PH26596A - Modification of the DNA sequence between the shine-dalgarno sequence and the start codon of the TRP operon to increase protein expression - Google Patents

Abstract

For the contracting states : BE, CH, DE, GB, IT, LI, LU, NL, SE 1. DNA segment of the trp operon from E. coli, characterized by the sequence (coding strand) I 5' CTATCGACC 3' (I) which is connected at the 5' end to the Shine-Dalgarno sequence AAGG, and at the 3' end to the start codon ATG. For the contracting state : AT 1. A process for the preparation of a vector having the trp expression system of E. coli, characterized by cleavage with the restriction enzyme Nco l of an E. coli vector which contains the DNA sequence I 5' GTATCGACC 3' (I) (coding strand) followed by 5' ATGG 3', and a) ligation of a gene structure of DNA sequence II 5' CATG X... 3' 3' Y... 5' (II) in which X and Y denote the first complementary pair of nucleotides downstream of the start codon of a structural gene, in the cleavage site, or b) enzymatic filling in of the cleavage site and ligation of the DNA of the sequence III 5' GTA TCG ACC ATG 3' (III) 3' CAT AGC TGG TAC 5' with a DNA of the sequence IV 5' X... 3' (IV) 3' Y... 5' in which X and Y have the abovementioned meaning, or c) enzymatic degradation of the protruding sequence of the cleavage site, and ligation of the DNA of the sequence VI 5' GTA TCG AC 3' (VI) 3' CAT AGC TG 5' with a DNA of the sequence VII 5' Z ATG X... 3' (VII) 3' Z'TAC Y... 5' Z and Z' denoting any desired pair of nucleotides, which can also be dispensed with.

Description

{ “QO ' ' | [

LN ' to 26596

HOECHST AKTIENGESELLSCHAFT HOE 85/F 072 Dr.KL/mi (J Modification of the DNA sequence between the Shine-

Dalgarno sequence and the start codon of the trp operon to increase protein expression

Regulation sequences of the trp operon are frequently used for the expression of eukaryotic proteins in E. coli.

A DNA segment containing the promoter and the operator of the trp operon is now commercially available.

Modifications of the regulation sequences of the trp operon have already been disclosed. Thus, the possibility of the incorporation of a Hind 111 cleavage site between the ribosomal binding site and the start codon in the nucleotide sequence of the regulation element of the trp operon from Serratia marcescens, for example, is described in German Offenlegungsschrift 3,247,922 (corresponding to

South African Patent No. 83/9519 and Published Australian

Patent Application No. 83/22832). The insertion of a Cla I cleavage site into the corresponding sequence of E. coli is disclosed in J.C. Edman et al., Nature 291 (1981) 503- 506. However, this modification alters the number of nucleotides between the ribosomal binding site and the start codon compared with the natural sequence.

It has now been found that a cleavage site for a restric- tion enzyme can be inserted in the DNA sequence between the ribosomal binding site and the start codon by replacement of a single nucleotide, that is to say with- out altering the number of nucleotides. According to the invention, the nucleoside adenosine which is located immediately upstream of the start codon is replaced by cytidine.

The invention thus relates to a modified DNA segment of the trp operon of E. coli, which is located between the

( v | . . ~~ to a] —- 2 -—

Shine-Dalgarno sequence and the first start codon and has “. J the DNA sequence 1 5' GTATCGACC 3 (1) 3' CATAGCTGG 5°

This sequence I is connected at the 5' end of the upper strand to the Shine-Dalgarno sequence 5' AAGG 3 3' TTCC 5°! of the trp operon (which, at the level of the RNA, corres- ponds to the actual ribosomal binding site), and is connected at the 3' end of the upper strand to the start codon ATG. - The sequence I according to the invention is compared below with the natural E. coli sequence and the sequence disclosed by Edman et al., op. cit., only the upper strand, called the "coding strand" below, being shown for reasons of clarity:

SL : E. coli GTA TCG ACA

Edman et al. GTA TCG AT

Sequence 1 GTA TCG ACC (Alterations from the E. coli sequence are underlined.) : 30 This replacement according to the invention of the A in the natural sequence by C entails the following advan- i tages:

If the nucleoside guanosine is connected downstream of the start codon ATG then the recognition sequence

CLCATGG

TU re het pre nes sey ye ee at pe Pry owt tor «edi pag th tome

! ’ Cy C , — 3 -— for the restriction enzyme Nco I is formed. This cleavage : site permits the insertion of DNA in the immediate neigh- ) bourhood of the start codon, for example by use of synthetic oligonucleotides of the formula 11 5! CATGX... 3! (11) 3! Y... 5°! in which X and Y denote the first complementary nucleo- tide pair downstream of the start codon of a structural gene. If in this formula X represents G, and Y represents

C, then the Nco I cleavage site is retained in the liga- tion product. If, in contrast, for example a synthetic linker is inserted, whose protruding sequence 5' CATG 3', is connected to another nucleotide, then, although the

Nco I cleavage site is eliminated, on the other hand there is complete variability with regard to the first amino acid downstream of the start codon.

Of course, it is also possible to fill in enzymatically the protruding ends of the DNA which has been cut with

Nco 1, for example using Klenow polymerase, and to ligate the blunt-ended DNA of the sequence 111, which has thus been obtained, 5! GTA TCG ACC ATG 3 (111) : 3 CAT AGC TGG TAC 5° with a blunt-ended sequence 1V 5° X ... 3 (1v) 3 Y ... 5! to give the DNA sequence V 5! GTA TCG ACC ATG X ... 3 (v) 3 CAT AGC TGG TAC Y ... 5!

. a Co tot . - 4 -

X and Y having the abovementioned meanings. No further start codon for a particular structural gene which is to be expressed is required in this. This is favorable for the preparation of proteins shortened at the N-terminal end, for example. : Another possibility is enzymatic degradation of the pro- } truding ends, this likewise resulting in a blunt-ended

DNA sequence VI 5' GTA TCG AC 3! (v1) 3 CAT AGC TG 5' which can be ligated with a blunt-ended sequence VII 5! Z ATG X ... 3! (Vil) 3! I'TAC Y ... 5! . . to give the DNA sequence VIII | Co - 50 GTA TCG ACZ ATG X ... 3 | (VIII)

So 3 CAT AGC TGZ'TAC Y ... 50

Z and 7' denoting any desired nucleotide pair, which can

Co 25 also be dispensed with. The natural E. coli sequence is formed when Z and Z' represent A and T respectively. :

Apart from these diverse cloning possibilities, the in- vention offers the advantage that the expression of the : 30 structural gene is improved to a surprising extent.

Another aspect of the invention relates to a process for the preparation of a vector containing the trp expression

Co system from E. coli, which comprises cleavage of an E. coli vector which contains the DNA sequence 1 (coding strand) followed by 5' ATGG 3' with the restriction en- zyme Nco I and

Cy et GE

: ‘ Co Co - 5 - a) ligation of a gene structure of DNA sequence Il into the cleavage site or b) enzymatic filling in of the cleavage site and lig- ation of the DNA of the sequence IIl1 with a DNA of the sequence IV or ¢) enzymatic degradation of the protruding sequence of the cleavage site and Ligation of the DNA of the sequence VI with the DNA of the sequence VII.

Another aspect of the invention relates to E. coli host organisms which contain a vector obtained according to the invention. Furthermore, the invention relates to 2a process for the preparation of polypeptides composed of genetically codable amino acids, which comprises induc- tion, in a known manner, of expression by E. coli cells which have been transformed with a vector according to

EE the invention. oo

Further aspects of the invention, and their preferred embodiments, are illustrated in detail below and set out in the patent claims.

Figures 1 to 3 illustrate the exemplary embodiments in detail. Thus, Figure 1 shows the preparation of the plasmid pH 131/5 from the known plasmid ptrpL 1. Figure 2 shows the preparation of the plasmid pH 185/11, which codes for interleukin-2, from the known plasmid p 159/6 and the plasmid pH 131/5 (Figure 1). Finally, Figure 3 shows the plasmid pH 192/5 which codes for B-interferon.

A particular embodiment of the invention comprises the vector having ampicillin resistance with the A-lLactamase promoter in the same orientation as the trp promoter.

This is because it has emerged, surprisingly, that, owing to the trp operon modified according to the invention, there is not only very pronounced expression of the gene located downstream of the start codon but also the pos- sibility of induction of the B-lactamase. An increased ec 26596 concentration of g-lLactamase confers resistance to relatively high concentrations of ampicillin, by which means another possibility of selection is opened up.

This makes it possible rapidly to test particularly favo- rable promoter mutations or modifications of the nucleo- tides in the region of the ribosomal binding site for each protein which is to be expressed.

If the simultaneous formation of A-lLactamase is un- desired, but the intention is to make use of vectors having ampicillin resistance, it can be suppressed by insertion of a terminator between the structural gene for the desired polypeptide and the structural gene for B- lactamase. Another embodiment of this aspect of the in- vention accordingly comprises the insertion of a suitable terminator, preferably a bacterial terminator, between the abovementioned genes. The terminator of the trp ope- ron is particularly suitable, which is incorporated at a suitable site, for example 10 to 20 nucleotides down- stream of the stop codon (or the stop codons) for the : . Structural gene, or immediately upstream of the g. lactamase operon. oo -

The gene construct having the trp promoter/operator according to the invention can be incorporated in all plasmids replicating in E. coli. It is advantageous to use the commercially available E. coli vectors, such as

PBR 322, pBR 325, pACYC 177, pACYC 184 and pUC 8, and their derivatives. Examples of suitable derivatives are - 30 those plasmids from which the non-essential regions have been removed, cleavage sites or markers have been intro- duced or have been modified.

The gene sequences II, IV, V, VII and Vill contdin, with the nucleotide pair XY, the start of any desired struc- tural gene, for example, in the first place, a gene which is intrinsic to the host and codes for a protein which brings about transport into the periplasmic space or to a

Ce a a RE vd Tat Sot be ay i» Chi cell membrane. 1t is possible in this manner to prepare fusion proteins which can be removed from the cytoplasm, and thus be more readily isolated, and/or be protected from degradation by enzymes intrinsic to the cell. How- ever, it is also possible to generate fusion proteins which, by reason of their insolubility, can readily be separated from the proteins intrinsic to the cell. It is also possible to express the desired proteins directly by placing the structural gene immediately downstream of the start codon ATG.

Examples of polypeptides which can be obtained according to the invention are insulin, interferons, interleukins, such as interleukin-2, hirudin or somatostatin.

The invention is jliustrated in detail by the examples

Co ~which follow. Reference may be made to the textbook : "Molecular Cloning” by Maniatis et al., Cold Spring Harbor (1982), with regard to the individual process steps.

Example 1

Chromosomal E. coli DNA is cleaved with Hinf I, and the 492 bp fragment is isolated which contains, of the trp operon, the promoter, operator, the structural gene of the L-peptide, the attenuator and the codons of the trp E structural gene for the first six amino acids. This fragment is filled in with deoxynucleotide triphosphates by means of

Klenow polymerase, connected at both ends to an oligo- nucleotide which contains a recognition sequence for

Hind 111, and then cleaved with Hind III. The Hind 111 fragment thus obtained is Ligated in the Hind 111 cleavage site of pBR 322. The plasmid thus obtained is ptrpE2-1 (J.C. gdmann et al., OP. cit.). This is trans- ferred as described into the plasmid ptrpL1.

For the conversion of this starting material into a vec- oo tor according to the invention it is reacted with Cla 1

Qo . - 8 -

Co as recommended by the manufacturer (New England Biolabs).

Cr After incubation is complete the incubation mixture is extracted with phenol, the organic phase is separated off, and the DNA is precipitated by addition of 2.5 times

S the volume of ethanol and incubation at -20°C.

The DNA is removed by centrifugation and then treated with alkaline phosphatase (Boehringer Mannheim) in order to remove 5'-phosphate residues.

The synthetically prepared oligonucleotide IX 5! CGACCATGGT 3! (1X) is phosphorylated at the 5' end with the enzyme polynuc- leotide kinase and ATP. For this purpose, the synthetic oligonucleotide is heated at 70°C for 5 minutes and then immediately cooled in an ice bath. The phosphoryl- ation is carried out in 25 pl of buffer (50 mM tris.HCL, pH 7.6; 10 mM MgClp, 5S mM dithiothreitol (DTT)) with the addition of 100 pM ATP and about 10 units of Té-poly- nucleotide kinase, at 37°C over the course of 30 minutes.

The reaction is stopped by addition of the sodium salt of ethylenediaminetetraacetic acid (EDTA) to a final con- centration of 50 uM. Excess ATP can be removed by, for example, gel filtration on sepharose (SEPHADEX R G 50, oo fine).

The oligonucleotide IX is self-complementary and can associate with itself to give the double-stranded struc- ture X 5° CGACCATGGT 3 (xX)

TGGTACCAGC

- 35

This double-stranded oligonucleotide X has protruding ends which allow insertion into the Cla I site of the ‘opened plasmid ptrpL1.

CO

« . Co

About 50 ng of the oligonucleotide are incubated with about @ 1 pg of the reacted plasmid, which has been treated with * phosphatase, in 30 pl of buffer (50 mM tris. HCL, pH 7.4; 10 mM MgClp, 10 mM DTT) with the addition of 1 mM ATP and 0.1 ng/mL bovine serum albumin (BSA) at 12°C for 20 hours. The plasmid pH 131/5 is obtained (Figure 1).

The reaction mixture can be used immediately for the transformation of competent E. coli cells. Selection is carried out on agar plates using L broth (H.J. Miller,

Experiments in Molecular Genetics, Cold Spring Harbor, 1972) and 50 pg/ml ampicillin.

Since an Nco I cleavage site has been inserted in the plasmid pH 1317/5, the ampicillin-resistant colonies were tested to see whether the plasmid DNA therein contained a

Hind I1I1-Nco I fragment about 300 bp in size. More than 80% of the colonies had this fragment. Sequencing by the

Maxam-Gilbert method confirmed the incorporation of the synthetic DNA fragment and the sequence of the plasmid pH 1314/5 as indicated in Figure 1.

Example 2

The plasmid p 159/6 as shown in Figure 5 of German Offen-

Legungsschrift 3,419,995 is incubated with the enzymes

EcoR I and Sal I, as recommended by the manufacturers, and a 420 bp DNA fragment which contains the genetic information for human interleukin-2 is separated off by gel electrophoresis. The single-stranded protruding ends are degraded with mung bean nuclease (Pharmacia P-L Bio- chemicals) under the conditions recommended by the manufacturer.

The plasmid pH 131/5 is reacted with Nco 1, and the pro- truding single-stranded ends are Likewise degraded with mung bean nuclease. This is followed by incorporation of the structural gene for interlteukin-2, which is now

~ “ - . . N ‘ Co - - 10 - 265960 : blunt-ended, into the plasmid, which has been opened and 3 made blunt-ended, using DNA (igase under "blunt-end" con- ditions. This results in re-formation of the Ncol cleav- age site. Transformation into E. coli 294 is followed by selection of the ampicillin-resistant clones which have appropriate restriction fragments, for example an Eco RI-

Xba I fragment comprising about 260 bp, or an Eco RI-Sac

I fragment having about 150 bp.

The nucleotide sequence was confirmed for the plasmid pH 185/11 (Figure 2) by sequencing. The Nco I restriction site is retained in this construct.

For the expression of interleukin-2, E. coli 294 bacteria i which contain the plasmid pH 185/11 are incubated in LB medium (H.J. Miller, op. cit.) containing 50 pa/mt ampi- cillin, with aeration, overnight. Then a 1:100 dilution in

M 9 medium (H.J. Miller, op. cit.) containing 1 pa/mi thiamine and 500 pa/ml casamino acids is prepared. At an 0D of 0.5, induction can be carried out with indolyl-3- acrylic acid to a final concentration of 15 pa/mi. The bacteria are removed by centrifugation after a further 2 ' to 3 hours. It is possible by SDS gel electrophoresis to detect with the induced bacteria a strong protein band which reacts with antibodies against an interleukin-2 prepared in accordance with German Offenlegungsschrift 3,419,995. The band corresponds to the expected molecular weight of interteukin-2 and does not occur with non- induced bacteria. The biological activity of the inter- leukin-2 can be detected in high concentration in the induced bacteria.

The abovementioned conditions for culturing the bacteria apply to shaken flasks. Higher concentrations of cas- amino acids and/or L-tryptophan should be added for fermentation to higher 0D values (above 3).

pe

CQ

§ "a - 11 —-

Example 3

Q

The structural gene for human A-interferon was obtained from a cDNA bank. The clones contain the inserts in the Pst

I site of the plasmid pBR 322. A segment of 120 bp from the structural gene of B-interferon was jsolated by exposure to the restriction enzymes Hint I and Pst 1. The recog- nition sequence of the Hinf I site starts 16 nucleotides downstream of the codon for the N-terminal methionine of this biologically active B-interferon.

The oligonucleotide XI, obtained by synthesis, 5' CATGAGCTACAATCTTCTTGG 3 (XI) 3! TCGATGTTAGAAGAACCTAA 5°!

Nco 1 Hinf 1 : Po. : +s added onto the Hinf I end of the fragment using DNA

Ligase. DNA segment XII is obtained.

Moreover, a DNA segment of 365 bp was isolated from the structural gene of B-interferon using Pst I and Bgl Il.

This segment was cloned in the commercially available plasmid puUC 12 which had previously been reacted with Pst 1 and Bam HI. The plasmid pH 188 is obtained. After amplification and re-isolation, the plasmid pH 188 is in- cubated with Pst I and Eco RI, and the B-interferon gene fragment is jsolated (DNA segment XI111).

The plasmid pH 131/5 is reacted with the restriction en- zymes Nco 1 and Eco RI. This is followed by incubation of DNA segments XII and XIII with the opened plasmid in the presence of the enzyme DNA ligase, under conditions which result in covalent coupling of the Linkages. The expected sequence in the plasmid pH 192/5 is confirmed by restriction analysis and sequencing (Figure 3).

The process for the expression of the R-interferon is a . 4 RY - 12 - analogous to Example 2. Again, a pronounced band is ® detected on the electrophoresis gel after induction, this : band not being present with non-induced bacteria. The biological activity of B-interferon can be detected in the extracts from the bacteria.

The structural gene for interleukin-2 was inserted in the Nco I site of the plasmid pH 131/5 in accordance with

Example 2. After reaction of the plasmid with Eco RI, the protruding ends were made blunt-ended by incubation with Klenow polymerase in the presence of deoxyadenosine triphosphate and deoxythymidine triphosphate.

Into this plasmid which has been opened and made blunt- ended the commercially available terminator of the trp operon (Pharmacia P-L Biochemicals) is incorporated under “blunt-end” conditions with simultaneous ring-closure.

After growth and induction of the bacteria as described in Example 2 and previously, the bacteria are separated off and lysed. SDS gel electrophoresis shows no change in the band of the interleukin-2 protein, which has the same intensity as in Example 2. However, the band cor- responding to g-lactamase exhibits a markedly lower intensity.

Claims (9)

- 13 - HOE 8S/F 072 Patent Claims: J

1. DNA segment of the trp operon from E. coli, which contains the sequence (coding strand) 1 5! GTATCGACC 3! (1) which is connected at the 5' end to the Shine-Dalgarno sequence AAGG, and at the 3' end to the start codon ATG.

>. DNA as claimed in claim 1, which has the sequence (coding strand) la 5° GTATCGACCATGG 3! (1a) which is connected at the 5' end to the Shine-Dalgarno sequence AAGG, and in which the G at the 3' end is the first nucleotide of a structural gene downstream of the start codon.

3. A process for the preparation of a vector having the "trp expression system of E. coli, which comprises cleavage with the restriction enzyme Nco I of an E. coli vector which contains the DNA sequence 1 (coding strand) followed by 5' ATGG 3', and, a) ligation of a gene structure of DNA sequence II 5° CATGX ... 3 (11) 3! Y ... 5° in which X and Y denote the first complementary pair of nucleotides downstream of the start codon of a structural gene, in the cleavage site, or b) enzymatic filling in of the cleavage site and lLig- ation of the DNA of the sequence 111 5! GTA TCG ACC ATG 3 (111) 3 CAT AGC TGG TAC 5! with a DNA of the sequence IV 5° X ... 3 (1v) 3! Y ... 5° in which X and Y have the abovementioned meaning, or ¢) enzymatic degradation of the protruding sequence of the cleavage site, and Ligation of the DNA of the sequence VI

Ce Po - 14 - HOE 85/F 072 5! GTA TCG AC 3 (vl) J 3 CAT AGC TG 5°! : with a DNA of the sequence VII 5! Z ATG X ... 3° (Vil) 3! Z'TAC Y ... 5! 1 and 2' denoting any desired pair of nucleotides, which can also be dispensed with.

4. A vector obtained by the process as claimed in claim 3.

5. A vector as claimed in claim 4 which is Plasmid pH 131/5 as shown in Figure 1.

6. A vector as claimed in claim 4 which is Plasmid pH 185/11 as shown in Figure 2.

7. A vector as claimed in claim 4 which is Plasmid pH 192/5 as shown in Figure 3, p

8. E. coli which contains a vector as claimed in claim 4.

9. A process for the preparation of a polypeptide composed of genetically codable amino acids, which comprises induction of expression of E. coli cells as claimed in claim 8.

g “ :

Lo . - -1 - HOE 85/F 072 Abstract of the Disclosure: 2659 0 when, in the trp operon of E. coli, the adenosine immedi- ately upstream of the ATG start codon is replaced by cytidine, and guanosine is connected downstream of the start codon ATG, then an Nco I cleavage site which permits cloning is obtained. The operon thus modified results in very strong expression of the gene downstream of the start codon. In addition, it is possible for the formation of AB -Lactamase to be increased, which results in increased ampicillin resistance, which can be utilized for selec- tion. ’