PL178040B1 - Method of recombining and host cell for producing xylythol - Google Patents

Abstract

Novel methods for the synthesis of xylitol are described.

Description

The subject of the invention is a method of producing xylitol by a recombinant host by genetically modifying a native organism, cultivating this organism, and isolating xylitol, which consists in:

(a) the arabitol-producing microbial host is transformed with DNA encoding D-arabitol dehydrogenase (EC 1.1.1.11) and optionally with DNA encoding xylitol dehydrogenase (EC 1.1.1. 9);

(b) culturing the recombinant host of step (a) using D-hexose as carbon source such as: glucose, fructose, galactose, mannose or mixtures thereof, or a polymer or oligomer containing such D-hexose, or D-arabitol, ethanol or glycerol to give xylitol as the product; and (c) isolating the xylitol produced in step (b).

Preferably, arabitol is an intermediate in said pathway.

Also preferably, the native host is an arabitol-producing yeast or an arabitol-producing fungus.

In a further preferred embodiment of the invention, the D-xylulokinase activity (EC 2.7.1.17) is inactivated in the host, and optionally the transketolase activity (EC 2.2.1.1) of the host is inactivated.

Even more preferably, the activity of the host trαnpketslase (EC 2.2.1.1) and D-xylulokinase (EC 2.7.1.17) is inactivated.

The yeasts used in the method of the invention are selected from the group consisting of Zygosaccharomyces rouxii, Candida polymorpha, Torulopsis canaiaα, Pichia farinosa and Tozuloppsrα hansenii, and the fungi are selected from the group consisting of Dendryohiella salina and Schizophyllum commune. More preferably, Zygosaccharomyces rouxii is used as the yeast.

The invention also relates to a recombinant microbial host, characterized in that it is capable of producing xylitol using D-hexose as a carbon source, such as: glucose, fructose, galactose, mannose, or mixtures thereof, or a polymer or oligomer containing such D-hexose or D- arabitol, ethanol or glycerol, transformed DNA, encoding D-arabitol dehydrogenase (EC 1.1.1.11) and optionally DNA,. encoding dehydrogen 178,040 xylitol (EC 1.1.1.9). Preferably, in such a recombinant host according to the invention, the activity of D-xylulokinase (EC 2.7.1.17), and possibly the activity of transketolase (EC 2.2.1.1) has been inactivated.

Most preferably, the microbial host according to the invention is characterized in that the activities of D-xylulokinase (EC 2.7.1.17) and transketolase (EC 2.2.1.1) have been inactivated.

Preferably the recombinant microbial host is characterized in that arabitol-producing yeast or arabitol-producing fungus is used as the native microbial host, and even more preferably the yeast is selected from the group consisting of Zygosaccharomyces rouxii, Candida polymorpha, Torulopsis candida, Pichulospora hansenii and Pichulospora hansenii. and the mushrooms are selected from the group consisting of Dendryphiella salina and Schizophyllum commune. Most preferably, the yeast is Zygosaccharomyces rouxii.

The invention also relates to a method of producing xylitol by a microbial host by genetically modifying a native organism, cultivating this organism, and isolating xylitol, characterized in that (a) the microbial host transformed with a gene encoding xylitol dehydrogenase (EC 1.1.1.9) is cultivated; D-glucose-6-phosphate dyhydrogenesis (eC 1.1.1.44), D-ribulose-5-phosphate 3-epimerase (EC 5.1.3.1) and / or D-ribulokinase (2.7.1.47) using D-hexose as carbon source such as: glucose, fructose, galactose, mannose, or mixtures thereof, or a polymer or oligomer containing such D-hexose, or D-arabitol, ethanol or glycerol, yielding a xylitol product; and (b) isolating the xylitol produced in step (a). Preferably, a host with inactivated transketolase activity (EC 2.2.1.1), and optionally with an inactivated xylulokinase activity (EC 2.7.1.17) is used as the microbial host. Even more preferably, the microbial host is a host transformed with a gene encoding a non-specific phosphatase catalyzing the dephosphorylation of D-xylulose phosphate to D-xylulose.

A further object of the invention is also a recombinant microbial host capable of producing xylitol using as a carbon source D-hexoses such as: glucose, fructose, galactose, mannose, or mixtures thereof, or a polymer or oligomer containing such D-hexose, or ethanol or glycerol, transformed gene coding for xylitol dehydrogenase (EC 1.1.1.9), D-glucose-6-phosphate dehydrogenase (EC 1.1.1.49), 6-phospho-D-gluconate dehydrogenase (EC 1.1.1.44), D-ribulose-5-phosphate-3 epimerase (EC 5.1.3.1), and / or D-ribulokinase (EC 2.7.1.47). In a preferred embodiment of the invention, the transketolase activity (EC 2.2.1.1) has been inactivated in the recombinant microbial host, or optionally the D-xylulokinase activity (EC 2.7.1.17) has been inactivated.

The recombinant microbial host is preferably characterized in that the host is transformed with a gene encoding a non-specific phosphatase catalyzing the dephosphorylation of D-xylose phosphate to D-xylulose.

Accordingly, the invention provides a method for the production of xylitol, according to which a new and unknown microbial strain is prepared which is genetically engineered to produce such xylitol either de novo or in increased amounts compared to a native non-genetically engineered microorganism. The new metabolic pathway is incorporated by genetic engineering into a microorganism, resulting in de novo or increased xylitol production by the microorganism. The new route modifies the D-arabitol biosynthesis and / or metabolism pathway by extending the previously existing D-arabitol biosynthetic pathway with additional steps in the utilization of D-arabitol, by introducing and overexpressing genes encoding D-arabitol dehydrogenase producing D-xylulose (EC 1.1.1.11) and xylitol dehydrogenase (EC 1.1.1.9) to a microorganism producing D-arabitol. As a result, the microorganism produces xylitol by fermenting carbon sources which the unmodified microorganism uses for the biosynthesis of D-arabitol.

178 040

In a preferred embodiment of the method of the present invention, D-xylose is consumed in order to block the metabolic pathway by a reaction of D-xylokinase and transketolase inactivating the D-xylulokinase activity (EC 2.7.1.17) of the host or inactivating the transketolase activity (EC 2.2.1.1.) Of the host .

The invention thus provides a method for the production of xylitol using the novel microorganisms mentioned above, the method using the above modified D-arabitol biosynthetic pathway, which pathway has been further modified by inactivation by chemically induced mutagenesis or decay of the gene encoding transketolase (EC 1.1) or the gene encoding D-xylulokinase (EC 2.7.1.17) in such microorganisms.

Preference is given to using yeasts selected from the group consisting of Zygosaccharomyces rouxii, Candida polymorpha, Torulopsis candida, Pichia farinosa and .Torulaspora hansenii in the process of the invention, and fungi selected from the group consisting of Dendryphiella salina and Schizophyllum commune. Zygosaccharomyces rouxii is used particularly preferably as the yeast.

Host cells provided by the invention are capable of producing xylitol when grown on carbon sources other than D-xylulose or D-xylose, and other than polymers or oligomers or mixtures thereof. The carbon sources used by the host cells of the invention are cheap and readily available. The microorganisms of the invention are also capable of secreting the synthesized xylitol into culture. This goal is achieved by modifying the metabolism of the desired microorganism, the most common naturally occurring yeast microorganism, by introducing and inducing expression of the desired heterologous genes. This object is also achieved by further modifying the metabolism of such desired microorganisms so as to overexpress and / or inactivate the activity or expression of certain genes homologous to such microorganisms in the native state.

In a preferred modified recombinant microbial host according to the invention, D-xylulokinase activity is inactivated (EC 2..7.1.17), or transketolase activity is inactivated (EC 2.2.1.1.), Or D-xylulokinase activities are inactivated (EC 2.7.1.17). ) and transketolases (EC 2.2.1.1).

Fig. 1 shows the restriction map of the insert in the pARL2 plasmid. This is an insert from the chromosomal Klebsiella terrigena Phpl locus containing the K. terrigena D-arabitol dehydrogenase gene. The open box represents the chromosomal DNA of K. terrigen. Arrows indicate the location and direction of the D-arabitol dehydrogenase gene (EC 1.1.1.11) in this DNA.

Figure 2 shows the pYARD construction with pADH and pAAH5. In the plasmid diagrams, bacterial sequences are marked with a single line (-); the wavy line is marked with 2μΜ. DNA from S.cerevisiae; the open arrow (=>) indicates the ADCI promoter (ADCI gene encoding S. cerevisiae alcohol dehydrogenase or ADCI previously was designated AD HI); the empty diamond (0) indicates the ADCI transcription terminator; the rectangular block represents the LEU2 gene; the dashed arrow indicates the D-arabitol dehydrogenase gene.

Figure 3 shows the construction of the plasmid pJDB (AX) -16. XYL2 is the Pichia stipitis xylitol dehydrogenase gene. dalD is the D-arabitol dehydrogenase gene. ADCI designates the transcriptional regulation region (promoter) of the ADCI gene preceding and operably linked to the dalD coding sequence. The symbols have the same meaning as in Figure 4. In the plasmid diagrams, bacterial and 2 pm sequences are marked with a single line (-). DNA when marked; the closed arrow marks the ADC1 promoter; the shaded diamond (0) indicates the ADCI transcription terminator; the rectangular block represents the LEU2 marker gene; the shaded arrow indicates the XYL2 gene; and the locked rectangle represents the dalD gene.

Fig. 4 shows the construction of the E.coli-Z spindle vector pSRT (AX) -9. Rouxii. The symbols have the same meaning as in Fig. 3.

Figure 5 shows the restriction map of the cloned T. candida rDNA fragment.

Fig. 6 shows the construction of the pTC (AX) plasmid

Figure 7 shows the restriction map of the cloned T. candida rDNA fragment.

Fig. 7a shows the construction of the pCPU (AX) plasmid.

178 040

Figure 8 shows the cloning of ZWF1 and the gnd gene.

Figure 8a shows the construction of the PAAH (gnd) plasmid.

Fig. 9 shows the construction of the pSRT (ZG) plasmid.

Fig. 10 shows the cultivation of Z. rouxii ATCC 13356 [pSRT (AX) -09] in a fermentor.

Figure U shows the cultivation of the mutant derived from the Z.rouxii ATCC 13356 strain [pSRT (AX) -09] in a fermentor.

I. Definitions

In the following description, a number of terms used in recombinant DNA technology are commonly used. To ensure a clear and unambiguous understanding of the description and claims, including the scope of these terms, the relevant definitions are provided below.

Carbon source other than xylose or xylulose. As used herein, the term "carbon source other than xylose or xylulose" means a carbon substrate for xylitol production other than D-xylose and D-xylulose, polymers or oligomers or mixtures thereof (such as xylan and hemicellulose). The carbon source preferably supports growth of the genetically engineered microbial host cells of the invention and fermentation in yeast hosts. A variety of cheap and readily available compounds can be used as a carbon source for xylitol production in the microbial host cells of the invention, including D-glucose and various syrups containing D-glucose and mixtures of D-glucose with other sugars. The term also includes other sugars absorbed by the hosts of the translation invention due to the presence of translational stop codons in the antisense RNA sequence.

The term "complementary DNA" or the gene "cDNA" includes recombinant genes synthesized, for example, by reverse transcription of mRNA, and therefore do not contain interfering sequences (introns). Gene clones from genomic DNA will typically contain introns.

Cloning media. Plasmid or phage DNA, or other DNA sequence capable of carrying genetic information, particularly DNA, in a host cell. A cloning medium is often characterized by having one or few endonuclease recognition sites in which such DNA sequences can be cleaved in a predetermined manner without losing the essential biological function of the carrier, and into which the required DNA can be incorporated to effect its cloning. in the host cell. The cloning medium may further include a marker useful for use in identifying cells transformed with the cloning medium, and replication sources that allow the support to maintain and replicate in one or more prokaryotic or eukaryotic hosts. The markers relate to e.g. tetracycline resistance or ampicillin resistance. The term "vector" is sometimes used in place of "cloning medium". A "plasmid" is a cloning vehicle, usually circular DNA, that is maintained and autonomously replicated in at least one host cell.

Expression vehicle. A vehicle or vector similar to the cloning medium, but which supports the expression of the gene in which it was cloned upon transformation into a host. A cloned gene is typically placed under the control (i.e., operably linked) of certain control sequences, such as promoter sequences, which may be delivered by a carrier or by recombinant construction of the cloned gene. Expression control sequences will vary depending on whether the vector intended to express a gene operably linked in a prokaryotic or eukaryotic host, and may contain transcriptional elements such as enhancer elements (upstream of the activation sequence) and sequences. translation initiation and termination sites and / or sites.

Host. The host is a cell, either prokaryotic or eukaryotic, that is used as the recipient or carrier of the recombinant material.

178 040

The host according to the invention. An "inventive host" is a microbial host that does not inherently produce significant amounts of xylitol during fermentation, from known carbon sources other than D-xylose and D-xylulose, polymers or oligomers or mixtures thereof, but has been genetically engineered. to be able to produce it according to the methods of the invention. "Substantial amount" means an amount that allows the secretion of xylitol in pure form, or an amount that can be readily measured by analytical techniques typically employed in carbohydrate analysis in microbial fermentation broth.

Arabitol dehydrogenase. Two types of D-arabitol dehydrogenases are known: producing D-xylulose (EC 1.1.11) and producing D-ribose. D-ribose-producing dehydrogenases have been found in wild yeast and fungi. Arabitol dehydrogenases producing D-xylulose have only been found in bacteria. Unless otherwise stated, all references and references in the description to arabitol dehydrogenase relate to arabitol dehydrogenase producing D-xylulose.

Drogipentosis-phosphate oxidizing branch. The term "oxidizing branch of the pentose-phosphate pathway" includes that part of the pentose-phosphate shunt that catalyzes oxidative reactions such as those catalyzed by D-glucose 6-phosphate dehydrogenase (EC 1.1.1.49) and / or 6-phospho-D- dehydrogenase. gluconate (EC 1.1.1.44), in which hexose substrates are used and pentose phosphates are produced. The "non-oxidative" part of the pentose-phosphate pathway (which also catalyzes the direct formation of ribose from D-glucose) is characterized by non-oxidative isomerizations such as ribose-5-phosphate isomerase, D-ribulose-5-phosphate-3-epimerase and transaldolase reactions. See Biological Chemistry, R.H. Mahler and and E. H. Cordes, Harper & Row, Editors, New York, 1966, pp. 448-454.

Functional derivatives. A "functional derivative" of a protein or nucleic acid is a molecule which is a chemical or biochemical derivative derived from that protein or nucleic acid and which retains the biological activity (functional or structural) that is characterized by the native protein or nucleic acid. The term "functional derivative" also includes "fragments," "variants," "analogs", or "chemical derivatives" of a molecule that retain the desired activity of the native molecule.

A molecule is referred to herein as a "chemical derivative" of another molecule when it contains additional chemical groups not normally included in the molecule. Such groups can increase the solubility, absorption, biological half-life of the molecule, etc. The groups can reduce the toxicity of the molecule, eliminate or attenuate an undesirable side effect of the molecule, and the like. Groups capable of exerting such effects are described in Remington's Pharmaceutical Sciences (1980). Procedures for conjugating such groups to a molecule are well known.

Fragment. A "fragment" of a molecule such as a protein or nucleic acid is part of the native genetic sequence of amino acids or nucleotides, and especially the functional derivatives of the invention.

Variant or analog. A "variant" or "analog" of a protein or nucleic acid means a molecule that is substantially similar structurally or biologically active to a native molecule, such as a molecule encoded by a functional allele.

II. Construction of metabolic pathways for xylitol biosynthesis

According to the invention, the metabolic pathways of the microbial host are manipulated so as to impair or eliminate the use of carbon for purposes other than xylitol production. All such hosts produce xylitol in one step of fermentation. In one embodiment, the hosts of the invention may exhibit xylitol dehydrogenase activity (EC 1.1.1.9) sufficient to produce xylitol. However, as described below, in those hosts where overproduction of xylitol dehydrogenase is desired, the recombinant genes encoding xylitol dehydrogenase can be transformed into host cells'.

In an embodiment of the invention, the hosts of the invention are characterized by the ability to synthesize xylitol from structurally not very similar carbon sources such as

178 040 as D-glucose and not just from D-xylose and / or D-xylulose. The hosts of the invention are also able to excrete the synthesized xylitol into the medium.

In particular, in exemplary and preferred embodiments, the hosts of the invention are characterized by one of two pathways. First, there is a pathway where arabitol is an intermediate in xylitol production, and second, there is a pathway where xylulose 5-phosphate is used to produce xylitol by dephosphorylation and reduction. Accordingly, the hosts of the invention are characterized by at least one of the following genetic modifications:

(1) the cloning of the gene encoding the protein showing the activity of D-arabitol dehydrogenase producing D-xylulose (EC 1.1.1.11) was performed, whereby the conversion of D-arabitol to D-xylulose is obtained (conversion pathway I feature); and / or (2) the native host gene encoding transketolase activity has been deactivated (feature of transformation pathway II).

Additionally, a variety of other modifications can be made to the host to increase its ability to produce xylitol. For example, the hosts described in (1) and (2) may be further modified such that:

(3) the cloning of the gene encoding the protein showing xylitol dehydrogenase activity (EC 1.1.1.9) in the host was performed;

(3) the native host gene encoding D-xylulokinase (EC 2.7.1.17) has been inactivated;

(4) the cloning in the host of the gene encoding the protein showing the activity of D-glucose 6-phosphate dehydrogenase (EC 1.1.1.49) was performed;

(4) cloning in the host of the gene encoding the protein showing 6-phospho-D-gluconate dehydrogenase activity (EC 1.1.1.44); and (5) cloning in the host of the gene encoding the protein showing D-ribulose -5-phosphate-3-epimerase activity (EC 5.1.3.1).

In a preferred embodiment, the hosts according to the invention display more than one of the above-mentioned genetic modifications. For example, in a preferred embodiment of the invention, carbon passes from D-arabitol "directly to" (ie in one step) D-xylulose and from D-xylulose "directly to" xylitol. Accordingly, in such an embodiment, the host according to the invention has been modified such that the gene encoding a protein having D-arabitol dehydrogenase producing D-xylulose activity and the gene encoding xylitol dehydrogenase (EC 1.1.1.9) has been cloned. It should be emphasized that while in many embodiments, D-arabitol is internally synthesized from other carbon sources by the hosts of the invention, it may also be externally added directly to the medium.

In another preferred embodiment, the xylitol biosynthetic route does not include arabitol as an intermediate. Rather, there is a shift of carbon from D-xylulose 5-phosphate to D-xylulose and then onto xylitol. When D-glucose is used as the carbon source, the carbon may pass through the oxidative part of the pentose-phosphate pathway, from D-glucose via D-glucose 6-phosphate and D-ribulose 6-phospho-6-phosphate to D-ribulose 5-phosphate. D-ribulose phosphate can then be epimerized to D-xylulose 5-phosphates, dephosphorylated to D-xylulose and reduced to xylitol. Accordingly, the host of the invention used in this embodiment should be a host in which:

(a1) the gene encoding a protein exhibiting D-glucose 6-phosphate dehydrogenase activity (EC 1.1.1.49) has been cloned in the host or the native gene of the host is overexpressed; and / or (a2) the cloning of a gene encoding a protein showing 6-phospho-D-gluconate dehydrogenase activity (EC 1.1.1.44) in the host is performed or the native gene of the host is overexpressed; and / or

178,040 (a3) the cloning of the gene encoding the protein showing D-ribulose-5-phosphate-3-epimerase activity in the host was performed or the native gene of the host is overexpressed; and / or (a4) the cloning of a gene encoding a protein exhibiting xylitol dehydrogenase activity (EC 1.1.1.9) is performed in the host or the native gene of the host is overexpressed; and / or (b) the native transketolase gene has been inactivated; and / or (c) the native host gene coding for xylulokinase activity (EC 2.7.1.17) has been deactivated.

The dephosphorylation step (conversion of D-xylulose phosphate to D-xylulose) is one step catalyzed by an enzyme that has not been characterized in pure form. However, the enzymatic activity responsible for a similar step (conversion of D-ribulose 5-phosphate to D-ribulose) in the native D-arabitol production route by osmophilic yeast has been shown to be non-specific and is also able to catalyze safosphorylswαnia D-xylulose 5-phosphates (JM Ingram and WA Wood, J. Bacteriol. 89: 1186-1194 (1965)). Mutation of transketolase and overexpression of the two dehydrogenases of the oxidative pentose-phosphate pathway serve two purposes. First, they can increase the efficiency of pathway I by increasing the amount of ribulose 5-phosphate in the cell and consequently the production of arabitol and xylitol. Second, the excessive build-up of xylulose-5-phosphates necessary for Pathway II may occur as a result of the same combination of modifications.

Therefore, methods using the naturally occurring pathway to form D-arabitol from various carbon sources and extending this pathway by two reactions to convert D-arabitol to xylitol are not the only possible pathway within the scope of the invention. Other pathways to xylitol as the final metabolic product can be constructed, not including D-arabitol as an intermediate. Thus, the conversion to xylitol from D-ribulose-5-phosphatol can be accomplished by more than one reaction chain. D-ribulose 5-phosphoran can be efficiently converted to D-xylulose 5-fssfsran by D-ribuloso-5-fssfsrano-3-epimerase, and if further conversion of D-xylulose 5-phosphate is prevented by mutation in the transketolase gene, the accumulated D-xylulose 5-phosphate can be dephosphorylated by the same non-specific phosphatase as D-ribulose β-phosphate (JM Ingram et al., J. Bacteriol. 89: 1186-1194 (1965)) and reduced to xylitol by xylitol dehydrogenase. The implementation of such a pathway may additionally require the deactivation of the D-xylulokinase gene to minimize energy loss caused by the sterile loop D-xylulose 5-phosphate -> D-xylulose 5-phosphsrαn D-xylulose. Additional genetic alteration - the introduction and (over) expression of the D-ribulokinase gene (EC 2.7.1.47) may minimize the simultaneous production of D-arabitol by such strains by binding D-ribulose produced by nonspecific phosphatase. D-ribulose can be converted back to D-ribulose phosphate and then to D-xylulose 5-phosphate.

III. Host construction according to the invention

The method of genetically engineered hosts of the invention is facilitated by the isolation and partial sequencing of a pure protein encoding the enzyme of interest, or the cloning of genetic sequences capable of encoding such a protein by polymerase chain reaction technology; and as a result of the expression of such genetic sequences. The term "genetic sequences" as used herein refers to a nucleic acid molecule (preferably DNA). The genetic sequences capable of encoding a protein come from a variety of sources. These sources include genomic DNA, cDNA, synthetic DNA, and combinations thereof. A preferred source of genomic DNA is a yeast genomic library. A preferred source of cDNA is a cDNA library made from yeast mRNA grown under conditions known to induce expression of the desired mRNA or protein.

The cDNA of the invention does not include naturally occurring introns when the cDNA has been produced using mature mRNA as a template. The genomic DNA of the invention may or may not include naturally occurring introns. Furthermore, such genomic DNA can be obtained associated with the 5 'region of the promoter of the genomic sequences and / or with the 3' region of transcriptional termination. Moreover, such genomic DNA can be obtained in association with genetic sequences which encode the 5 'untranslated region of the mRNA and / or with genetic sequences which encode the 3' untranslated region. To the extent that the host cell can recognize transcriptional and / or translational regulatory signals associated with mRNA and protein expression, the 5 'and / or 3' untranslated regions of the native gene and / or the 5 'and / or 3' untranslated regions of the mRNA may be retained and used in transcriptional and translational regulation. Genomic DNA can be isolated from any host cell, especially yeast host, and then purified by well-known methods (see, e.g., Guide to Molecular Cloning Techiques, S.L. Berger et al., Eds., Academic Press (1987)). Preferably the mRNA preparation used will be enriched in mRNA encoding the desired protein, either naturally, by isolation from protein-producing cells, or in vitro, by techniques commonly used to enrich mRNA preparations with specific sequences, such as sucrose gradient centrifugation, or with both techniques.

When cloning in a vector, such appropriate DNA preparations (genomic DNA or cDNA) are randomly ground or enzymatically cleaved and ligated with the appropriate vectors to obtain a recombinant gene library (genomic or cDNA).

The DNA sequence encoding the desired protein or functional derivatives thereof can be inserted into the DNA vector by known techniques including blunt end and bevel ligation ending, restriction enzyme digestion to obtain suitable ends, proper sticky end filling, alkaline phosphatase treatment to avoid unwanted junctions. and ligation with appropriate ligases. Techniques for such manipulation are described by T. Maniatis (T. Maniatis et al., Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, 2nd ed., 1988) and are well known.

Libraries containing the sequences encoding the desired gene may be selected and the sequence of the desired gene identified by any method that specifically selects the sequence encoding the gene or protein of interest, such as e.g. a) hybridization with a suitable nucleic acid probe (s) that contain the DNA-specific sequence of that protein, B) analysis translation selected on the basis of hybridization, in which the native mRNA hybridizing with a given clone is translated in vitro, followed by further characterization of the translation products, or c) in case the cloned genetic sequences are themselves capable of expressing the mRNA, immunopreparation of the protein translation product is performed produced by the host containing the clone.

Protein-specific oligonucleotide probes that can be used to identify clones of that protein can be designed on the basis of knowledge of the nucleic acid sequence of the DNA encoding such protein or related protein. Alternatively, antibodies can be grown against the purified protein species and used to identify the presence of unique protein determinants in transformants that express the desired cloned protein. The sequence of amino acid residues in a peptide is determined using their commonly used three-letter designations or their single-letter designations. A listing of such three-letter and single-letter designations can be found in textbooks such as Biochemistry, A. Lehninger, Worth Publishers, New York NY, (1970). When the amino acid sequence is presented horizontally, the amino terminus is at the left terminus and the carboxy terminus is at the right terminus unless otherwise noted. Likewise, unless otherwise noted, the 5 'end of the nucleic acid sequence is on the left.

Because the genetic code is ambiguous, more than one codon can be used to encode a specific amino acid (JD Watson, in: Molecular Biology from the Gene, 3rd ed., WA Benjamin, Inc., Menlo Park, Ca (1977) , pp. 356-357). Peptide fragments

178,040 are analyzed to identify the amino acid sequences that can be encoded by the oligonucleotides with the lowest degree of ambiguity.

This is preferably accompanied by the identification of sequences which contain amino acids encoded by only one codon.

While coincidentally the amino acid sequence may only be encoded by a single oligonucleotide sequence, often the amino acid sequence may be encoded by any set of similar oligonucleotides. Importantly, however, while all members of such a kit contain an oligonucleotide sequence that is capable of encoding the same peptide fragment and therefore potentially contain the same oligonucleotide sequence as the gene that encodes the peptide fragment, only one element in the kit contains a nucleotide sequence identical to the gene sequence encoding the exon. Since this element is included in this kit and is capable of hybridizing to DNA even in the presence of other kit elements, an unfractionated set of oligonucleotides can be used in the same way as a single oligonucleotide is used to clone a gene encoding a peptide.

Using the genetic code, one or more oligonucleotides may be identified from the amino acid sequence, any of which may be capable of encoding a desired protein. The probability that a particular oligonucleotide will actually contain the appropriate protein coding sequence can be estimated taking into account the abnormal base pairing relationships and the frequency with which a particular codon is actually used (to encode a particular amino acid) in eukaryotic cells. Using "codon rules", a single oligonucleotide sequence or set of oligonucleotide sequences is identified that contains the theoretically "most likely" sequence unable to encode protein sequences.

A suitable oligonucleotide or set of oligonucleotides capable of encoding a fragment of a certain gene (or complementary to such an oligonucleotide or set of oligonucleotides) can be synthesized by commonly known methods (see, e.g., Synthesis and Application of DNAandRNA, SA Narang, ed. 1987, Academic Press, San Diego, CA) and used as a probe to identify and isolate a clone of such a gene, using known techniques. Methods of nucleic acid hybridization and clone identification are described by T. Maniatis et al. In Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY (1982), and by B.D. Hames et al in Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985)). Those members of the gene library described above, which have been proven to hybridize to such an extent, are then analyzed to determine the length and nature of the coding sequences contained therein.

To facilitate the detection of the desired DNA coding sequence, the above-described DNA probe is labeled with a detectable group. The detectable group may be any material with detectable physical or chemical properties. Such materials are well known in the art of nucleic acid hybridization, so that substantially most of the labels used in such methods can be used in the method of the invention. Particularly useful are radioactive labels such as ³² P, ³ H, C ^{l4, 35} S, ²⁵ and the like. Use of a radioactive label can be any giving the desired signal and having a suitable half-life. If the oligonucleotide is single-stranded, it can be radiolabelled using a kinase reaction. Polynucleotides labeled with a non-radioactive marker such as biotin, an enzyme, or a fluorescent group may also be useful as nucleic acid hybridization probes. Accordingly, the determination of a partial protein sequence enables the identification of the theoretically "most probable" DNA sequence or set of such sequences capable of encoding such a peptide. By constructing an oligonucleotide complementary to such a theoretical sequence (or by constructing a set of oligonucleotides complementary to such a set of "most likely" oligonucleotides), a DNA molecule (or set of DNA molecules) is obtained capable of acting as probe (s) for identifying and isolating clones containing the gene.

178 040

In an alternative method of gene cloning, a library is generated using an expression vector by DNA cloning or, even more preferably, cDNA obtained from a cell capable of expressing the protein in an expression vector. The library is then selected to isolate the elements that produce the desired protein by expression, e.g. by selecting the library with protein antibodies.

The above methods can therefore identify genetic sequences capable of encoding a protein or biologically active or antigenic fragments of that protein. In order to further characterize such genetic sequences, and to produce recombinant protein, it is desirable to express the proteins which encode these sequences. Such expression identifies those clones which produce, as a result of the expression, proteins exhibiting the characteristics of the desired protein. Such characteristics may include, but are not limited to, the ability to specifically bind an antibody, the ability to initiate the production of an antibody that is capable of binding to a native, non-recombinant protein, the ability to impart enzymatic activity to a cell, which is a property of a protein, and the ability to impart non-enzymatic (but specific ) activities of the recipient cell.

The DNA sequence can be shortened by known methods in order to isolate the desired gene from the chromosomal region which contains more information than is necessary when using the gene in the hosts of the invention. For example, restriction digest can be used to cleave full-length sequences at the desired site. Alternatively or additionally, nucleases that cleave from the 3 'end of the dNa molecule can be used to digest a sequence and obtain a truncated form, the sequence of the required length being identified and purified by gel electrophoresis and DNA sequencing. Such nuclease include, for example, exonuclease III and Bal 31. Other nuclease are well known.

In the practice of the invention, the osmophilic yeast Z. rouxii was used as a model. Z. rouxii can be used in the production of foodstuffs as they are traditionally used in Japan to make soy sauce. For example, yeast is described in The Yeast, A Taxonomic Study, Kreger-van Rijn (ed.), Elsevier Science Publishers B.V., Amsterdam, 1984, where the yeast is described at pages 462-465. Other D-arabitol producing yeasts such as Candida polymorpha, Torulopsis candida, Candida tropicalis, Pichia farinosa, Torulospora hansenii etc., as well as D-arabitol producing fungi such as Dendryphiella salina or Schizophyllum commune, can also be used as host organisms in the method according to the invention.

It is known that the enzymes that oxidize D-arabitol to D-xylulose (C 1.1.1.11) occur in bacteria, but not in yeasts and fungi. Accordingly, Klebsiella terrigena is a preferred source of the D-arabitol dehydrogenase (D-xylulose producing) gene, as it is a non-pathogenic soil bacterium showing high stimulated D-arabitol dehydrogenase activity. Klebsiella terrigena Phpl strain applied. examples were obtained from K. Haahteli, University of Helsinki. Strain secretion is described by Haahtela et al., App. Env. Microbiol. 45: 563-570 (1983). Cloning of the D-arabitol dehydrogenase gene may conveniently be performed by constructing a genomic library of K. terrigen chromosomal DNA in a suitable vector, e.g. on the well known and commercially available plasmid pUC19. This library is transformed into one of a number of E. coli strains capable of using D-xylulose but not D-arabitol as sole carbon source. An example of a suitable strain is the E. coli SCSI strain available from Stratagene. Transformants are then seeded on a medium containing D-arabitol as the sole carbon source, and clones capable of growing on such medium are isolated. The coding region of K. terrigen D-arabitol dehydrogenase can conveniently be isolated as a 1.38 kb BclI-C11 fragment and fused to the appropriate promoter and transcriptional terminator sequences. The Saccharomyces cerevisiae ADCI transcriptional promoter and terminator are examples of transcriptional regulatory elements useful in the practice of the invention when Z. rouxii is used as a host organism. ADCI sequences are available from GenBank.

178 040

Although most D-xylulose and fungi contain a xylitol dehydrogenase gene (EC 1.1.1.9), overexpression of this gene will usually be necessary in practicing the invention. Cloning of the xYL2 Pichia stipitis gene encoding xylitol dehydrogenase (EC 1.1.1.9) can conveniently be performed according to polymerase chain reaction technology using published information on the nucleotide sequence of the XYL2 gene (Kotter et al., Cum Genet. 18: 493-500 (1990)). The gene may be introduced into another yeast species without any modification by expression under the control of its own promoter, or the promoter may be replaced with another strong yeast promoter.

Constructions of genetically stable transformants with vector systems or with transforming systems can be made, thereby integrating the desired DNA into the host chromosome. Such integration may occur de novo in the cell, or may be mediated by transformation with a vector that functionally integrates itself into the host chromosome, such as phage, retroviral vectors, transposons, or other DNA elements that facilitate the integration of DNA sequences into chromosomes.

Genes coding for D-arabitol dehydrogenase and xylitol dehydrogenase (EC 1.1.19). under the control of appropriate promoters, they can be combined in one plasmid construction and introduced into host cells - organisms producing D-arabinose as a result of transformation. The nature of the plasmid vector will depend on the host organism. Thus, in a preferred embodiment of the invention, vectors containing pSRl latent plasmid DNA are used in the case of Z. rouxii (K. Ushio et al., J. Ferment. Technol. 66: 481-488 (1988)). In the case of other yeast or fungal species for which autonomously replicating plasmids are unknown, the integration of the xylitol dehydrogenase (EC 1.1.1.9) and D-arabitol dehydrogenase genes in the host chromosome can be used. Targeting the integration to the host ribosomal DNA locus (DNA encoding the ribosomal RNA) of the host is a preferred way of carrying out high copy number integration, and high expression levels of the two dehydrogenase genes so targeted can be obtained by sufficient recombinant DNA sequences on the recombinant construct to direct integration into that's the locus. The genetic markers used to transform D-arabitol producing microorganisms are preferably dominat markers with introduced resistance to various antibiotics such as gentamicin or phleomycin, to heavy metals such as copper, etc. The selectable marker gene can either be directly linked to or inserted into the DNA sequence of the expressed gene. the cell itself by co-transformation.

In addition to the introduction of the genes D-arabitol dehydrogenase and xylitol dehydrogenase (EC 1.1.1.9), other genetic modifications can be made by constructing new xylitol-producing strains. Thus, genes encoding enzymes of the oxidative pentose-phosphate pathway can be overexpressed in order to increase the rate of synthesis of D-ribulose 5-phosphate, a precursor to D-arabitol. In addition, the gene encoding transketolase, an enzyme that catalyzes the catabolism of pentulose 5-phosphate or pentose 5-phosphate, can be inactivated using conventional techniques for mutagenesis or gene disruption, leading to increased accumulation of 5-carbon sugar phosphates. Inactivation of the D-xylulokinase gene may increase xylitol yield by eliminating the loss of D-xylulose by phosphorylation. The combination of the transketolase inactivating mutation and the overexpression of D-ribulose 5-epimerase can be used to create a different kind of xylitol production route in which D-arabitol is not used as an intermediate.

For the expression of a desired protein and / or its active derivatives, transcriptional and translational signals recognized by an appropriate host are necessary. The cloned coding sequences obtained by the methods described above, preferably in double-stranded form, can be operably linked to sequences that control transcriptional expression in an expression vector and then introduced into a host, prokaryotic or eukaryotic cell, yielding a recombinant protein or a functional derivative thereof. Depending on which strand is operably linked to sequences that control transcriptional expression, antisense RNA or a functional derivative thereof may also be expressed.

178 040

As a result of expression of the protein in different hosts, various portranslational modifications can arise that can alter the properties of the protein. Preferably, the invention comprises the expression of the protein or a functional derivative thereof in eukaryotic cells, in particular yeast.

A nucleic acid molecule such as DNA is defined as "expressible" a polypeptide when it contains expression control sequences that include transcriptional regulatory information, which sequences are "operably linked" to the nucleotide sequence that encodes the polypeptide.

A functional linkage is a linkage in which the sequence is linked to one or more regulatory sequences such that expression of the sequence is influenced or controlled by the regulatory sequence. Two DNA sequences (such as a coding sequence and a promoter region sequence joined to the 5 'end of the coding sequence) are said to be operably linked if promoter induction results in transcription of mRNA encoding the desired protein and if the nature of the link between the two DNA sequences (1) is not it affects the reading frame of the coding sequence, 92) does not interfere with the ability of regulatory expression sequences to direct the expression of a protein, antisense mRNA, or (3) does not interfere with the ability of the template DNA to transcribe. Accordingly, the promoter region should be operably linked to the DNA sequence if the promoter is to be able to transcribe this DNA sequence efficiently.

The exact nature of the regulatory regions necessary to achieve gene expression may vary depending on the species or cell type, but typically they contain as essential, 5 'non-transcribing and 5' non-translating (non-coding) sequences, respectively, transcriptional and translational sequences, such as a TATA box, cover sequence, CAAT sequence, etc. In particular, such 5 'non-transcribing cantonal sequences will contain a region encompassing the promoter of transcriptional regulation of an operably linked gene. Such transcriptional control sequences may also include enhancer sequences or upstream activator sequences, as appropriate.

Protein expression in eukaryotic hosts such as yeast requires the use of regulatory regions operating in such hosts, and preferably yeast regulatory systems. A wide variety of transcriptional and translational regulatory sequences may be used depending on the nature of the host. Preferably, such regulatory signals are associated in a native state with a particular gene ensuring high expression level in the host cell.

In the case of eukaryotes, when transcription is not linked to translation, such control regions may or may not provide a methionine initiator codon (AUG) depending on whether the cloned sequence contains methionine. Such regions will typically contain a promoter region sufficient to direct the initiation of RNA synthesis in the host cell. Preference is given to promoters from yeast genes encoding a translatable mRNA product, and in particular, strong promoters may be used provided that they also function as promoters in the host cell. Preferred strong promoters include the GALI gene promoter, promoters of a glycolytic gene such as the phosphoglycerinase gene (pGk) or the constitutive alcohol dehydrogenase (ADC1) promoter (G. Amerer, Meth. Enzymol. 101C: 192-201 (1983); Aho, FEBS Lett. 291: 45-49 (1991)). '

As is commonly known, translation of the eukaryotic mRNA is initiated at the codon encoding the first methionine. Therefore, it is preferable to ensure that the linkage between the eukaryotic promoter and the DNA sequence encoding the desired protein or its functional derivative does not contain any interfering codons that are capable of encoding methionine. The presence of such codons is due either to the formation of the fusion protein (when the AUG codon is in the same reading frame as the DNA sequence encoding the protein) or from a frame shift mutation (when the AUG codon is not in the same reading frame as the protein coding sequence).

Regulatory signals for transcriptional initiation may be selected which allow suppression or activation such that expression of operably linked

178,040 genes. Temperature sensitive regulatory signals are of interest such that by altering the temperature expression may be suppressed or initiated, or responsive to chemical regulation, e.g., forming a metabolite. Translational signals are not necessary when expression of antisense RNA sequences is desired.

If desired, the cloning techniques described above may result in non-transcrinated and / or non-translated regions 3 'to the sequence encoding the desired protein. The 3'-non-transcribed region may be conserved due to its elements of the regulatory transcription termination sequence; the 3'-non-translatable region may be conserved either because of its regulatory sequence termination sequence elements or because of those elements which direct polyadenylation in eukaryotic cells. When native expression control sequence signals do not function satisfactorily in a host cell, sequences operating in the host cell can be exchanged.

The vectors of the invention may furthermore contain other operably linked regulatory elements such as DNA elements that confer antibiotic resistance or replication sources for maintaining the vector in one or more host cells.

In another preferred embodiment, especially in the case of Z. rouxii, the introduced sequence is inserted into a plasmid vector capable of autonomous replication in the recipient host. Any of a number of vectors can be used for this purpose.

Important factors to consider in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector can be recognized and distinguished from recipient cells that do not contain the vector; the number of vector copies required in a particular host; and whether it is desirable to "exchange" the vector between host cells of different species.

Preferred yeast plasmids are host dependent. In the case of Z. rouxii, vectors based on native latent plasmids pSR1 (E. Toh et al., J. Bacteriol. 151: 1380-1390 (1982)), pSB1, pSB2, pSB3 or pSB4 (E. Toh et al., J. Gen. Microbiol 130: 2527-2534 (1984) The plasmid pSRT303D (A. Jeampipatkul et al., Mol. Gen. Genet. 206: 88-84 (1987)) is an example of a useful plasmid vector for the yeast Zygosaccharomyces.

After the vector or DNA sequence containing the construct (s) for expression has been generated, the DNA construct (s) are introduced into an appropriate host cell by any of a variety of methods, such as transformation. Following introduction of the vector, recipient cells are cultured in a selective medium that ensures selection for growth of the vector-containing cells. The expression of one or more cloned gene sequences results in the desired protein or a fragment of this protein. Such expression can take place continuously in transformed cells or in a controlled manner, e.g., by initiating expression.

To construct hosts according to the invention that have been altered such that they can no longer express a certain gene product, site-directed mutagenesis can be performed using known techniques such as gene disruption (RS Rothstein, Meth. Enzymol. 101C: 202-211 (1983)).

IV. Production of xylitol

When recombinant arabitol-producing yeasts, preferably osmophilic yeasts, are used as hosts according to the invention, they can grow on a high osmotic pressure medium, e.g. on a medium containing 10-60% D-glucose and preferably 25% D-glucose. ("Normal" medium typically contains only 2-3% glucose. High osmotic pressure medium induces the production of D-arabitol in wild-type osmophilic yeast strains such as Z. rouxii. The culture medium for recombinant and control (wild-type) strains is analyzed by known methods, at different cultivation time intervals to determine the xylitol content Under cultivation conditions not optimized for maximum D-arabitol yield, the Z. rouxii ATCC13356 [pSRT (AX) -9] strain produces and secretes both xylitol and D-arabitol into the medium. Only D-arabitol is detected

178,040 in the culture of the control strain. The xylitol yield in the first trials [see Table 4 in Example 4] after 48 hours of cultivation was approximately 7.7 g / liter.

Xylitol can be isolated from the host medium of the invention and purified by any of the known methods. For example, US Patent No. 5,081,026, which is hereby incorporated by reference, describes the chromatographic separation of xylitol from yeast cultures. Thus, after the fermentation step, xylitol can be separated from the culture and purified using the chromatography steps described in US Patent No. 5,081,026 followed by crystallization.

Examples

Example 1. Cloning of the bacterial D-arabitol dehydrogenase gene

Klebsiella terrigena Phpl (obtained from K. Haahteli, University of Helsinki, see Haahtelai et al., Appl. Env. Microbiol. 45: 563-570 (1983)) was grown in 1 liter of LB medium (1% tryptone, 0.5% yeast extract) , 1 °% NaCl) overnight at 30 ° C. Bacterial cells (approximately 5 g) were centrifuged, washed once with TE (10 mM tris-HCl, 1 mM EDTA, pH 7.5) and resuspended in TE containing 1% sodium dodecyl sulfate and 200 pg / ml proteinase K. The suspension was incubated at 37 ° C for 30 minutes, then the paradise was extracted with an equal volume of phenol and twice with chloroform. 3M sodium acetate (1/10 vol.) And ethanol (3 vol.) Were added and the precipitated nucleic acids were centrifuged and redissolved in 5 ml Te. RNA was removed by centrifuging the solution in 25 ml of 1M NaCl overnight at 30,000 rpm in a Beckman Ti50.2 centrifuge. The resulting K. terrigen chromosomal DNA contained fragments with an average size of 50,000 base pairs (bp). The DNA was then digested with Sau3A restriction endonuclease in supplier (Boehringer) buffer at an enzyme: DNA ratio of 5U / mg until the average size of the DNA fragment was reduced to approximately 5-10 kb (as assessed by agarose gel electrophoresis). The digestion product was fractionated by electrophoresis on a block of 0.6% agarose gels with dimensions of 20 x 10 x 0.6 cm in TBE buffer (0.09 M tris-boric acid, 1 mM EDTA, pH 8.3) at 5V / cm for overnight, after which a hole in the agarose block corresponding to a fragment of about 5 kB in size was cut out, a piece of dialysis membrane was inserted into the hole and electrophoresis was continued until essentially all DNA fragments larger than 5 kB had been adsorbed on the membrane. Plasmid DNA from pUC19 (obtained from Pharmacia) was digested with restriction endonuclease BamHI and bacterial alkaline phosphatase using the buffer and reaction conditions specified by the manufacturer. The linear form of pUC19 was purified by preparative gel electrophoresis using the membrane electroelution method described above, and then ligated into a 5-15 kB fraction of Klebsiella terrigena chromosomal DNA. The ligation mixture was used to transform E. coli SCSI competent cells (obtained from Stratagene) to ampicillin resistance. Approximately 10,000 recombinant clones were obtained in this experiment. Average cells from the transformation plates were plated on the plates with minimal medium containing D-arabitol (1%) as sole carbon source. After 2 days of incubation at 37 ° C, a series of colonies were obtained. Plasmid DNA was isolated from the two (fastest growing) clones and used to re-transform E. coli strain HB101, unable to catabolize D-arabitol but capable of utilizing D-xylulose. All transformants were found to be positive for D-arabitol utilization on McConke's D-arabitol agar plates (obtained from Difco) while control clones (same pUC19 transformed strain) were negative. Restriction analysis showed that the two clones isolated contain identical plasmids. One of the two isolated plasmids (named pARL2) was used for further analysis. A restriction map of the cloned 9.5 kb (approx) K. terrigen DNA fragment in pARL2 containing the D-arabitol dehydrogenase gene is shown in Figure 1.

Example 2. Expression of the bacterial D-arabitol dehydrogenase gene in yeast

From the original 9.5 kb K. terrigen DNA clone containing the D-arabitol dehydrogenase gene, an approximately 1.8 kb Sacl-HindIII fragment was subcloned using conventional recombinant DNA techniques and found to contain the D-arabitol dehydrogenase gene.

178 040

The plasmid containing this DNA fragment in the pUC19 vector (pADH, where ADH is D-arabitol dehydrogenase) was isolated from the E. coli JM110 strain, digested with BclI and Clal restriction endonuclease, and then the 1.38 kb DNA fragment was isolated by preparative agarose gel electrophoresis . This DNA fragment was treated with the Klenow DNA-polymerase I fragment in the presence of all four deoxynucleotide triphosphates and ligated into the yeast expression vector pAAH5 (Ammerer, Meth. Enzymol. 101: 192-203 (1983)) cut with HindIII and the given Klenow fragment (Fig. 2) ). The resulting expression plasmid, pYARD, is an E. coli-Saccharomyces cerevisiae spindle vector containing replication and an ampicillin resistance gene of bacterial origin (E. coli), replication from 2 pm of DNA of yeast origin (S. cerevisiae) and the LEU2 gene for selection in yeast of yeast origin (S. cerevisiae). The expression cassette contains the yeast alcohol dehydrogenase I (ADC) promoter and a flanking transcription terminator (ADCI) operably linked to the K. terrigen D-arabitol dehydrogenase gene.

Saccharomyces cerevisiae strain GRF18 (MATa, leu-2-3,112, his3-11,15) and S. cerevisiae DBY746 (ATCC 44773; MATa, leu2-3,112, his3-Al, ura3-52 trpl-289) were used as transforming hosts with the pYARD D-arabitol dehydrogenase expression vector described above, with the same results. Transformation was performed by the standard lithium chloride procedure (Ito et al., J. Bacteriol. 153: 163-160 (1983)), using the pYARD LEU2 marker for selection of transformants. Transformants were grown on liquid medium in minimal medium: 0.67% yeast nitrogen bases ("Difco"), 2% D-glucose, 100 mg / liter histidine and tryptophan at 30 ° C overnight with shaking. Cells were centrifuged, resuspended in a minimum volume of 0.1 M sodium phosphate buffered to pH 6.8, containing 1 mM NAD + and broken with 0.5 mm glass beads in a bead beater ("Biospec products") for 6 minutes with cooling ice. D-arabitol dehydrogenase activity was determined as described above. In these experiments, an extract of K. terrigena cells grown on D-arabitol was used as positive control material, and DBY746 transformed with pAAH5 as negative control material. The results in Table 2 show that the K. terrigena secreted D-arabitol dehydrogenase gene is efficiently expressed in yeast.

Table 2

Microbial strain D-arabitol dehydrogenase activity (arbitrary units) K. terrigena Phpl 3.5 DBY746 [pYARD] 1.0 DBY746 [pAAH5] 0.00

Example 3. Construction of yeast vectors for overexpression of the genes xylitol dehydrogenase and D-arabitol dehydrogenase

The known nucleotide sequence of the yeast XYL2 gene (Pichia stipitis) encoding xylitol dehydrogenase [Kotter et al., Curr. Genet. 18: 493-500 (1990)] was used to synthesize oligonucleotides for the cloning of this gene by the polymerase chain reaction method. Two oligonucleotides: CGAATTCTAGACCACCCTAAGTCGTCCC (5'-oligonucleotide) [SEQ ID No. 1] and TTCAAGAATTCAAGAAACTCACGTGATGC (3'-oligonucleotide) [SEQ ID No. 2] was designed to insert convenient XbaI and EcoRI restriction sites onto the 5'- and 3'-ends of the PCR product. The 5'-oligonucleotide is attached at position 1-24 of XYL2 and the 3'-oligonucleotide is attached at position 1531-1560 according to the numbering used by K otter et al., Curr. Genet. 18: 493-500 (1990).

Pichia stipitis CBS6054 (Centraalbureau voor Schimmelcultures, Oosterstraat 1, PO Box 273.3740 AG Baam, The Netherlands) was grown overnight in YEPD medium (1% yeast extract, 2% peptone, 2% D-glucose), then cells were centrifuged, washed once a 1M solution of sorbitol containing 2mM EDTA, pH 7.5, 1 M solution of sorbitol, pH 7.5, was resuspended in the same solution and digested with Lysicate (Sigma). Digestion was monitored by following the optical density at 600 nm at a 1: 1000 dilution of the cell suspension in 2% SDS. Digestion was complete when this value had dropped to about 1/7 of the original value. The spheroplast suspension was then washed 4 times with 1 M sorbitol solution. Spheroplasts were lysed with 1% SDS and treated with 200 µg / ml proteinase K at 37 ° C for 30 minutes. After extracting once with phenol and twice with chloroform, the nucleic acids were precipitated with ethanol and redissolved in a small amount of TE buffer. The integrity of the chromosomal DNA was checked by agarose gel electrophoresis. The average size of the DNA fragment exceeded 50 kb. PCR was performed using Tag DNA polymerase (Boehringer) in supplier's buffer. The thermal cycle was used: 93 ° C - 30 s, 55 ° C - 30 s and 72 ° C - 60 s. The PCR product was extracted with chloroform, ethanol precipitated and digested with EcoRI and Xbal under standard conditions. After agarose gel purification, the DNA fragment was cloned into XbaI and EcoRI cleaved pUC18 (plasmid pUC (XYL2)). Subsequent restriction analysis confirmed that the restriction map of the cloned fragment corresponds to the nucleotide sequence of the XYL2 P stipitis gene.

The yeast plasmids for overexpression of D-arabitol dehydrogenase and xylitol dehydrogenase were constructed as shown in Figures 3 and 4. In order to change the restriction flanking sites of the D-arabitol dehydrogenase expression cassette in the pYARD plasmid, the entire cassette was excised using digestion with BamHI18. BamHI. The resulting plasmid pUC (YARD) was digested with SalI and EcoRI, and the 2 kb DNA fragment itself was isolated by preparative agarose gel electrophoresis. This fragment was ligated with the 1.6 kb HindIII-EcoRI DNA fragment isolated from plasmid pUC (XYL2) and the E. coli-yeast spindle vector fragment pJDB207 of

6.6 kb (J.D. Beggs, Nature 275: 104-109 (1978)) digested with HindIII and SalI. The plasmid pJDB (AX) -16 was isolated after transformation of E. coli with the above ligation mixture. This plasmid is replication competent in both E. coli and Saccharomyces cerevisiae. In S. cerevisiae, it monitors the high level of synthesis of both D-arabitol dehydrogenase and xylitol dehydrogenase. The plasmid pSRT (AX) -9 was synthesized by ligating the Salo fragment

4.7 kb from plasmid pJDB (AX) -9 and the linear form of the plasmid pSRT303D (Jeampipatkul et al., Mol. Gen. Genet. 206: 88-94 (1987)) obtained by partial hydrolysis with Sal.

Example 4. Construction of xylitol secreting yeast strains

Zygosaccharomyces rouxii ATCC 13356 was transformed with the plasmid pSRT (AX) -9 by slightly altering the previously described method (K. Ushio et al., J. Ferment. Technol. 66: 481-488 (1988)). Briefly, Z. rouxii was grown overnight in YEPD medium (obtaining a culture with an optical density of 3-5 at 600 nm), after which cells were harvested by low speed centrifugation, washed twice with 1M sorbitol solution with 1mM EDTA, pH 7.5, Resuspension in the same solution equal to 1/5 of the original culture volume containing 1% o 2-mercaptoethanol, and digestion at room temperature was performed with lysicate (Sigma). The course of the digestion was followed by taking an appropriate sample of the cell suspension which was diluted with 1% SDS solution and measuring the optical density of the diluted sample at 600 nm. When this value had dropped to 1/7 of its original value, digestion was terminated by cooling the suspension in ice and then washing it (10 minutes centrifugation at 0 ° C at 1000 rpm) with a sorbitol solution until the detectable smell of mercaptoethanol was eliminated. The spheroplasts were washed once with a cold 0.3 M solution of calcium chloride in 1 M sorbitol and resuspended in the same solution with a volume equal to 1/4 of the original culture volume. 200 μΐ samples of this suspension and 10-20 μg of plasmid DNA were mixed and incubated at 0 ° C for 40 minutes. 0.8 ml of ice-cold 50% PEG-6000 solution containing 0.3 M calcium chloride was added to the spheroplast suspension. and incubation at reduced temperature was continued for 1 hour Spheroplasts were concentrated by centrifugation at 4000 rpm for 10 minutes in a laboratory centrifuge, resuspended in 2 ml YEPD containing 1 M sorbitol and allowed to regenerate on

178,040 overnight at room temperature. Regenerated cells were seeded on YEPD plates containing 50-100pg / ml gentamicin and incubated at 30 ° C for 4-6 days.

Transformants were grown in YEPD liquid medium, and then cell extracts obtained as described for S. cerevisiae (Example 2) and the activities of D-arabitol dehydrogenase and xylitol dehydrogenase were determined. The results of these measurements were compared with similar measurements made for other organisms in Table 3. They show that both genes are efficiently expressed in Z. rouxii.

Z. rouxii ATCC 13356 cells transformed with pSRT (AX) -9 were grown for 2 days in 50 ml YEPD containing 50 pg / ml gentamicin, then harvested and used to inoculate 1000 ml YEPD containing 25 wt. D-glucose and 50 pg / ml gentamicin. The cultivation was carried out in a 100 ml flask on a rotary shaker (200 rpm) at 30 ° C. In another experiment (experiment 2) the same medium without yeast extract was used (low-phosphate medium). The xylitol content in the nutrient broth was determined by standard HPLC and gas chromatography methods. The results are given in Table 4. No xylitol was detected in the culture medium of untransformed Z. rouxii grown on the same medium (without gentamicin).

Table 3

Activities of D-arabitol dehydrogenase and xylitol dehydrogenase in various organisms and strains

Organism and strain Plasmid (*) Dehydrogenase D-arabitol (IU / mg protein) Xylitol dehydrogenase (IU / mg protein) Klebsiella terrigena Phpl - 0.48 NW (**) S. cerevisiae DBY746 - 0.00 <0.01 S. cerevisiae DBY746 pJDB (YARD) 3.0 <0.01 S. cerevisiae DBY746 pJDB (AX) -16 1.9 1.2 Z. rouxii ATCC 13356 - 0.00 <0.02 Z. rouxii ATCC 13356 pSRT (AX) -9 1.3 0.7

(*) Plasmids express the following enzymes: pJDB (YARD) - pJDB D-arabitol dehydrogenase (AX) -16 - D-arabitol dehydrogenase and pSRT xylitol dehydrogenase (AX) -9 - D-arabitol dehydrogenase and xylitol dehydrogenase (* *) NO- was not determined

Table 4

Production of xylitol by Z. rouxii ATCC 13356 containing the plasmid pSRT (AX) -9 (g / liter)

Breeding time (hours) Experience 1 medium with yeast extract Experience 2 medium without yeast extract 0 0.0 0.0 48 7.7 0.5 144 7.5 6.1

Xylitol-producing strains from other carbon sources can be constructed in a similar manner. For example, Candida tropicalis are capable of converting n-alkanes to D-arabitol (K. Hattori and T. Suzuki, Ergic. Biol. Chem. 38: 1875-1881 (1974) in good yield.

The 4.7 kb from plasmid pJDB (AX) -9 can be inserted into plasmid pCU1 (L. Haas et al., J. Bacteriol. 172: 4571-4577 (1990)) and used to transform S. topicalis SU-2 (ura3 ). The same expression cassette can also be transformed in a prototropic strain of C. tropicalis on a plasmid vector containing a dominant selective marker.

178 040

Example 5. Construction of an integrative dominant selection vector for the expression of arabitol dehydrogenase and xylitol dehydrogenase and transformation of Torulopsis candida

Chromosomal DNA was isolated from T. candida (ATCC 20214) by a method similar to the standard procedure described for S. cerevisiae. However, the production of T. candida spheroplasts requires a high concentration of Lysicate (Sigma) - about 50,000 U / 10 g of cells, and a long inhibition time - from several hours to overnight incubation at room temperature to achieve effective cell wall lysis. 1 M sorbitol containing 1 mM EDTA and 1% mercaptoethanol, pH 8 was used as buffer for preparation of spheroplasts. Spheroplasts were washed three times with the same buffer (without mercaptoethanol) and lysed in 15 ml of 1% SDS. After cell lysis, two phenol extractions were performed immediately, then DNA was precipitated by adding 2 volumes of ethanol and the mixture was centrifuged (5 minutes, 10,000 rpm). The DNA was washed twice with 70% ethanol and dried under reduced pressure. The DNA was dissolved in 5 ml of 10 mM tris-HCl buffer containing 1 mM EDTA, RNAse A was added to a concentration of 10 pg / ml and the solution was incubated for 1 hour at 37 ° C. DNA integrity was confirmed by agarose gel electrophoresis using uncleaved β-DNA as the molecular weight standard.

200 (g of T. candida chromosomal DNA was cut with HindIII and EcoRI and the digestion product was introduced into a 6 cm diameter hole in the block (8 x 15 x 0.8 cm) with 0.7% preparative agarose gel and electrophoresed separation was performed. 1 cm was excised from the gel and smeared on a positively charged nylon membrane (Boehringer 1209 299). The smear was inoculated with a 10 kb DNA fragment probe from Zygosaccharomyces bailii rDNA excised with a pAT68 plasmid Hall (K. Sugihara et al., Agric. Biol. Chem. 50 (6): 1503-151 (1986)) The probe was labeled and smears were developed using the DIG DNA Labeling and Detection Kit (Boehringer 1093 657) according to the manufacturer's instructions. 3 hybridization bands were observed corresponding to DNA fragments of approximately 4. 5, 2.7 and 1.1 kb. Using the smear as a standard, the band corresponding to the largest (4.5 kb) fragment of the hybridized DNA was cut from the rest of the preparative gel, DNA electroelution was performed, which was then ligated with pUC19 solution cut with EcoRI and HindIII.

The ligation mixture was used to transform E. coli. The transformed bacteria were plated on a charged nylon membrane (Bio-Rad 162-0164) lying on the agar surface of the plate containing LB medium and ampicillin. After incubation for 24 hours at 37 ° C, the membrane was lifted and the bacterial colonies were lysed in situ according to the manufacturer's instructions. It is necessary to replicate the plate, because E. coli penetrates through this type of membrane and when the filter is lifted, a trace of each bacterial colony is visible on the agar surface. The membrane was probed with the same Z. bailii rDNA fragment using the same DIG detection kit as before. A number of positive clones were identified (approximately 2-5% of all clones). Restriction analysis of plasmid minipreps from 8 hybridization positive and 4 hybridization negative clones using a mixture of EcoRI, HindIII and EcoRY. All the hybridization-positive clones gave identical restriction fragment patterns (with characteristic fragments of 0.55 and 1.5 kb), while the same patterns for the hybridization-negative clones were different each time. Plasmid DNA from one of the hybridization-positive clones was isolated on a preparative scale and named pTCrDNA. It was concluded that the cloned piece was a T. candida rDNA fragment as 1) it hybridizes strongly with Z. bailii rDNA and 2) is cloned from the digestion of partially enriched T. candida chromosomal DNA at high frequency (rDNA is known to be represented by approximately 100 copies in a yeast cell). The partial restriction map of the cloned DNA fragment is shown in Figure 5.

A plasmid connecting the T. candida rDNA fragment to the dominant selectable marker was constructed as follows. The plasmid pUT332 (A. Gatignol et al, Gene 91: 35-41 (1990)) was cleaved with HindIII and KpnI, then the 1.3 kb DNA fragment was isolated by agarose gel electrophoresis and ligated with the HindIII-EcoRI fragment of 4 , 5 kB from pTCrDNA and pUC19 digested with EcoRI and KpnI (Figure 6). The transformation of the mix22 was then performed

After ligation into E. coli, the clone containing the pTC plasmid (PHLE) was identified by restriction analysis.

PTC (PHLE) was partially digested with SalI and the linear form of the plasmid was purified by agarose gel electrophoresis. It was ligated to the 5 kb Sal fragment isolated from pJDB (AX) -16 (Example 2). The pTC plasmid (AX) was identified among the clones obtained after transforming the ligation mixture into E. coli (Figure 6). This plasmid contains the following functional elements:

a) a bacterial phleomycin resistance gene under the control of a yeast promoter and a transcription terminator enabling direct selection of yeast cells transformed by this plasmid;

b) a T. candida rDNA fragment which is the target of homologous recombination with the T. candida chromosome and increasing the transformation efficiency;

c) an expression cassette for the genes for arabitol dehydrogenase and xylitol dehydrogenase, ensuring the synthesis of two enzymes by arabitol-xylitol conversion.

Example 6. Transformation of T. candida and analysis of xylitol production

The pTC plasmid (AX) was used to transform Torulopsis candida strain ATCC 20214. T. candida was grown for 36 hours in YEPD medium containing 10% glucose. The cells were centrifuged (2000 rpm for 10 minutes at 4 ° C) and washed 3 times with sterile 1 M sorbitol. The cell pellet was suspended in an equal volume of cold 1 M sorbitol, then 200 μΐ samples were mixed with pUT (AX) DNA (20-100 pg) and transferred to ice-cooled electroporation cuvettes with a 2 mm electrode gap and electroporation was performed on the apparatus Invitrogen ElectroPorator with the following setting: voltage 1800 V, capacitance 50 pF, parallel resistance 150 Ω. Cells were transferred to 2ml of YEPD containing 1M sorbitol and incubated overnight at 30 ° C on a shaker. The transformed cells were centrifuged at low speed and then plated onto plates containing YEPD medium titrated to pH 7.5 and containing 30 µg / ml phleomycin. The plates were incubated at 30 ° C for 7-10 days. Most of the yeast colonies that developed during this time were background mutants as a similar number of colonies appeared on the control plates (containing cells treated similarly but without adding DNA). In order to distinguish actual transformants from spontaneous mutants, chromosomal DNA was isolated from 72 distinct yeast colonies using the scaling-down procedure used for the isolation of T. candida chromosomal DNA, described above. 10 µg of each of the preparations obtained was cut with EcoRI and BamHI. The digestion products were separated on a ¹⁰ % agarose gel and then smeared on a positively charged nylon membrane as described in Example 5. The smears were inoculated with a pADH plasmid DNA probe (Example 2) that contained arabitol dehydrogenase and pUC sequences but did not contain fragments Yeast-derived DNA (to avoid hybridization between possible homologous yeast sequences). The probe was labeled and smears were developed using the DIG DNA Labeling and Detection Kit (Boehringer 1093 657). Only one clone (T. candida: pTC (AX)) was detected with a hybridization signal compatible with the structure of the transformed plasmid (3 bands in the range of 2-3 kb), indicating a very low transformation efficiency. A positive hybridization signal was detected in one more clone, however, the site of the single hybridization band (about 5-7 kb) indicated that either only the pTC fragment (AX) had integrated into the yeast chromosome or a rearrangement occurred at the integration site. The plasmid was assumed to have integrated into the T. candida chromosome. This assumption is consistent with the observation that all T. candida :: pTC (AX) clones retain a phleomycin resistance phenotype after cultivation in a nonselective medium and cloning. T. candida :: pTC transformant (AX) was grown in YEPD medium containing 10% glucose for 36 hours, after which the arabitol dehydrogenase and xylitol dehydrogenase activities were determined as described in Example 4. The results are shown in Table 5.

178 040

Table 5

Activity of arabitol dehydrogenase and xylitol dehydrogenase in wild T. candida and in a strain transformed with pTC (AX) (IU / mg protein)

T. candida Arabitol dehydrogenase Xylitol dehydrogenase Wild type 0.02 0.03 Transformant 0.03 0.05

The xylitol dehydrogenase activity was not significantly increased compared to the endogenous T. candida xylitol dehydrogenase activity level. The activity of the plasmid-encoded arabitol dehydrogenase (EC 1.1.1.11) was difficult to distinguish from the endogenous activity of synonymous but distinct arabitol dehydrogenase (ribulose producing, EC 1.1.1). The only firm conclusion from this experiment is that the expression level for both enzymes was significantly lower than in Z. rouxii. Attempts to increase the number of plasmid copies and the expression level of the two dehydrogenases by the integrated plasmid by culturing T. candida :: pTC (AX) on a medium with increased phleomycin concentration did not give positive results.

The production of xylitol by T. candida :: pTC (AX) was tested after culturing in YEPD medium containing 10% glucose for 5-7 days. In three separate experiments the transformant produced 1.1, 1.6 and 0.9 g xylitol / liter, while no xylitol was detected by HPLC in wild T. candida culture medium. The detection limit of the adopted method of analysis is below 0.1 g / liter-. Therefore, it can be concluded that the xylitol production by T. candida :: pTC (AX) is determined by the plasmid.

Example 7. Transformation of Candida polymorpha with arabitol dehydrogenase and xylitol dehydrogenase genes

In order to introduce the genes of arabitol dehydrogenase and xylitol dehydrogenase into Candida polymorpha, a mutant of the orotidine phosphate decarboxylase gene (hereinafter abbreviated to URA3) was isolated using a modified method of Boeke et al. (JD Boeke et al., Mol. Gen. Genet. 197: 345-346 ( 1984)). C. polymorpha ATCC 20213 strain was grown for 24 hours on YEPD, the cells were centrifuged (2000 rpm, 10 minutes), washed twice with water and resuspended in 3 volumes of sterile 0.1 M sodium phosphate buffer, pH 7.0. Ethyl methanesulfonate was added to a concentration of 1% and cells were incubated for 2 hours at room temperature. The reaction was stopped by transferring the cells to 0.1 M sodium thiosulfate solution and washing them three times with sterile water. Mutagenized cells were transferred to 0.5 liter YEPD and grown at 30 ° C with shaking for 2 days. The yeast was centrifuged, washed twice with water, and transferred to 1 liter of medium containing 0.7% yeast nitrogen bases (Difco), 2% glucose (SC medium) followed by incubation on a rotary shaker for 24 hours at 30 ° C. 1 mg of nystatin was added to the culture and incubation continued for 4 hours. Nystatin-treated cells were separated from the medium by centrifugation, washed twice with water and transferred to 1 liter of SC medium containing 50 mg uracil / liter. The cells were incubated on a rotary shaker for 5 days and then plated on SC medium plates containing 50 mg / L uracil and 1 g / L fluoroorotic acid. After incubating the plates for 2 weeks at 30 ° C, approximately 400 fluoroorotinic acid resistant colonies were obtained, and all of them were tested for uracil auxotropy. 5 uracil-dependent clones were isolated. However, 3 clones also grew on uracil-free medium, albeit at a reduced rate. Two clones (named C. polymorpha U-2 and C. polymorpha U-5) showing a clear uracil dependency phenotype were used in the transformation experiments.

The cloning of the C. polymorpha URA3 gene was performed using a conventional strategy. Chromosomal DNA was isolated as described in Example 5. dNa was partially cut with Sau3A and fractionated on an agarose gel. A number was collected

178,040 fractions and their particle size distributions were determined by analytical gel electrophoresis. Fractions of 5-10 kb were used in the cloning experiments. The vector used for library construction, pYEpl3 (Broach et al. Gene 8: 121-133 (1979)) contained the S. cerevisiae LEU2 gene, 2p replication-derived and a unique restriction site for BamHI. The vector was cleaved with BamHI, purified by agarose gel electrophoresis, and dephosphorylated with bacterial alkaline phosphatase. A number of independent vector preparations were tested by varying the ligation conditions (vector to insert ratio and reaction volume) in small-scale experiments in order to optimize for the highest number of transformants and the highest percentage of recombinant clones (analyzed by restriction analysis of plasmid minipreps from random clones) . Large scale ligation under optimized conditions was performed, followed by transformation into the E. coliXLl-BLUE strain. The constructed library contained approximately 15,000 primary transformants, approximately 90% of which contained inserts.

The transformation of the yeast strain DBY746 (MATa, leu2-3,112, his3-Al, trp 1-289, ura3-52) was performed with the C. polymoroha gene library. Each library set was transformed separately into S. cerevisiae using about 20 pg of plasmid DNA and post-transformation streaked in one plate supplemented with uracil, tryptophan and histidine (e.g. using only leucine selection). 3,000-10,000 yeast transformants were obtained on each plate. Then, replica yeast transformants were streaked on the plates with minimal medium supplemented with tryptophan and histidine (plates minus uracil). Control replicas were made on histidine and histidine minus uracil plates. Control replicas were also made on histidine-minus and tryptophan-minus plates. From one to 4 uracil-independent clones were present on nearly every plate. Histidine-independent and tryptophan-independent isolates were also obtained, but the number of such isolates was 2-3 times smaller than in the case of URA3 isolates.

Plasmids from 6 uracil-independent clones were released in E. coli, isolated on a preparative scale and used to transform DBY746 into leucine prototrophy. 10-20 random colonies from each transformation were then checked for the dependence on uracil. Five of the six plasmids released transformed DBY746 to the Leu + Ura ⁺ phenotype. Restriction analysis of the five plasmids mentioned confirmed the existence of very similar restriction patterns. These patterns were too complex to make an unambiguous restriction map of the cloned fragment. However, it was found that digestion with HinaIΠ resulted in the secretion in all clones of a fragment covering the majority of the DNA insert (approximately 4.5 kb). Such a fragment from one of the C. pslymsrpha isolates, pCP291, was purified by agarose gel electrophoresis and subcloned into pJDB (AX) partially digested with HindIII. The structure of the pCPU (AX) plasmid isolated from this cloning experiment is shown in Figure 7A.Z.

Attempts were made to transform both C. oolymorohα U-2 and C. polymoiOha U-5 under the same electroporation conditions as in Example 6. Electroporated cells after shaking overnight in YEPD containing 1 M sorbitol were plated on SC medium plates. After incubation for 10 days at 30 ° C, approximately 100 colonies were observed in the plate containing the C. po. Mo U-5 transformed with: pCPU (AX); while the number of colonies on the control plate (containing cells of the same strain treated in a similar way but without adding DNA) was only 14. In the case of C. pol ^ o ^ ha U-5 no significant effect was found in the transformation experiment compared to the control plate (without GOUT). Three random clones from the C. polymorpha U-2 transformed plate were first smeared on a fresh SC medium plate and these smears were used to inoculate 100 ml of YEPD medium containing 15% glucose. Control cultures were inoculated with C. polymorohα U-2. After incubation on a rotary shaker (200 rpm) at 30 ° C for 10 days, the xylitol content in the culture medium was determined by HPLC. The results of the experiment are presented in Table 6.

178 040

Table a 6

Production of xylitol by C. polymorpha transformed with pCPU (AX)

Strain Xylitol (mg / ml) C. polymorpha U-2 0.0 C. polymorpha:: pCPU (AX) -1 0.5 C. polymorpha:: pCPTJ (AX) -2 0.0 C. polymorpha:: pCPU (AX) -3 2.1

Significant variations in the level of xylitol produced by different clones were observed. This may be due to the integration of the pCPU (AX) plasmid at different loci of the C. polymorpha chromosome. C. polymorpha strain:: pCPU (AX) -2 is probably a revertant and not a true transformant. However, these experiments clearly show that the arabitol-xylitol conversion pathway can also be incorporated into C. polymorpha.

Example 8. Cloning of enzymes of the oxidative pentose-phosphate pathway and their overexpression in osmophilic yeast

The first enzyme of the oxidative pentose-phosphate pathway, D-glucose 6-phosphate dehydrogenase, is encoded in S. cerevisiae by the ZWF1 gene. The sequence of this gene is known (T. Nogae and M. Johnston, Gene 96: 161-19 (1990); D. Thomas et al., The EMBO J. 10: 547-553 (1991)). The gene encompassing the complete coding region, the 5'-non-coding region of 600 bp and the 3'-non-coding region of 450 bp was cloned by PCR using two oligonucleotides: CAGGCCGTCGACAAGGATCTCGTCTC (5'-oligonucleotide) [SEQ ID No. 3] and AATTAGTCGACCGTTAATTGGGGCCACTGAGGC (3'-oligonucleotide) [SEQ ID No. 4], the 5'-oligonucleotide anneals at positions 982-1007 and the 3'-oligonucleotide at positions 3523-3555 according to the numbering of D-glucose 6-phosphate dehydrogenase given by T. Noage and M. Johnston, Gene 96 : 161-19 (1990). Chromosomal DNA was isolated from the S. cerevisiae GRF18 strain using the method described in Example 3. The PCR parameters were the same as in Example 3. The amplified DNA fragment containing the ZWF1 gene was digested with SalI and cloned into pUC 19 digested with the same restriction, yielding the plasmid pUC (ZWF) . The identity of the cloned gene was confirmed by restriction analysis.

The second enzyme of the pentose-phosphate pathway, 6-phosphogluconic acid dehydrogenase, is encoded in E. coli by the gnd gene. The nucleotide sequence of this gene is known (M.S. Nasoff et al., Gene 27: 253-264 (1984)). For the cloning of the gnd gene from E. coli, chromosomal DNA was isolated from the E. coli HB101 strain by a method identical to that used for isolating Klebsiella terrigena DNA (Example 1). Oligonucleotides (GCGAAGCTTAAAAATGTCCAAGCAACAGATCGGCG [SEQ ID No 5] and GCGAAGCTTAGATTAATCCAGCCATTCGGTATGG [SEQ ID No 6]) for PCR amplification of the gnd gene are designed to amplify only the coding region and directly upstream of the HindIII coding site and immediately upstream of the coding initiation site. The 5'-oligonucleotide is attached at positions 56-78 and the 3'-oligonucleotide is attached at positions 1442-1468 according to the 6-phosphogluconic acid dehydrogenase numbering given by M.S. Nasoff et al. Gene 27: 253-264 (1984). The amplified DNA fragment was digested with HindIII and ligated into the HindIII digested pUC19 vector. 10 independent, apparently identical clones of the resulting plasmid pUC (gnd) were pooled. This was done to avoid possible problems with sequence errors that might have been introduced during PCR amplification. The coding region of the gnd gene was fused with the S. cerevisiae ADCI promoter and the transcription terminator by transferring the 1.4 kb HindIII fragment from the pUC (gnd) set into the pAAH5 expression vector (G. Ammerer, Meth. Enzymol. 101C: 192-203 (1983) ). A series of independent clones of the resulting plasmid pAAH (gnd) were transformed into the S. cerevisiae GRF18 strain according to the lithium chloride procedure (Ito et al., J. Bacteriol. 153: 163-168 (1983)) and the activity of 6-phospho-D dehydrogenase was determined in transformants. -gluconate. In all transformants

The activity of 6-phospho-D-gluconate dehydrogenase is several times higher than that of the untransformed host, indicating that bacterial 6-phospho-D-gluconate dehydrogenase can be efficiently expressed in yeast. The clone pAAH (gnd) was selected for further construction, ensuring the highest activity in yeast. The cloning of the ZWF1 and gnd genes and the construction of the pAAH (gnd) plasmid are shown in Figures 8 and 8a.

Plasmid pSRT (ZG) was constructed in an osmophilic yeast host to overexpress both glucose-6-phosphate dehydrogenase and 6-phospho-D-gluconate dehydrogenase genes simultaneously. The method of plasmid construction is shown in Fig. 9. Briefly, the expression cassette of 6-phospho-D-gluconate dehydrogenase from plasmid pAAH (gnd) was transferred as a 3.1 kb BamHI DNA fragment to uUC19 cleaved with BamHI. The resulting plasmid pUC (ADHgnd) was cleaved with SacI and XbaI, then a fragment. 3.1 kb DNA was purified by agarose gel electrophoresis. This fragment was ligated simultaneously with two other DNA fragments: the 2.5 kb pUC (ZWF) fragment obtained by digestion with SacI and partial digestion with PstI, and the vector fragment of the plasmid pSRT (AX) -9 (Example 3 ) digested with PstI and XbaI. The structure of the obtained pSRT (ZG) plasmid was confirmed by restriction analysis. After transforming Z. rouxii ATCC 13356 with pSRT (ZG) (as described in Example 4), the activity of D-glucose-6-phosphate dehydrogenase and 6-phospho-D-gluconate dehydrogenase was determined in the transformed strain. Both enzymes show approximately 20 times higher activities in the transformed strain than in the untransformed control strain (Table 7). Similar methods can be used to overexpress two genes encoding enzymes in the oxidative part of the pentose-phosphate pathway in other yeast species. However, since vectors that can be maintained as extra-chromosomal plasmids in most yeast species except Saccharomyces or Zygosaccharomyces are lacking, integrative transformation is the only useful method for such hosts. Preferred integrating vectors are vectors intended for integration into the ribosomal DNA locus, as vectors of this type provide a large number of integrative copies and hence a high level of expression (T.S. Lopes et al., Gene 79: 199-206 (1989)).

Table 7

Activity of D-glucose-6-phosphate dehydrogenase and 6-phospho-D-gluconate dehydrogenase in Z. rouxii ATCC 13356 transformed with pSRT (ZG) and in the non-transformed control strain (pmole / minute * mg protein)

Yeast strain Dehydrogenase D-glucose-6-P Dehydrogenase 6-β-gluconate Z. rouxii (untransformed) 0.33 0.45 Z. rouxii [pSRT (ZG)] 7.3 7.7

Example 9. Construction of transketolase mutants in yeast

Transketolase mutants in yeast are most conveniently obtained by site-directed gene disruption, although known chemical mutagenesis methods can also be used. In order to use the gene disruption technique, it is usually necessary to use a homologous transketolase gene cloned from the yeast species where mutation is desired, although sometimes a heterologous clone from very closely related species can also be used. The sequence of the S. cerevisiae transketolase gene is known (T.S. Fletcher and I.L. Kwee, EMBL DNA Sequence Library, ID: SCTRANSK, available under No. M63302). Using this sequence, the S. cerevisiae transketolase gene was cloned by PCR. Oligonucleotides AGCTCTAGAAATGACTCAATTCACTGACATTGATAAGCTAGCCG [SEQ. ID No 7] and GGAGAATTCAGCTTGTCACCCTTATAGAATCGAATGGTCTTTTG [SEQ ID No 8] and chromosomal DNA from S. cerevisiae (isolated as described above) were used to amplify a DNA fragment containing the transketolase gene. The 5'-oligonucleotide is attached

178,040 at position 269-304 and the 3'-oligonucleotide is attached at position 2271-2305 as indicated for transketolase (T.S. Fletcher and I.L. Kwee, EMBL DNA sequence library, ID: SCTRANSK, available under No. M63302). The fragment was digested with XbaI and EcoRI and cloning was performed in pUC19 cleaved with the same enzymes. Restriction analysis of the obtained pUC (TKT) plasmid confirmed the identity of the cloned DNA fragment. This plasmid was cut with BgIII and ClaI and the large DNA fragment was purified by agarose gel electrophoresis. This fragment was ligated with two DNA fragments isolated from plasmid pUT332 (A. Gatiniol et al., Gene 91: 35-41 (1990)): the C11I-PstI fragment containing the URA3 gene and the 3'part of the bleomycin resistance gene, and the BamHI-PstI fragment. DNA containing the yeast TEF1 (transcriptional extension factor 1) promoter and the 5 'portion of the sequence encoding the bleomycin resistance gene. After transforming E. coli with the above ligation mixture and restriction analysis of the plasmid clones, the pTKT plasmid (BLURA) was isolated. This plasmid contains the coding sequence of the S. cerevisiae transketolase gene in which the 90 kb fragment between sites ClaI and BgIII was replaced with a pUT332 fragment containing two markers distinguishable in S. cerevisiae - the URA3 gene and the bleomycin resistance gene under the control of the TEF 1 promoter and the transcription terminator CYC 1. The plasmid was used to transform S. cerevisiae DBY746 (ATCC 44773; MATahis3Al leu2-2,112, ura3-52 trpl-289) to phleomycin resistance (10 pg / ml phleomycin in YEPD medium) by the lithium chloride method (Ito and others, J. Bacteriol. 153: 163-168 (1983)). Transformants were tested for uracil prototropy and growth ability on D-xylulose. Five URA3 clones, 3 of which showed reduced growth on D-xylulose, were grown in 100 ml of media, after which cell extracts were prepared by shaking with glass beads, and transketolase activity was determined in crude extracts. The assay was performed in 0.1 M glycyl glycine pH 7.6 buffer containing 3 mM magnesium chloride, 0.1 mM thiamine pyrophosphate, 0.25 mM NADh and 0.2 mg / ml bovine serum albumin. Immediately before the measurement, 3 µl of a solution containing 0.5 M D-xylulose 5-phosphate and 0.5 M ribose 5-phosphate was added to 1 ml of the above buffer, followed by 7.5 U triose phosphate isomerase and 1.5 U α- dehydrogenase. glycophosphate (both from Sigma). The reaction was initiated by the addition of an appropriate sample of the crude extract and monitored by recording the decrease in optical density at 340 nm. The cell extract of the DBY746 strain was used as a control sample. The transketolase activity in the crude extract of DBY746 and in the two transformants grown undisturbed on D-xylulose could be readily measured to give about 0.25 U / mg protein. The three transformants with impaired growth on D-xylulose showed a transketolase activity below the detection limit of the method used (at least 20 times less than that of the wild-type strain). The activities of D-glucose 6-phosphate dehydrogenase and 6-phospho-D-gluconate dehydrogenase were also determined in order to check whether enzyme inactivation occurred in the preparation of cell extracts. The activities of these two enzymes were very similar in all six strains. Therefore, it was concluded that the three poorly growing clones on D-xylulose contain a mutation of the transketolase gene. The growth of the strains with the disrupted transketolase gene was also slightly inhibited in a synthetic medium lacking aromatic amino acids, phenylalanine and tyrosine, although in this case the effect was less than the effect of the mutation on D-xylulose utilization.

Transketolase genes from other yeast species may conveniently be cloned by complementing the transketolase mutation in the S. cerevisiae strains described above. Preferably, cloning can be performed by constructing a gene library of a yeast strain not belonging to Saccharomyces in a suitable vector (e.g., in the well-known plasmid YEpl3), transforming this library into a S. cerevisiae strain containing the transketolase mutation (e.g. into mutants obtained by gene disruption as described) above) and selecting for reconstituted growth on D-xylulose. Plasmid DNA can be released from such D-xylulose positive transformants and used to transform the same recipient strain. All clones from this transformation should thrive on D-xylulose. Transketolase activity and its recurrence can be determined in transformants

178,040 may serve, to a considerable extent, as confirmation of the identity of the cloned gene. Additional and final confirmation can be obtained by sequencing short sections of the cloned DNA and finding sequence fragments homologous to the S. cerevisiae transsketolase sequence or by demonstrating hybridization of the cloned DNA fragment to an authentic S. cerevisiae transketolase clone. The cloning procedure can also be based on DNA hybridization as the primary method for selecting clones containing the transketolase gene from a non-Saccharomyces yeast gene library. A fragment of the S. cerevisiae transketolase gene can be used as a probe in a colony or plaque hybridization experiment, and clones showing a strong hybridization signal can be further analyzed by performing partial sequencing.

Due to the method used to clone the transketolase gene from selected yeast species, the next step in obtaining a transketolase mutation in this yeast is the same. The cloned DNA fragment should be characterized by making a partial restriction map and preferably by locating the coding region in the transketolase gene. Then, a piece of DNA that may act as a selectable marker in the selected yeast is inserted into the DNA fragment containing the transketolase gene, no closer than a few hundred bp from either end of that fragment. A cassette containing the bacterial phleomycin gene under the control of a strong yeast promoter, such as the above-described pUT332 plasmid cassette, can e.g. be used as a dominant selective marker in many yeast species. It is essential that the insertion of the DNA fragment containing the selectable marker is made in such a way that the transketolase gene coding region is either broken down by the inserted DNA or preferably that the inserted DNA fragment replaces (part of) the coding region. This DNA construct can then be used to break down a chromosomal copy of the transketolase gene in selected yeasts by a method similar to the method described above for producing a transketolase mutation in S. cerevisiae. Any suitable transformation method may be used, with preferred methods being protoplast transformation and electroporation. Selection of clones containing the disrupted transketolase gene can be performed in a similar manner to that described above for S. cerevisiae. In addition, analysis of the structure of the chromosomal region of the transketolase by Southern hybridization can be used as a variant method or in addition to other methods.

Example 10. Cloning of the D-ribulokinase gene

The preferred method of cloning the D-ribulokinase gene is similar to the method described in Example 1 for the cloning of D-arabitol dehydrogenase. It is known that the D-ribulokinase gene in a number of bacteria such as E. coli or Klebsiella aerogenes is part of the ribitol utilization operon (T. Loviny et al., Biochem. J. 230: 579-585 (1985)). Moreover, it is known that E. coli B strains do not contain this operon and are therefore incapable of using ribitol as a carbon source. Accordingly, an E. coli B strain (such as the conventional laboratory strains HB101 and JM 103 and strains that can be transformed with high yields such as SCS-1 or XL1-Blue from Stratagene) can be transformed with a gene library of bacteria using ribitol, constructed in any suitable vector, preferably in pUC19. Non-pathogenic bacterial species such as Klebsiella terrigena are a preferred organism source for secreting the D-ribulokinase gene. E. coli transformants that are capable of growing on minimal medium containing ribitol as sole carbon source can then be selected. Plasmid DNA from such ribitol positive clones can then be isolated and used to re-transform the E. coli B strain. All transformants after this re-transformation should be capable of growing on ribitol as sole carbon source. Then, a restriction map of the cloned insert can be made. Using such a map, various deletion derivatives of the starting clone can be prepared and analyzed for the behavior of the ribitol operon by performing the above-described performance test. A series of consecutive deletions can be made to reduce the size of the DNA fragment carrying the ribitol operon to 3.5-4 kb (operon size in K. aerogenes). Finally, the (partial) nucleotide sequence of the D-ribulokinase gene can be determined and used

178,040 to excise the coding region of that gene using appropriate naturally occurring restriction sites or using known PCR techniques to introduce such sites. Expression of the D-ribulokinase gene in other hosts, preferably in yeast, may be performed by methods including standard steps such as fusing the coding region of the D-ribulokinase gene with an appropriate promoter and transcription terminator, transfer of the expression cassette into a vector suitable for transformation in the host of choice, production of transformants and finally checking the efficiency of D-ribulokinase expression.

Example 11. Cloning and overexpression of the D-ribulose-5-phosphate-3-epimerase gene

A method for isolating homogeneous D-ribulose-5-phosphate-3-epimerase from baker's yeast (Saccharomyces cerevisiae industrial yeast) is known (W.T. Williamson et al., Met. Enzymol. 9: 605-608 (1966)). The enzyme can be isolated, and its N-terminal and partially internal amino acid sequences can be determined by generally known methods. These obtained partial amino acid sequences can then be used to generate a method termed reverse translation of oligonucleotide sequences, which can then be used to initiate a polymerase chain reaction. PCR-generated DNA fragments can be used as hybridization probes to select a yeast gene library for full-length copies of the D-ribulose-5-phosphate-3-epimerase gene. A preferred method of overexpressing the D-ribulose-5-phosphate-3-epimerase gene in other yeast hosts is to clone it in a vector that contains a large number of copies in the desired host (e.g. in the pSRT303D vector in the case of Z. rouxii). Another and more efficient way to perform overexpression is to establish at least a partial nucleotide sequence of the D-ribulose-5-phosphate-3-epimerase gene around the translation start codon and use this information to isolate the D-ribulose-5-phosphate-3-epimerase gene coding sequence. and fusing it with a promoter known to function efficiently in the host of choice.

Example 12. Cloning of the D-xylulokinase gene and construction of D-xylulokinase mutants

Methods for cloning D-xylulokinase (EC 2.7.1.17) from different yeast species have been described (NWY Ho et al., Enzyme Microbiol. Technol. 11: 417-421 (1989); PE Stevis et al., Applied and Environmental Microbiol. 53: 2975. -2977 (1978). A method for constructing a D-xylulokinase mutation in S. cerevisiae by gene disruption is also described (PE Stevis et al., Appl. Biochem. Biotechnol. 20: 327-334 (1989)). Similar methods can be used to construct mutants. D-xylulokinase in other yeasts In the case of yeast species other than S. cerevisiae, the genetic markers used to disrupt the D-xylulokinase gene are preferably the dominant antibiotic resistance markers (see example 9). Classic methods of constructing mutants based on chemical mutagenesis can also be used ( e.g. treatment with ethyl methanesulfonate or acryflavine) or physical (ultraviolet rays, X-rays) Enrichment with the mutant can be achieved by growing cells mutagenized on D-xylulose as the only carbon source in the presence of an antibiotic (such as nystatin) that only kills growing cells. The inability of D-xylulokinase mutants to utilize D-xylulose as the sole carbon source for growth can be exploited for mutant selection.

Example 13. Strains Producing Xylitol With D-arabitol With Increased Yield

Example 4 describes the construction of a yeast strain capable of producing xylitol from a structurally unrelated carbon source such as D-glucose according to a pathway in which D-arabitol is used as the primary intermediate. In order to increase the xylitol yield in fermentations involving a strain using this "D-arabitol pathway", the yield of D-arabitol should be increased. The conversion pathway from D-glucose to D-arabitol in yeasts producing D-arabitol has been described (J.M. Ingram et al., J. Bacteriol. 89: 1186-1194 (1965)). D-arabitol is produced from D-ribulose 5-phosphate by dephosphorylation and reduction of D-ribulose reductase linked to NADPH. Formation of D-ribulose 5-phosphate from D-glucose 6-phosphate by two consecutive irreversible dehydrogenation steps involving D-glucose 6-phosphate dehydrogenase

178 040 and 6-phospho-D-gluconate dehydrogenase is a common pathway of metabolism referred to as the oxidation branch of the pentose-phosphate pathway (or hexose monophosphate bypass). In the non-oxidative branch of the pentose-phosphate transformation, D-ribulose 5-phosphate is reversibly isomerated to D-ribose 5-phosphate and D-xylulose 5-phosphate. D-ribose 5-phosphate and D-xylulose 5-phosphate are then metabolized by transketolase. Therefore, a transketolase mutation can be performed in the microbial strain producing D-arabitol, which will increase the efficiency of conversion of D-ribulose 5-phosphate to D-arabitol. Example 9 describes the production of transketolase mutants. A further increase in the yield of D-arabitol can be achieved when the rate of D-ribulose 5-phosphate biosynthesis is maximized by overexpression of the two genes encoding the enzymes of the oxidative branch of the pentose-phosphate pathway as described above (Example 8). The transformation of the strains optimized in this way for the yield of D-arabitol can then be carried out with recombinant DNA sequences carrying the genes of xylitol dehydrogenase and D-arabitol dehydrogenase (Examples 3 and 4) to obtain a strain with increased xylitol production yield.

Example 14. Xylitol producing strains by other pathways

The methods shown in Examples 4 and 13 are the simplest methods for constructing microbial strains capable of converting D-glucose and other carbon sources to xylitol. These methods use the natural pathway to form D-arabitol from various carbon sources and extend this pathway by two reactions for converting D-arabitol to xylitol. However, this path is not the only path to change. Other pathways leading to xylitol as the end product of the metabolism may also be constructed, not including D-arabitol as an intermediate. Thus, the conversion to xylitol from the same precursor, D-ribulose 5-phosphate, can be carried out in different reaction chains. D-ribulose 5-phosphate can be efficiently converted to D-xylulose 5-phosphate using D-ribulose-5-phosphate-3-epimerase (Example 11), and if further conversion of D-xylulose 5-phosphate is prevented by mutating the transketolase gene , accumulated D-xylulose 5-phosphate can be dephosphorylated by the same non-specific phosphatase as D-ribulose 5-phosphate (MJ Ingram et al., J. Bacteriol. 89: 1186-1194 (1965)) and reduced to xylitol by xylitol dehydrogenase ( example 3). The implementation of this pathway may additionally require deactivation of the D-xylulokinase gene (Example 12) to reduce the energy loss associated with the sterile loop of D-xylulose phosphate -> D -> - xylulose D-xylulose 5-phosphate. Additional genetic alteration - the introduction and (over) expression of the D-ribokinase gene (EC 2.7.1.47) may minimize the simultaneous production of D-arabitol by such strains by binding D-ribulose produced by non-specific phosphatase. D-ribulose can be converted back to D-ribulose phosphate and then to D-xylulose 5-phosphate.

Example 15. Stability of the recombinant Z. rouxii strain and xylitol production under fermentation conditions

The stability of xylitol production during long-term cultivation was checked both under selective conditions (using a selective medium: YEPD containing 50 mg / liter G418 and 30% glucose) and under non-selective conditions (using the same medium but without G418). A single freshly prepared transformant of Z. rouxii ATCC 13356 [pSRT (AX) -9] was grown in 200 ml of YEPD containing G418. Cells were transferred to 50% glycerin solution and frozen in 1 ml aliquots at -70 ° C. 4 frozen samples of Z. rouxii [pSRT (AX) -9] were used to inoculate two 50 ml cultures with selective medium and two with non-selective medium. After the cultures had reached a stationary growth phase (50-60 hours at 30 ° C and 200 rpm), samples were taken for the determination of pentitol content by HPLC and 1 ml of the culture was used to inoculate another 50 ml of the same (selective or non-selective) medium. The growth / dilution cycle was repeated 4 more times. The conditions in this experiment approximated the development of the recombinant strain from standard frozen inoculum in a large scale fermentor. The results of this experiment are shown in Table 8. As expected, the stability of the recombinant strain is higher in a selective medium. However, even on a non-selective medium, the decrease in xylitol yield could only be detected after about 20 generations. Under selective conditions, xylitol production was stable for about 30 generations.

A sample of the frozen base preparation of the transformed Z. rouxii strain was used to inoculate a 2-liter fermenter containing 1 liter of medium with the following composition (per liter): 0.1 g NaCl, 6.8 g potassium phosphate, 0.5 g ammonium sulfate, 20 g yeast extract and glucose 400 g, G481 50 mg, pH 6.0. The cultivation conditions were as follows: aeration rate of 0.5 v / min, stirring 400 rpm, temperature 30 ° C.

Figure 10 shows the course of glucose consumption and xylitol accumulation as a function of fermentation time. The dissolved oxygen concentration is also shown reflecting the respiratory capacity of the yeast culture. An apparently two-phase increase has been observed: in the first phase, after about 40 hours, a plateau of glucose and xylitol is reached (less than half of the glucose is consumed at this point), while the second phase is observed after about 200 hours, when the processes of glucose consumption and xylitol production equalize out. The final xylitol concentration was 15 g / liter, almost twice as high as the flask fermentation concentrations. Biphasic growth with a significant induction period indicates that a spontaneous mutant (possibly showing a higher alcohol tolerance than the parent strain) was selected. To test this hypothesis, a single clone was isolated from the culture at the end point of the fermentor operation. This isolate was grown in a fermentor under the same conditions as described above. The results of this experiment (Fig. 11) confirmed that, in fact, a mutant capable of fully assimilating 400 g / liter of glucose in about 60 hours was isolated. This experiment also showed that the xylitol-producing Z. rouxii strain can also uptake xylitol when all the glucose in the culture medium has been consumed.

Table 8

The stability of xylitol production by the strain Z. rouxii ATCC 13356 [pSRT (AX) -9] under serial culture conditions (g / liter, normalized with respect to the total pentitol yield)

Breeding conditions Another dilution No. Kennel no selective non-selective 1 1 8.3 8.6 2 8.9 8.6 2 1 8.9 8.9 2 8.5 8.4 3 1 8.5 8.3 2 8.6 8.2 4 1 8.7 8.0 2 8.6 6.9 5 1 8.6 7.6 2 8.1 5.6 6 1 7.0 7.0 2 6.9 2.4

All references are included as a reference. Upon reading the complete description of the invention, it will be understood by those skilled in the art that its scope may be practiced over a wide equivalent range of concentrations, parameters, etc. without departing from the scope of the invention or any embodiments thereof.

178 040

Summary of sequences (1) General information (i) Applicant

Anu M. Harkki Andrey N. Myasnikov Juha H.A. Apajalahti Ossi A. Pastinen (ii) Title of the invention: Method for producing xylitol (iii) Number of sequences: 8 (iv) Address for correspondence:

(A) Recipient:

(B) Street:

(C) City:

(D) Condition:

(E) Country:

(f) Postal code (ZIP):

(v) Computer readable form:

(A): Media type: floppy disk (B) Computer: IBM compatible (c) Operating system: PC-DOS / MS-DOS (D) Software: PatentIn Release # 1.0, version # 1.25 (vi) Data for the current of filing (A) Filing number: PCT (to be granted) (B) Filing date: simultaneously (C) Classification (vi) Previous filing details:

(A) Filing number: US 08/110 672 (B) Filing date: August 24, 1993 (vi) Previous filing details:

(A) Filing number: US 07/973 325 (b) Filing date: November 5, 1992 (viii) Information about the attorney / attorney (A) Name (B): Registration number (C) The attorney's case number (ix) Information about connectivity:

(A) Telephone:

(B) Fax:

(2) Information on sequence n ° 1 (i) Characteristics of the sequence:

(A) Length: 28 base pairs (B) Type: Nucleic acid (C) Strandedness: Neutral (D) Topology: Neutral (xi) Sequence Description: SEQ ID No. 1:

CGAATTCTAG ACCACCCTAA GTCGTCCC

178 040 (2) Information on sequence n ° 2 (i) Sequence characteristics:

(A) Length: 29 base pairs (B) Type: nucleic acid (C) Strandedness: neutral (D) Topology: neutral (xi) Sequence description: SEQ ID No. 2:

TTCAAGAATT CAAGAAACTC ACGTGATGC (2) Information on sequence n ° 3 (i) Sequence characteristics:

(A) Length: 26 base pairs (B) Type: Nucleic acid (C) Strandedness: Neutral (D) Topology: Neutral (xi) Sequence Description: SEQ ID No. 3:

CAGGCCGTCG ACAAGGATCT CGTCTC (2) Information on sequence # 4 (i) Sequence characteristics:

(A) Length: 33 base pairs (B) Type: nucleic acid (C) Stranded: neutral (D) Topology: neutral (xi) Sequence description: SEQ ID No. 4:

AATTAGTCGA CCGTTAATTG GGGCCACTGA GGC (2) Information on sequence n ° 5 (i) Sequence characteristics:

(A) Length: 35 base pairs (B) Type: nucleic acid (C) Stranded: neutral (D) Topology: neutral (xi) Sequence description: SEQ ID No. 5:

GCGAAGCTTA AAAATGTCCA AGCAACAGAT CGGCG 35 (2) Sequence information # 6 (i) Sequence characteristics:

(A) Length: 34 base pairs (B) Type: nucleic acid (C) Stranded: neutral (D) Topology: neutral (xi) Sequence description: SEQ ID No. 6:

GCGAAGCTTA GATTAATCCA GCCATTCGGT ATGG (2) Sequence information # 7 (i) Sequence characteristics:

(A) Length: 44 base pairs (B) Type: nucleic acid (C) Strand: neutral (D) Topology: neutral

178 040 (xi) Sequence Description: SEQ ID No. 7:

AGCTCTAGAA ATGACTCAAT TCACTGACAT TGATAAGCTA GCCG 44 (2) Sequence information # 8 (i) Sequence characteristics:

(A) Length: 44 base pairs (B) Type: Nucleic acid (C) Strandedness: Neutral (D) Topology: Neutral (xi) Sequence Description: SEQ ID No. 8:

GGAGAATTCA GCTTGTCACC CTTATAGAAT CGAATGGTCT TTTG 44

- bacterial sequences O transcription terminator

Λ / γη 2μ ^{ADC 1} DNA and ^{ADC 1} promoter II LEU 2 gene

1¾aen arabitol dehydrogenase

FIG. 2

178 040

Μ

Ο

4J • Η • ο ϋ

m ο

LU

<0 · Η C · π -η υ

178 040

FIG. .4

178 040

EcoRI SacI Smal Apal Xbal Scal

HindIII

FIG. 5 kb

178 040

178,040 σ

c

σ ε

this ο

σ is

CC ο

UJ _ο s <-

U178 040

2uDNA

178 040

5 'oligo

The 3'-oligo chromosomal DNA of S. cerevisiae

PCR

Salt and

Salt

And pUCI9 amplified DNA fragment

kb

FIG. 8

178 040

5 'oligo

Escherichia coli DMA 3'-oligo chromosomal

Hindlll

PCR

HindIII amplified DNA fragment

HindIII fragment at 1.4 kb pUC19

Hindlll

HindIII, 1.4 kb fragment of pAAH5HindIII

BomHI

FIC5. 8A

178 040

(Λ

CL

FIG. 9

178 040

Glucose (g / l)

178 040

Glucose (g / L)

Time (h) (g / l)

FIG. 11

178 040

Publishing Department of the UP RP. Circulation of 70 copies. Price PLN 6.00.

Claims (23)

Patent claims A method of producing xylitol by a recombinant host which consists in genetically modifying a native organism, culturing this organism, and isolating xylitol, characterized in that: (a) the arabitol-producing microbial host is transformed with DNA encoding D-arabitol dehydrogenase (EC 1.1.1.11) and optionally with DNA encoding xylitol dehydrogenase (EC 1.1.1.9); (b) cultivating the recombinant host of step (a) using D-hexose as the carbon source: glucose, fructose, galactose, mannose, or mixtures thereof, or a polymer or oligomer containing such D-hexose, or D-arabitol, ethanol or glycerol to give the xylitol product; and (c) isolating the xylitol produced in step (b). 2. The method according to p. A process according to claim 1, characterized in that arabitol is an intermediate in said pathway of transformation. 3. The method according to p. The method of claim 1, wherein the native host is arabitol-producing yeast or arabitol-producing fungus. 4. The method according to p. The method of claim 3, wherein the D-xylulokinase activity (EC 2.7.1.17) is inactivated. 5. The method according to p. The host of claim 3, wherein the transketolase activity (EC 2.2.1.1) is inactivated. 6. The method according to p. The host of claim 1, wherein the transketolase (EC 2.2.1.1) and D-xylulokinase (EC 2.7.1.17) activity of the host is inactivated. 7. The method according to p. A method according to any of the preceding claims, characterized in that the yeast is selected from the group consisting of Zygosaccharomyces rouxii, Candida polymorpha, Torulopsis candida, Pichia farinosa and Torulospora hansenii, and the fungi are selected from the group consisting of Dendryphiella salina and Schizophyllum commune. 8. The method according to p. The process of claim 7, wherein the yeast is Zygosaccharomyces rouxii. 9. A recombinant microbial host capable of producing xylitol using as a carbon source D-hexoses such as: glucose, fructose, galactose, mannose, or mixtures thereof, or a polymer or oligomer containing such D-hexose, or D-arabitol, ethanol or glycerol, transformed DNA encoding D-arabitol dehydrogenase (EC 1.1.1.11) and possibly DNA encoding xylitol dehydrogenase (EC 1.1.1.9). 10. The recombinant microbial host according to claim 1, The method of claim 9, wherein D-xylulokinase activity (EC 2.7.1.17) has been inactivated. 11. The recombinant microbial host according to claim 1 The method of claim 9, characterized in that the transecetolase activity (EC 2.2.1.1) has been inactivated. 12. The recombinant microbial host according to claim 1, 22, characterized in that the activities of D-xylulokinase (EC 2.7.1.17) and transketolase (EC 2.2.1.1) have been inactivated. 13. The recombinant microbial host according to claim 1, An arabitol-producing yeast or an arabitol-producing fungus as claimed in any of the preceding microbial hosts. 14. The recombinant microbial host according to claim 14, The method of claim 13, wherein the yeast is selected from the group consisting of Zygosaccharomyces rouxii, Candida polymorpha, Torulopsis candida, Pichia farinosa and Torulospora hansenii, and the fungi are selected from the group consisting of Dendryphiella salina and Schizophyllum commune. 178 040 15. The recombinant microbial host according to claim 15 14. The process of claim 14, wherein the yeast is Zygosaccharomyces rouxii. 16. A method of producing xylitol by a microbial host which comprises genetically modifying a native organism, cultivating this organism, and isolating xylitol, characterized by (a) culturing the microbial host transformed with a gene encoding xylitol dehydrogenase (EC 1.1.1.9); D-glucose-6-phosphate dehydrogenase (EC 1.1.1.44), D-ribulose-5-phosphate-3-epimerase (EC 5.1.3.1) and / or D-ribulokinase (2.7.1.47) using D-hexose as carbon source such as: glucose, fructose, galactose, mannose, or mixtures thereof, or a polymer or oligomer containing such D-hexose or D-arabitol, ethanol or glycerol, yielding a xylitol product; and (b) isolating the xylitol produced in step (a). 17. The method according to p. The method of claim 16, wherein the host with inactivated transketolase activity (EC 2.2.1.1) is used as the microbial host. 18. The method according to p. The method of claim 16 or 17, wherein the host with inactivated xylulokinase activity (EC 2.7.1.17) is used as the microbial host. 19. The method according to p. A method according to claim 17 or 18, characterized in that the host transformed with a gene encoding a non-specific phosphatase catalyzing dephosphorylation of D-xylose phosphate to D-xylulose is used as the microbial host. 20. A recombinant microbial host capable of producing xylitol using D-hexose as a carbon source such as: glucose, fructose, galactose, mannose, or mixtures thereof, or a polymer or oligomer containing such D-hexose, or ethanol or glycerol, transformed with a gene encoding a dehydrogenase xylitol (EC 1.1.1.9), D-glucose-6-phosphate dehydrogenase (EC 1.1.1.49), 6-phospho-D-gluconate dehydrogenase (EC 1.1.1.44), D-ribulose-5-phosphate-3-epimerase (EC 5.1.3.1), and / or D-ribulokinase (EC 2.7.1.47). 21. The recombinant microbial host according to claim 1 The method of claim 20, characterized in that the transketolase activity (EC 2.2.1.1) has been inactivated. 22. The recombinant microbial host according to claim 1, 20 or 21, characterized in that the activities of D-xylulokinase (EC 2.7.1.17) have been inactivated. 23. The recombinant microbial host according to claim 1, The method of claim 20 or 21, wherein the host is transformed with a gene encoding a non-specific phosphatase catalyzing dephosphorylation of D-xylulose phosphate to D-xylulose. The invention relates to a method of producing xylitol and a recombinant microbial host. In general, the invention relates to genetically modified microorganisms for the production of useful chemicals (metabolic engineering), and in particular to the construction of microbial strains by genetic manipulation so that they are capable of converting readily available carbon sources such as D-glucose into a more valuable product, e.g. xylitol. Xylitol is a chemical of great importance as a special sweetener. It is approximately as sweet as sucrose, non-toxic and not carcinogenic. Currently, xylitol is produced by the chemical hydrogenation of D-xylose. D-xylose is obtained from hydrolysates of various plant materials, in which it is always present in a mixture with other pentoses and hexoses. The purification of xylose as well as xylitol is therefore a considerable problem. Several methods of this type are known. Examples include the processes disclosed in U.S. Patent Nos. 3,784,408, 4,066,711, 4 075 406 and 4 008 285. The reduction of D-xylose to xylitol can also be performed microbiologically using natural strains (M.F.S. Barbosa et al., J. Industrial Microbiol. 3: 241-251 (1988) or genetically engineered strains (J. Hallbom et al., 178 040 Biotechnology 9: 1090-1095 (1991)). However, obtaining the substrate D-xylose in a form suitable for yeast fermentation is also a serious problem since cheap xylose sources such as sulphite liquor from pulp and paper production will contain contaminants that inhibit fungal growth. A valuable alternative method of producing xylitol would be to produce it by fermentation of a cheap and readily available substrate such as D-glucose. However, there are no known microorganisms that produce xylitol in significant amounts during the one-stage fermentation of any known carbon source, other than D-xylose and D-xylulose, which are structurally very similar to xylitol. On the other hand, many microbes, especially osmophilic yeasts, e.g. Zygosaccharomyces rouxii, Candida polymorpha and Torulopsis candida, produce significant amounts of the very similar pentitol, D-arabitol from D-glucose (DH Lewis and DC Smith, New Phytol. 66: 143-184. (1967)). Taking advantage of this property of osmolytic yeast, H. Onishi and T. Suzuki developed a method for converting D-glucose into xylitol by three successive fermentations (Appl. Microbil. 18: 1031-1035 (1969)). In this process, D-glucose is first converted to D-arabitol by fermentation with an osmolytic yeast strain. Then D-arabitol is oxidized to D-xylulose by fermentation with Acetobacter suboxydans. Finally, D-xylulose is reduced to xylitol in a third fermentation using one of many yeast strains capable of reducing D-xylulose to xylitol. The obvious disadvantage of this method is that it involves 3 different fermentation steps, each lasting 2-5 days; In addition, additional steps such as sterilization and cell removal are necessary, which adds to the cost of the process. The yield of the fermentation step is low and the amount of by-products is significant. Accordingly, there is still a need for methods for the cost-effective production of xylitol by microbial systems from readily available substrates.