JP3433295B2 - Recombinant method and host for xylitol production - Google Patents

Abstract

Novel methods for the synthesis of xylitol are described.

Description

DETAILED DESCRIPTION OF THE INVENTION CROSS REFERENCE TO RELATED APPLICATIONS This application is filed on November 5, 1992
It is a partial continuation application of 07 / 973,325.

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention generally relates to methods of using genetically modified microorganisms to produce useful compounds (metabolic engineering).
And, more particularly, to genetically constructing microbial strains capable of converting readily available carbon sources such as D-glucose into more valuable products such as xylitol. .

2. Related Technology Xylitol is a compound of considerable value as a special sweetener. It is almost as sweet as sucrose, non-toxic and non-carcinogenic.

Currently, xylitol is produced by the chemical hydrogenation of D-xylose. D-xylose is obtained from hydrolysates of various plant materials that are present in admixture with other pentoses and hexoses. Therefore, the purification of xylose and even xylitol offers important challenges. Many methods of this type are known. U.S. Patents 3,784,408, 4,066,711, 4,075,406 and
4,008,285 can be mentioned as an example.

Reduction of D-xylose to xylitol is also a strain isolated from nature (Barbosa, MFS et al., J. Industri).
al Microbiol. 3: 241-251 (1988)) or a genetically treated strain (Hallborn, J. et al., Biotechnology 9: 109).
It can also be achieved by microbiological methods using any of 0 to 1095 (1991)). However, since cheap xylose sources such as sulfite solutions obtained from pulp and paper processing contain impurities that inhibit yeast growth, the substrate, D-xylose, is obtained in a form suitable for yeast fermentation. That is also an important issue.

Another interesting method of producing xylitol would be to obtain xylitol by fermentation of inexpensive and readily available substrates such as D-glucose. However, it is known that microorganisms that produce a considerable amount of xylitol during one-step fermentation of ordinary carbon sources other than D-xylose and D-xylulose, both of which are structurally very closely related to xylitol. Absent.

On the other hand, many microorganisms, especially hyperosmophilic yeasts such as Zygosaccharomyces.
rouxii), Candida polymorp
ha) and Torulopsis candi
da) is a significant amount of closely related pentitol, D
-Arabitol is produced from D-glucose (Lewis
DH and Smith DC, New Phytol. 66: 143-184 (1967
Year)). Using this hyperosmophilic yeast, H. Onishi and T. Suzuki developed a method for converting D-glucose to xylitol by three successive fermentations (Appl. Microbiol. 18). : 1031 ~ 1035 (19
69 years))). In this method, D-glucose was first converted to D-arabitol by fermentation with a hyperosmophilic yeast strain. Next, D-arabitol was oxidized to D-xylulose by fermentation with Acetobacter suboxydans. Finally, D-
D-xylulose was reduced to xylitol in a third fermentation using one of the many yeast strains capable of reducing xylulose to xylitol.

The obvious drawback of this method is that it involves three different fermentation stages, each of which takes 2-5 days.
And additional processing steps, such as sterilization and cell removal, are required, thus increasing processing costs. The yield of this stepwise fermentation process is low and the amount of by-products is high. Therefore, there is still a need for a method of economically producing xylitol in microbial systems from readily available substrates.

SUMMARY OF THE INVENTION The present invention provides a method of constructing a recombinant host and a recombinant host constructed by the method. Such hosts are capable of producing xylitol when grown on carbon sources other than D-xylulose or D-xylose, and other than polymers or oligomers or mixtures thereof. The carbon source used by the host of the present invention is inexpensive and readily available. The microorganism of the present invention can also secrete the synthesized xylitol into the culture medium. This object is achieved by modifying the metabolism of the desired microorganism, preferably the naturally occurring yeast microorganism, by introducing and expressing the desired heterologous gene. This object is also achieved by further modifying the metabolism of the microorganism so as to overexpress and / or inactivate the activity or expression of a gene of the same species in the desired microorganism in its native state. It

Therefore, one object of the present invention is to provide a method for producing xylitol, which utilizes a novel microbial strain, that is, a novel recombinant host, also referred to herein as a gene-treated microorganism, as the xylitol producer. The genetically treated microorganisms then produce the xylitol either de novo or in increased amounts when compared to naturally untreated microorganisms.

Yet another object of the present invention is to provide a method for the production of xylitol which utilizes a novel metabolic pathway that has been processed in the microorganism, said method being the novel production or production of xylitol by such a microorganism. Bring an increase.

Yet another object of the present invention is to provide a method of producing xylitol which uses a novel metabolic pathway as described above and which modifies D-arabitol biosynthesis and / or metabolic pathway, wherein said The pathway is modified so that the microorganism produces xylitol by fermenting the carbon source that the unmodified host utilizes for the biosynthesis of D-arabitol. Yet another object of the present invention is to
A pre-existing pathway for D-arabitol biosynthesis (D
-With an additional step of utilizing arabitol), or modified D above by modifying one or more steps of the D-arabitol pathway with a similar step of forming xylitol -To provide a method of producing xylitol utilizing the arabitol pathway.

Yet another object of the present invention is D-arabitol dehydrogenase (EC 1.1.1.1) which forms D-xylose.
1) and xylitol dehydrogenase (EC 1.1.1.
Utilizing the modified D-arabitol biosynthetic pathway described above, which has been modified by extending the preexisting D-arabitol pathway by introducing and overexpressing the gene encoding 9) into a D-arabitol producing microorganism. To provide a method for producing xylitol.

Yet another object of the present invention is to use the novel microorganisms as described above and to encode the transketolase (EC 2.2.1.1) gene or D- in such microorganisms.
Utilizes the modified D-arabitol biosynthetic pathway described above which is further modified by inactivating the gene encoding xylulokinase (EC 2.7.1.17) using chemically induced mutations or gene disruption It is to provide a method for producing xylitol.

Yet another object of the present invention is to use the novel microorganisms as described above, wherein the enzymes of the oxidative part of the pentose-phosphate pathway in such microorganisms, especially D-glucose-.
Of xylitol utilizing genetically engineered and modified overexpression of the gene encoding 6-phosphate dehydrogenase (EC 1.1.1.49) and / or 6-phospho-D-gluconate dehydrogenase (EC 1.1.1.44) It is to provide a production method.

Still another object of the present invention is to use the novel microorganism as described above, and to encode a gene encoding an enzyme of an oxidized portion of the pentose-phosphate pathway and D-ribulose-5.
-Of the phosphate epimerase (EC 5.1.3.1) gene,
It is to provide a method for producing xylitol that utilizes genetically engineered and modified overexpression.

BRIEF DESCRIPTION OF THE FIGURES FIG. 1 is a restriction map of the insert in plasmid pARL2. This insert is from Klebsiel
la terrigena) Php1 chromosomal locus and contains the K. terrigena D-arabitol dehydrogenase gene. The white box represents K. terigena chromosomal DNA. Arrows indicate the position and orientation of the D-arabitol dehydrogenase (EC 1.1.1.11) gene in this DNA.

Figure 2 shows the construction of pYARD obtained from pADH and pAAH5. In the plasmid diagram, the single line (-) indicates the bacterial sequence and the wavy line indicates S. cerevisiae 2 μm.
DNA, the white arrow () indicates the ADC I promoter (ADC I
The gene represents S. cerevisiae alcohol dehydrogenase or ADC I, formally referred to as ADH I), the white diamonds (◇) represent the ADC I transcription terminator, the rectangular block represents the LEU2 gene, and the shaded area. The arrow indicates the D-arabitol dehydrogenase gene.

Figure 3 shows the construction of plasmid pJDB (AX) -16. XY
L2 is a xylitol dehydrogenase gene obtained from Pichia stipitis. da1
D is the D-arabitol dehydrogenase gene. A
DC I is the transcriptional regulatory region (promoter) of the ADC I gene, which precedes and is operably linked to the dal D coding sequence. The symbols are not the same as in FIG. In the plasmid schematic, the single line (-) is the bacterial sequence and is indicated where 2 μm DNA is noted, the black arrow indicates the ADC1 promoter, and the cross-hatched diamond symbol. Indicates ADC I transcription terminator, rectangular block is L
The EU2 marker gene is indicated, the shaded arrow indicates the XYL2 gene, and the hatched rectangle indicates the dal D gene.

Figure 4 shows E. coli-Z. Lucii shuttle vector pSRT.
3 shows the construction of (AX) -9. The symbols are the same as in FIG.

Figure 5 shows the transcription map of the cloned T. candida rDNA fragment.

  Figure 6 shows the construction of plasmid pTC (AX).

FIG. 7 shows the transcription map of the cloned T. candida rDNA fragment.

  Figure 7a shows the construction of plasmid pCPU (AX).

  FIG. 8 shows cloning of ZWF1 and gnd genes.

  Figure 8a shows the construction of PAAH (gnd) plasmid.

  Figure 9 shows the construction of plasmid pSRT (ZG).

Figure 10 shows Z. ruxii strain ATCC13356 [pSRT in a fermentor.
(AX) -09].

Figure 11 shows Z. ruxii strain ATCC13356 [pSRT in a fermentor.
(AX) -9] shows the culture of the mutant strain derived from.

Detailed Description of the Preferred Embodiments I. Definitions In the following description, a number of terms used in recombinant DNA technology are used extensively. For a clear and consistent understanding of the specification and claims, including the scope indicated by the above terms, the following definitions are provided.

Carbon sources other than xylose or xylulose. As used herein, "D-xylose and carbon sources other than D-xylose" means D-xylose and D-xylulose or polymers or oligomers or mixtures thereof (eg, xylan and hemicellulose).
Means a carbon substrate for the production of xylitol other than. The carbon source preferably supports growth of the genetically treated microbial host of the present invention and fermentation in a yeast host. A number of cheap and readily available compounds can be used as carbon sources for the production of xylitol in the microbial host of the present invention, including D-glucose and various D- glucose.
Included are glucose-containing syrups as well as mixtures of D-glucose with other sugars. Other sugars that can be assimilated by the hosts of the invention, including yeasts and fungi, such as various aldohexoses and ketohexoses (eg D-fructose, D-
Galactose and D-mannose) and their oligomers and polymers (eg sucrose, lactose, starch, insulin and maltose) are intended to be included in this term. Xylose and petose other than xylulose, glycerol, ethanol,
Non-carbohydrate carbon sources such as various vegetable oils or hydrocarbons, preferably n-alkanes having 14 to 16 carbon atoms, are also intended to be included in the term. The range of carbon sources useful as substrates for xylitol production by the host of the present invention will vary according to the microbial host. For example, glucose and glucose-containing syrups are preferred carbon sources for the production of xylitol by the genetically engineered Digosaccharomyces ruxii of the present invention, while n-alkanes, preferably having 14 to 16 carbon atoms, are modified Candida tropica. It is the preferred carbon source for tropicalis strains.

gene. A DNA sequence containing a template for RNA polymerase.
RNA transcribed from a gene may or may not encode a protein. The RNA encoding the protein is called messenger RNA (mRNA), and in eukaryotes it is transcribed by RNA polymerase II. RNA polymerase II template (RNA polymerase II template in which an RNA sequence having a sequence which is complementary to a specific mRNA sequence but not normally translated is transcribed (RNA polymerase
(As a result of the II promoter) can also be constructed. Such genetic constructs are referred to herein as "antisense RNA genes," and such RNA transcripts are referred to as "antisense RNA."
Antisense RNA is usually not translated due to the presence of a translation stop codon in the antisense RNA sequence.

A "complementary DNA" or "cDNA" gene is, for example, an mRNA
It lacks intervening sequences (introns) because it contains a recombinant gene that is synthesized by reverse transcription.

Cloning vehicle. A plasmid or phage DN that can carry genetic information, especially DNA into the host cell
A or other DNA sequence. Cloning vehicles are often characterized by one or a few endonuclease recognition sites, and such DNA sequences are cleavable in a measurable manner without loss of the vehicle's essential biological function at said sites, and The desired DNA may be spliced into the site to effect cloning into the host cell. The cloning vehicle also
It contains markers suitable for use in identifying cells transcribed in the cloning vehicle and one or more origins of replication that allow the vehicle to be maintained and replicated in a prokaryotic or eukaryotic host. For example, the marker is tetracycline resistance or ampicillin resistance.
The term "vector" is sometimes "cloning vehicle"
Used for. A "plasmid" is a cloning vehicle, generally circular DNA, that is maintained in at least one host cell and replicates automatically.

Expression vehicle. A vehicle or vector that is similar to a cloning vehicle but supports the expression of a gene cloned therein after transformation into a host. The cloned gene is usually under the control of (ie, operably linked to) some regulatory sequence, such as a promoter sequence which may be provided by the vehicle or a recombinant construct of the cloned gene. Placed in. Expression control sequences include whether the vector is designed to express a gene operably linked in a prokaryotic or eukaryotic host, and enhancer elements (upstream activating sequences) and termination sequences, and And / or whether it additionally contains transcriptional elements such as transcription initiation and termination sites.

Host. A host is a prokaryotic or eukaryotic cell used as a recipient and carrier for recombinant material.

The host of the present invention. A "host of the invention" is one that naturally produces less xylitol during fermentation from conventional carbon sources other than D-xylose or D-xylulose or polymers or oligomers or mixtures thereof, but in significant amounts by the method of the invention. Is a microbial host that has been treated to produce xylitol. By "substantial amount" is meant an amount that is suitable for isolating pure form of xylitol or that can be reliably determined by analytical methods commonly used for carbohydrate analysis in microbial fermentation broths. .

Arabitol dehydrogenase. Two types of D-
There is arabitol dehydrogenase: D-xylulose formation (EC 1.1.11) and D-ribulose formation. D
Ribulose-forming dehydrogenase is found in wild-type yeasts and fungi. The D-xylulose-forming arabitol dehydrogenase is known only in bacteria. Unless otherwise stated, what is intended herein and referred to herein as arabitol dehydrogenase is D-xylulose-forming arabitol dehydrogenase.

Oxidative part of the pentose-phosphate pathway. By "oxidative part of the pentose-phosphate pathway", oxidation reactions such as D-glucose-6-phosphate dehydrogenase (EC 1.1.1.49) and 6-phospho-6.
-It is meant to include a part of the pentose-phosphate shunt that catalyzes a reaction catalyzed by gluconate dehydrogenase (EC 1.1.1.44) and utilizes a hexose substrate to form pentose phosphate. The "non-oxidative" part of the pentose phosphate pathway, which also catalyzes the net formation of ribose from D-glucose, is catalyzed by ribose-5-phosphate isomerase, D-ribulose-5-phosphate-3-epimerase and transaldolase. The reaction is characterized by non-oxidative isomerization. Biological Chemistry, HR Mahler and EH Cordes, Publisher, Harper & Row, New York, 1966, 4
See pages 48-454.

Functional derivative. A "functional derivative" of a protein or nucleic acid is chemically or biochemically derived from (obtained from) said protein or nucleic acid and is a biochemical activity (functional or structural) characteristic of said native protein or nucleic acid. It is a molecule that holds either
The term "functional derivative" is intended to include "fragments", "variants", "analogs" or "chemical derivatives" of a molecule that retain the desired activity of the natural molecule.

As used herein, a molecule is said to be a "chemical derivative" of another molecule when the molecule contains additional chemical moieties that are not normally a part of that molecule. Such moieties can improve the solubility, absorption, biological half-life, etc. of the molecule. These moieties can reduce the toxicity of the molecule, or can eliminate or reduce unwanted side effects of the molecule. The part that may mediate such effects is Remingtons
Pharmaceutical Sciences (Remington's Ph
armaceutical Sciences) (1980). Methods for attaching such moieties to molecules are well known in the art.

Fragment. A "fragment" of a molecule such as a protein or nucleic acid is meant to refer to a portion of a naturally occurring amino acid or nucleotide gene sequence, and particularly the functional derivatives of the invention.

Variant or analog. A “variant” or “analog” of a protein or nucleic acid refers to a molecule that is substantially similar in structure and biological activity to any naturally occurring molecule, such as a molecule encoded by a functional allele. Means like.

II. Construction of metabolic pathways for xylitol biosynthesis According to the present invention, the natural metabolic pathways of microbial hosts are engineered to reduce or eliminate carbon utilization for purposes other than xylitol production. The hosts of the present invention all produce xylitol in one fermentation stage. In one embodiment, the host of the invention has sufficient xylitol dehydrogenase (EC 1.1.1.
9) Can retain activity. However, as described below, in hosts in which it is desirable to overproduce xylitol dehydrogenase activity, recombinant genes encoding xylitol dehydrogenase can be transformed into host cells.

In a particular realization of the invention, the hosts of the invention are all from a structurally unrelated carbon source such as D-glucose, and not exactly from D-xylose and / or D-xylulose. , Xylitol can be synthesized.

In particular, in the illustrated and preferred embodiment, the host of the present invention features one of two pathways. First
For, the pathway in which arabitol is an intermediate in xylitol formation, and second, the pathway in which xylulose-5-phosphate is directed to xylitol formation by dephosphorylation and reduction reactions. Therefore, the host of the present invention is characterized by at least one of the following genetic modifications: (1) A gene encoding a protein having D-xylulose-forming D-arabitol dehydrogenase (EC 1.1.1.11) activity is present in the host. Has been cloned, which results in the conversion of D-arabitol to D-xylulose (feature of pathway I); and / or (2) inactivation of the native host gene encoding transketolase activity. (Feature of Pathway II).

In addition, various further modifications can be made to the host to increase the host's ability to produce xylitol. For example, the host described in (1) and (2) can be further repaired as follows: (3) A gene encoding a protein having xylitol dehydrogenase (EC 1.1.1.9) activity is present in the host. Cloned; (3) the natural host gene encoding D-xylulokinase (EC 2.7.1.17) is inactivated; (4) D-glucose-6-phosphate dehydrogenase (EC 1.1. 1.49) A gene encoding a protein having activity has been cloned into the host; (4) A gene encoding a protein having 6-phospho-D-gluconate dehydrogenase (EC 1.1.1.44) activity has been cloned into the host. (5) A residue encoding a protein having D-ribose-5-phosphate-3-epimerase (EC 5.1.3.1) activity Child has been cloned into the host.

In a preferred embodiment, the host of the invention has more than one of the above genetic modifications. For example, in a preferred embodiment, carbon flows from D-arabitol "directly" to D-xylulose (ie, in one step) and from D-xylulose "directly" to xylitol. Thus, in such an embodiment, the host of the invention comprises a gene encoding a protein having D-xylulose-forming D-arabitol dehydrogenase activity and a gene encoding xylitol dehydrogenase (EC 1.1.1.9) cloned into the host. Have been modified as It should be noted that in many embodiments D-arabitol is synthesized internally by the host of the present invention from other carbon sources, but D-arabitol can also be added externally directly to the medium.

In another preferred embodiment, the xylitol biosynthetic pathway does not introduce arabitol as an intermediate. Rather, the carbon goes from D-xylulose-5-phosphate to D-xylulose and then to xylitol. When D-glucose is used as the carbon source, carbon is converted from D-glucose to D-glucose-6-phosphate, 6-phospho-D-gluconate, D-ribulose-5-phosphate by the oxidizing moiety of the pentose phosphate pathway. Will proceed. D-ribulose-5-phosphate will be further epimerized to D-xylulose-5-phosphate, dephosphorylated to D-xylulose and reduced to xylitol. Thus, the hosts of the invention used in this embodiment would include the following hosts: (a1) a gene encoding a protein having D-glucose-6-phosphate dehydrogenase (EC 1.1.1.49) activity. Is cloned into the host or the host's native gene is overexpressed; and / or (a2) a gene encoding a protein having 6-phospho-D-gluconate dehydrogenase (EC 1.1.1.44) activity. Cloned into the host or the host native gene is overexpressed; and / or (a3) a gene encoding a protein having D-ribulose-5-phosphate-3-epimerase activity is cloned into the host Native or host natural gene is overexpressed; and / or (a4) xylitol dehydrogena A gene encoding a protein having nuclease (EC 1.1.1.9) activity has been cloned into the host or the host's native gene is overexpressed; and / or (b) the native transketolase gene is absent. Activated; and / or (c) the native host gene encoding xylulokinase (EC 2.7.1.17) activity is inactivated.

The dephosphorylation step (conversion of D-xylulose phosphate to D-xylulose) is the only step catalyzed by an enzyme that has not been characterized in its pure form. However, the natural D- of high osmotic affinity yeast
Similar steps in the arabitol formation pathway (D-ribulose-
It was previously known that the enzymatic activity involved in 5-phosphate to D-ribulose is non-specific and can also catalyze the dephosphorylation of xylulose-5-phosphate (Ingram, JM and WA Wood, J. Bacteriol. 8
9: 1186-1194 (1965)). Mutation of transketolase and overexpression of two dehydrogenases of the oxidative pentose phosphate pathway serves a dual purpose. First, they increase the amount of ribulose-5-phosphate in cells and, consequently, the production of arabitol and xylitol, increasing pathway I efficiency. Second, the same combination of modifications also results in the excessive accumulation of xylulose-5-phosphate required for pathway II engineering.

Therefore, the only method within the invention is to use the naturally occurring pathway to form D-arabitol from various carbon sources and extend this pathway in two further reactions to convert D-arabitol to xylitol. Not a possible route. Other pathways can be constructed that lead to xylitol as the final metabolite and do not involve D-arabitol as an intermediate. Thus, the D-ribulose-5-phosphate to xylitol pathway can be achieved with more than one reaction chain. D-ribulose-5-phosphate is D-xylulose-5 by D-ribulose-5-phosphate-3-epimerase.
The accumulated D-xylulose-5-phosphate can be efficiently converted to phosphate and if further conversion of D-xylulose-5-phosphate is blocked by mutation of the transketolase gene. It can be dephosphorylated by the same non-specific phosphatase as -5-phosphate (In
gram, JM, etc., J. Bacteriol. 89: 1186 ~ 1194 (1965
)), And can be reduced to xylitol by xylitol dehydrogenase. To realize this pathway, further useless circulation: D-xylulose-5-phosphate → D-xylulose → D-xylulose-5-
Inactivation of the D-xylulokinase gene is required to minimize energy loss by phosphate.
Additional genetic modification --- D-librokinase (EC 2.
7.1.47) Gene transfer and (over) expression --- can minimize co-production of D-arabitol by the strain by capturing non-specific phosphate produced D-ribulose. See. D-ribulose is converted to the original D-ribulose-5-phosphate, and even D-xylulose-5-phosphate.

III. Construction of the host of the invention According to the invention, a method of genetically treating a host of the invention comprises the isolation and partial sequencing of a pure protein encoding the enzyme or encoding the above protein. It is facilitated by cloning the resulting gene sequence by the polymerase chain reaction technique, as well as expressing the gene sequence. As used herein, the term "gene sequence"
Is intended to refer to a nucleic acid molecule, preferably DNA. Gene sequences capable of encoding proteins are derived from a variety of sources. These sources include genomic DN
A, cDNA, synthetic DNA and combinations thereof are included. A preferred source of genomic DNA is the yeast genomic library. A preferred source of cDNA is a cDNA library prepared from yeast mRNA grown under conditions known to induce expression of the desired mRNA or protein.

When the cDNA of the present invention is made using mature mRNA as a template, it does not contain naturally occurring introns. The genomic DNA of the present invention may or may not contain naturally occurring introns. Furthermore, such genomic DNA is 5'of the gene sequence.
It can be obtained by linking with a promoter region and / or a 3 ′ transcription termination region. Furthermore, such genomic DNA
Can be obtained by linking the gene sequence encoding the 5'untranslated region and / or the gene sequence encoding the 3'untranslated region of mRNA. To the extent that the host cell is able to recognize transcriptional and / or translational regulatory signals associated with the expression of mRNA and protein, therefore, the 5'and / or 3'untranscribed regions of the native gene, and / or
The 5'and / or 3'untranslated regions of the mRNA retain transcription and translation regulation and can be used for transcription and translation regulation. Genomic DNA can be extracted and purified from any host cell that naturally expresses the desired protein, particularly a fungal host, by means well known in the art (eg, guidance for molecular cloning techniques (Gu.
ide to Molecular Cloning Techniques), SLBerger
Editing, etc., Academic Press (1987)). Preferably, the mRNA preparation used is either naturally isolated by isolation from cells producing large amounts of protein or
It will be enriched with mRNA encoding the desired protein by techniques commonly used to enrich mRNA preparations for a particular sequence in vitro, such as by sucrose gradient centrifugation, or both.

For cloning into a vector,
Each DNA preparation (either genomic DNA or cDNA) is optionally cleaved or enzymatically cleaved, and ligated into an appropriate vector for recombinant gene (genomic or cDNA)
Either) form a library.

The DNA sequence encoding the desired protein or functional derivative thereof can be inserted into a DNA vector according to conventional techniques. These techniques include blunting or sticky ends of the ligating ends, restriction enzyme digestion to provide suitable ends, joining of sticky ends where appropriate, alkaline phosphatase treatment to avoid unwanted ligation, and Ligation with a suitable ligase is included. Such an operation technique is disclosed by Maniatis T. (Maniatis, T. et al., Molecular Cloning (Laboratory Manual), Cold Spring Harbor Laboratory, 2nd Edition, 1).
988), and are well known in the art.

A library containing sequences encoding the desired gene contains any means for specifically selecting sequences encoding such genes or proteins, eg, a) containing DNA-specific sequences of this protein. By hybridization with a suitable nucleic acid probe, or b) by translation analysis in which hybridization is selected, in which the native mRNA hybridizing to the clone in question is translated in vitro and the translation product is further characterized, or c) cloning If the expressed gene sequence itself can express the mRNA, it can be screened and the desired gene sequence identified by immunoprecipitation of the translated protein product produced by the host containing the clone.

Oligonucleotide probes specific to a protein that can be used to identify clones of a protein are from knowledge of the amino acid sequence of a protein or from the knowledge of the nucleic acid sequence of DNA encoding such a protein or related proteins. Can be designed. Alternatively, an antibody can be raised against a purified form of the protein and used to confirm the presence of a unique protein determinant in transformants expressing the desired cloned protein. it can. The sequences of amino acid residues in peptides herein are referred to by their commonly used three letter names or by one letter names. These three-letter and one-letter name tables can be found in textbooks such as Biochemistry, Lehninger A., Worth Publishers, New York, NY (1970). it can. Unless otherwise stated, when amino acid sequences are displayed horizontally, the amino terminus is intended to be at the left end and the carboxy terminus is intended to be at the right end. Similarly, nucleic acid sequences are shown at the 5'end on the left unless otherwise noted or apparent from the text.

Due to the degeneracy of the genetic code, more than one codon can be used to code for a particular amino acid (Wa
tson, JD, Molecular biology of genes, 3rd edition, WABenjami
n, Inc., Menlo Park, California (1977), 35.
6-357). The peptide fragments are analyzed to identify the amino acid sequence that can be encoded by the oligonucleotide with the lowest degree of degeneracy. This is preferably accomplished by identifying sequences containing amino acids encoded by only one codon.

Sometimes an amino acid sequence can only encode one oligonucleotide sequence, but this amino acid sequence can often be encoded by any of a similar set of oligonucleotides. Importantly, all members of this set contain an oligonucleotide sequence that can encode the same peptide fragment, and thus potentially the same oligonucleotide sequence as the gene that encodes the peptide fragment. However, only one member of this set contains the same nucleotide sequence as the exon encoding the sequence of the above gene.
This member is present in the set and can hybridize to DNA in the presence of other members of the set, so that one oligonucleotide is used to clone the gene encoding the peptide. An unfractionated set of oligonucleotides can be used in the same manner as in.

Using the genetic code, one or more different oligonucleotides can be identified from amino acid sequences each of which can encode the desired protein.
The possibility that a particular oligonucleotide actually constitutes the actual protein-encoding sequence depends on the unusual base pairing relationships and the frequency with which the particular codon is actually used (encoding a particular amino acid) in eukaryotic cells. Can be taken into consideration for the estimation. "Codon usage rule"
Is used to identify an oligonucleotide sequence or set of oligonucleotide sequences that contains the theoretical "most likely" nucleotide sequence that can encode a protein sequence.

May encode a fragment of a gene (or
A suitable oligonucleotide or set of oligonucleotides (which is complementary to the oligonucleotide or set of oligonucleotides) can be synthesized by means well known in the art (eg, DNA and RNA synthesis and application, SANarang editing, 1987, Academic Press, San Diego, Calif.), And can be used as a probe to identify and isolate clones of the above genes by techniques known in the art. Techniques for nucleic acid hybridization and clone identification are described by Maniatis T. et al., Molecular Cloning,
Laboratory manuals, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY (1982) and Hames BD etc. Nucleic Acid Hybridization (N
Nucleic Acid Hybridization), practical method, IRL Pre
ss, Washington, DC (1985).
The members of the above gene libraries that have been found to be capable of such hybridization are then analyzed to determine the extent and nature of the coding sequences they contain.

The DNA probe is labeled with a detectable group to facilitate detection of the desired DNA coding sequence. Such detectable groups can be any material that has detectable physical or chemical properties. Such materials have been well-developed in the area of nucleic acid hybridization, and, in general, most any label useful in such methods can be applied to the present invention. 32P, 3
Radiolabels such as H, 14C, 35S, 125I and the like are particularly useful. Any radiolabel that provides a suitable signal and has a sufficient half-life can be used. When single stranded, the oligonucleotide can be radiolabeled using the kinase reaction. Alternatively, polynucleotides are also useful as nucleic acid hybridization probes when labeled with a non-radioactive marker such as biotin, an enzyme or a fluorescent group.

Thus, in summary, the elucidation of partial protein sequences allows the identification of theoretical "most likely" DNA sequences or sets of such sequences that could encode such peptides. By constructing an oligonucleotide complementary to this theoretical sequence (or,
By constructing a set of oligonucleotides complementary to the "most possible" set of oligonucleotides) a DNA molecule is obtained which can serve as a probe for the identification and isolation of clones containing the gene.

In another method of cloning genes, libraries are produced using expression vectors by cloning DNA or more preferably cDNA prepared from cells capable of expressing the protein in the expression vector. The library is then screened for members that express the desired protein, for example by screening the library with antibodies to the protein.

Therefore, the method described above is able to identify a gene sequence capable of encoding a protein or a biologically active or antigenic fragment of said protein. To further characterize such gene sequences, and to produce recombinant proteins, it is desirable to express the proteins encoded by these sequences. Such expression identifies clones expressing a protein having the desired protein characteristics. Such characteristics include, inter alia, the ability to specifically bind to the antibody, the ability to induce the production of antibodies capable of binding the naturally occurring non-recombinant protein, the ability to provide the cell with the enzymatic activity characteristic of the protein. And the ability to provide non-enzymatic (but specific) function to the recipient cell.

The DNA sequence is shortened by means known in the art to isolate the desired gene from a chromosomal region containing more information than is needed to utilize the desired gene in the host of the invention. Can be separated. For example, restriction digests can be used to cleave the full length sequence at the desired position. Alternatively, or in addition to the above, a sequence can be digested into a truncated form using a nuclease that cleaves from the 3'end of the DNA molecule, and then the desired length is subjected to gel electrophoresis and DNA Identified and purified by sequencing. Such nucleases include, for example, exonuclease III and Bal31. Other nucleases are well known in the art.

In the practical realization of the present invention, the hyperosmophilic yeast Z. ruxii is used as one model. This is amenable to food production as Z. ruxii is traditionally used in Japan to produce soy sauce. This yeast is, for example: yeast, taxonomic study (The Yeasts, A Taxon
omic Study, Kreger-va
n Rij) (Editor), Elsevier Science publishers BV, 3984
Described in Amsterdam, and this yeast
Pp. 462-465. Other D-arabitol producing yeasts such as Candida polymorpha, Torrlopsis candida, Candida tropicalis, Pichia farinosa, Torulaspora hansenii, etc., and Dendrifiera
Salina (Dendryphiella salina) or Schizophyllum
D-arabitol-producing fungi, such as commune, can also be used as host organisms for the purposes of the present invention.

It is known that the enzyme that oxidizes D-arabitol to D-xylulose (EC 1.1.1.11) is present in bacteria but not in yeast or fungi. For the purposes of the present invention, Klebsiella teriligena is a non-pathogenic soil bacterium and has a highly inducible D-arabitol dehydrogenase activity, thus providing a preferred supply of the D-arabitol dehydrogenase (D-xylulose forming) gene. Is the source. The Klebsiella terrigena strain Php1 used in the examples was obtained from K. Haahtela, University of Helsinki. Isolation of this strain was carried out by App.
45: 563-570 (1983). Cloning of the D-arabitol dehydrogenase gene can be conveniently accomplished by constructing a gene library of K. terigena chromosomal DNA in a suitable vector, such as the well known and commercially available plasmid pUC19. . This library is transformed into one of many E. coli strains that can use D-xylulose but not D-arabitol as the sole carbon source. The E. coli strain SCS1 available from Stratagene is one example of a suitable strain. Next, the above transformant is inoculated into a medium containing D-arabitol as the sole carbon source, and a clone capable of growing in this medium is isolated. The coding region of the K. terigena D-arabitol dehydrogenase can conveniently be isolated in the form of a 1.38 kb BCl I-Cla I fragment and fused to a suitable promoter and transcription terminator sequences.
The Saccharomyces cerevisiae ADCI promoter and transcription terminator are examples of suitable transcriptional regulatory elements for the purposes of the present invention when yeast Z. ruxii is used as the host organism. The sequence of ADC I is GenBank
k).

Although most yeasts and fungi carry the xylitol dehydrogenase (EC 1.1.1.9) gene, overexpression of the gene is typically required for the practice of the invention. Cloning of the Pichia stipitis XYL2 gene encoding xylitol dehydrogenase (EC 1.1.1.9) is described in XY
The published information on the nucleotide sequence of the L2 gene can be used to conveniently achieve the polymerase chain reaction technique (Ktter et al., Curr. Genet. 18: 493-500 (1990).
Year)). The gene can be introduced into other yeast species without any modification and expressed under the control of its own promoter, and the promoter can be replaced with another strong yeast promoter.

Genetically stable transformants can be constructed using vector systems or transformation systems, and thereby integrate the desired DNA into the host chromosome. Such integration can be either de novo in the cell or a vector that functionally inserts itself into the host chromosome, such as a phage, retroviral vector, transposon or
Integration can be facilitated by transformation with other DNA elements that promote integration of the DNA sequence into the chromosome.

D-arabitol dehydrogenase and xylitol dehydrogenase (EC
The gene encoding 1.1.1.9) can be combined in one plasmid construct and introduced by transformation into the host cell of the D-arabitol producing organism.
The nature of the plasmid vector depends on the host organism. Therefore, in the Z. ruxii vector into which the DNA of pSR1 was introduced, a cryptic plasmid (Ushio, K. et al., J. Fer
ment.Technol. 66: 481-488 (1988)) is used in a preferred embodiment of the present invention. In other yeast or fungal species that are not known to replicate plasmids automatically,
Xylitol dehydrogenase (EC 1.1.1.9) and D
-Integration of the arabitol dehydrogenase gene into the host chromosome can be used. Host ribosome
Targeting integration at the DNA (DNA encoding ribosomal RNA) locus is the preferred method of obtaining high copy number integration, and high level expression of the two dehydrogenase genes targeting as described above This can be accomplished by providing the recombinant construct with sufficient recombinant DNA sequence to integrate directly into the locus. The genetic marker used for transformation of the D-arabitol-producing microorganism is preferably a dominant marker that confers resistance to various antibiotics such as gentamicin or fluomycin or heavy metals such as copper. The selectable marker gene can be directly linked to the DNA gene sequence to be expressed or introduced into the same cell by cotransformation.

In addition to introducing the D-arabitol dehydrogenase and xylitol dehydrogenase (EC 1.1.1.9) genes, other genetic modifications can be used to construct novel xylitol producing strains. Thus, the gene encoding the enzyme of the oxidative pentose phosphate pathway is D-arabitol precursor D-ribulose-
It can be overexpressed to increase the degree of synthesis of 5-phosphate. Further, transketolase-pentulose-5-phosphate or pentose-5-
The gene encoding the enzyme catalyzing the catabolism of phosphate --- can be inactivated by conventional mutagenesis or gene disruption techniques that increase the accumulation of 5-carbon sugar phosphates. Inactivation of the D-xylulokinase gene can increase xylitol yield by eliminating the loss of D-xylulose due to phosphorylation.
A combination of transketolase inactivating mutations and overexpression of D-ribulose-5-epimerase can be used to create another type of xylitol production pathway in which D-arabitol is not used as an intermediate. .

In order to express the desired protein and / or its active derivative, transcriptional and translational signals recognizable by an appropriate host are required. The cloned coding sequence obtained in the manner described above, and preferably in double-stranded form, is operably linked to a sequence controlling transcriptional expression in an expression vector and is of prokaryotic or eukaryotic origin. It can be introduced into host cells to produce recombinant proteins or functional derivatives thereof. It is also possible to express the antisense RNA or a functional derivative thereof, depending on which strand of the coding sequence binds to the sequence that controls transcriptional expression.

Expression of proteins in different hosts can result in different post-transcriptional modifications that can alter the properties of the protein. Preferably, the invention comprises the expression of the protein or its functional derivatives in eukaryotic cells, and especially in yeast.

A nucleic acid molecule, such as DNA, contains an expression control sequence having transcriptional regulatory information, and if such sequence is "operably linked" to a nucleotide sequence encoding a polypeptide, the molecule is Is "expressible".

An operable linkage is a linkage that is linked to one (or more) regulatory sequences in such a way that the expression of the sequences is under the influence or control of the regulatory sequences. When the transcription of the mRNA encoding the desired protein occurs due to the introduction of the promoter function, and the two DNA sequences (for example, the coding sequence and the promoter region sequence linked to the 5'end of the coding sequence) are (1) the coding sequence Does not change the open reading frame of (2) the expression control sequence is a protein or antisense
2 if it does not interfere with the ability to direct the expression of RNA or (3) the ability to transcribe a DNA template
Two DNA sequences are said to be operably linked. Thus, a promoter region will be operably linked to a DNA sequence if the promoter is capable of directing the transcription of the DNA sequence.

The precise nature of the regulatory regions required for gene expression may vary between species or cell types, but generally it is necessary to have 5'non-transcribed and 5'untranslated (5'non-translated and 5'untranslated, respectively) that initiate transcription and translation, respectively. It must have (non-coding) sequences, such as TATA boxes, capping sequences, CAAT sequences, etc. In particular, such a 5'non-transcriptional control sequence contains a region having a promoter for transcriptional control of an operably linked gene. Such transcription control sequences can also have enhancer sequences or upstream activator sequences, if desired.

Expression of proteins in eukaryotic hosts such as yeast requires the use of regulatory regions functional in such hosts, and preferably yeast regulatory systems. A wide variety of transcriptional and translational regulatory sequences may be used, depending on the nature of the host. Preferably, these regulatory signals are associated in their native state with specific genes that allow high levels of expression in the host cell.

In eukaryotes where transcription is not linked to translation, such regulatory regions may be cloned sequence initiators.
The methionine codon may or may not be provided, depending on whether it contains methionine (AUG). Such regions generally contain sufficient promoter region to direct the initiation of RNA synthesis in the host cell. A promoter obtained from a yeast gene encoding a translatable mRNA product is preferable,
And in particular, strong promoters can be used if they act as promoters in the host cell. Preferred strong yeast promoters
GAL1 gene promoters, glycolytic gene promoters such as those for phosphoglycerokinase (PGK),
Or the constitutive alcohol dehydrogenase (ADC1) promoter is included (Ammerer, G.Meth.Enzymol.101C: 192
~ 201 (1983); Aho, FEBS Lett. 291: 45 ~ 49 (1991
Year)).

As is widely known, translation of eukaryotic mRNA is initiated at the first methionine-encoding codon. For this reason, it is preferred to ensure that the linkage between the eukaryotic promoter and the DNA sequence encoding the desired protein or a functional derivative thereof does not contain an intervening codon that may encode methionine. If such a codon is present, a fusion protein (if the AUG codon is in the same reading frame as the protein-encoding DNA sequence) or a frameshift mutation (if the AUG codon is not in the same frame as the protein-encoding sequence). Either occurs.

Transcription initiation regulatory signals may be selected that allow repression or activation, so that expression of the operably linked gene can be regulated. Regulatory signals that are temperature-sensitive or chemically regulated, such as dependent on metabolic intermediates, so that expression can be suppressed or initiated by changing temperature are important. Antisense
No translation signal is required if expression of the RNA sequence is desired.

If desired, the non-transcribed and / or untranslated region 3'of the sequence encoding the desired protein can be obtained by the cloning methods described above. The 3'-untranscribed region may carry its transcription termination regulatory sequence elements, and the 3-untranslated region may carry its translation termination regulatory sequence elements or those elements that direct polyadenylation in eukaryotic cells. it can. If the native expression control sequence signals do not function well in the host cell, functional sequences in the host cell may be substituted.

The vector of the present invention further comprises a DNA conferring antibiotic resistance.
Other operably linked regulatory elements, such as elements, or origins of replication for maintaining the vector in one or more host cells can be included.

In another preferred embodiment, especially with respect to Z. ruxii, the introduced sequences are incorporated into a plasmid vector capable of autonomous replication in the recipient host. Any variety of vectors can be used for this purpose.

Factors that are important in selecting a particular plasmid or viral vector include: ease of recognition of receptor cells containing vector and selection from receptor cells containing no vector; within a particular host. The desired copy number of the vector; and whether it is desirable to be able to "carry" the vector between host cells of various species.

The preferred yeast plasmid depends on the host. In Z. ruxii, the natural hidden plasmid pSR1 (Toh, E. et al., J. Ba.
cteriol.151: 1380 to 1390 (1982)), pSB1, pSB2, pS
B3 or pSB4 (Toh, E. et al., J. Gen. Microbiol. 130: 2527 ~
2534 (1984)) is preferred. Plasmid pSRT303D (Jearnpipatkul, A. et al., Mol.Gen.Genet.20)
6: 88-84 (1987)) is an example of an effective plasmid vector for Digosaccharomyces yeast.

Once the vector or DNA sequence containing the construct is prepared for expression, the DNA construct is introduced into a suitable host cell by any of a variety of suitable means. After introducing the vector, the recipient cells are grown in a selective medium that selects for growth of the vector-containing cells. Expression of the cloned gene sequence results in production of the desired protein or production of fragments of this protein. This expression can occur in a continuous manner in transformed cells, or in a controlled manner, for example by inducing expression.

Site-directed mutagenesis was performed using techniques known in the art, such as gene disruption, to construct a host of the invention that has been modified so that it is no longer able to express certain gene products. Can be carried out (Rothst
ein, RS, Meth. Enzymol. 101C: 202-211 (1983)).

IV. Production of xylitol When recombinant arabitol-producing yeast, preferably its hyperosmophilic yeast, is used as the host of the invention, they are hyperosmolar medium, for example 10-60% D-glucose, And preferably it can be grown in a medium containing 25% D-glucose. ("Normal" medium usually contains only 2-3% glucose.)
Hyperosmolar medium induces D-arabitol formation in wild-type strains of hyperosmophilic yeast such as Z. ruxii. Culture media of recombinant and control (wild type) strains are analyzed for the presence of xylitol at various incubation times according to methods known in the art. Under culture conditions that were not optimized for maximum D-arabitol yield, the experimental strain Z. ruxii ATCC 13356 [pSRT (AX) -9] produced both xylitol and D-arabitol and secreted into the culture medium. Only D-arabitol was detected in the culture medium of the control strain. The xylitol yield of the first test [see Table 4 of Example 4] was approximately 7.7 g / l after 48 hours of culture.

Xylitol can be purified from the culture medium of the host of the present invention according to any technique known in the art.
For example, US Pat.
081,026 described the chromatographic separation of xylitol from yeast cultures. Therefore, from the fermentation step, xylitol can be purified from the culture medium using a chromatographic step as described in US Pat. No. 5,081,026, followed by crystallization.

Although the present invention has been generally described, it will be better understood with reference to certain specific embodiments. These examples are included herein for purposes of illustration only and are not intended to be limiting unless explicitly stated otherwise.

Examples Example 1 Cloning of the bacterial D-arabitol dehydrogenase gene Klebsiella terrigena Ph
pl (K. Haahtela, obtained from University of Helsinki, Hertera et al., Appl. Env. Microbiol., 45: 563-570.
(1983)) was grown overnight in 1 liter LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl) at 30 ° C. Collect the bacterial cells (about 5g) by centrifugation,
Washed once in TE (10 mM Tris-HCl, 1 mM EDTA, pH 7.5) and 1% sodium dodecyl sulfate and 20
Resuspended in TE containing 0 μg / ml proteinase K. The suspension was incubated at 37 ° C for 30 minutes and then extracted once with an equal volume of phenol and twice with chloroform. 3M sodium acetate (1/10 vol) and ethanol (3 vol) were added and the precipitated nucleic acid was collected by centrifugation and redissolved in 5 ml TE. RNA
Was removed by centrifugation of the solution at 30,000 rpm overnight through 25 ml of 1M NaCl in a Beckman Ti50.2 rotor. K. terigena chromosomal DNA obtained by the above method
Had an average fragment size of over 50,000 base pairs (bp). DNA then restriction endonuclease Sau3A
With an enzyme: DNA ratio of 5 U / mg in the buffer of a supplier (Boehringer) with an average DNA fragment size of about 5-10 kb
It was digested until it was reduced to (agarose gel electrophoresis). The digest was digested with TBE buffer (0.09M Tris-borate, 1mM E
20 x 10 x overnight at 5 V / cm in DTA, pH 8.3)
Fractionated by electrophoresis through a 0.6 cm 0.6% agarose gel, cutting the wells in the agarose slab at a position corresponding to a fragment size of approximately 5 kb, fixing a piece of dialysis membrane along the well and larger than 5 kb. Electrophoresis was continued until essentially all of the DNA fragments were adsorbed on the membrane.
Plasmid DNA of pUC19 (purchased from Pharmacia) was digested with the restriction endonucleases BamHI and bacterial alkaline phosphatase using the supplier's buffer and reaction conditions. The linear form of pUC19 was purified by preparative gel electrophoresis using the membrane electroelution method described above and ligated with the 5-15 kb fraction of Klebsiella terrigena chromosomal DNA. E. coli SC using ligation mixture
S1 competent cells (purchased from Stratagene) were converted to ampicillin resistance. In this experiment, about 10,000
Recombinant clones were obtained. Pooled cells obtained from the conversion plates were plated on minimal medium plates containing D-rabitol (1%) as the sole carbon source. 37 ° C
Several colonies were obtained after 2 days of culture in. Plasmid DNA was isolated from two of these clones (fastest growing) and used to retransform E. coli strain HB101 which is not able to catabolize D-arabitol but can use D-xylulose. .
All transformants are MacConkei (obtained from Zifco)
Was demonstrated to be positive for D-arabitol-utilization on the agar-D-arabitol plates of, while all control clones (the same strain transformed with pUC19) were negative. Restriction analysis showed that the two isolated clones contained the same plasmid. One of the two isolated plasmids (designated pARL2) was used for subsequent identification. Cloned 9.5 k of K. terigena DNA in pARL2 carrying the D-arabitol dehydrogenase gene.
The restriction map of the b (outline) fragment is shown in FIG.

Example 2 Expression of the bacterial D-arabitol dehydrogenase gene in yeast About 1.8 kb Sac I-Hind I from the original K. terigena 9.5 kb DNA clone containing the D-arabitol dehydrogenase gene.
The II fragment was subcloned using common recombinant DNA technology and was found to contain the D-arabitol dehydrogenase gene. A plasmid containing this DNA fragment in the pUC19 vector (pADH, where ADH stands for D-arabitol dehydrogenase) was isolated from E. coli strain JM110, Bcl I and
Digested with Cla I restriction endonuclease and 1.38k
b DNA fragments were isolated by preparative agarose gel electrophoresis. This DNA fragment was treated with the Klenow fragment of DNA-Polymerase I in the presence of a total of four triphosphate deoxynucleotides and previously prepared with Hind I.
The yeast expression vector pAAH5 (Ammerer, cleaved with II and treated with Klenow fragment,
Meth. Enzymol., 101: 192-203 (1983)) was ligated (Fig. 2). The resulting expression plasmid, pYARD, is
Replication and ampicillin resistance gene bacteria (E. coli)
Source, yeast of replication from 2 μm DNA (S. cerevisiae)
Source and yeast for selection in yeast (S. cerevisiae)
A shuttle E. coli-Saccharomyces cerevisiae vector containing the LEU2 gene. The expression cassette contains the yeast alcohol dehydrogenase I (ADC I) promoter and (A
DC I) contains the transcription terminator flanking and is operably linked to the K. terigena D-arabitol dehydrogenase gene.

Saccharomyces cerevisiae strain GRF18 (MATα, le
u2-3,112, his3-11,15) and S. cerevisiae strain DB
Y746 (ATCC44773; MATα, leu2−3,112 his3−Al ura3
-52 trp1-289) are both used as hosts for the conversion with the D-arabitol dehydrogenase expression vector pYARD described above, giving the same results. The conversion is standard lithium chloride method (Ito et al., Bacteriol., 153: 163-
160 (1983)) using the pEUD LEU2 marker for transformant selection. Minimal medium for transformants in liquid culture: 0.67% yeast nitrogen substrate (“Difco”), 2% D-
Glucose, 100 mg / l histidine and tryptophan: were grown overnight at 30 ° C. with shaking. Cells were harvested by centrifugation, suspended in a minimum volume of 0.1 M potassium phosphate buffer containing 1 mM NAD +, pH 6.8, and ice-cooled in a bead beater device ("Biospec product"). Destroyed for a minute. D
-Arabitol-grown K. terigena cell extract was used as a positive control in these experiments and pAAH5-converted DBY746 was used as a negative control. The results presented in Table 2 show that the D-arabitol dehydrogenase gene isolated from K. terigena was effectively expressed in yeast.

Example 3 Structure of yeast vector for overexpression of xylitol dehydrogenase and D-arabitol dehydrogenase genes Yeast (Pichia stipitis gene XYL2 which encodes xylitol dehydrogenase)
Known nucleotide sequence of (Ktter, etc., Cu
rr. Genet., 18: 493-500 (1990), was used to synthesize an oligonucleotide for cloning of this gene by polymerase chain reaction. Two kinds of oligonucleotides: CGAATTCTAGACCACCCTAAGTCGTCCC (5'-oligonucleotide) [SEQ ID NO: 1] and TTCAAGAATTCAAGAAACTCACGTGATGC (3'-oligonucleotide) [SEQ ID NO: 2] were designed to be 5'-of the PCR product.
And common restriction sites at the 3'end Xba I and Eco
RI was added. Ketter et al., Curr. Genet., 18: 493-500.
According to the numbering used in (1990), 5'-oligonucleotides are annealed at positions 1-24 of XYL2 and 3'-nucleotides are annealed at positions 1531-1560.

Y Pichia Stipichis CBS6054 (Central Bureau Fool Simmel Kutchers, Oosterstraat 1, PO Box 273, 3740AG Bahn, The Netherlands)
Grow overnight in EPD medium (1% yeast extract, 2% peptone, 2% D-glucose), collect cells by centrifugation and wash once with 1M sorbitol solution containing 1 mM EDTA, pH 7.5, Resuspended in the same solution and digested with lithicase (Sigma). Digestion was controlled by monitoring the optical density at a 1: 100 dilution of 600 nm cell suspension in 1% SDS. The digestion was terminated when this value dropped to about 1/7 of the initial value. 1 spheroplast suspension
Dissolved in SDS and 200 μg / ml proteinase K
At 37 ° C. for 30 minutes. After one phenol and two chloroform extractions, the nucleic acids were ethanol precipitated and redissolved in a small amount of TE buffer. Chromosome DN
The incorporation of A was checked by agarose gel electrophoresis. The average DNA fragment size was larger than 50 kb. P
CR was performed using Tag DNA Polymerase (Boehringer) in the supplier's buffer. Thermal cycle is 93 ℃ -30
Seconds were 55 ° C for 30 seconds and 72 ° C for 60 seconds. The PCR product is chloroform extracted, ethanol precipitated, and
Digested with EcoR I and Xba I under standard conditions.
After agarose gel purification, the DNA fragment was cloned into Xba I and EcoR I cut pUC18 (plasmid pUC (XYL2)). Subsequent restriction analysis confirmed that the restriction map of the cloned fragment corresponded to the nucleotide sequence of the P. stipitis XYL2 gene.

The yeast plasmid for overexpressing D-arabitol dehydrogenase and xylitol dehydrogenase was constructed as shown by FIGS. 3 and 4. To alter the flanking restriction sites of the D-arabitol dehydrogenase expression cassette of plasmid pYARD, the entire cassette was deleted by BamHI digestion and BamHI split pUC1.
Cloned to 8. The resulting plasmid pUC (YARD) is Sa
digested with l I and EcoR I, and only one
The 2.0 kb DNA fragment was isolated by preparative gel electrophoresis. This fragment was ligated with the 1.6 kb Hind III-EcoR I DNA fragment isolated from plasmid pUC (XYL2) and the E. coli yeast shuttle vector
A 6.6 kb fragment of pJDB207 (Beggs, J.
D., Nature, 275: 104-109 (1978)) with Hind III and
Digested with Sal I. Plasmid pJDB (AX) -16
Was isolated after conversion of E. coli using the above ligation mixture. This plasmid is replicable in both E. coli and Saccharomyces cerevisiae. In S. cerevisiae it lends itself to high level synthesis of both D-arabitol dehydrogenase and xylitol dehydrogenase. A linear form of plasmid pSRT303D (Jean Pipepack (Je
arnpipatkul), Mol. Gen. Genet., 206: 88-94 (198).
By the ligation reaction of 7)), the plasmid pSRT (AX) -9 was synthesized.

Example 4 Structure of yeast strain secreting xylitol Zygosaccharomyce
s rouxii) ATCC 13356 was transformed with the plasmid pSRT (AX) -9 by a slight modification of the method previously described (Ushio, K. et al., J. Ferment. Tech.
nol., 66: 481-488 (1988)). Briefly, Z. rouxii cells were grown overnight in YEPD medium (giving a culture with an optical density of 3-5 at 600 nm),
Collected by low speed centrifugation, 1M sorbitol, 1mM EDTA solution,
Washed twice in pH 7.5, resuspended in 1/5 initial culture volume of the same solution containing 1% 2-mercaptoethanol, and digested with lithicase (Sigma) at room temperature. . After digestion, an appropriate aliquot of the cell suspension was diluted in 1% SDS solution and the optical density of the diluted sample was measured at 600 nm. This value is the initial value 1
When it fell to / 7, the digestion was stopped by cooling the suspension on ice and washing (10 min, 1000 rpm centrifugation, 0 ° C.) until the mercaptoethanol odor was no longer detectable. Spheroplasts were washed once with cold 0.3M calcium chloride solution in 1M sorbitol and resuspended in 1/4 of the initial culture volume of the same solution. 200 μl aliquot of this suspension and 10-20 μg of plasmid DNA
Were mixed and incubated at 0 ° C. for 40 minutes. 0.8 ml ice-cold 50% PEG-6000 solution containing 0.3M calcium chloride was added to the spheroplast suspension and the cold culture was continued for 1 hour. Spheroplasts were concentrated by centrifugation in a table-top centrifuge at 400 rpm for 10 minutes, resuspended in 2 ml YEPD containing 1M sorbitol and left overnight at room temperature for regeneration. The regenerated cells were plated on YEPD plates containing 50-100 μg / ml gentamicin and incubated at 30 ° C for 4-6 days.

Transformants were grown in liquid YEPD medium and cell extracts were added.
Prepared as described for S. cerevisiae (Example 2), and the activity of D-rabitol dehydrogenase and xylitol dehydrogenase was measured. The results of these measurements were compared in Table 3 with similar measurements made in other organisms. They show that both genes were effectively expressed in Z. rouxii.

Z. rouxii ATCC 13356 transformed with pSRT (AX) -9
Cells in 50 ml YE containing 50 μg / ml gentamicin
It was grown in PD for 2 days, collected by centrifugation and inoculated into 100 ml YEPD containing 25 wt% D-glucose and 50 μg / ml gentamicin. This culture was grown at 1000C on a rotary shaker (200 rpm) in a 1000 ml flask. In another experiment (Experiment 2), the same medium without yeast extract (low phosphate medium) was used. The xylitol content in the culture broth was analyzed by standard HPLC and gas chromatography. The results are shown in Table 4. No xylitol was detected in the culture medium of Z. rouxii which was not converted in the same medium (without gentamicin).

A similar scheme can be used to construct xylitol-producing strains from other carbon sources. For example, Candida tropicalis can convert n-alkanes to D-arabitol in good yields (Hattori, K. and Suzuki T.,
Agric. Biol. Chem., 38: 1875-1881 (1974)). A 4.7 kb Sal I flask from plasmid pJDB (AX) -9 can be inserted into plasmid pCU1 (Haas,
L. et al., J. Bacteriol., 172: 4571-4577 (1990)), and C. tropicalis strain SU-2 (ura3). Alternatively, the same expression cassette can be transformed into the prototrophic C. tropicalis strain on a plasmid vector carrying a dominant selectable marker.

Example 5 Expression of arabitol dehydrogenase and xylitol dehydrogenase and Tolulopsis candida
The structure of the integrated dominant selection vector for the transformation of dida) Chromosomal DNA was isolated from T. candida (ATCC 20214) by a method similar to the standard method used for S. cerevisiae. However, the production of T. candidas ferroplasts requires about 50,00 per 10 g of cells to obtain effective cell wall lysis.
It requires a high concentration of 0 U of lithicase (Sigma) and a long culture time of 5 to 6 hours to overnight culture at room temperature. Buffer for spheroplast production is 1 mM containing 1M sorbitol and 1% mercaptoethanol.
It was EDTA, pH 8. The spheroplasts were washed 3 times with the same buffer (without mercaptoethanol) and 15
Dissolved in ml 1% SDS. Two phenol extractions were performed immediately after cell lysis and the DNA was precipitated by addition of 2 volumes of ethanol and centrifugation (10,000 rpm for 5 minutes). The DNA was washed twice with 70% ethanol and dried under vacuum. 5 ml of 10 mM DNA containing 1 mM EDTA
Dissolve in Tris-HCl buffer and add RNAse A at 10 μg / ml
The concentration was added and the solution was incubated for 1 hour at 37 ° C. DNA incorporation was confirmed by agarose gel electrophoresis using uncleaved lambda DNA as a molecular weight control.

200 μg of T. candida chromosomal DNA was added to Hind III and Ec
Cleaved with oR I and digested product 0.7% (8 × 15 × 0.8cm)
Applied on a preparative agarose gel into 6 cm wide wells and separated by electrophoresis. A 1 cm wide piece of gel was cut from the gel and blotted onto a positively charged nylon membrane (Boehringer 1209 299). The bleeding point is the plasmid pAT68 (.K Sugihara, etc., Agric.Biol.Ch
em., 50 (6): 1503-151 (1986)), deleted with Sal I from Zygosaccha.
romyces bailii) rDNA was examined using a 10 kb DNA fragment. The probe was labeled and smeared in using the DIG DNA labeling and detection kit (Boehringer 1093 657) according to the manufacturer's instructions. about
Three hybridization bands were observed corresponding to DNA fragments of 4.5, 2.7 and 1.1 kb. Using the blot point as a control, the band corresponding to the largest (4.5 kb) hybridizing DNA fragment was cut from the rest of the preparative gel, the DNA was electroeluted and pUC19 cut with EcoR I and Hind III. And ligated.

The ligation mixture was used to transform E. coli. The transformed bacteria were charged with a charged nylon membrane (Bio-Rad) placed on the agar surface of a plate containing LB medium with ampicillin.
162-0164). After 24 hours of incubation at 37 ° C., the membranes were lifted and in situ lysis of bacterial colonies was performed according to the manufacturer's instructions. A replica plate was not needed because E. coli permeates this type of membrane and there is a visible trace of all bacterial colonies on the agar surface after lifting the filter. Membranes were probed with the same Z. vailli rDNA fragment using the same DIG detection kit as above. A large number of positive clones were identified (about 2-5% of all clones). Restriction analysis of plasmid microformulations from 8 hybridization positive clones and 4 hybridization negative clones was performed with EcoR I, Hind III and EcoR.
Performed using a mixture of V. All hybrid positive clones produced the same restriction fragment pattern (with characteristic fragments of 0.55 and 1.5 kb),
The same pattern of hybridization negative clones were all different. Plasmid DNA from one of the hybridization positive clones was isolated on a preparative balance and pTCrD
I named it NA. It was concluded that the cloned piece was a fragment of T. candida rDNA because 1) it hybridized strongly with Z. bailli rDNA and 2) it was frequently and partially enriched in T. candida. Candida chromosome DN
Because it was cloned from the A digest (rDNA is known to be expressed in yeast in about 100 copies). A partial restriction map of the cloned DNA fragment is shown in FIG.

A plasmid combining the T. candida rDNA fragment with a positive selection marker was constructed as follows. Plasmid pUT332 (Gatignol, A.
Et al., Gene, 91: 35-41 (1990)) by Hind III and Kpn I.
4.5 kb Hind III-E from pTCrDNA and pUC19 which had been digested with E. coli, the 1.3 kb DNA fragment was isolated by agarose gel electrophoresis and digested with EcoR I and Kpn I.
Ligation reaction was performed with the coRi fragment (Fig. 6). The ligation mixture was transformed into E. coli and the plasmid pTC (PHL
Clones carrying E) were identified by restriction analysis.

PTC (PHLE) was partially digested with Sal I and the linear plasmid was purified by agarose gel electrophoresis. 5 kb Sal I isolated from pJDB (AX) -16
The fragment was ligated (Example 2). The plasmid pTC (AX) was identified in the clones obtained after conversion of this ligation reaction mixture into E. coli (Fig. 6). This plasmid contains the following functional elements: a) a bacterial phleomycin-resistance gene under the control of yeast promoters and transcription terminators, which allows direct selection of yeast cells transformed by this plasmid, b) T A piece of T. candida rDNA that provides the target for homologous recombination with the Candida chromosome and improves conversion efficiency, c) arabitol-dehydrogenase and xylitol dehydration for the synthesis of the two enzymes of the arabitol-xylitol conversion process. Expression cassette for elementary enzyme.

Example 6 Transformation of T. candida and analysis of xylitol production The plasmid pTC (AX) was used to transform Tolulopsis candida strain ATCC20214. T. candida was grown for 36 hours in YEPD medium containing 10% glucose. Cells were harvested by centrifugation (2000 rpm, 10 min, 4 ° C) and washed 3 times with sterile 1M sorbitol. Suspend the cell pellet in an equal volume of cold 1M sorbitol and
1 aliquot was mixed with pUT (AX) DNA (20-100 μg) and transferred into an ice-cold 2 mm electrode gap electroporation cuvette and electroporated using the Invitrongen Electroporator apparatus at the following settings: Done: Voltage 1800V, capacitance 50μF, parallel resistance 150Ω. The cells were transferred into 2 ml YEPD containing 1M sorbitol and cultured on a shaker at 30 ° C overnight. The transformed cells were collected by low speed centrifugation and plated on plates containing YEPD medium titrated to pH 7.5 and containing 30 μg / ml phleomycin. The plates were incubated at 30 ° C for 7-10 days. Most of the yeast colonies that grew during this time were background mutants because a similar number of colonies appeared on the control plate (which contained similarly treated cells but no added DNA). there were. In order to distinguish between the spontaneous mutant and the true transformant, chromosomal DNA was isolated from 72 individual yeast colonies by the scale-down method for isolating T. candida chromosomal DNA described above. 10 μg of these DNAs were cut with a mixture of EcoR I and BamH I. The digests were separated on a 1% agarose gel and then blotted onto positively charged nylon membranes as described in Example 5. The bleed point contains the arabitol-dehydrogenase sequence and the pUC sequence (to avoid possible hybridization between homologous yeast sequences) but the DN of the yeast source.
The A fragment was examined with DNA from the plasmid pADH (Example 2) which does not contain the A fragment. The probe was labeled and the bleed spot was smeared using the DIG DNA labeling and detection kit (Boehringer 1093 657).
Only one clone (T. Candida :: pTC (AX)) with a hybridization signal comparable to the structure of the convertible plasmid (3 bands in the 2-3 kb region) showed very low conversion efficiency. It's been found. A positive hybridization signal was detected for the other clone, but only one hybridization band position (approximately 5-7 kb) was pTC.
Only the (AX) fragment was shown to integrate into the yeast chromosome or some transposition occurred at the integration site. We deduced that the plasmid had integrated into the T. candida chromosome. This presumption is that T. candida :: pTC (AX) after growth in selective media and cloning.
It is consistent with the observation that all clones of E. coli have a phleomycin resistance phenotype.

T. candida :: pTC (AX) transformants were grown in YEPD medium containing 10% glucose for 36 hours, and arabitol dehydrogenase and xylitol dehydrogenase activities as described in Example 4. It was measured. The results are shown in Table 5.

The activity of xylitol-dehydrogenase was not significantly increased over the activity level of endogenous T. candidaxylitol dehydrogenase. The activities of the plasmid-encoded arabitol-dehydrogenase (EC1.1.1.11) are endogenously synonymous but different (ribulose-producing, EC1.1.
It is difficult to separate from the activity of 1.). The only final conclusion from this experiment was that the expression levels of both enzymes were much lower than Z. rouxii. T. Candida :: pT
Attempts to increase the plasmid copy number and the expression levels of the two dehydrogenases of the integrating plasmid by culturing on a medium while increasing the concentration of C (AX) with increased phleomycin were unsuccessful.

Xylitol production by T. candida :: pTC (AX)
It was tested after growing in YEPD containing 10% glucose for 5-7 days. In three separate experiments, the transformants produced 1.1, 1.6, and 0.9 g / l xylitol, but no xylitol was detected by HPLC in the wild-type T. candida culture medium. The detection limit of the analytical method we used is less than 0.1 g / l. Therefore, it can be concluded that xylitol production by T. candida :: pTC (AX) is actually measured by the plasmid.

Example 7 Candida polymorpha (Candida) using the arabitol-dehydrogenase and xylitol-dehydrogenase genes
In order to add the arabitol dehydrogenase and xylitol dehydrogenase genes into Candida polymorpha, a mutant in the orotidine phosphate dehydrogenase gene (hereinafter also referred to as URA3) was modified by Boeke et al. Method (Boeke, JD et al., Mol. Gen. Genet., 197: 345-346 (198
4)) was used to isolate. C. polymorpha strain ATCC202
Grow 13 in YEPD for 24 hours and centrifuge cells (2000 rpm, 1
(0 min), washed twice with water, and suspended in 3 volumes of sterile 0.1 M discrete sodium buffer, pH 7.0. Ethyl methanesulfonate was added to 1% concentration and cells were incubated for 2 hours at room temperature. Cells
The reactions were stopped by transferring to 0.1 M sodium thiosulfate solution and washing them 3 times with sterile water. Mutagenized cells were transferred into 0.5 liter of YEPD and grown at 30 ° C. with shaking for 2 days. The yeast were collected by centrifugation, washed twice with water and transferred into 1 liter of medium containing 0.7% yeast nitrogen base (Difco), 2% glucose (SC medium) and 30 in a rotary shaker. Incubated at ℃ for 24 hours. 1 mg of nystatin was added to the culture and the culture was continued for 4 hours.
Nystatin-treated cells were separated from the culture medium by centrifugation, washed twice with water and containing 50 mg / l uracil.
Transferred to 1 liter of SC medium. 5 cells in a rotary shaker
Incubate for days and then 50 mg / liter uracil and 1
Plates were plated on SC medium plates containing g / l fluoroorotic acid. After culturing the plates for 2 weeks at 30 ° C., approximately 400 fluoroorotic acid-resistant colonies were obtained, all of which were tested for uracil auxotrophy. Five uracil-dependent clones were isolated. However, three clones grew in medium without uracil, but at a reduced rate. Two clones with a clear uracil-dependent phenotype (designated C. polymorpha U-2 and C. polymorpha U-5) were used for conversion experiments.

Cloning of C. polymorpha URA3 gene was performed by a general method. Chromosomal DNA was isolated by the method described in Example 5. The DNA was partially cut with Sau3A and fractionated on an agarose gel. Five or six fractions were collected and their molecular size distribution was examined by analytical gel electrophoresis. Fractions in the 5-10 kb range were used for cloning experiments. The vector used for library construction, pYEp13 (Broach et al., Gene, 8:12).
1-133 (1979) contains the S. cerevisiae LEU2 gene, the 2μ origin of replication and a unique restriction site for BamHI. The vector was cut with BamHI, purified by agarose gel electrophoresis, and dephosphorylated with bacterial alkaline phosphatase. The vector to insert ratio and reaction volume were varied to test several independent vector formulations and ligation conditions in small experiments to optimize the maximum number of transformants and the highest percentage of recombinant clones ( Analyzed by restriction analysis of plasmid micropreparations from irregular clones). Large-scale ligation was performed using optimized conditions and transformed into E. coli strain LC1-BLEU. The constructed library contained about 15,000 primary transformants, about 90% of which were insert-containing.

Yeast strain DBY746 (MATalpha, leu2-3,112, his3-A
1, trp1-289, ura3-52) were transformed with the C. polymorpha gene library. About 20 μg of plasmid DN
A is used separately and the transformants are plated on one plate supplemented with uracil, tryptophan and histidine (ie using only leucine selection)
Each library pool was transformed into S. cerevisiae. 3,000-10,000 yeast transformants were obtained per plate. The yeast transformants were then replica plated on plates with minimal medium supplemented with tryptophan and histidine (plates devoid of uracil). A control replica on histidine-histidine (a plate devoid of uracil) was also made. Control replicas on plates with histidine removed and tryptophan removed were also made. 1-4 uracil-dependent clones appeared on almost all plates. Histidine-dependent and tryptophan-dependent isolates were also obtained, but the number of isolates was
It was 2-3 times lower than the URA3 isolate.

Plasmids from 6 of the uracil-dependent clones were rescued in E. coli, isolated on a production scale and used to reconvert DBY746 to leucine prototrophy. 10-20 irregular colonies from each transformation were then examined for uracil dependence. Five of the six rescued plasmids converted DBY746 to the Leu + Ura + phenotype. Restriction analysis of the five named plasmids revealed very similar restriction patterns. These patterns are so complex that it is difficult to produce clear restriction maps of cloned fragments. However, Hind III digestion caused DN in all clones.
It was found that a fragment covering most of the A insert (approximately 4.5 kb) was generated. This fragment, pCP291-, from one of the C. polymorpha URA3 isolates was purified by agarose gel electrophoresis and subcloned into HindIII partially digested pJDB (AX). Plasmid pCPU (AX) isolated as a result of this cloning experiment
The structure of is shown in Figure 7A.Z.

The conversion of both C. polymorpha U-2 and C. polymorpha U-5 was attempted using the same electroporation conditions as described in Example 6. Electroporated cells,
After shaking overnight in YEPD containing 1M sorbitol,
Plates were plated twice on SC medium plates. 10 at 30 ° C
After culturing for about 100 days, about 100 colonies were observed on plates containing C. polymorpha U-2 transformed with pCPU (AX), while control plates (treated in the same way with no added DNA). The number of colonies on the cells (containing the cells of this strain) was 14. C. polymorpha U-5 showed no significant effect in conversion experiments on controls without DNA. C. Three irregular clones from the polymorpha U-2 conversion plate were first streaked on fresh SC medium and these streaks were used to prepare 100 ml of YEPD culture containing 15% glucose. Was inoculated. Control cultures were inoculated with C. polymorpha U-2. After culturing on a rotary shaker at 30 ° C. for 10 days, the xylitol content in the culture medium was analyzed by HPLC. The results of this experiment are shown in Table 6.

Considerable variability in xylitol production levels was observed between different clones. It may be the effect of integration of the plasmid pCPU (AX) at different locations on the C. polymorpha chromosome. Strain C. polymorpha U-2 :: p
CPU (AX) -2 is probably a revertant and not a true transformant. However, these experiments clearly showed that an arabitol-xylitol step could also be incorporated into C. polymorpha.

Example 8 Cloning of Oxidative Phosphate Pentose Step Yeasts and Their Overexpression in Osmophilic Yeasts The first enzyme of the oxidative phosphate pentose step, D-glucose-6-phosphate dehydrogenase, was added to S. cerevisiae. Encoded by the AZWF1 gene. The sequence of this gene is known (Nogae T. and Johnston, M., Gene, 96: 161-19 (1990); Thomas D. et al., The EMBO J., 10: 547-553 (19
91)). Two kinds of oligonucleotides having a gene containing 600 bp of the 5'-noncoding region and 450 bp of the 3'-noncoding region which are the complete coding region: CAGGCCGTCGACAAGGATCTCGTCTC (5'-oligonucleotide) [SEQ ID NO: 3] And cloned by PCR using AATTAGTCGACCGTTAATTGGGGCCACTGAGGC (3'-oligonucleotide) [SEQ ID NO: 4]. Nogae, T. and Johnston, M., Gene,
96: 161-19 (1990), numbering the D-glucose-6-phosphate dehydrogenase, the 5'-oligonucleotide was annealed at position 982-1007, and the 3'-oligonucleotide Was annealed at positions 3523-3555. Chromosomal DNA
Was isolated from S. cerevisiae strain GRF18 by the method described in Example 3. PCR parameters are in Example 3
It was the same as the inside. Amplified DN containing the ZWF1 gene
The A fragment was digested with Sal I and cloned into pUC19 digested with the same restriction enzymes to generate plasmid pUC (ZW
F) occurred. The identity of the cloned gene was examined by restriction analysis.

The second enzyme of phosphate pentose, 6-phosphogluconate dehydrogenase, was encoded by the gnd gene in E. coli. The oligonucleotide sequence of this gene is known (Nasoff, MS et al., Gene, 27: 253-264 (19
84)). In order to clone the gnd gene from E. coli, chromosomal DNA was cloned from E. coli strain HB101 into Klebsiella
It was isolated by the same method used for the isolation of Terigena DNA (Example 1). Oligonucleotides for PCR amplification of gnd gene (GCGAAGCTTAAAAATGTCCAAGCAACAGATCGGCG [SEQ ID NO:
5] and GCGAAGCTTAGATTAATCCAGCCATTCGGTATGG [SEQ ID NO: 6] to amplify only the coding region and add a Hind III site immediately upstream of the reprogramming codon and immediately downstream of the stop codon. Nasov, MS et al., Gene, 27: 253-264 (198
In the D-glucose-6-phosphate dehydrogenase numbering as described in 4), the 5'-oligonucleotide was annealed at positions 56-78 and the 3'-oligonucleotide was at positions 1422-1468. Annealed. Hin the amplified DNA fragment
Vector pUC digested with dIII and digested with HindIII
It was ligated with 19. 10 of the resulting plasmid pUC (gnd)
One unique and clearly identical clone was pooled. This was done to avoid possible problems with sequence errors that may have been added during PCR amplification. The expression vector pAAH5 (Ammerer, Meth. Enzymol., 101: 192-203 (19
83)) to fuse the coding region of the gnd gene with the S. cerevisiae ADC I promoter and transcription terminator. The resulting plasmid pAAH (gn
Several independent clones of d) were transferred into the S. cerevisiae strain GRF18 by the lithium chloride method (Ito et al., J. Bacteriol., 153: 163-168 (1983)) and 6-phospho-D.
-The activity of gluconate dehydrogenase was measured in the transformants. In all of the transformants, the activity of 6-phospho-D-gluconate dehydrogenase was increased several times as compared to the non-transformed host because bacterial 6-phospho-D-gluconate dehydrogenase was found in yeast. It shows that it can be effectively expressed. PAAH (gn produced the highest activity in yeast)
The clone of d) was selected for subsequent construction. Cloning of the ZWF1 and gnd genes and the structure of the pAAH (gnd) plasmid are shown in Figures 8 and 8a.

To simultaneously overexpress both the D-glucose-6-phosphate dehydrogenase and 6-phospho-D-gluconate dehydrogenase genes in osmotic tolerant yeast hosts,
The plasmid pSRT (ZG) was constructed. The method for constructing this plasmid is shown in FIG. Briefly, the 6-phospho-D-gluconate dehydrogenase expression cassette from plasmid pAAH (gnd) was cloned into a 3.1 kb BamHI DNA
The fragment was transferred into BamHI cut pUC19. The resulting plasmid pUC (ADHgnd) was split with Sac I and Xba I and the 3.1 kb DNA fragment was purified by agarose gel electrophoresis. This fragment was obtained by digestion with two other DNA fragments, Sac I and partial digestion with Pst I, resulting in pUC (ZW
The 2.5 kb fragment of F) was ligated to the vector fragment of plasmid pSRT (AX) -9 (Example 3) digested with Pst I and Xba I. The resulting plasmid pSRT
The structure of (ZG) was confirmed by restriction analysis. After conversion of Z. rouxii ATCC 13356 with pSRT (ZG) (by the method described in Example 4), D-glucose-6-phosphate dehydrogenase and 6-phospho-D-
The activity of gluconate dehydrogenase was measured in the transformed strain. Both enzymes were about 20 times more active in the transformed strains than the unconverted controls (Table 7). Similar methods can be used to obtain overexpression of two genes encoding enzymes for the oxidative part of the phosphate pentose process in other yeast species. However, integration conversion is the only useful method for such a host because there is no vector in most yeast species other than Saccharomyces or Digosaccharomyces that can be retained as an extrachromosomal plasmid. A preferred type of integration vector is a vector targeted for integration at the ribosomal DNA locus, because this type of vector provides high copy number integration and consequently higher expression levels (Lopez). (Lopes), TS, etc.
Gene, 79: 199-206 1989)).

Example 9 Construction of transketolase isomers in yeast Transketolase isomers in yeast are most commonly obtained by site-directed gene disruption methods, but general chemical mutagenesis is also applicable. Applying gene disruption techniques generally requires a homologous transketolase gene cloned from the yeast species for which mutagenesis is desired, although sometimes heterologous clones from closely related species can also be used. it can. The sequence of the transketolase from S. cerevisiae is known (Fletch (Fletch
er), TS and Kwee, IL, EMBL DNA sequence library, ID: SCTRANSK, accession number M63302).
This sequence is used to clone the S. cerevisiae transketolase gene by PCR. Oligonucleotides AGCTCTAGAAATGACTCAATTCACTGACATTGATAAGCTAGCCG [SEQ ID NO: 8] and from S. cerevisiae for amplification of a DNA fragment containing the transketolase gene. Chromosomal DNA of (isolated as above) was used. (Fletcher, TS and Wee, I.
L., EMBL DNA Sequence Library, ID: SCTRANSK, Accession No. M63302) to locate the 5'-oligonucleotide in the transketolase numbering as described in
Annealed at 269-304 and 3'-oligonucleotides at positions 2271-2305. The fragment was digested with Xba I and EcoR I and cloned in pUC19 which had been cleaved with the same enzymes. Restriction analysis of the resulting plasmid pUC (TKT) confirmed the identity of the cloned DNA fragment. This plasmid was cut with Bgl II and Cla I and the large DNA fragment was purified by agarose electrophoresis. This fragment was isolated from plasmid pUT332 as two DNA fragments (Gatignol (Gatigno).
l), A. et al., Gene, 91: 35-41 (1990)) ;; URA3 gene and Cla I-Pst I fragment carrying the 3'-part of the bleomycin resistance gene and yeast TEF1 (transcription elongation factor 1). BamHI carrying a promoter and the 5'-part of the bleomycin resistance gene coding sequence.
Ligated with Pst I DNA fragment. Plasmid pTKT (BLURA) was isolated after transformation of E. coli with the above ligation mixture and restriction analysis of plasmid clones. This plasmid contains the coding sequence for the S. cerevisiae transketolase gene, in which the 90 bp fragment between the Cla I and Bgl II sites is the TEF.
It is replaced by two selectable markers in S. cerevisiae under the control of the 1 promoter and the CYC1 transcription terminator, the URA3 gene and a fragment of the bleomycin resistance gene. Using this plasmid, the lithium chloride method (Ito et al., J. Bacterol., 153: 1)
63-168 (1983)) S. cerevisiae strain DBY746 (A
TCC44773; MATα his3A1 leu2−3,112 ura3−52 trp
l-289) was converted to pleomycin resistance (10 mg / ml phleomycin in YEPD medium). The transformants were tested for uracil prototrophy and ability to grow on D-xylulose. Five URA3 clones, three of which showed reduced growth on D-xylulose, were grown in 100 ml of culture and shaken with glass beads to produce a cell extract. , And transketolase activity was measured in the crude extract. The test is 3m
M magnesium chloride, 0.1 mM thiamine pyrophosphate, 0.25 mM
NADH and 0.1M containing 0.2mg / ml bovine serum albumin
Performed in glycyl-glycine buffer, pH 7.6. Immediately before measurement, 3 μl containing 0.5 M D-xylose-5-phosphate and 0.5 M ribose-5-phosphate
Was added to 1 ml of the above buffer, followed by 7.5 U of triose phosphate isomerase and 1.5 U of α-glycerophosphate dehydrogenase (both from Sigma).
Was added. A cell extract of strain DBY746 was used as a control. The transketolase activity in the crude extract of DBY746 and the two non-delayed transformants on D-xylose was readily measurable at approximately 0.25 U / mg protein.
Three transformants of reduced growth on D-xylose had transketolase activity (at least 20-fold lower than wild type) below the detection limit of our method. D-
The activities of glucose-6-phosphate dehydrogenase and 6-phospho-D-gluconate dehydrogenase were also measured as controls for possible enzyme inactivation during the production of cell extracts. The activities of these two enzymes were very similar in all 6 strains. Therefore, it was concluded that three poorly growing clones on D-xylose contained a mutation in the transketolase gene. Growth of strains carrying the disrupted transketolase gene was somewhat delayed on synthetic medium lacking the aromatic amino acids phenylalanine and tyrosine, but the effect was less than the effect of this mutant on D-xylose utilization.

Transketolase genes from other yeast species are described above.
It can be easily cloned by complementation of transketolase variants in S. cerevisiae. Suitably, a gene library of non-Saccharomyces yeast strains is constructed in a suitable vector (eg the known plasmid YEp13) and this library is obtained by transketolase mutants (eg by gene disruption as described above). Mutants)
Cloning can be performed by converting to S. cerevisiae strains carrying S. cerevisiae and selecting for transformants with restored growth on D-xylose. Plasmid
DNA can be rescued from such D-xylose-positive transformants and used to transform the same recipient strains. All clones from this transformant should grow well on D-xylose. Transketolase activity can be measured from transformants,
And a significant level of its re-emergence is proof of the identity of the cloned gene. Additional and final proof is to sequence a short stretch of cloned DNA and
This is done by finding a piece of sequence homologous to the S. cerevisiae transketolase gene sequence or by demonstrating the hybridisation of a cloned DNA fragment using an autologous transketolase clone from S. cerevisiae. Alternatively, the cloning method may be based on DNA hybridization as the primary method for selecting clones containing the transketolase gene from a non-Saccharomyces yeast gene library. Fragments of the S. cerevisiae transketolase gene can be used as probes for colony or plaque hybridization experiments, and the clones giving the strongest hybridization signals can be further analyzed by partial sequencing.

Whatever method is used to clone the transketolase gene from the selected yeast species, the subsequent steps to obtain the mutant transketolase gene in this yeast are the same. The cloned DNA fragment should be identified by creating a partial restriction map and preferably localizing the coding region of the transketolase gene. A piece of DNA that could serve as a selectable marker in the selected yeast was then inserted into a DNA fragment containing the transketolase gene no closer than a few hundred bp from either end of this fragment. Cassettes containing the bacterial phleomycin gene under the control of a strong yeast promoter, such as the above cassette from plasmid pUT332 could be used for many yeast species, eg as a dominant selectable marker. A method similar to the above method for disrupting the coding region of the transketolase gene with the inserted DNA or, preferably, the inserted DNA structure is then obtained in S. cerevisiae with transketolase variants. It is essential to insert the DNA fragment carrying the selectable marker in such a way that it can be used to disrupt the chromosomal copy of the transketolase gene in the yeast selected by.
Any suitable conversion method can be used, the preferred methods being protoplast conversion and electroporation. Selection of clones carrying the disrupted transketolase gene can be performed in the same manner as the above method for S. cerevisiae. Also, structural analysis of transketolase chromosomal regions by Southern hybridization can be used as a modification or in addition to other methods.

Example 10 Cloning of the D-librokinase gene The preferred method for cloning the D-ribrokinase gene is similar to the method described in Example 1 for cloning the D-arabitol dehydrogenase. For example, E. coli and Klebsiella aerogenes (Klebsi
It is known that D-librokinase in several bacteria such as E. aerogenes) is part of the ribitol-utilizing operon (Loviny, T. et al., Biochem. J., 23.
0: 579-585 (1985)). It is also known that E. coli B strain does not contain this operon and therefore cannot utilize ribitol as a carbon source. Therefore, E. coli B strains (eg common laboratory strains HB101 and JM103 or strains which can be converted with high efficiency, eg SCS1 or XL1 from Stratagen).
-Blue) to any suitable vector, preferably pUC19
The gene library of ribitol-utilizing bacteria constructed in can be used for conversion. Non-pathogenic bacterial species, such as Klebsiella terrigena, are suitable source organisms for the isolation of the D-librokinase gene. E. coli transformants capable of growing on minimal medium containing ribitol as the sole carbon source can then be selected. Plasmid DNA from such ribitol-positive clones can be isolated and used to retransform E. coli B strains. All transformants from such reconversion should be grown on ribitol as the sole carbon source. A restriction map of the cloned insert can then be created. Using this map, various deleted derivatives of the original clone can be produced and analyzed for possession of the ribitol operon by the functional tests described above. The size of the DNA fragment carrying the ribitol operon can be minimized to 3.5-4 kb (size of this operon in K. aerogenes) by making several consecutive deletions. Finally, the (partial) nucleotide sequence of the D-librokinase gene was determined and the code for this gene was made using the appropriate naturally occurring restriction sites or using known PCR techniques for the introduction of such sites. It is possible to excite the attached region. D
A vector suitable for conversion of the expression cassette in another host, preferably yeast, for example by fusing the coding region of the D-librokinase gene with an appropriate promoter and transcription terminator, in another host, preferably yeast. , Transformants are obtained and finally expressed by methods including standard steps such as varying the effects of D-riblokinase expression.

Example 11 Cloning and overexpression of the D-ribulose-5-phosphate-3-epimerase gene The method for isolating the homologous D-ribulose-5-phosphate-3-epimerase from baker's yeast (industrial Saccharomyces cerevisiae yeast) is as follows: Known (Williamson, WT et al., Meth. Enzymol., 9: 605-608.
(1966)). The enzyme can be isolated and the N-terminus as well as the partial internal amino acid sequence can be determined by commonly known methods. The partial amino acid sequence thus obtained can then be used to generate a sequence of oligonucleotides by a method known as back translation, which is then used to carry out the polymerase chain reaction. Can be prepared. The DNA fragment generated by PCR can be used as a hybridization probe to screen a yeast gene library for full-length copies of the D-ribulose-5-phosphate-3-epimerase gene. D-ribulose-in other yeast hosts
A preferred method for overexpressing the 5-phosphate-3-epimerase gene is a vector with a high copy number in the host in which it is desired (eg, for Z. leucii).
pSRT303D vector). Another and more efficient method for overexpressing a gene is to determine at least a partial nucleotide sequence of the D-ribulose-5-phosphate-3-epimerase gene around the translation initiation codon and provide this information to D-ribulose. The method used to isolate the coding sequence for the -5-phosphate-3-epimerase gene and to fuse it with a promoter known to function effectively in the host of choice.

Example 12 Cloning of the D-xylulokinase gene and structure of D-xylulokinase variants Methods for cloning D-xylulokinase (EC 2.7.1.17) from different yeast species have been described (Ho. (H
o), NWY et al., Enzyme Microbiol.Technol., 11: 417-4.
21 (1989); Stevis, PE et al., Appli
ed and Environmental Microbiol., 53: 2975-2977 (19
87)). Also, due to gene disruption in S. cerevisiae, D
-Methods for constructing xylulokinase variants have also been described (Stevis, PE et al., Appl. Biochem. Bi
Otechnol., 20: 327-334 (1989)). D- in other yeast
Similar methods can be used to construct xylulokinase variants. For yeast species other than S. cerevisiae,
The consensus marker used for the D-xylulokinase gene is preferably a dominant antibiotic resistance marker (see Example 9). Alternatively, classical mutant construction methods based on chemical (eg treatment with ethyl methanesulfonate or acriflavine) or physical (ultraviolet, X-ray) mutagenesis can be used. Mutant enrichment is
Mutagenized cells can be grown on D-xylulose as the sole carbon source in the presence of an antibiotic (nystatin) that kills only the growing cells. D-
Xylulokinase mutant D as a single carbon source for growth
The property of not being able to utilize xylulose can be used for the selection of variants.

EXAMPLE 13 Strains Producing Xylitol via D-Arabitol in Improved Yield Example 4 utilizes D-arabitol as a key intermediate product from a structurally unrelated carbon source such as D-glucose. The method for constructing a yeast strain capable of producing xylitol by the step of In order to improve the xylitol yield in fermentations with strains utilizing this "D-arabitol process", the D-arabitol yield must be improved. The process of producing D-arabitol from D-glucose in D-arabitol-producing yeast has been described previously (Ingram,
JM et al., J. Bacteriol. 89: 1186-1194 (1965)). D
-Arabitol is produced from D-ribulose-5-phosphate via dephosphorylation and reduction with NADPH-linked D-ribulose reductase. D-ribulose-5 from D-ribulose-6-phosphate by two successive irreversible dehydrogenation steps using D-glucose-6-phosphate dehydrogenase and 6-phospho-D-gluconate dehydrogenase The production of phosphate is a commonly occurring process known as the oxidative alternative as the pentose phosphate (or hexose monophosphate shunt) process. In the non-oxidative alternative of the pentose phosphate process, D-ribulose-5-phosphate was reversibly linked to ribulose-5-phosphate and D-xylulose-.
Isomerized to 5-phosphate. Ribulose-5-phosphate and D-xylulose-5-phosphate are further metabolized by transketolase. Thus, the transketolase can be mutated in the D-arabitol-producing microbial strain, and the fraction of D-ribulose-5-phosphate converted in D-arabitol will be increased. Example 9 describes a method for obtaining transketolase variants. Maximizing the rate of D-rubyrose-5-phosphate biosynthesis by overexpression of the two genes encoding the oxidative alternative enzymes of the phosphate pentose step described above (Example 8) further increased D-arabitol yield. An increase is obtained. D this way
A strain optimized for arabitol yield, then recombinant DNA carrying the xylitol dehydrogenase and D-arabitol dehydrogenase genes (Examples 3 and 4).
The construct is transformed to produce strains with improved xylitol production efficiency.

Example 14 Strains that produce xylitol by an alternative process The method according to Examples 4 and 13 is the most direct method for the construction of microbial strains capable of converting D-glucose and other carbon sources to xylitol. These methods utilize a naturally occurring process to produce D-arabitol from various carbon sources and extend this process by two additional reactions to convert D-arabitol to xylitol. However, this step is not the only possible step. Other processes can be constructed that produce xylitol as the final metabolite and do not contain D-arabitol as an intermediate. That is, the steps from the same precursor D-ribulose-5-phosphate to xylitol can be realized by different continuous reactions. D-ribulose-
5-Phosphate-3-epimerase (Example 11) can effectively convert D-ribulose-5-phosphate to D-xylulose-5-phosphate, and further conversion of D-xylulose-5-phosphate is possible. The collected D-xylulose-5-phosphate is the same non-drug as D-ribulose-5-phosphate if prevented by a mutation in the transketolase gene.
Dephosphorylation with a specific phosphatase (Ingram, JM et al., J. Bacteriol., 89: 1186-11.
94 (1965)), and can be reduced to xylitol by xylitol dehydrogenase (Example 3). In order to realize this process, a futile cycle: D-xylulose-5-phosphate → D-xylulose → D-xylulose-5-phosphate of D-xylulokinase gene (Example 12) for minimizing energy loss by phosphate Requires further inactivation. An additional genetic change, D
-Minimizing concurrent D-arabitol production by such strains by capturing non-specific phosphatase produced D-ribulose by introducing and (over) expression of the ribulokinase gene (EC2.7.1.47) can do. D-ribulose will in turn be converted to D-ribulose-5-phosphate and further to D-xylulose-5-phosphate.

Example 15 Stability of recombinant Z. rouxii strain under fermenter culture conditions and production of xylitol Selective stability of xylitol production during extended culture (selective medium: Both containing YEPD) and non-selective conditions (using the same medium without G418) were tested. 1 freshly obtained Z. rouxii ATCC 13356
[PSRT (AX) -9)] was transformed in YEPD containing G418 in a volume of 200 ml. Cells were transferred into 50% glycerol solution and frozen in 1 ml aliquots at -70 ° C. Four frozen Z. rouxii [pSRT (AX)-
2) 50ml in selective medium using subsample of 9)]
Cultures and in duplicate in non-selective cultures were inoculated.
After the culture reached the quiescent phase of growth (50-60 hours at 30 ° C and 200 rpm), the sample was tested for pentitol content.
Harvested for HPLC analysis and used 1 ml of culture to inoculate another 50 ml of the same medium (selective or non-selective). The growth-dilution cycle was repeated 4 more times. The conditions of this experiment are similar to the growth of recombinant strains from standard frozen inoculum in large scale fermentation. The results of this experiment are shown in Table 8. As one might expect, the stability of the recombinant strain is higher on selective medium. However, a decrease in xylitol yield was detected only after about 20 generations, even in non-selective media. Under selective conditions, xylitol production was stable for about 30 generations.

A partial sample of transformed Z. rouxii raw material was used to inoculate a 2 liter fermentor containing 1 liter of medium having the following composition (per liter): 0.1 g NaC
l, 6.8g potassium phosphate, 0.5g ammonium sulfate, 20g
Yeast extract and 400 g glucose, 50 mg G481, pH
6.0. Culture conditions are aeration rate 0.5 v / min; stirring 400 rpm; temperature 3
It was 0 ° C.

Figure 10 shows the time course of glucose consumption and xylitol accumulation during this fermentation. The concentration of dissolved oxygen that reflects the respiratory activity of the yeast culture is also shown. Obvious two-step growth was observed, with the first step reaching a plateau in glucose and xylitol concentrations in about 40 hours (less than half of the available glucose was consumed at that time), and the second step was glucose consumption. And when xylitol production resumed after about 200 hours of culture.
The final xylitol concentration was 15 g / l, which was about twice as high as that obtained in flask fermentation.
Two-step growth with a long lag period indicated that spontaneous mutants, possibly with higher alcohol tolerance than the parental strain, were selected. To test this hypothesis, one clone was isolated from the culture at the end of fermentor operation.
This isolate was grown in a fermentor under the same conditions as above. According to the results of this experiment (Fig. 1011), 40 within about 60 hours
It was confirmed that a fully assimilable mutant of 0 g / l glucose was indeed isolated. Experiments also show that the xylitol-producing Z. rouxii strain is also able to assimilate xylitol when all the glucose in the culture medium has been consumed.

All controls are added here as a reference. Although the present invention has been fully described above, those skilled in the art can implement this range over a wide range and with equivalent concentrations, parameters, etc. without affecting the spirit or scope of the invention or its aspects. It will be appreciated that it is possible.

Sequence Listing (1) General Information: (i) Applicants: Harukki, Num. Miasnikov, Andrey N. Apaya Lahti, Yuha H. A. Pastinen, Ossi. (Ii) Title of invention: Production of xylitol (iii) Number of sequences: 8 (iv) Communication address: (A) Recipient: (B) Street: (C) City: (D) State: (E) Country : (F) Zip code: (v) Computer readable format: (A) Medium format: Floppy disk (B) Computer: IBM PC compatible (C) OS used: PC-DOS / MS-DOS (D ) Software: PatentIn Release # 1.0.Ve
rsion # 1.25 (vi) Current application data: (A) Application number: PCT / FI93 / 00450 (B) Application date: November 5, 1993 (C) Classification: (vi) Priority application data: (A) Application number: US 08/110672 (B) Application date: August 24, 1993 (vi) Priority application data: (A) Application number: US 07/973325 (B) Application date: November 5, 1992 ( viii) Information on Agent: (A) Name: (B) Registration Number: (C) Inquiry / License Number: (ix) Information on Telecommunications: (A) Telephone: (B) Fax: (2) Sequence Number Information for: (i) Sequence characteristics: (A) Sequence length: 28 (B) Sequence type: Nucleic acid (C) Number of strands: Both forms (D) Topology: Both forms (xi) Sequence display : SEQ ID NO: 1: (2) Information for SEQ ID NO: 2 (i) Sequence characteristics: (A) Sequence length: 29 (B) Sequence type: Nucleic acid (C) Number of strands: Both forms (D) Topology: Both forms ( xi) Sequence listing: SEQ ID NO: 2: (2) Information for SEQ ID NO: 3 (i) Sequence characteristics: (A) Sequence length: 26 (B) Sequence type: Nucleic acid (C) Number of strands: Both forms (D) Topology: Both forms ( xi) Display of sequences: SEQ ID NO: 3: (2) Information for SEQ ID NO: 4 (i) Sequence characteristics: (A) Sequence length: 33 (B) Sequence type: Nucleic acid (C) Number of strands: Both forms (D) Topology: Both forms ( xi) Sequence listing: SEQ ID NO: 4: (2) Information for SEQ ID NO: 5 (i) Sequence characteristics: (A) Sequence length: 35 (B) Sequence type: Nucleic acid (C) Number of strands: Both forms (D) Topology: Both forms ( xi) Sequence listing: SEQ ID NO: 5: (2) Information for SEQ ID NO: 6 (i) Sequence characteristics: (A) Sequence length: 34 (B) Sequence type: Nucleic acid (C) Number of strands: Both forms (D) Topology: Both forms ( xi) Display of sequence: SEQ ID NO: 6: (2) Information for SEQ ID NO: 7 (i) Sequence characteristics: (A) Sequence length: 44 (B) Sequence type: Nucleic acid (C) Number of strands: Both forms (D) Topology: Both forms ( xi) Display of sequence: SEQ ID NO: 7: (2) Information for SEQ ID NO: 8 (i) Sequence characteristics: (A) Sequence length: 44 (B) Sequence type: Nucleic acid (C) Number of strands: Both forms (D) Topology: Both forms ( xi) Display of sequences: SEQ ID NO: 8:

─────────────────────────────────────────────────── ─── Continuation of the front page (72) Inventor Apaya Lahti Yuha Heikki Antero Finland EFI-00670 Helsinki Kitteny Chinthi 24 Sea (No address) (72) Inventor Paschinen Ossi Ante Finland EFI-02-02 Kantobik Rayakalio D ( (No address display) (56) Reference Japanese Unexamined Patent Publication No. 6-339383 (JP, A) Special Table 7-500492 (JP, A) Special Table 4-503750 (JP, A) Special Table 5-507843 (JP , A) (58) Fields investigated (Int.Cl. ⁷ , DB name) BIOSIS / WPI (DIALOG) PubMed

Claims (25)

(57) [Claims] 1. A method for producing xylitol from a recombinant host, the method comprising: (a) arabitol-producing yeast or an arabitol-producing fungal recombinant host, and D-xylulose-producing D-arabitol dehydrogenase (EC). 1.1.1.11) transforming with the coding DNA and xylitol dehydrogenase (EC 1.1.1.9) coding DNA, (b) growing the recombinant host of (a) above under conditions which provide for the synthesis of xylitol, And (c) a method comprising recovering the xylitol produced in (b) above. 2. The host is D-xylulokinase (EC
The method according to claim 1, which does not express 2.7.1.17). 3. The host is transketolase (EC 2.
The method according to claim 1, which does not express 2.1.1). 4. The host is D-glucose-6-phosphate dehydrogenase (EC 1.1.1.49), 6-phospho-D-gluconate dehydrogenase (EC 1.1.1.4).
4) and further transformed with one or more coding sequences selected from the group consisting of D-ribulose-5-phosphate-3-epimerase (EC 5.1.3.1) coding DNA. the method of. 5. The yeast is digosaccharomyces (Z.).
5. Any one of claims 1 to 4 selected from the group consisting of Rukisii, Candida polymorpha, Torlopsis candida, Pichia farinosa, and Torluspora hansenii, and the fungus selected from the group consisting of Dendrifiera salina and Schizophyllum commune. The method described in. 6. The method according to claim 5, wherein the yeast is Z. ruxii. 7. Xylitol is D-xylulose-5-
Conversion of phosphate to D-xylulose followed by D-xylulose
The method of claim 1 formed by reducing kylylulose to xylitol. 8. The host comprises D-glucose-6-phosphate dehydrogenase (EC 1.1.1.49), 6-phospho-D-gluconate dehydrogenase (EC 1.1.1.4).
4), D-ribulose-5-phosphate-3-epimerase (EC 5.1.3.1), and D-librokinase (EC
The method according to claim 7, which is further transformed with a construct encoding one or more enzymes selected from the group consisting of 2.7.1.47). 9. The host is transketolase (EC 2.
The method according to claim 8, which does not express 2.1.1). 10. The host is D-glucose-6-phosphate dehydrogenase (EC 1.1.1.49), 6-phospho-D-gluconate dehydrogenase (EC 1.1.1.4).
4), D-ribulose-5-phosphate-3-epimerase (EC 5.1.3.1), and D-librokinase (EC
The method according to claim 9, which is further transformed with a construct encoding one or more enzymes selected from the group consisting of 2.7.1.47). 11. The host is D-xylulokinase (EC
The method according to claim 10, which does not express 2.7.1.17). 12. The host comprises D-glucose-6-phosphate dehydrogenase (EC 1.1.1.49), 6-phospho-D-gluconate dehydrogenase (EC 1.1.1.4).
4), D-ribulose-5-phosphate-3-epimerase (EC 5.1.3.1), and D-librokinase (EC
The method according to claim 11, which is further transformed with a construct encoding one or more enzymes selected from the group consisting of 2.7.1.47). 13. The host is transketolase (EC
2.2.1.1) and D-xylulokinase (EC 2.7.1.17)
The method according to claim 7, which does not express. 14. The host comprises D-glucose-6-phosphate dehydrogenase (EC 1.1.1.49), 6-phospho-D-gluconate dehydrogenase (EC 1.1.1.4).
4), D-ribulose-5-phosphate-3-epimerase (EC 5.1.3.1), and D-librokinase (EC
The method according to claim 13, which is further transformed with a construct encoding one or more enzymes selected from the group consisting of 2.7.1.47). 15. The yeast is selected from the group consisting of Digosaccharomyces ruxii, Candida polymorpha, Torrlopsis candida, Pichia farinosa, and Torluspora hansenii, and the fungus is selected from the group consisting of Dendrifiera salina and Schizophyllum commune. A method according to any one of claims 7 to 14. 16. The yeast according to claim 15, which is Z. ruxii.
The method described. 17. D-xylulose-producing D-arabitol dehydrogenase (EC1.1.1.11) -encoding DNA and xylitol dehydrogenase (EC 1.1.1.9) -encoding DNA.
An arabitol-producing yeast or an arabitol-producing fungal recombinant host transformed with. 18. The host is D-xylulokinase (EC
The recombinant host according to claim 17, which does not express 2.7.1.17). 19. The host is transketolase (EC
The recombinant host according to claim 17, which does not express 2.2.1.1). 20. The host is D-xylulokinase (EC
2.7.1.17) or transketolase (EC 2.2.1.1)
18. The recombinant host according to claim 17, which does not express. 21. The recombinant host according to claim 17, wherein the host is transformed with a gene encoding D-glucose-6-phosphate dehydrogenase (EC 1.1.1.49). 22. The recombinant host according to claim 17, wherein the host has been transformed with a gene encoding 6-phospho-D-gluconate dehydrogenase (EC 1.1.1.44). 23. The recombinant host according to claim 17, wherein the host has been transformed with a gene encoding D-ribulose-5-phosphate-3-epimerase (EC 5.1.3.1). 24. The yeast is selected from the group consisting of Digosaccharomyces ruxii, Candida polymorpha, Torrlopsis candida, Pichia farinosa, and Torluspora hansenii, and the fungus is selected from Dendrifiera salina and Schizophyllum commune. The recombinant host described. 25. The yeast according to claim 24, which is Z. ruxii.
The recombinant host described.