CN111676244B

CN111676244B - Measles and rubella combined vaccine using measles virus as carrier

Info

Publication number: CN111676244B
Application number: CN202010509735.2A
Authority: CN
Inventors: 刘兰军; 张勇侠; 罗心梅; 高雅丽
Original assignee: CHENGDU INSTITUTE OF BIOLOGICAL PRODUCTS CO LTD
Current assignee: CHENGDU INSTITUTE OF BIOLOGICAL PRODUCTS CO LTD
Priority date: 2020-06-05
Filing date: 2020-06-05
Publication date: 2024-02-23
Anticipated expiration: 2040-06-05
Also published as: CN111676244A

Abstract

The invention aims to provide a measles and rubella combined vaccine taking measles virus as a vector, and belongs to the field of recombinant vector vaccines. The invention firstly discloses an infectious clone, which is a recombinant plasmid obtained by constructing ORF2 (comprising C gene, E2 gene and E1 gene) fragments of rubella virus into a plasmid vector; the recombinant plasmid comprises measles virus antigenome sequences. The invention also discloses a recombinant virus which is obtained by rescuing transfected cells from the infectious clone. The combined vaccine is prepared by taking the recombinant virus as an immunogen, can induce organisms to generate specific antibodies for resisting rubella and measles, and has a remarkable effect.

Description

Measles and rubella combined vaccine using measles virus as carrier

Technical Field

The invention belongs to the field of recombinant vector vaccines.

Background

Measles virus (measles virus) is the causative agent of measles, belonging to the genus measles virus of the family paramyxoviridae. Measles is a common acute infectious disease in children and is characterized by skin papules, fever and respiratory symptoms. If there is no complication, it is good after healing. Since the early 60 s of China applied attenuated live vaccines, the incidence rate of children is remarkably reduced. But remains a major cause of childhood death in developing countries.

The live attenuated measles vaccine "Hu-191" (MV-S191) is one of the production strains of measles vaccine in China, and has been a history of about 55 years so far. Studies have shown that: the children' S antibody positive rate is high, the positive rate is 80.6% after 3-10 years after the measles is vaccinated, the average value of the antibody level is 108.42IU/L, the long-term high protective antibody level after the measles is vaccinated is suggested, and the MV-S191 measles vaccine has good immunogenicity.

Rubella virus is a single-stranded positive strand RNA virus belonging to the genus measles virus of the family togaviridae. The rubella virus genome contains about 9800 amino acids, is infectious, has irregular spherical shape under a virus particle electron microscope, has polymorphism, has the diameter of 50-85 nanometers, and is coated with a film. In addition to the structurally complex lipid envelope from the host cell, rubella virus contains 3 proteins, E1 and E2 intercalate on the envelope to form spikes, and protein C forms the capsid. E1 is a glycoprotein, has neutralizing epitopes and hemagglutination epitopes, contains important T cells, B cells and antibody neutralizing epitopes on the molecule, and can induce humoral immunity and cellular immunity in animals. The function of glycoprotein E2 is currently unknown. These three proteins, which have molecular weights of 60kD (E1), 42-47 kD (E2) and 30kD (C), respectively, are 110kD polypeptides derived from mRNA translation of 245 kD. The antigenic structure of rubella virus is quite stable, with only one serotype.

The rubella virus is easy to generate vertical infection, and after the rubella virus is infected for the first time in the early gestation period of the pregnant woman, the virus can enter the fetus through the placenta barrier, so that abortion or stillbirth can be caused, congenital rubella syndrome can be caused in the fetus, and fetal malformation is caused.

Rubella vaccine is a vaccine for preventing and controlling rubella diseases. The U.S. and the united kingdom began to popularize rubella vaccines at the end of 60 s and the beginning of 70 s in the 20 th century, and then began to use them sequentially in all countries of the world. Commercial rubella vaccine strains include HPV77-DE5 strain, condehilly strain, RA27/3 strain, T0336 strain and BRD-II strain. Among them, the RA27/3 vaccine has been used widely together with measles, mumps, varicella to form measles rubella combined vaccine (MR), measles rubella mumps combined vaccine (MMR) or leprosy mumps-varicella combined vaccine (MMRV).

The recombinant vector vaccine is a novel vaccine integrating a plurality of viral genes. The principle is as follows: the neutralizing epitope gene fragment of virus A is inserted into the genome of virus B to obtain a recombinant virus, and the recombinant virus can express the neutralizing antigen of virus A (or further form virus-like particles of virus A), can induce the organism to produce corresponding antibodies, and can produce memory B cells and T cells aiming at viruses A and B. The recombinant virus is used as immunogen to prepare vaccine, i.e. recombinant vector vaccine. The recombinant vector vaccine only needs to culture one strain, prepares a high-titer virus, and selects a freeze-drying stabilizer and a freeze-drying process of the virus.

At present, measles rubella attenuated live vaccine of 8 months of immunization is prepared by inoculating chicken embryo cells and human diploid cells respectively with measles virus attenuated strain (measles vaccine Hu 191 strain) and rubella virus attenuated strain (BRD-II strain or RA27/3 strain), culturing, harvesting virus solution, mixing proportionally, adding proper stabilizer and freeze-drying. Recombinant measles vector vaccines have not been developed in which the structural protein (forming virus-like particles) genes of the rubella virus are constructed into the measles virus antigenome.

Disclosure of Invention

The invention aims to solve the problems that: provides a measles-rubella bivalent vaccine virus seed and related recombinant vector vaccine.

The technical scheme of the invention is as follows:

the invention firstly provides an infectious clone, wherein the infectious clone is a recombinant plasmid obtained by constructing ORF2 fragment of rubella virus into a plasmid vector;

the recombinant plasmid comprises measles virus antigenome sequences.

The term "antigenome sequence" refers to: the reverse complement of the viral genome is typically DNA. Since measles virus is an RNA virus, the construction of a plasmid using genomic RNA directly is difficult, and therefore the antigenomic sequence (DNA form) of measles virus is used.

Further, the ORF2 fragment of the rubella virus is located between the P and M genes of the measles virus antigenome.

Further, the measles virus is Hu 191 strain of measles virus.

Further, the 5 'and 3' ends of the ORF2 fragment are respectively connected with an X sequence and a Y sequence;

the X sequence is shown as SEQ ID NO.3, and the Y sequence is shown as SEQ ID NO. 4.

Further, the sequence of the ORF2 fragment is a DNA fragment shown as SEQ ID NO. 1.

The invention also provides a recombinant virus which is a measles virus carrying an ORF2 fragment expressing rubella virus.

The recombinant virus, which is obtained by packaging the above infectious clone together with 4 helper plasmids for electrotransfection of host cells and proliferation and release in the cells;

the helper plasmids are plasmids carrying genes expressing T7RNA polymerase, measles N protein, P protein and L protein, respectively.

Further, the co-electrotransfection is: the mixture of the infectious clone and 4 helper plasmids was transferred to a BioRad electric cup with a diameter of 2mm and shocked 1 time with exponential waves, 140V, 950. Mu.F.

The invention also provides application of the infectious clone or recombinant virus in preparing measles and rubella combined vaccine.

The invention also provides a measles and rubella combined vaccine which is prepared by taking the recombinant virus as an immunogen and adding pharmaceutically acceptable auxiliary materials.

The invention has the beneficial effects that:

the recombinant virus of the invention has high titer after being cultured by Vero cells, and the antibody aiming at rubella virus E2 protein can be detected by serum generated by immunized mice at WB level. The antibody titer of the serum against rubella virus is equivalent to the titer of R27/3 vaccine strain and reaches 1:32000, which shows that the rubella virus special protein structure expression gene capable of stimulating the organism to generate immune response is inserted into the measles virus genome, and the obtained recombinant virus can stably express rubella foreign protein in the replication process to generate immune response against the rubella virus.

The measles and rubella combined vaccine is a recombinant vector vaccine prepared by the recombinant virus, and can induce organisms to generate enough specific antibodies against rubella and measles. In the combined vaccine, the complicated vaccine preparation process of the traditional measles-rubella bigeminal vaccine is not needed, and the quality control of the vaccine is more facilitated. In terms of industrialization, the combined vaccine only needs one measles vaccine production line, and the traditional measles-rubella combined vaccine needs an expensive production line based on diploid cell culture rubella virus besides the measles vaccine production line. Therefore, the measles and rubella combined vaccine has lower cost production, faster production period and more stable and controllable quality. Is more suitable for large-area popularization and use in crowds. In addition, if the epidemic strain of the rubella virus is mutated, the original rubella vaccine strain cannot generate a better immune protection effect, and according to the solution provided by the invention, the structural protein of the clinical isolate of the rubella virus can be replaced, so that a new generation of measles and rubella combined vaccine can be rapidly developed, and an effective preventive measure is provided for rubella epidemic situation in time. Therefore, the measles and rubella combined vaccine is expected to replace the conventional measles and rubella combined vaccine, and has good application prospect.

It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.

Drawings

Fig. 1: recombinant measles virus vector pT7MV _S191 -RVS cleavage identification; 1:SpeI 2:EcoRI 3:NcoI 4:NdeI

Fig. 2: MV (motion vector) _S191 -RVS recombinant virus RT-PCR identification; 1: PCR products of RV structural genes; 2: measles virus P gene PCR product.

Fig. 3: MV (motion vector) _S191 -RVS recombinant virus rubella C protein detection; MV 1 _S191 Viral cell lysate; 2:MV _S191 Virus culture supernatant; 3: a Marker;4:MV _S191 -RVS recombinant viral cell lysate; 5:MV _S191 RVS recombinant virus culture supernatant.

Fig. 4: MV (motion vector) _S191 RVS recombinant virus by agarose 4FF gel filtration chromatography.

Fig. 5: the external water elution peak sample is subjected to WB analysis after 12% SDS-PAGE electrophoresis, and the primary antibody is an anti-rubella C protein antibody. Well 1 is agarose 4FF gel purification elution peak 1#,2 is agarose 4FF gel purification elution peak 2#, and well 3 is MV _S191 -VZVgE recombinant virus culture supernatant, well 4 MV _S191 RVS recombinant virus culture supernatant.

Fig. 6: primary antibody is MV _S191 -RVS virus immune serum 1:500 dilution; electrophoresis loading sequence: electrophoresis well 1 was 3. Mu.g, electrophoresis well 2 was 2. Mu.g, electrophoresis well 3 was 1. Mu.g, and electrophoresis well 4 was 3. Mu.g of PV-DEN2NS1 non-related protein (control protein).

Fig. 7: the primary antibody is diluted 1:500 for the virus immune serum of the R27/3 vaccine strain; electrophoresis loading sequence: 1 μg in well 1, 2 μg in well 2, 3 μg in well 3, and 3 μg in well 4 of PV-DEN2NS1 non-related protein (control protein).

Fig. 8: immunized mice were assayed for rubella antibody titer.

Detailed Description

The reagents and equipment used in the embodiments of the invention are all known products and are obtained by purchasing commercially available products.

EXAMPLE 1 construction of recombinant viruses

1 infectious clone of recombinant virus pT7MV _S191 Construction of RVS

1.1 obtaining exogenous genes

Human codon optimized coding rubella vaccine strain RA27/3 structural protein

(GenBank protein_id= "AAB81188.1", including protein C, protein E2 and protein E1) ORF2 fragment, bsiWI cleavage site and ATG start codon are introduced at the 5 'end of the gene, bssHII cleavage site and TAA stop codon are introduced at the 3' end, the number of bases from BsiWI cleavage site to BssHII cleavage site is ensured to be a multiple of 6, and the nucleotide sequence is synthesized by Jinwei company.

1.2 construction of measles Virus vector

The measles Hu191 strain virus antigenome was constructed on pT7-MCS vector and modified as follows: the 5 'end of the antigenome is inserted into a T7 promoter and hammerhead nuclease sequence (HamRz), the 3' end of the antigenome is inserted into a T7 terminator and hepatitis delta virus ribozyme sequence (HdvRz), and an artificially synthesized Additional Transcription Unit (ATU) is introduced between the P gene and the M gene.

1.3 insertion of exogenous Gene

BsiWI and BssHII restriction enzyme sites are respectively added at two ends of a gene for encoding structural proteins of rubella viruses, ORF2 is inserted into the ATU through the BsiWI and BssHII restriction enzyme sites, and the infectious clone pT7MV of the recombinant measles virus for expressing rubella virus-like particles is constructed by respectively connecting an X sequence (a sequence on the 5 'side of the ATU after being digested by BsiWI) and a Y sequence (a sequence on the 3' side of the ATU after being digested by BssHII) to the upstream and downstream of the ORF2 _S191 RVS. DNAman software vs pT7MV _S191 The RVS sequence was subjected to a single cleavage analysis, speI can cleave the plasmid into 2 fragments, ncoI can cleave the plasmid into 6 fragments, ecoRI can cleave the plasmid into 3 fragments and NdeI can cleave the plasmid into 4 fragments. The cleavage band is consistent with the cleavage result of the theoretical sequence. The results are shown in FIG. 1.

2 virus rescue

Will be 5X 10 ⁵ The Vero cells were well mixed with electrotransport buffer and suspended. 12 μg pT7MV _S191 RVS and 8. Mu.g of pT7-IRES-MVN plasmid (obtained by inserting the measles N protein (MVN) gene in the form of the Takara pT7-IRES His-C DNA as vector), 4. Mu.g of pT7-IRES-MVP (obtained by inserting the Takara pT7-IRES His-C DNA as vector and the measles P protein (MVP) gene in the form of the multiple cloning site), 1. Mu.g of pT7-IRES-MVL (obtained by inserting the Takara pT7-IRES His-C DNA as vector)Cloning site insertion measles L protein (MVL) gene), 4. Mu.g pCAGGS-T7RNAP (pCAGGS as vector, multiple cloning site insertion T7RNA polymerase gene) helper plasmid mix, rescue virus as follows:

1) The mixture was transferred to a BioRad electric cup with a diameter of 2mm and shocked 1 time with exponential waves, 140V, 950. Mu.F.

2) After electrotransfection, cells were transferred into T25 flasks and 5ml10% NBS/MEM,5% CO were added ₂ Culturing at 37 ℃ for 24 hours.

3) After 5ml of 10% NBS/MEM was changed and the culture was continued for 4 days, lesions were observed. Culturing until cytopathy changes by about 80-90%.

4) The transfected cells and supernatant mixture were repeatedly frozen and thawed 3 times to harvest the recombinant virus.

3 detection of recombinant measles virus

3.1RT-PCR identification of exogenous genes

Taking virus culture solution, and centrifuging at 4 ℃ for 2min at 1500 g. The supernatant was taken, genomic RNA of the recombinant virus was extracted according to the instructions of Roche high purity viral RNA extraction kit, and the genomic RNA was reverse transcribed into cDNA using random primers. The cDNA is used as a template, a Phusion high-fidelity DNA polymerase and a primer seq-F2ATU-FOR, a seq-F2ATU-REV are used FOR amplifying exogenous gene fragments, and a PCR product is sent to gold intellectual sequencing. The cDNA is used as template, and the P gene primer amplifies measles virus P gene. As can be seen from FIG. 2, the gene fragments (3189 bp) expressing the structural proteins of rubella virus C, E and E1 and measles virus P gene can be amplified from the rescue virus RNA, and the fragment sizes are consistent with the theoretical values.

3.2Western Blot detection of expression of C protein in rubella virus VLPs

Vero cells were inoculated into T25 cell flasks, 10% NBS/MEM medium, 37℃and 5% CO ₂ Culturing until the cell confluency is 80-90%, and inoculating recombinant virus and MV respectively according to MOI=0.03 _S191

P4(Vero)，37℃，5％CO ₂ After 30min of adsorption, 2% NBS/MEM was added to 5ml at 37℃with 5% CO ₂ Culturing for 3d. MV (motion vector) _S191 Vero cells served as control. Washing cells 3 times with 5ml PBS (phosphate buffered saline) in 1T 25 cell bottle, adding 1ml RAPI lysate to completely lyse cells and viruses, and collecting lysate. Centrifuging at 10000r/min for 10min, and collecting supernatant. Western Blot detects recombinant virus.

Detection of recombinant virus MV Using anti-rubella C protein antibodies _S191 RVS cell lysate and expression of rubella VLPs from cell culture supernatants. Vaccine strain MV _S191 Is used as a control. The results show that: recombinant virus MV _S191 RVS can detect the expression of rubella C protein in both cell lysate and cell culture supernatant, against virus MV _S191 The cells did not see hybridization signal (FIG. 3). The results show that: rescue of the obtained recombinant virus MV _S191 RVS can detect the expression of rubella VLPs in Western Blot experiments.

3.3 recombinant Virus MV _S191 RVS virus particle molecular sieve purification and detection

Vero cells were inoculated into T255 cell flasks, 10% NBS/MEM medium, 37℃and 5% CO ₂ Culturing until the cell confluency is 80-90%, and inoculating recombinant virus and MV respectively according to MOI=0.03 _S191 P4(Vero)，37℃，5％CO ₂ After 30min of adsorption, 2% NBS/MEM was added to 5ml at 37℃with 5% CO ₂ Culturing for 3d. 5T 255 virus culture solutions were thawed repeatedly at-80℃for 3 times, the thawed virus culture solutions were centrifuged at 4000rpm, and the supernatant was collected and concentrated in a 3000MCD ultrafiltration tube.

If recombinant measles virus MV _S191 The rubella virus VLPs are formed in RVS and are collected in the outer water elution peak after purification by agarose 4FF gel filtration chromatography due to their large particles. 10ml of concentrated virus solution is purified by agarose 4FF gel filtration chromatography, an external water elution peak is collected, WB analysis is carried out after 12% SDS-PAGE electrophoresis, and the primary antibody is an anti-rubella C protein antibody. The purification chromatography is shown in figure 5. Recombinant measles virus MV was self-preserved in laboratory _S191 -VZVgE as negative control, unpurified recombinant measles virus MV _S191 RVS as positive control. As can be seen from FIG. 6, the expression of rubella C protein was seen in the elution peak, indicating that the recombinant measles virus MV _S191 Rubella virus VLPs are formed in RVS.

4 recombinant Virus titre detection

Detecting infectious titer of recombinant virus by end point dilution method, calculating cell half-number feeling by Reed-Muench methodDye quantity (CCID) ₅₀ ). Subculturing the recombinant virus on Vero cells, taking the virus cultured by the generation P1-P4, and collecting the virus liquid once by freezing and thawing at the temperature of minus 20 ℃. Recombinant virus was inoculated into 96-well plate-cultured Vero cells at a dilution ratio of 100. Mu.l/well per dilution of virus solution with 10-fold serial dilutions of MEM containing 2% NBS, 8 wells were inoculated per dilution, and the mixture was placed at 37℃with 5% CO ₂ Culturing under the condition for 7 days to judge the result. MV (motion vector) _S191 Subculturing RVS recombinant virus on Vero cells for 5 generations, and determining the titer of each generation of virus, wherein the titers of the P1-P5 generation of virus are all 5.8lgCCID ⁵⁰ About/ml.

5 recombinant virus MV _S191 RVS immunized mouse experiment

25 female Kunming mice, 15-20g, were assessed for immune response. At the same time, vaccine strain MV is set _S191 Is a control group. Titer of 10 ⁶ CCID ₅₀ Recombinant virus MV/ml _S191 RVS and rubella virus R27/3 strains are respectively immunized on animals, the animals are boosted for 21d after the initial immunization, blood is collected through cardiac puncture after the last immunization for 14d, serum is separated, and the animals are inactivated for 30min at 56 ℃.

5.1 R27/3 vaccine strain and MV _S191 Serum rubella antibody WB detection of RVS virus immunized mice

The recombinant protein PV-RVE2 (molecular weight about 85 KD) for expressing rubella virus E2 protein is obtained by prokaryotic expression and purification in the laboratory, and the protein is loaded in a gradient mode. WB detects whether antibodies to rubella virus E2 protein are produced in immune serum. The primary antibodies are R27/3 vaccine strains and MV respectively _S191 RVS virus immunized mouse serum, the secondary antibody is anti-mouse IgG monoclonal antibody, TMB color development.

From fig. 6, fig. 7, it can be seen that: there is a hybridization signal for the PV-RVE2 recombinant protein at about 85KD of the target protein PV-RVE2 electrophoresis band position, and no hybridization signal at the control protein. Description: r27/3 vaccine strain and MV _S191 RVS virus immunization of mouse serum all produced antibodies against rubella virus E2 protein. FIG. 6 primary antibody is MV _S191 RVS virus immune serum 1:500 dilution, electrophoresis loading sequence: electrophoresis well 1 was 3. Mu.g, electrophoresis well 2 was 2. Mu.g, electrophoresis well 3 was 1. Mu.g, and electrophoresis well 4 was 3. Mu.g of PV-DEN2NS1 non-related protein (control protein). FIG. 7 primary antibody was diluted 1:500 in the immune serum of the R27/3 vaccine strain virus, and was electricSwimming and loading sequence: 1 μg in well 1, 2 μg in well 2, 3 μg in well 3, and 3 μg in well 4 of PV-DEN2NS1 non-related protein (control protein).

5.2 R27/3 vaccine strain and MV _S191 ELISA detection of RVS recombinant virus immunized mouse serum rubella antibody

The ELISA plate is coated with the virus R27/3 vaccine strain by taking the R27/3 freeze-dried vaccine as a control, and the serum of immunized mice is diluted from 1:500, and the serial dilution of the serum is twice diluted to 1:32000, and the total dilution is 7. The primary antibodies are R27/3 vaccine strains and MV respectively _S191 RVS virus immunized mouse serum, the secondary antibody is anti-mouse IgG monoclonal antibody, and the antibody titer of the rash in the immunized serum is detected. Absorbance OD on the abscissa of serum dilution of immunized mice ₄₅₀ Antibody titers were calculated as plotted on the ordinate.

Fig. 8 results: r27/3 vaccine strain and MV _S191 RVS recombinant virus immunization of mice all produced better immune response, and recombinant virus MV _S191 RVS is equivalent to the rubella antibody titer of the R27/3 vaccine strain, the titer reaches 1:32000, and OD is used ₄₅₀ Dilutions with values twice higher than negative data were judged as positive data.

5.3R27/3 vaccine strain and MV _S191 Serum measles antibody titer detection of RVS recombinant virus immunized mice

Neutralizing antibody titers were determined using a micro Cytopathic (CPE) inhibition method. MV whose virus titer is known _S191 RVS recombinant virus and vaccine strain MV _S191 Diluted to 2X 10 ³ CCID ₅₀ Per mL, serum to be tested is serially diluted according to 1:10, 1:20, 1:40, 1:80, 1:160 and 1:320, and 8 compound wells are arranged in 50 μl/Kong Jiazhi 96 well plates at each dilution; serum to be tested is respectively equal in volume to vaccine strain MV _S191 Virus mixing, 37 ℃,5% CO ₂ The incubator was neutralized for 1h. 100. Mu.L of cells were added per well at a concentration of 10 ⁵ Vero cells at 37℃and 5% CO per mL ₂ After 7d of incubation, CPE was observed. The highest dilution capable of inhibiting 50% CPE was determined as the neutralization titer of the antibody, and the neutralization antibody titer of the serum to be tested was calculated as the reciprocal of the dilution.

The results show that: MV (motion vector) _S191 RVS recombinant virus and epidemic diseaseSeedling MV _S191 Measles neutralizing antibody titers of immune serum were all greater than 1:320. And MV when immune serum dilution is 1:160 and 1:320 _S191 After virus neutralization by RVS recombinant virus immune serum, CPE ratio is lower than MV _S191 Vaccine strain immune serum, indicating MV _S191 RVS recombinant virus vs MV _S191 The vaccine strain can induce the organism to produce anti-measles virus antibodies with equivalent titer (table 1).

Table 1 measles neutralizing antibody titres

To sum up, MV _S191 RVS recombinant virus assembled to form rubella VLPs, and MV _S191 RVS bivalent vaccine induces simultaneously in mice the immune response of the organism to measles and rubella, hopefully replacing the conventional measles-rubella bivalent vaccine.

The invention relates to a partial sequence as follows:

human codon optimization encoding rubella vaccine strain RA27/3 structural protein gene ORF2 fragment (SEQ ID NO. 1):

ATU(SEQ ID NO.2):

GTCGACCCAACTAGCCTACCCTCCATCATTGTTATAAAAAACTTAGGAACCAGGTCCACACAGCCGCCAGCCCATCAACGCGTACGATGGTGAGCAAGGGCGAGGAGCTGTTCACCACTCTCGGCATGGACGAGCTGTACAAGTAGGCGCGCAGCGCTTAGACGTCTCGCGACTAGT

note that: the first part of the scribing is a BsiWI enzyme cutting site, and the enzyme cutting position is behind the first C base of the scribing; the second scribe is the BssHII cleavage site, which follows the first G base of the scribe.

Sequence located on the 5' side after cleavage by BsiWI (X sequence, SEQ ID No. 3):

GTCGACCCAACTAGCCTACCCTCCATCATTGTTATAAAAAACTTAGGAACCAGGTCCACACAGCCGCCAGCCCATCAACGC

the 3' -terminal-linked ATU partial sequence of ORF2 (Y sequence, SEQ ID NO. 4):

CGCGCAGCGCTTAGACGTCTCGCGACTAGT

primer SEQ-F2ATU-FOR (SEQ ID NO. 5):

CGACCCAACTAGCCTACCC

primer SEQ-F2ATU-REV (SEQ ID NO. 6):

AACTTGGGAGGCAATCACTT

SEQUENCE LISTING

<110> all of the Limited for research of Chengdu Biometrics

<120> measles and rubella combined vaccine using measles virus as vector

<130> GY014-2020P019734CC

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 3172

<212> DNA

<213> Artificial sequence (artificial)

<400> 1

atggcctcta ccacacccat cacaatggag gatctgcaga aggccctgga gacccagagc 60

cgggccctga gagccgagct ggccgccggc gcctcccagt ctcggagacc caggccccct 120

agacagaggg acagctccac cacaggcgac gattctggcc gcgatagcgg aggacctagg 180

cgccggagag gcaaccgggg ccggggccag aggcgcgact ggagcagggc cccaccacct 240

ccagaggaga gacaggagac aaggtctcag accccagcac caaagcctag ccgggccccc 300

cctcagcagc ctcagccacc cagaatgcag acaggcaggg gcggatccgc cccaagacca 360

gagctgggcc ctccaaccaa cccattccag gccgccgtgg ccaggggcct gcgcccccct 420

ctgcacgacc ctgatacaga ggcaccaacc gaggcatgcg tgacctcctg gctgtggtct 480

gagggagagg gagccgtgtt ctacagggtg gacctgcact ttacaaatct gggaacccca 540

ccactggacg aggatggccg ctgggatcca gccctgatgt acaacccatg tggacctgag 600

cctccagcac acgtggtgcg ggcctataat cagcccgccg gcgacgtgag aggcgtgtgg 660

ggcaagggcg agaggacata tgccgagcag gattttcgcg tgggaggaac caggtggcac 720

agactgctga ggatgccagt gcggggcctg gacggcgata gcgcccccct gccacctcac 780

accacagaga gaatcgagac ccgctccgcc cggcacccat ggagaatcag gttcggcgcc 840

cctcaggcct ttctggcagg actgctgctg gccgccgtgg cagtgggcac agccagagcc 900

ggactgcagc ctagggccga catggcagca ccacccaccc tgccacagcc tccacgggcc 960

cacggacagc actacggcca ccaccaccac cagctgccat tcctgggcca cgacggacac 1020

cacggaggca ccctgagggt gggccagcac cacaggaacg cctccgatgt gctgccagga 1080

cactggctgc agggaggatg gggctgctat aatctgtctg actggcacca gggcacacac 1140

gtgtgccaca ccaagcacat ggacttttgg tgcgtggagc acgatagacc ccctccagcc 1200

acccctacac cactgaccac agccgccaac agcaccacag ccgccacacc agcaaccgca 1260

ccagcacctt gccacgccgg cctgaatgat agctgcggag gcttcctgtc cggatgtgga 1320

cctatgaggc tgaggcacgg agcagacaca agatgcggca ggctgatctg tggcctgtcc 1380

accacagccc agtacccccc taccagattt ggatgcgcaa tgagatgggg actgccacca 1440

tgggagctgg tggtgctgac agccagaccc gaggatggct ggacctgcag aggcgtgcca 1500

gcacacccag gaacccggtg tcccgagctg gtgagcccta tgggcagagc cacatgtagc 1560

cctgcctccg ccctgtggct ggccaccgcc aacgccctgt ccctggacca cgccctggcc 1620

gccttcgtgc tgctggtgcc atgggtgctg atctttatgg tgtgccggag aacatgtagg 1680

cgccggggcg ccgccgccgc cctgaccgcc gtggtgctgc agggctacaa tcctccagcc 1740

tatggcgagg aggccttcac atacctgtgc accgcaccag gatgtgcaac ccaggcacca 1800

gtgcccgtgc gcctggccgg cgtgcggttc gagtctaaga tcgtggacgg aggatgcttt 1860

gcaccatggg atctggaggc aacaggagca tgcatctgtg agatccctac cgatgtgagc 1920

tgtgagggac tgggagcatg ggtgcctacc gcaccatgcg cccgcatctg gaacggaaca 1980

cagcgggcct gtaccttctg ggccgtgaat gcctactcta gcggcggcta tgcccagctg 2040

gccagctact ttaaccccgg cggctcctac tataagcagt atcacccaac agcatgcgag 2100

gtggagcctg ccttcggcca cagcgacgca gcatgttggg gattccctac cgatacagtg 2160

atgagcgtgt tcgccctggc cagctacgtg cagcacccac acaagaccgt gagggtgaag 2220

ttccacaccg agacacgcac cgtgtggcag ctgtccgtgg caggcgtgtc ttgcaacgtg 2280

accacagagc acccattttg taatacacca cacggacagc tggaggtgca ggtgccacct 2340

gaccccggcg atctggtgga gtatatcatg aaccacaccg gcaatcagca gtccagatgg 2400

ggcctgggct ctcctaattg ccacggacca gactgggcct cccccgtgtg ccagagacac 2460

agccctgatt gttccaggct ggtgggagca acaccagaga gacctaggct gcgcctggtg 2520

gatgccgacg atccactgct gcgcacagca cctggaccag gagaagtgtg ggtgaccccc 2580

gtgatcggat cccaggccag aaagtgcggc ctgcacatca gggcaggacc ctacggccac 2640

gcaaccgtgg agatgcctga gtggatccac gcccacacca catctgaccc ttggcaccca 2700

ccaggaccac tgggcctgaa gttcaagaca gtgcgcccag tggccctgcc ccggaccctg 2760

gcccctccac gcaacgtgcg ggtgacaggc tgctatcagt gtggcacccc tgccctggtg 2820

gagggcctgg ccccaggagg aggcaactgc cacctgaccg tgaatggaga ggacctggga 2880

gcattcccac ctggcaagtt tgtgacagcc gccctgctga ataccccacc cccttaccag 2940

gtgagctgtg gaggagagtc tgacagggcc agcgccagag tgatcgatcc tgccgcccag 3000

tcctttacag gcgtggtgta tggcacccac accacagccg tgtctgagac aaggcagacc 3060

tgggcagagt gggctgccgc ccactggtgg cagctgaccc tgggagcaat ctgcgccctg 3120

ctgctggccg gactgctggc ctgctgtgca aagtgtctgt actatctgag ag 3172

<210> 2

<211> 177

<212> DNA

<213> Artificial sequence (artificial)

<400> 2

gtcgacccaa ctagcctacc ctccatcatt gttataaaaa acttaggaac caggtccaca 60

cagccgccag cccatcaacg cgtacgatgg tgagcaaggg cgaggagctg ttcaccactc 120

tcggcatgga cgagctgtac aagtaggcgc gcagcgctta gacgtctcgc gactagt 177

<210> 3

<211> 81

<212> DNA

<213> Artificial sequence (artificial)

<400> 3

gtcgacccaa ctagcctacc ctccatcatt gttataaaaa acttaggaac caggtccaca 60

cagccgccag cccatcaacg c 81

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence (artificial)

<400> 4

cgcgcagcgc ttagacgtct cgcgactagt 30

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence (artificial)

<400> 5

cgacccaact agcctaccc 19

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (artificial)

<400> 6

aacttgggag gcaatcactt 20

Claims

1. A measles and rubella combined vaccine, which is characterized in that: the recombinant measles virus is prepared by taking recombinant measles virus carrying ORF2 fragment of rubella virus as an immunogen and adding pharmaceutically acceptable auxiliary materials;

the recombinant measles virus is obtained by packaging infectious clone and 4 auxiliary plasmids together and electrically transfecting host cells, and proliferating and releasing the recombinant measles virus in the cells; the auxiliary plasmids are plasmids respectively carrying N protein, P protein and L protein genes for expressing T7RNA polymerase and measles;

the infectious clone is a recombinant plasmid obtained by constructing ORF2 fragment of rubella virus into a plasmid vector; the sequence of the ORF2 fragment is a DNA fragment shown in SEQ ID NO. 1; the recombinant plasmid comprises measles virus antigenome sequences; the measles virus is Shanghai 191 measles virus strain; the ORF2 fragment of rubella virus is located between the P gene and M gene of the measles virus antigenome; the 5 'and 3' ends of the ORF2 fragment are respectively connected with an X sequence and a Y sequence; the X sequence is shown as SEQ ID NO.3, and the Y sequence is shown as SEQ ID NO. 4.

2. The vaccine of claim 1, wherein: the co-electrotransfection is: the mixture of the infectious clone and 4 helper plasmids was transferred to a BioRad electric cup with a diameter of 2mm and shocked 1 time with exponential waves, 140V, 950. Mu.F.

3. Use of a recombinant measles virus carrying ORF2 fragment of rubella virus in the preparation of a measles, rubella combined vaccine, said recombinant measles virus being obtained by electrotransfection of infectious clones together with 4 helper plasmids into a host cell for packaging, and propagation and release of the resulting virus in the cell; the auxiliary plasmids are plasmids respectively carrying N protein, P protein and L protein genes for expressing T7RNA polymerase and measles;

4. A use according to claim 3, wherein: the co-electrotransfection is: the mixture of the infectious clone and 4 helper plasmids was transferred to a BioRad electric cup with a diameter of 2mm and shocked 1 time with exponential waves, 140V, 950. Mu.F.