DK172695B1 - DNA sections of the trp operon of E. coli, plasmids containing the DNA section, method of producing a vector in - Google Patents

Abstract

For the contracting states : BE, CH, DE, GB, IT, LI, LU, NL, SE 1. DNA segment of the trp operon from E. coli, characterized by the sequence (coding strand) I 5' CTATCGACC 3' (I) which is connected at the 5' end to the Shine-Dalgarno sequence AAGG, and at the 3' end to the start codon ATG. For the contracting state : AT 1. A process for the preparation of a vector having the trp expression system of E. coli, characterized by cleavage with the restriction enzyme Nco l of an E. coli vector which contains the DNA sequence I 5' GTATCGACC 3' (I) (coding strand) followed by 5' ATGG 3', and a) ligation of a gene structure of DNA sequence II 5' CATG X... 3' 3' Y... 5' (II) in which X and Y denote the first complementary pair of nucleotides downstream of the start codon of a structural gene, in the cleavage site, or b) enzymatic filling in of the cleavage site and ligation of the DNA of the sequence III 5' GTA TCG ACC ATG 3' (III) 3' CAT AGC TGG TAC 5' with a DNA of the sequence IV 5' X... 3' (IV) 3' Y... 5' in which X and Y have the abovementioned meaning, or c) enzymatic degradation of the protruding sequence of the cleavage site, and ligation of the DNA of the sequence VI 5' GTA TCG AC 3' (VI) 3' CAT AGC TG 5' with a DNA of the sequence VII 5' Z ATG X... 3' (VII) 3' Z'TAC Y... 5' Z and Z' denoting any desired pair of nucleotides, which can also be dispensed with.

Description

in DK 172695 B1

The invention relates to a DNA section of the trp operon of E. coli, plasmids containing the DNA section, method of producing a vector containing this DNA section, E. coli containing the vector, and method of producing polypeptide by expression of this E. coli.

Modifications to the regulatory sequences of the trp operon are already known. It is thus in e.g. German Publication No. 3,247,922 discloses how in the nucleotide sequence of the regulatory elements of the trp operon of Serratia marcescens between the ri-bosomal binding site and the starting code can be incorporated into a Hind

Ill-afskæringssted. From J.C. Edman et al., Nature, 291 / 503-506 (1981), it is known that a Cla Ι cut-off site can be inserted in the corresponding sequence from E. coli.

However, this variation changes the number of nucleotides between the ribosomal binding site and the starting code relative to the natural sequence.

It has now been found that by exchanging a single nucleotide, that is, without changing the nucleotide number, a cut-off site for a restriction enzyme can be inserted into the DNA sequence between the ribosomal binding site and the start codon. According to the invention, nucleotide adenosine is replaced with cytidine immediately before the start codon.

Thus, the invention relates to a modified DNA section 25 of the trp operon of E. coli, which lies between the "Shine-Dal-garno" sequence and the first start codon and is peculiar to the DNA sequence I: 5 'GTATCGACC 3' (I ) 3 'CATAGCTGG 5' 30 This sequence I is connected to the "Shlne-Dalgarno" sequence 5 'AAGG 3' 3 'TTCC 5' of the trp operon (corresponding to the actual ribosomal 35) at the 5 'end of the upper strand. binding site in the plan of RNA), and at the 3 'end of the upper 2 DK 172695 B1

ISLAND

re string connected to the start codon ATG.

In the following, the sequence I of the invention is compared with the natural E. coli sequence and that of Edman et al. above known sequence, for reasons of simplicity only the upper string is reproduced, hereinafter referred to as the "coding" string:

E. coli GTA TCG ACA

Edman et al. GTA TCG AT Sequence In GTA TCG ACC

10 (changes relative to the E. coli sequence are emphasized).

This substitution according to the invention with C instead of A in the natural sequence results in the following advantages: If, following the start codon ATG, the nucleoside guanosine follows, the recognition sequence c4catgg is generated for the restriction enzyme Nco I.

This cut-off site allows the insertion of DNA immediately adjacent to the start codon, e.g. by synthetic oligonucleotides of formula II: 5 'CATGX ... 3' (II) 3 'Y ... 5' where X and Y represent the first complementary nucleotide pair after the start codon of a structural gene. Here, where X means 25 G and Y means C, the Nco I cut-off site has been retained in the ligation product. On the other hand, for example, a synthetic linker whose imminent sequence 5 'CATG 3' joins a second nucleotide, although the Nco I cut-off site is abolished, however, the full variability of the first amino acid after the start codon is given.

Of course, one can also fulfill the superimposed ends of the enzyme cut with Nco I enzymatically, e.g. by Klenow polymerase, and ligating the thus blunted DNA to the sequence III:

ISLAND

3 DK 172695 B1 5 'GTA TCG ACC ATG 3' (III) 3 'CAT AGC TGG TAC 5' with a blunted sequence IV: S 'X ... 3' (IV) 5 3 'Y ... 5' to DNA sequence V: 5 'GTA TCG ACC ATG X ... 3' ^ 3 'CAT AGC TGG TAC Y ... 5' with X and Y having the above meanings. Hereby, no additional start codon is required for a particular structural gene to be expressed.

This is e.g. favorable for the production of proteins abbreviated at the N-terminal end.

It is also possible to perform an enzymatic breakdown of the protruding ends, thereby also forming a blunted DNA sequence VI: 5 'GTA TCG AC 3' (VI) 3 'CAT AGC TG 5' as with a blunted sequence VII: 20 5 'Z ATG X ... 3' (VII) 3 'Z1TAC Y ... 5' can be ligated to DNA sequence VIII: 5 'GTA TCG ACZ ATG X ... 3' (VIII) 3 'CAT AGC TGZ'TAC Y ... 5 '25 where Z and Z1 represent any nucleotide pair which may also lapse. When Z and Z 'represent A or T, the natural E. coli sequence is formed.

In addition to these numerous cloning capabilities, the invention provides the advantage that the expression of the structural gene is surprisingly improved.

The invention further relates to a method for producing a vector with the trp expression system from E. coli, and this method is characterized by cutting an E. coli vector containing the DNA-35 sequence I (coding strand), followed by of 5 'ATGG 3', DK 172695 B1 4 with the restriction enzyme Nco I and a) in the cut site ligate a gene structure of DNA sequence II or 5 b) enzymatically meet the cut sites and li gate the DNA of sequence III with a DNA of sequence IV or c) enzymatically breaks down the protruding sequence of the cut site and ligates the DNA of sequence VI 10 with a DNA of sequence VII.

The invention further relates to E. coli host organisms which are characterized by a vector obtained by the method according to claim 3, wherein Z is C and 2 'is G.

In addition, the invention relates to a method for producing polypeptides from genetically coding amino acids, and this method is characterized in that, in known manner, E. coli cells according to claim 4 are expressed for expression.

Furthermore, the invention relates to the plasmids set forth in claims 6 and 7.

In the drawing, Figures 1-3 further illustrate the exemplary embodiments. Thus, FIG. In the preparation of the plasmid pH 131/5 from the known plasmid ptrpL 1.

FIG. 2 shows the preparation of the interleukin-2 encoded plasmid pH 185/11 from the known plasmid p 159/6 25 and the plasmid 131/5 (Fig. 1). FIG. 3 finally shows the β-interferon coding plasmid pH 192/5.

A particular embodiment of the invention consists in that the vector exhibits an ampicillin resistance with the β-lacta-mase promoter in the same orientation as the trp promoter. Surprisingly, it has been found that through the trp operon modified according to the invention not only does a very strong expression of the gene arranged after the start codon, but that the β-lactamase can also be induced. An increased concentration of β-lactamase gives a re-35

ISLAND

5 DK 172695 B1 resistance to higher concentrations of ampicillin, thereby opening a further selection option. This makes it possible to quickly test particularly favorable promoter mutations or also variations of the nucleotides in the region of the ribosomal binding site of any protein to be expressed.

When the concomitant formation of β-lactamase is undesirable, but vectors with ampicillin-resistance must be used, these can be suppressed by insertion of a terminator between the structural gene of the desired polypeptide and the structural gene of β-lactamase. Thus, a further embodiment of this aspect of the invention consists in inserting a suitable terminator, preferably a bacterial terminator, between said genes. Particularly suitable is the terminator of the trp operon which is built into a suitable location, e.g. 10 to 20 nucleotides after the stop codon (or stop codons) of the structural gene, or immediately before the (3-lactamase operon).

The gene construct of the invention with the trp promoter / operator can be incorporated into all E. coli replicating plasmids. Advantageously, the commercially available E. coli vectors such as pBR 322, pBR 325, pACYC 177, pACYC 184, pUC 8 and their derivatives are used. As derivatives, e.g. such plasmids into consideration, from which non-essential regions have been removed or in which intersection sites or markers have been incorporated or altered.

The gene sequences II, IV, V, VII and VIII contain with the nucleotide pair XY the origin of any structural gene, e.g. first, a host-specific gene encoding a protein that causes transport in the periplastic space or on a cell membrane. In this way, fusion proteins can be prepared that can be removed from the plasmid and thus more readily isolated and / or protected against degradation by cell-capable enzymes. However, fusion proteins can also be prepared which, due to their insolubility, can easily be separated from the cell-suitable proteins. In addition, it is possible to express the desired proteins directly, by placing the structural gene immediately behind the start codon ATG.

Examples of polypeptides which can be recovered according to the invention are insulin, interferons, interleukins such as interleukin-2, hirudin or somatostatin.

The invention is further illustrated in the following examples. For the individual process steps, reference is made to the textbook "Molecular Cloning" by Maniatis et al., Cold Spring Harbor (1982).

Example 1 Chromosomal E. coli DNA is cut with Hinf I and the 492 bp fragment isolated, which contains, in addition to the trp operon, the promoter, operator, structural gene of the L-peptide, attenuator and codon for the first six amino acids of trp E structural gene. This fragment is filled by Klenow polymerase with deoxynucleotide triphosphates, joined at both ends with an oligonucleotide containing a Hind III recognition sequence, and post-cut with Hind III. The Hind III fragment thus formed is ligated into the Hind III cut-off site by pBR 322.

Thus, plasmid ptrpE2-1 (J.C. Edman et al., Cited above) is obtained. This is converted as described to plasmid ptrpL1.

To convert this starting product into a vector, this is reacted with Cla I according to the manufacturer's recommendations 30 (New England Biolabs). After incubation is completed, the incubation mixture is extracted with phenol, the organic phase is separated and the DNA precipitated by the addition of the 2.5-fold volume of ethanol and incubation at -20 ° C.

After centrifugation of the DNA, this is processed

ISLAND

7 DK 172695 B1 with alkaline phosphatase (Boehringer Mannheim) to remove 5'-phosphate residues.

The synthetically prepared oligonucleotide IX: 5 'CGACCATGGT 3' (IX) 5 is phosphorylated with the enzyme polynucleotide kinase and ATP at the 5 'end. For this purpose, the synthetic oligonucleotide is heated for 5 minutes to 70 ° C and then immediately cooled in an ice bath. Phosphorylation takes place in 25 µl of buffer (50 mM tris-HCl, pH 7.6, 10 mM MgCl 2, 5 µM dithio-10-tritol (DTT)) with the addition of 100 µM ATP and ca. 10 units of T4 polynucleotide kinase at 37 ° C over 30 minutes. The reaction is terminated by adding the sodium salt of ethylenediaminetetraacetic acid (EDTA) to a final concentration of 50 µM. Excess ATP can be separated, e.g. by gel filtration on Sepharose (^ SEPHADEX G 50, fine).

The oligonucleotide IX is self-complementary and may associate with the double stranded structure X: 5 'CGACCATGGT 3' (χ)

20 TGGTACCAGC

This double-stranded oligonucleotide X exhibits protruding ends allowing insertion into the Cla I site of the opened plasmid ptrpL1.

An amount of approx. 50 ng of the oligonucleotide is incubated at 12 ° C for 20 hours at ca. 1 µg of the phosphatase-treated plasmid reacted in 30 µl of buffer (50 mM tris-HCl, pH 7.4, 10 mM MgCl 2, 10 mM DTT) with the addition of 1 mM ATP and 0.1 ng / ml bovine serum albumin (RSA).

The plasmid pH 131/5 is obtained (Fig. 1).

The reaction mixture can be used immediately for transformation of competent E. coli Cells. The selection is made on agar plates with L-Broth (H.J. Miller, Experiments in Molecular Genetics, Cold Spring Harbor, 1982) and 50 µg ampicillin per ml.

35 Since in the plasmid pH 131/5 one has been introduced

ISLAND

8 DK 172695 B1

At the Nco I transition site, the ampicillin-resistant colonies are examined to determine whether the plasmid DNA obtained contains a ca. 300 bp Hind III Nco I fragment, Over 80% of the colonies exhibit this fragment. The sequence analysis of Maxam-Gilbert confirms the incorporation of the synthetic DNA fragment and the indicated sequence of the plasmid pH 131/5 of FIG. First

Example 2 The plasmid p 159/6 of FIG. 5 of German Publication No. 3,419,995 is incubated with the enzymes Eco RI and Sal I in accordance with the manufacturer's recommendations, and a gel electrophoretic is separated from a 420 bp DNA fragment containing the genetic information for human interleukin. -2. The single-stranded protruding ends are broken down with Mung-Bean nuclease (Pharmicia P-L Biochemicals) under the conditions recommended by the manufacturer.

The plasmid p 131/5 is reacted with Nco I and the protruding ends are also digested with Mung-Bean nuclease.

Next, the incorporation of the now blunt-ended structural gene for interleukin-2 into the blunt-ended opened plasmid follows "blunt-end" conditions with DNA ligase. This restores the Nco I intersection site. After transformation in E. coli 294, the selection of the ampicillin-resistant clones exhibiting appropriate restriction fragments, e.g. et approx. 260 bp comprising Eco RI-Xba fragment fragment or an Eco RI-Sac I fragment of ca. 150 bp.

30 The plasmid pH 185/11 (Fig. 2) confirms the nucleotide sequence by sequence analysis. In this construction, the Nco I restriction site is retained.

For the expression of interleukin-2, E. coli 294 bacteria containing the 185/11 plasmid are incubated in LB medium (H.J. Miller, cf. above) with

ISLAND

9 DK 172695 B1 50 µg ampicillin pr. ml overnight under aeration.

Then a 1: 100 dilution is prepared in M 9 medium (H.J. Miller, cf. above) with 1 µg of thiamine per ml. per ml and 500 µg casamino acids ml. At 5 OD = 0.5, indolyl-3-acrylic acid can be induced to a sut concentration of 15 µg per day. ml. After another 2-3 hours, the bacteria are centrifuged. By SDS gel electrophoresis, a strong protein band that reacts with antibodies against an interleukin-2 produced in accordance with German Publication No. 3,419,995 can be determined. The band corresponds to the expected molecular weight of interleukin-2 and does not occur with non-induced bacteria. The biological activity of interleukin-2 can be detected at high concentration in the induced bacteria.

The above conditions for the cultivation of the bacteria apply to shake flasks. When fermenting to higher OD values (above 3), higher concentrations of casamino acids and / or L-tryptophan must be added.

20

Example 3

The structural gene for human β-interferon is recovered from a cDNA bank. The clones contain the insertion into the Pst I site of plasmid pBR 322. By the action of the restriction enzymes Hinf I and Pst I, a 120 bp subunit is isolated from the structural gene of the β-interferon. The recognition sequence of the Hinf I site thus begins 16 nucleotides after the codon of the N-terminal methionine in the biologically active β-interferon.

The synthetically recovered oligonucleotide XI: 5 * CATGAGCTACAATCTTCTTGG (χι) 3 'TCGATGTTAGAAGAACCTAA 5'

Nco I Hinf I

is added with DNA ligase to the Hinf I end of the fragment.

35 The DNA section XII is obtained.

o DK 172695 B1 10

From the structural gene of the (3-interferon), a DNA fragment of 365 bp is further isolated with Pst I and Bgl II.

This section is cloned into the commercially available plasmid pUC 12, which has previously been reacted with Pst I and Barn HI.

The plasmid pH 188 is obtained. After amplification and gene isolation, the plasmid pH 188 is incubated with Pst I and Eco RI and the [3-interferon gene fragment is isolated (DNA section XIII).

The plasmid pH 131/5 is reacted with the restriction enzymes Nco I and Eco RI. Subsequently, incubation of DNA sections XII and XIII with the opened plasmid in the presence of the enzyme DNA ligase under conditions leading to a covalent linkage of the bonds follows. By restriction and sequence analysis, the expected sequence in the plasmid pH 192/5 is confirmed (Fig. 3).

15 To express the [3-interferon], proceed analogously to Example 2. Here, too, after induction on the electrophoresis gel, a clear band that is not present by non-induced bacteria can be determined. In the extracts of the bacteria, the biological activity of the 0-20 interferon can be detected.

In the Nco I site of plasmid pH 131/5, according to Example 2, the structural gene for interleukin-2 is inserted. After reacting the plasmid with Eco RI, the protruding ends are blunt ended by incubation with Klenow polymerase in the presence of deoxyadenosine triphosphate and desoxythymidine triphosphate.

The commercially available terminator of the trp operon (Pharmacia P-L Biochemicals) is incorporated into this opened, blunt-ended plasmid under "blunt end" conditions and under simultaneous cyclization.

After growth and induction of the bacteria as described in Example 2 and above, the bacteria are separated and lysed. SDS gel electrophoresis shows unchanged the band of the interleukin-2 protein at the same intensity as in Example 2. However, the band corresponding to the β-lacta mass exhibits a markedly weaker intensity.

Claims (7)

1. DNA section of the E. coli trp operon, characterized by the sequence (coding strand) I: 5 5 'GTATCGACC 3' (I) connected at the 5 'end to the Shine-Dalgarno sequence AAGG and at 3' end is connected to the start codon ATG. DNA according to claim 1, characterized by the sequence (coding strand) 1a: 5 'GTATCGACCATGG 3' (1a) connected at the 5 'end to the Shine-Dalgarno sequence AAGG, and at G at the 3' end it is first nucleotide in a structural gene after the start codon. 15 Method for producing a vector with the trp expression system from E. coli, characterized by cutting an E. coli vector containing the DNA sequence I (coding strand), followed by 5 'ATGG 3 ', with the restriction enzyme Nco I and a) at the cut site ligate a gene structure with the DNA sequence II: 5' CATGX ... 3 '(II) 3' Y ... 5 '25. which X and Y mean the first complementary now -leotide pairs following the start codon of a structural gene, or b) enzymatically meet the cut-off site and ligate the DNA of sequence III: 5 'GTA TCG ACC ATG 3' (III) 30 3 'CAT AGC TGG TAC 5' with DNA of sequence IV: C 1 Y 1 S Λ ... J (IV) 3 'Y ... 5' where X and Y have the meaning given above, or c) enzymatically breaks down the protruding sequence at the cut-off site and ligates DNA 'one with the sequence VI: 5 * GTA TCG AC 3' (VI) 3 'CAT AGC TG 5' with a DNA of the sequence VII: S 5 'Z ATG X ... 3' (VII) 3 'Z'TAC Y . . 5 'where Z and Z' denote any nucleotide pair which may also be absent. 10 E. coli, characterized by a content of a vector obtained according to claim 3, wherein Z is C and Z 'is G. Process for producing a polypeptide t5 from genetically encoded amino acids, characterized in that E. coli cells according to claim 4 are expressed. 6. Plasmid pH 131/5 of FIG. 1 20 7. Plasmid pH 185/11 of FIG. 2. 25 30 35