgcggtcagg gacctggaga gagcgatgac gacgctgaaa ctttgggaat ccccccaaga 2100
aatctccagg catcaagcac tgggttacag tgttattacg tttatgatca cagcggtgaa 2160
gcggttaagg gaatccaaga tgctgactct atcatggttc aatcaggcct tgatggtgat 2220
agcaccctct caggaggaga caatgaatct gaaaacagcg atgtggatat tggcgaacct 2280
gataccgagg gatatgctat cactgaccgg ggatctgctc ccatctctat ggggttcagg 2340
gcttctgatg ttgaaactgc agaaggaggg gagatccacg agctcctgag actccaatcc 2400
agaggcaaca actttccgaa gcttgggaaa actctcaatg ttcctccgcc cccggacccc 2460
ggtagggcca gcacttccgg gacacccatt aaaaagggca cagacgcgag attagcctca 2520
tttggaacgg agatcgcgtc tttattgaca ggtggtgcaa cccaatgtgc tcgaaagtca 2580
ccctcggaac catcagggcc aggtgcacct gcggggaatg tccccgagtg tgtgagcaat 2640
gccgcactga tacaggagtg gacacccgaa tctggtacca caatctcccc gagatcccag 2700
aataatgaag aagggggaga ctattatgat gatgagctgt tctctgatgt ccaagatatt 2760
aaaacagcct tggccaaaat acacgaggat aatcagaaga taatctccaa gctagaatca 2820
ctgctgttat tgaagggaga agttgagtca attaagaagc agatcaacag gcaaaatatc 2880
agcatatcca ccctggaagg acacctctca agcatcatga tcgccattcc tggacttggg 2940
aaggatccca acgaccccac tgcagatgtc gaaatcaatc ccgacttgaa acccatcata 3000
ggcagagatt caggccgagc actggccgaa gttctcaaga aacccgttgc cagccgacaa 3060
ctccaaggaa tgacaaatgg acggaccagt tccagaggac agctgctgaa ggaatttcag 3120
ctaaagccga tcgggaaaaa gatgagctca gccgtcgggt ttgttcctga caccggccct 3180
gcatcacgca gtgtaatccg ctccattata aaatccagcc ggctagagga ggatcggaag 3240
cgttacctga tgactctcct tgatgatatc aaaggagcca atgatcttgc caagttccac 3300
cagatgctga tgaagataat aatgaagtag ctacagctca acttacctgc caaccccatg 3360
ccagtcgacc caactagtac aacctaaatc cattataaaa aacttaggag caaagtgatt 3420
gcctcccaag gtccacaatg acagagacct acgacttcga caagtcggca tgggacatca 3480
aagggtcgat cgctccgata caacccacca cctacagtga tggcaggctg gtgccccagg 3540
tcagagtcat agatcctggt ctaggcgaca ggaaggatga atgctttatg tacatgtttc 3600
tgctgggggt tgttgaggac agcgattccc tagggcctcc aatcgggcga gcatttgggt 3660
tcctgccctt aggtgttggc agatccacag caaagcccga aaaactcctc aaagaggcca 3720
ctgagcttga catagttgtt agacgtacag cagggctcaa tgaaaaactg gtgttctaca 3780
acaacacccc actaactctc ctcacacctt ggagaaaggt cctaacaaca gggagtgtct 3840
tcaacgcaaa ccaagtgtgc aatgcggtta atctgatacc gctcgatacc ccgcagaggt 3900
tccgtgttgt ttatatgagc atcacccgtc tttcggataa cgggtattac accgttccta 3960
gaagaatgct ggaattcaga tcggtcaatg cagtggcctt caacctgctg gtgaccctta 4020
ggattgacaa ggcgataggc cctgggaaga tcatcgacaa tacagagcaa cttcctgagg 4080
caacatttat ggtccacatc gggaacttca ggagaaagaa gagtgaagtc tactctgccg 4140
attattgcaa aatgaaaatc gaaaagatgg gcctggtttt tgcacttggt gggatagggg 4200
gcaccagtct tcacattaga agcacaggca aaatgagcaa gactctccat gcacaactcg 4260
ggttcaagaa gaccttatgt tacccgctga tggatatcaa tgaagacctt aatcgattac 4320
tctggaggag cagatgcaag atagtaagaa tccaggcagt tttgcagcca tcagttcctc 4380
aagaattccg catttacgac gacgtgatca taaatgatga ccaaggacta ttcaaagttc 4440
tgtagaccgt agtgcccagc aatgcccgaa aacgaccccc ctcacaatga cagccagaag 4500
gcccggacaa aaaagccccc tccgaaagac tccacggacc aagcgagagg ccagccagca 4560
gccgacggca agcgcgaaca ccaggcggcc ccagcacaga acagccctga cacaaggcca 4620
ccaccagcca ccccaatctg catcctcctc gtgggacccc cgaggaccaa cccccaaggc 4680
tgcccccgat ccaaaccacc aaccgcatcc ccaccacccc cgggaaagaa acccccagca 4740
attggaaggc ccctccccct cttcctcaac acaagaactc cacaaccgaa ccgcacaagc 4800
gaccgaggtg acccaaccgc aggcatccga ctccctagac agatcctctc tccccggcaa 4860
actaaacaaa acttagggcc aaggaacata cacacccaac agaacccaga ccccggccca 4920
cggcgccgcg cccccaaccc ccgacaacca gagggagccc ccaaccaatc ccgccggctc 4980
ccccggtgcc cacaggcagg gacaccaacc cccgaacaga cccagcaccc aaccatcgac 5040
aatccaagac gggggggccc ccccaaaaaa aggcccccag gggccgacag ccagcaccgc 5100
gaggaagccc acccacccca cacacgacca cggcaaccaa accagaaccc agaccaccct 5160
gggccaccag ctcccagact cggccatcac cccgcagaaa ggaaaggcca caacccgcgc 5220
accccagccc cgatccggcg gggagccacc caacccgaac cagcacccaa gagcgatccc 5280
cgaaggaccc ccgaaccgca aaggacatca gtatcccaca gcctctccaa gtcccccggt 5340
ctcctcctct tctcgaaggg accaaaagat caatccacca cacccgacga cactcaactc 5400
cccaccccta aaggagacac cgggaatccc agaatcaaga ctcatccaat gtccatcatg 5460
ggtctcaagg tgaacgtctc tgccatattc atggcagtac tgttaactct ccaaacaccc 5520
accggtcaaa tccattgggg caatctctct aagatagggg tggtaggaat aggaagtgca 5580
agctacaaag ttatgactcg ttccagccat caatcattag tcataaaatt aatgcccaat 5640
ataactctcc tcaataactg cacgagggta gagattgcag aatacaggag actactgaga 5700
acagttttgg aaccaattag agatgcactt aatgcaatga cccagaatat aagaccggtt 5760
cagagtgtag cttcaagtag gagacacaag agatttgcgg gagtagtcct ggcaggtgcg 5820
gccctaggcg ttgccacagc tgctcagata acagccggca ttgcacttca ccagtccatg 5880
ctgaactctc aagccatcga caatctgaga gcgagcctgg aaactactaa tcaggcaatt 5940
gagacaatca gacaagcagg gcaggagatg atattggctg ttcagggtgt ccaagactac 6000
atcaataatg agctgatacc gtctatgaac caactatctt gtgatttaat cggccagaag 6060
ctcgggctca aattgctcag atactataca gaaatcctgt cattatttgg ccccagttta 6120
cgggacccca tatctgcgga gatatctatc caggctttga gctatgcgct tggaggagac 6180
atcaataagg tgttagaaaa gctcggatac agtggaggtg atttactggg catcttagag 6240
agcggaggaa taaaggcccg gataactcac gtcgacacag agtcctactt cattgtcctc 6300
agtatagcct atccgacgct gtccgagatt aagggggtga ttgtccaccg gctagagggg 6360
gtctcgtaca acataggctc tcaagagtgg tataccactg tgcccaagta tgttgcaacc 6420
caagggtacc ttatctcgaa ttttgatgag tcatcgtgta ctttcatgcc agaggggact 6480
gtgtgcagcc aaaatgcctt gtacccgatg agtcctctgc tccaagaatg cctccggggg 6540
tacaccaagt cctgtgctcg tacactcgta tccgggtctt ttgggaaccg gttcatttta 6600
tcacaaggga acctaatagc caattgtgca tcaatccttt gcaagtgtta cacaacagga 6660
acgatcatta atcaagaccc tgacaagatc ctaacataca ttgctgccga tcactgcccg 6720
gtagtcgagg tgaacggcgt gaccatccaa gtcgggagca ggaggtatcc agacgctgtg 6780
tacttgcaca gaattgacct cggtcctccc atatcattgg agaggttgga cgtagggaca 6840
aatctgggga atgcaattgc taagttggag gatgccaagg aattgttgga gtcatcggac 6900
cagatattga ggagtatgaa aggtttatcg agcactagca tagtctacat cctgattgca 6960
gtgtgtcttg gagggttgat agggatcccc gctttaatat gttgctgcag ggggcgttgt 7020
aacaaaaagg gagaacaagt tggtatgtca agaccaggcc taaagcctga tcttacggga 7080
acatcaaaat cctatgtaag gtcgctctga tcctctacaa ctcttgaaac acaaatgtcc 7140
cacaagtctc ctcttcgtca tcaagcaacc accgcaccca gcatcaagcc cacctgaaat 7200
tatctccggc ttccctctgg ccgaacaata tcggtagtta atcaaaactt agggtgcaag 7260
atcatccaca atgtcaccac aacgagaccg gataaatgcc ttctacaaag acaaccctca 7320
ttccaaggga agcaggatag tcatcaacag agaacatctc atgattgata gaccctatgt 7380
tttgctggct attctgttcg tcatgtttct gagcttgatc gggttgctgg ccattgcagg 7440
cattaggctt catcgggcag ctatctacac tgcagagatc cataaaagcc tcagcaccaa 7500
tctagatgta actaactcaa tcgagcatca ggtcaaggat gtgcttacac cactcttcaa 7560
aatcatcggt gatgaagtgg gcctgagaac acctcagaga ttcactgacc tagtgaaatt 7620
catctctgac aagatcaaat tccttaatcc ggatagggag tatgacttca gagatctcac 7680
ttggtgtata aatccgccag agagaatcaa attgaattat gatcaatact gtgcagatgt 7740
ggctgctgaa gagctcatga atgcattagt gaactcaact ctactggaga ccagaacaac 7800
caatcagttc ctagctgtct caaagggaaa ctgctcaggg cccactacca tcagaggtca 7860
attctcaaac atgtcgctgt ctctgttaga cttatattta agtcgaggtt acaatgtgtc 7920
atctatagtc actatgacgt cccagggaat gtacggggga acttacctag ttgaaaagcc 7980
caatctgaac agcaaaggat cagaattatc acaactgagc atgtaccgag tgtttgaagt 8040
aggtgttata agaaatccag gcttgggggc tccggtgttc catatgacaa actattttga 8100
acaaccaatc agtaaggatc tcagcaactg catggtagct ttgggggagc tcaaactcgc 8160
agccctttgt cacgggggag attctatcac aattccctat cagggatcag ggaaaggtgt 8220
cagcttccag ctcgtcaagc taggtgtctg gaaatcccca accgacatgc attcctgggt 8280
ccccctatcg acggatgacc cagtgataga caggctctac ctctcatctc acagaggtgt 8340
catcactgac aatcaagcaa attgggctgt tccgacaaca cgaacagatg ataagttgcg 8400
gatggagaca tgcttccagc aggcgtgcaa gggcaaaatc caagcactct gtgaaaatct 8460
cgagtgggca ccgttgaagg acagcaggat tccttcatac ggggtcttgt ctgtcgacct 8520
gagtctggca gctgagccca aaatcaaaat tgcttcggga ttcggtccat tgatcactca 8580
cggttcaggg atggacctat acaaatccaa ccacaacaat gtgtattggc tgactatccc 8640
gccaatgaag aacttagcct taggtgtaat caacacattg gagtggatac cgagactcaa 8700
ggttagtccc aacctcttca ctgtcccaat taaggaagca ggcgaggact gccacgcccc 8760
aacataccta cctgcggagg tggatggtga tgtcaaactc agttccaatc tggtgattct 8820
acctggtcaa gatctccaat atgttttggc aacctacgat acttccagag ttgaacatgc 8880
tgtggtttat tacgtttaca gcccaagccg ctcattctct tacttttatc cctttaggtt 8940
acctataaag gggaccccca tcgaattaca agtggaatgc ttcacatggg cccaaagact 9000
ctggtgccgt cacttctgtg tgcttgctga ctcggaatct ggtagacata tcacccactc 9060
tgggatggtg ggcatggaag tcagctgcac agtcaaccgg gaagacgaag ccaatcgcag 9120
atagggcagc cagtgaacta acaacatgat ttcactcaga catcaagaat acccaccagt 9180
gtgaaataga catcagaatt aagaaaaacg tagggtccaa gtggttcccc gttatggact 9240
cgctatctgt caaccagatc ttataccctg aagttcacct agatagcccg atagttacca 9300
ataagatagt agccatcctg gagtatgctc gagtccctca cgcttacagc ctggaggacc 9360
ctacactgtg tcagaacatc aagcaccgcc taaaaaacgg attttccaac caaatgatta 9420
taaacaatgt ggaagttggg aatgtcatca agtccaagct taggagttat ccggcccact 9480
ctcatattcc atatccaaat tgtaatcagg atttatttaa catagaagac aaagagtcaa 9540
cgaggaagat ccgtgaactc ctcaaaaagg ggaattcgct gtactccaaa gtcagtgata 9600
aggttttcca atgcttaagg gacactaact cacggcttgg cctaggctcc gaattgaggg 9660
aggacatcaa ggagaaagtt attaacttgg gagtttacat gcacagctcc cagtggtttg 9720
agccctttct gttttggttt acagtcaaga ctgagatgag gtcagtgatt aaatcacaaa 9780
cccatacttg ccataggagg agacacacac ctgtattctt cactggtagt tcagttgagt 9840
tgctaatctc tcgtgacctt gttgctataa tcagtaaaga gtctcaacat gtatattacc 9900
tgacatttga actggttttg atgtattgtg atgtcataga ggggaggtta atgacagaga 9960
ccgctatgac tattgatgct aggtatacag agcttctagg aagagtcaga tacatgtgga 10020
aactgataga tggtttcttc cctgcactcg ggaatccaac ttatcaaatt gtagccatgc 10080
tggagcctct ttcacttgct tacctgcagc tgagggatat aacagtagaa ctcagaggtg 10140
ctttccttaa ccactgcttt actgaaatac atgatgttct tgaccaaaac gggttttctg 10200
atgaaggtac ttatcatgag ttaactgaag ctctagatta cattttcata actgatgaca 10260
tacatctgac aggggagatt ttctcatttt tcagaagttt cggccacccc agacttgaag 10320
cagtaacggc tgctgaaaat gttaggaaat acatgaatca gcctaaagtc attgtgtatg 10380
agactctgat gaaaggtcat gccatatttt gtggaatcat aatcaacggc tatcgtgaca 10440
ggcacggagg cagttggcca ccgctgaccc tccccctgca tgctgcagac acaatccgga 10500
atgctcaagc ttcaggtgaa gggttaacac atgagcagtg cgttgataac tggaaatctt 10560
ttgctggagt gaaatttggc tgctttatgc ctcttagcct ggatagtgat ctgacaatgt 10620
acctaaagga caaggcactt gctgctctcc aaagggaatg ggattcagtt tacccgaaag 10680
agttcctgcg ttacgaccct cccaagggaa ccgggtcacg gaggcttgta gatgttttcc 10740
ttaatgattc gagctttgac ccatatgatg tgataatgta tgttgtaagt ggagcttacc 10800
tccatgaccc tgagttcaac ctgtcttaca gcctgaaaga aaaggagatc aaggaaacag 10860
gtagactttt tgctaaaatg acttacaaaa tgagggcatg ccaagtgatt gctgaaaatc 10920
taatctcaaa cgggattggc aaatatttta aggacaatgg gatggccaag gatgagcacg 10980
atttgactaa ggcactccac actctagctg tctcaggagt ccccaaagat ctcaaagaaa 11040
gtcacagggg ggggccagtc ttaaaaacct actcccgaag cccagtccac acaagtacca 11100
ggaacgtgag agcagcaaaa gggtttatag ggttccctca agtaattcgg caggaccaag 11160
acactgatca tccggagaat atggaagctt acgagacagt cagtgcattt atcacgactg 11220
atctcaagaa gtactgcctt aattggagat atgagaccat cagcttgttt gcacagaggc 11280
taaatgagat ttacggattg ccctcatttt tccagtggct gcataagagg cttgagacct 11340
ctgtcctgta tgtaagtgac cctcattgcc cccccgacct tgacgcccat atcccgttat 11400
ataaagtccc caatgatcaa atcttcatta agtaccctat gggaggtata gaagggtatt 11460
gtcagaagct gtggaccatc agcaccattc cctatctata cctggctgct tatgagagcg 11520
gagtaaggat tgcttcgtta gtgcaagggg acaatcagac catagccgta acaaaaaggg 11580
tacccagcac atggccctac aaccttaaga aacgggaagc tgctagagta actagagatt 11640
actttgtaat tcttaggcaa aggctacatg atattggcca tcacctcaag gcaaatgaga 11700
caattgtttc atcacatttt tttgtctatt caaaaggaat atattatgat gggctacttg 11760
tgtcccaatc actcaagagc atcgcaagat gtgtattctg gtcagagact atagttgatg 11820
aaacaagggc agcatgcagt aatattgcta caacaatggc taaaagcatc gagagaggtt 11880
atgaccgtta ccttgcatat tccctgaacg tcctaaaagt gatacagcaa attctgatct 11940
ctcttggctt cacaatcaat tcaaccatga cccgggatgt agtcataccc ctcctcacaa 12000
acaacgacct cttaataagg atggcactgt tgcccgctcc tattgggggg atgaattatc 12060
tgaatatgag caggctgttt gtcagaaaca tcggtgatcc agtaacatca tcaattgctg 12120
atctcaagag aatgattctc gcctcactaa tgcctgaaga gaccctccat caagtaatga 12180
cacaacaacc gggggactct tcattcctag actgggctag cgacccttac tcagcaaatc 12240
ttgtatgtgt ccagagcatc actagactcc tcaagaacat aactgcaagg tttgtcctga 12300
tccatagtcc aaacccaatg ttaaaaggat tattccatga tgacagtaaa gaagaggacg 12360
agggactggc ggcattcctc atggacaggc atattatagt acctagggca gctcatgaaa 12420
tcctggatca tagtgtcaca ggggcaagag agtctattgc aggcatgctg gataccacaa 12480
aaggcttgat tcgagccagc atgaggaagg gggggttaac ctctcgagtg ataaccagat 12540
tgtccaatta tgactatgaa caattcagag cagggatggt gctattgaca ggaagaaaga 12600
gaaatgtcct cattgacaaa gagtcatgtt cagtgcagct ggcgagagct ctaagaagcc 12660
atatgtgggc gaggctagct cgaggacggc ctatttacgg ccttgaggtc cctgatgtac 12720
tagaatctat gcgaggccac cttattcggc gtcatgagac atgtgtcatc tgcgagtgtg 12780
gatcagtcaa ctacggatgg ttttttgtcc cctcgggttg ccaactggat gatattgaca 12840
aggaaacatc atccttgaga gtcccatata ttggttctac cactgatgag agaacagaca 12900
tgaagcttgc cttcgtaaga gccccaagtc gatccttgcg atctgctgtt agaatagcaa 12960
cagtgtactc atgggcttac ggtgatgatg atagctcttg gaacgaagcc tggttgttgg 13020
ctaggcaaag ggccaatgtg agcctggagg agctaagggt gatcactccc atctcaactt 13080
cgactaattt agcgcatagg ttgagggatc gtagcactca agtgaaatac tcaggtacat 13140
cccttgtccg agtggcgagg tataccacaa tctccaacga caatctctca tttgtcatat 13200
cagataagaa ggttgatact aactttatat accaacaagg aatgcttcta gggttgggtg 13260
ttttagaaac attgtttcga ctcgagaaag ataccggatc atctaacacg gtattacatc 13320
ttcacgtcga aacagattgt tgcgtgatcc cgatgataga tcatcccagg atacccagct 13380
cccgcaagct agagctgagg gcagagctat gtaccaaccc attgatatat gataatgcac 13440
ctttaattga cagagatgca acaaggctat acacccagag ccataggagg caccttgtgg 13500
aatttgttac atggtccaca ccccaactat atcacatttt agctaagtcc acagcactat 13560
ctatgattga cctggtaaca aaatttgaga aggaccatat gaatgaaatt tcagctctca 13620
taggggatga cgatatcaat agtttcataa ctgagtttct gctcatagag ccaagattat 13680
tcactatcta cttgggccag tgtgcggcca tcaattgggc atttgatgta cattatcata 13740
gaccatcagg gaaatatcag atgggtgagc tgttgtcatc gttcctttct agaatgagca 13800
aaggagtgtt taaggtgctt gtcaatgctc taagccaccc aaagatctac aagaaattct 13860
ggcattgtgg tattatagag cctatccatg gtccttcact tgatgctcaa aacttgcaca 13920
caactgtgtg caacatggtt tacacatgct atatgaccta cctcgacctg ttgttgaatg 13980
aagagttaga agagttcaca tttctcttgt gtgaaagcga cgaggatgta gtaccggaca 14040
gattcgacaa catccaggca aaacacttat gtgttctggc agatttgtac tgtcaaccag 14100
ggacctgccc accaattcga ggtctaagac cggtagagaa atgtgcagtt ctaaccgacc 14160
atatcaaggc agaggctatg ttatctccag caggatcttc gtggaacata aatccaatta 14220
ttgtagacca ttactcatgc tctctgactt atctccggcg aggatcgatc aaacagataa 14280
gattgagagt tgatccagga ttcattttcg acgccctcgc tgaggtaaat gtcagtcagc 14340
caaagatcgg cagcaacaac atctcaaata tgagcatcaa ggctttcaga cccccacacg 14400
atgatgttgc aaaattgctc aaagatatca acacaagcaa gcacaatctt cccatttcag 14460
ggggcaatct cgccaattat gaaatccatg ctttccgcag aatcgggttg aactcatctg 14520
cttgctacaa agctgttgag atatcaacat taattaggag atgccttgag ccaggggagg 14580
acggcttgtt cttgggtgag ggatcgggtt ctatgttgat cacttataaa gagatactta 14640
aactaaacaa gtgcttctat aatagtgggg tttccgccaa ttctagatct ggtcaaaggg 14700
aattagcacc ctatccctcc gaagttggcc ttgtcgaaca cagaatggga gtaggtaata 14760
ttgtcaaagt gctctttaac gggaggcccg aagtcacgtg ggtaggcagt gtagattgct 14820
tcaatttcat agttagtaat atccctacct ctagtgtggg gtttatccat tcagatatag 14880
agaccttgcc tgacaaagat actatagaga agctagagga attggcagcc atcttatcga 14940
tggctctgct cctgggcaaa ataggatcaa tactggtgat taagcttatg cctttcagcg 15000
gggattttgt tcagggattt ataagttatg tagggtctca ttatagagaa gtgaaccttg 15060
tataccctag atacagcaac ttcatctcta ctgaatctta tttggttatg acagatctca 15120
aggctaaccg gctaatgaat cctgaaaaga ttaagcagca gataattgaa tcatctgtga 15180
ggacttcacc tggacttata ggtcacatcc tatccattaa gcaactaagc tgcatacaag 15240
caattgtggg agacgcagtt agtagaggtg atatcaatcc tactctgaaa aaacttacac 15300
ctatagagca ggtgctgatc aattgcgggt tggcaattaa cggacctaag ctgtgcaaag 15360
aattgatcca ccatgatgtt gcctcagggc aagatggatt gcttaattct atactcatcc 15420
tctacaggga gttggcaaga ttcaaagaca accaaagaag tcaacaaggg atgttccacg 15480
cttaccccgt attggtaagt agcaggcaac gagaacttat atctaggatc acccgcaaat 15540
tctgggggca cattcttctt tactccggga acaaaaagtt gataaataag tttatccaga 15600
atctcaagtc cggctatctg atactagact tacaccagaa tatcttcgtt aagaatctat 15660
ccaagtcaga gaaacagatt attatgacgg ggggtttgaa acgtgagtgg gtttttaagg 15720
taacagtcaa ggagaccaaa gaatggtata agttagtcgg atacagtgcc ctgattaagg 15780
actaattggt tgaactccgg aaccctaatc ctgccctagg tggttaggca ttatttgcaa 15840
tatattaaag aaaactttga aaatacgaag tttctattcc cagctttgtc tggt 15894
<210> 6
<211> 1958
<212> DNA
<213> Measles virus (Measles virus)
<400> 6
agggtgcaag atcatccaca atgtcaccac aacgagaccg gataaatgcc ttctacaaag 60
ataaccccca tcccaaggga agtaggatag tcattaacag agaacatctt atgattgata 120
gaccttatgt tttgctggct gttctgtttg tcatgtttct gagcttgatc gggttgctag 180
ccattgcagg cattagactt catcgggcag ccatctacac cgcagagatc cataaaagcc 240
tcagcaccaa tctagatgta actaactcaa tcgagcatca ggtcaaggac gtgctgacac 300
cactcttcaa aatcatcggt gatgaagtgg gcctgaggac acctcagaga ttcactgacc 360
tagtgaaatt aatctctgac aagattaaat tccttaatcc ggatagggag tacgacttca 420
gagatctcac ttggtgtatc aacccgccag agagaatcaa attggattat gatcaatact 480
gtgcagatgt ggctgctgaa gagctcatga atgcattggt gaactcaact ctactggaga 540
ccagaacaac caatcagttc ctagctgtct caaagggaaa ctgctcaggg cccactacaa 600
tcagaggtca attctcaaac atgtcgctgt ccctgttaga cttgtattta ggtcgaggtt 660
acaatgtgtc atctatagtc actatgacat cccagggaat gtatggggga acttacctag 720
tggaaaagcc taatctgagc agcaaaaggt cagagttgtc acaactgagc atgtaccgag 780
tgtttgaagt aggtgttatc agaaatccgg gtttgggggc tccggtgttc catatgacaa 840
actatcttga gcaaccagtc agtaatgatc tcagcaactg tatggtggct ttgggggagc 900
tcaaactcgc agccctttgt cacggggaag attctatcac aattccctat cagggatcag 960
ggaaaggtgt cagcttccag ctcgtcaagc taggtgtctg gaaatcccca accgacatgc 1020
aatcctgggt ccccttatca acggatgatc cagtgataga caggctttac ctctcatctc 1080
acagaggtgt tatcgctgac aatcaagcaa aatgggctgt cccgacaaca cgaacagatg 1140
acaagttgcg aatggagaca tgcttccaac aggcgtgtaa gggtaaaatc caagcactct 1200
gcgagaatcc cgagtgggca ccattgaagg ataacaggat tccttcatac ggggtcttgt 1260
ctgttgatct gagtctgaca gttgagctta aaatcaaaat tgcttcggga ttcgggccat 1320
tgatcacaca cggttcaggg atggacctat acaaatccaa ccacaacaat gtgtattggc 1380
tgactatccc gccaatgaag aacctagcct taggtgtaat caacacattg gagtggatac 1440
cgagattcaa ggttagtccc tacctcttca ctgtcccaat taaggaagca ggcgaagact 1500
gccatgcccc aacataccta cctgcggagg tggatggtga tgtcaaactc agttccaatc 1560
tggtgattct acctggtcaa gatctccaat atgttttggc aacctacgat acttccaggg 1620
ttgaacatgc tgtggtttat tacgtttaca gcccaagccg ctcattttct tacttttatc 1680
cttttaggtt gcctataaag ggggtcccca tcgaattaca agtggaatgc ttcacatggg 1740
accaaaaact ctggtgccgt cacttctgtg tgcttgcgga ctcagaatct ggtggacata 1800
tcactcactc tgggatggtg ggcatgggag tcagctgcac agtcacccgg gaagatggaa 1860
ccaatcgcag atagggctgc tagtgaacca atcacatgat gtcacccaga catcaggcat 1920
acccactagt gtgaaataga catcagaatt aagaaaaa 1958
<210> 7
<211> 44
<212> DNA
<213> Artificial sequence (artificial sequence)
<220>

Claims (5)

1. An attenuated strain of chimeric measles virus, which has a preservation number of CCTCC NO: measles virus rMV/H (H1 a) V202074.
2. A vaccine composition, comprising:
(i) The attenuated chimeric measles virus strain of claim 1; and
(ii) A vaccine acceptable carrier.
3. A method for preparing an attenuated strain of chimeric measles virus according to claim 1, comprising the steps of:
(i) Constructing a chimeric measles virus recombinant plasmid comprising a nucleotide sequence selected from the group consisting of: the H gene corresponding to the nucleotide sequence shown as SEQ ID NO 6 of the genome of the wild type A genotype measles virus is replaced by the nucleotide sequence shown as SEQ ID NO 3;
(ii) Obtaining three helper plasmids respectively containing the N gene, the P gene and the L gene in the measles virus; and
(iii) (ii) co-transfecting host cells with the recombinant plasmid obtained in (i) and the three helper plasmids respectively, culturing for 2-4 days, then, cracking the cells, inoculating the cells to new cells for culturing, and obtaining the attenuated strain of the chimeric measles virus when cytopathic effect can be observed.
4. Use of an attenuated strain of chimeric measles virus according to claim 1 for the preparation of a vaccine composition for the prevention of measles.
5. A method of preparing a vaccine composition comprising the steps of:
(i) The preservation number is CCTCC NO: v202074 measles virus rMV/H (H1 a) is passaged or cultured to produce an attenuated vaccine strain;
(ii) (ii) mixing said attenuated vaccine strain prepared in step (i) with an immunologically acceptable carrier to thereby produce a vaccine composition.
CN202110262340.1A 2021-03-10 2021-03-10 Construction of H gene replaced chimeric measles attenuated strain Active CN113293148B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202110262340.1A CN113293148B (en) 2021-03-10 2021-03-10 Construction of H gene replaced chimeric measles attenuated strain
PCT/CN2022/079777 WO2022188784A1 (en) 2021-03-10 2022-03-08 Construction of h-gene-replaced chimeric measles attenuated strain

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110262340.1A CN113293148B (en) 2021-03-10 2021-03-10 Construction of H gene replaced chimeric measles attenuated strain

Publications (2)

Publication Number Publication Date
CN113293148A CN113293148A (en) 2021-08-24
CN113293148B true CN113293148B (en) 2022-10-25

Family

ID=77319129

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110262340.1A Active CN113293148B (en) 2021-03-10 2021-03-10 Construction of H gene replaced chimeric measles attenuated strain

Country Status (2)

Country Link
CN (1) CN113293148B (en)
WO (1) WO2022188784A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113293148B (en) * 2021-03-10 2022-10-25 上海青赛生物科技有限公司 Construction of H gene replaced chimeric measles attenuated strain
CN113999823B (en) * 2021-12-30 2022-04-26 北京赛尔富森生物科技有限公司 D8 gene type chimeric measles virus attenuated strain and its preparation method and use
CN113999824B (en) * 2021-12-30 2022-11-11 北京赛尔富森生物科技有限公司 H1a gene type chimeric measles virus attenuated strain, preparation method and application

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2110382A1 (en) * 2002-06-20 2009-10-21 Institut Pasteur Infectious cDNA of an improved vaccine strain of measles virus, use for immunogenic compositions
US20110052627A1 (en) * 2008-06-20 2011-03-03 Paul Chaplin Recombinant modified vaccinia virus measles vaccine
CN101323857A (en) * 2008-08-01 2008-12-17 中国疾病预防控制中心病毒病预防控制所 Modified measles virus whole gene cDNA clone and infectious virus preparation
EP2420242A1 (en) * 2010-08-20 2012-02-22 Lauer, Ulrich M. Oncolytic measles virus
JP5917626B2 (en) * 2014-07-28 2016-05-18 トレムアールエックス， インコーポレイテッド Vaccination with poxvirus vectors via mechanical epidermal destruction
CN111100845B (en) * 2018-10-25 2023-04-11 浙江大学 Recombinant measles virus and preparation method and application thereof
CN111019910B (en) * 2019-11-04 2022-03-15 上海青赛生物科技有限公司 F genotype mumps virus attenuated strain, construction method and application thereof
CN113293148B (en) * 2021-03-10 2022-10-25 上海青赛生物科技有限公司 Construction of H gene replaced chimeric measles attenuated strain
CN113999824B (en) * 2021-12-30 2022-11-11 北京赛尔富森生物科技有限公司 H1a gene type chimeric measles virus attenuated strain, preparation method and application

Also Published As

Publication number Publication date
WO2022188784A1 (en) 2022-09-15
CN113293148A (en) 2021-08-24

Similar Documents

Publication Publication Date Title
CN113293148B (en) Construction of H gene replaced chimeric measles attenuated strain
CN113293149B (en) Construction of F gene replaced chimeric measles attenuated strain
CN111019910B (en) F genotype mumps virus attenuated strain, construction method and application thereof
CN113293145B (en) New measles virus live vector corona vaccine
CN110256539B (en) Novel genetic engineering subunit vaccine of O-type foot-and-mouth disease virus
CN1989240A (en) Vaccine comprising an attenuated pestivirus
JP2013099357A (en) Attenuated pestiviruses
EP2391713A1 (en) Immunogenic compositions, vaccines and diagnostics based on canine distemper viruses circulating in north american dogs
CN115998856A (en) Novel influenza virus immunogenic composition and preparation method and application thereof
CN108728490A (en) A kind of carp herpesviral II types DNA vaccination and its construction method and application based on baculovirus vector
CN109321535A (en) A kind of heat-staple newcastle disease virus attenuated vaccine Candidate Strain
CN111647087B (en) Chimeric virus-like particle vaccine and preparation method and application thereof
CN109321534A (en) A kind of recombination VIII type newcastle disease virus low virulent strain
CN113293144B (en) Recombinant F genotype mumps virus live vector measles vaccine
JP6280635B2 (en) Stabilized FMDV capsid
US10894081B2 (en) Recombinant bivalent inactivated vaccine against foot-and-mouth disease virus, preparation method and use thereof
CN116376850A (en) B3 genotype chimeric measles virus attenuated strain and preparation method and application thereof
CN112111467B (en) Gene VII-type newcastle disease marker vaccine strain and preparation method and application thereof
CN111533811B (en) Novel genetically engineered vaccine of avian encephalomyelitis virus
CN111349621A (en) Recombinant baculovirus and application thereof in preparation of newcastle disease virus-like particles
CN116102660B (en) Porcine parvovirus gene engineering epitope vaccine and preparation method thereof
KR102542601B1 (en) Novel porcine epidemic diarrhea virus isolate and use thereof
CN111729078B (en) Chicken infectious anemia virus gene engineering vaccine
KR102365039B1 (en) Suspension Cell Culture Adapted Vaccine Strain Derived from Foot-and-mouth disease virus of A/ASIA/Sea-97 Lineage and Method of Preparing the Same
CN116785422A (en) Measles attenuated vaccine containing novel coronavirus combined antigen and rescue method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP01 Change in the name or title of a patent holder
CP01 Change in the name or title of a patent holder

Address after: 201507 No. 1136, langong Road, Jinshan Industrial Zone, Jinshan District, Shanghai

Patentee after: Shanghai Qingsai Biotechnology Co.,Ltd.

Patentee after: Beijing saierfusen Biotechnology Co.,Ltd.

Address before: 201507 No. 1136, langong Road, Jinshan Industrial Zone, Jinshan District, Shanghai

Patentee before: Shanghai Qingsai Biotechnology Co.,Ltd.

Patentee before: Beijing saierfusen Biotechnology Co.,Ltd.

PE01 Entry into force of the registration of the contract for pledge of patent right
PE01 Entry into force of the registration of the contract for pledge of patent right

Denomination of invention: Construction of a chimeric measles attenuated strain with H gene replacement

Effective date of registration: 20230718

Granted publication date: 20221025

Pledgee: China Minsheng Banking Corp Shanghai branch

Pledgor: Shanghai Qingsai Biotechnology Co.,Ltd.|Beijing saierfusen Biotechnology Co.,Ltd.

Registration number: Y2023310000382