OA18507A - Production of α-olefins. - Google Patents

Abstract

The present invention relates to the biosynthesis of α-olefins. In particular, the invention provides methods for the production of medium-chain αolefins, more particularly C11 α-olefins, using a polypeptide with decarboxylase activity on free fatty acids with 8 to 14 carbons, in particular on C8-C12 free fatty acids, more particularly on C12 free fatty acids, or a genetically engineered host cell expressing or overexpressing said polypeptide.

Description

DUPLICATA

DEMANDE DE BREVET D’INVENTION PCT/EP2016/065389 DU 30/06/2016

Nom du Déposant(s):

1. TOTAL RAFFINAGE CHIMIE

2. Q1NGDAO 1NSTITUTE OF B1OENERGY AND B1OPROCESS TECHNOLOGY (QIBEBT)

Titre d’invention: PRODUCTION OF a-OLEFINS

Noms d’inventeur(s):

1. FOURAGE, Laurent

2. LAEUFFER, Frédéric

3. STRUB, Henri

4. WANG, Yun

5. XU, Jian

6. XU, Huifang ,

7. Ll, Shengying

Mandataire : SCP AKKUM, AKKUM & Associâtes

B.P 4966 Yaoundé - Cameroun.

PRODUCTION OF α-OLEFINS

TECHNICAL FIELD

The application generally relates to biosynthetic processes, ln particular, the application relates to the biosynthesis of a-olefins.

BACKGROUND

Unsaturated hydrocarbons such as α-olefins are an Industrially Important group of molécules which can serve as precursors for lubricants and surfactants ln addition to 10 being used ln fuels, or as feedstock for further chemical conversion to e.g. fuels, potymers, plastics, textiles, solvents, adhesives, etc.

α-Olefins, more particularty linear α-olefins, hâve traditionally been produced from petroleum sources through oligomérization of ethylene but it would be advantageous to fmd alternative methods for producing such α-olefins, notably from renewabte 15 resources. Moreover, the chemical synthesis results in a mixture of linear a-olefins which exhibit different carbon chain length. Such mixture may not be desired as feedstock for fùrther chemical conversion such as the production of poly-a-olefîns of Interest.

Microbial production of olefins has been reported. Examples include a three-gene 20 cluster responsible for generating alkenes with Internat double bonds through the headto-head condensation of two fatty acyl-coenzyme A (acyl-CoA) molécules in Micmcoccus luteus (Beller et al. 2010 Appl Environ Microbiol 76:1212-1223); a unique P450 decarboxytase OleTjE from Jaotgalicoccus sp. ATCC 6456, which directly decarboxylates 0« to C» free fatty acids to form α-olefins in presence of H₂O₂ (WO 25 2009/085278, Rude et al. 2011 Appl Environ Microbiol 77:1718-1727, Uu et al. 2014

Biotechnology for Biofuels 7:28); another enzyme of the cyp152 P450 enzyme family, namely P450esp from Bacillus subtilis subsp. subtilis str. 168, for which decarboxytase activity on palmitic acid has been shown (WO 2009/085278, Rude et al. 2011); and a type I polyketide synthase from Synechococcus sp. PCC 7002, which is capable of 30 transforming fatty acyl-ACPs Into α-olefins via sequential polyketide synthase chain élongation, keto réduction, sulfonation mediated by its sutfotransferase domain, and

the coupled hydrolysis and décarboxylation catalyzed by the thloesterase domain (Mendez-Perez et al. 2011 Appl Environ Microbiol 77:4264-4267).

ln general, there is a need for alternative production methods of α-olefins, and more particularly improved processes that allow production of α-olefins at a lower cost and/or 5 that are more environmental friendly. It is also desired to provide production methods which allow tailoring of the carbon chain length of the α-otefins, more particularly a production method for medium-chain α-olefins (i.e. a-otefins having a carbon chain length comprised between 7 and 13), more particularly for Cn a-olefins.

SUMMARY OF THE INVENTION

The présent invention solves one or more of the above described problems of the prior art. ln particular, methods are provided for the production of α-olefins which allow controlling the carbon chain length of the a-olefins.

The présent invention is based, at least In part, on the discovery that certain genomic 15 sequences of Alicyclobacilius acidocaldarius and Staphylococcus massiliensis encode enzymes having free fatty acid decarboxylase activity. None of these organisms hâve previously been reported to produce terminal olefins. It has further been found that certain polypeptides can be identified which hâve spécifie decarboxylase activity on medium-chain free fatty acids, in particular Ce to C12 free fatty acids, more particularly 20 on C12 free fatty acids, thereby producing medium-chain α-olefîns, in particular C? to

C11 α-olefins, more particularly Cn α-olefins. The application provides examples thereof, more particularly an olefin-producing enzyme (Sm46) identified in Staphilococcus massiliensis, the P450bsp fatty acid hydroxylase (Bs168) from Bacillus subtilis subsp. subtilis str. 168 and the decarboxylase enzyme identified in 25 Alicyciobaciilus acidocaldarius, hâve spécifie decarboxylase activity on C12 free fatty acids, thereby producing Cn α-olefins. The identification of these enzymes facilitâtes the further identification of similar enzymes from other organisms.

The présent invention is in particular captured by any one or any combination of one or more of the below numbered aspects and embodiments (i) to (xvii) wherein:

(i) A method for the production of C7-C11 α-olefins comprising culturing a recombinant host cell comprising a recombinant nucleic acid encoding a decarboxylase enzyme under conditions suitable for the production of C7 to Ch α-olefins by said host cell, wherein the preferred substrate of said decarboxylase enzyme Is an CrC₁₂ free fatty acid.

(ii) The method according to (i), wherein said nucleic acid encoding a decarboxylase enzyme comprises a nucléotide sequence having at least about 75%, preferably at least about 80%, more preferably at least about 95%, sequence identity to SEQ ID NO:10, SEQ ID NO:7, SEQ ID NO: 3 or SEQ ID NO: 5 and wherein said recombinant nucleic acid ensures expression or overexpression of said decarboxylase.

(iii) The method according to (i) or (ii), wherein said nucleic acid encodes a polypeptide comprising an amino acid sequence having at least 80%, preferably at least 90% Identity, to SEQ ID NO:13, SEQ ID NO: 8, SEQ ID NO: 4 or SEQ ID NO: 6 or an active fragment of said polypeptide.

(iv) The method according to any one of (i) to (iii), wherein said nucleic acid encodes a polypeptide comprising the amino add sequence of SEQ ID NO:13.

(v) The method according to any one of (i) to (iv), wherein C,₂ free fatty acids are the preferred substrate of said decarboxylase, and wherein said α-olefins are Ch a-olefins.

(vi) The method according to any one of (i) to (v), wherein said host cell Is cultivated ln a medium comprising Ce-Ci₂free fatty acids, preferably Cufree fatty acids.

(vii) The method according to any one of (i) to (vi), wherein the host cell has further been genetically engineered to produce or overproduce Ce-Cu free fatty acids, preferably Cufree fatty acids.

(viii) The method according to (vii), wherein the host cell comprises a recombinant nucleic acid encoding an enzyme involved in the production of free fatty acids with a carbon chain length comprised between 8 and 12, more particularly a C12 free fatty acid.

(ix) The method according to claim (viii), wherein the host ceil comprises a recombinant nucieic acid encoding a thioesterase having activity on Ce to Cu acyl-ACP, preferably on Cn acyl-ACP.

(x) The method according to any one of (i) to (ix), wherein the host cell is an oieaginous host ceil.

(xi) The method according to any one of (I) to (x), wherein the host ceil Is selected from the group comprising bacteria, yeasts, fungi, piants and aigae.

(xii) The method according to any one of (i) to (xi), further comprising the step of recovering the α-olefins from the host ceil or the culture medium.

(xiii) A method for the production of poly-a-oiefins comprising the foilowing steps:

i) producing Ct-Ch α-olefins according to a method according to any one of (i) to (xii); and ii) performîng an oligomérization reaction using the α-olefins obtained in step i) as monomer to produce an oligomer; and optionally, iii) hydrogenating the oiigomer produced in step ii).

(xiv) The method according to (xiii), wherein the poly-a-olefins are C33 poly-a-olefins, wherein step i) comprises the production of Cn α-olefins, and wherein the oligomérization reaction in step ii) is a trimerization reaction.

(xv) A composition comprising poly-a-olefins obtainabie by the method according to (xiv), wherein at least 85%; preferably at least 90%, more preferably at least 95%, of the poly-a-oiefins are C33 poly-a-olefins.

(xvi) A poiypeptide having decarboxylase activity, wherein said polypeptide comprises an amino acid sequence having at least 80%, preferably at ieast 90%, identity to SEQ ID NO:13.

(xvii) An isolated nucieic acid encoding an enzyme having decarboxyiase activity, 35 wherein said nucieic acid comprises a nucléotide sequence having at least about 80%,

s more preferably at least about 95%, sequence identity to SEQ ID NO: 7 or SEQ ID NO:

5.

(xviii) The polypeptide according to (xvi) or the Isoiated nucleic acid according to (xvii), 5 wherein C₈ to Cu free fatty acids, preferably C_e to C12 free fatty acids, more preferably Cu free fatty acids are the preferred substrate of said decarboxylase.

(xix) The isoiated nucleic acid according to (xvii) or (xviii), wherein said nucleic acid comprises a nucléotide sequence having at least about 95% sequence identity to SEQ 10 ID NO: 7.

(xx) A vector comprising at least one regulatory sequence operatively coupled to the nucleic acid sequence of any of (xvii) to (xix).

(xxi) A host cell comprising lhe nucleic acid according to any of claims (xvii) to (xix) Integrated Into its genome or the vector according to claim 20.

(xxii) The host cell of (xxi), which is an oleaglnous eukaryotic microalgae or oleaginous yeast.

(xxiii) Use of a host cell according to (xxi) or (xxii) for the industrial production of lubricants.

(xxiv) Lubricant comprising poly-a-olefins obtalnable by a method according to (xiii) or 25 (xiv).

(xxv) Lubricant according to (xxiv), wherein said poly-a-olefins are biosourced polya-olefïns.

(xxvi) Lubricant according to (xxiv) or (xxv), wherein at least 50%, preferably at least 85%, of said poly-a-olefins consist of C_J3 poly-a-olefins.

(xxvii) Lubricant according to any one of (xxiv) to (xxvi), wherein said lubricant is an automotive lubricant.

(ix) Th© method according to claim (viii), wherein the host cell comprises a recombinant nucleic acid encoding a thioesterase having activity on Ca to C« acyl-ACP, preferably on Ci₂ acyl-ACP.

(x) The method according to any one of (i) to (ix), wherein the host ceil is an oleaginous host cell. - - ' (xi) The method according to any one of (i) to (x), wherein the host cell is selected from the group comprising bacteria, yeasts, fungi. plants and algae.

(xii) The method according to any one of (i) to (xi), further comprising the step of recovering the α-olefins from the host cell or the culture medium.

(xiii) A method for the production of poly-a-olefins comprising the following steps:

i) producing C7-C11 α-olefins according to a method according to any one of (i) to (xii); and li) performing an oligomérization reaction using the α-olefins obtained In step i) as monomer to produce an oligomer; and optionally, iii) hydrogenating the oligomer produced in step Ii).

(xiv) The method according to (xiii), wherein the poly-a-olefins are C» poly-a-olefins, wherjein step i) comprises the production of Cu α-oleftns, and wherein the oligomérization réaction In step ii) is a trimerlzation reaction.

(xv) A composition comprising poly-a-olefins obtainable by the method according to (xiv), wherein at least 85%, preferably at least 90%, more preferably at least 95%, of the poly-a-olefins are C33 poly-a-olefins.

(xvi) A polypeptide having decarboxylase activity, wherein said polypeptide comprises an amino acid sequence having at ieast 80%, preferably at least 90%, identify to SEQ IDNO:13.

(xvii) An isolated nucleic acid encoding an enzyme having decarboxylase activity, wherein said nucleic acid comprises a nucléotide sequence having at least about 80%, more preferably at least about 95%, sequence Identity to SEQ ID NO: 7 or SEQ ID NO:

5.

(xviii) The polypeptide according to (xvi) or the Isolated nucleic acid according to (xvii), wherein C# to Cu free fatty acids, preferably Ce to C« free fatty acids, more preferably C12 free fatty acids are the prefemed substrate of said decarboxylase.

(xix) The Isolated nucleic acid according to (xvii) or (xviii), wherein said nucleic acid comprises a nucléotide sequence having at least about 95% sequence Identity to SEQ ID NO: 7, (xx) A vector comprising at.least one regulatory sequence operatively coupled to the nucleic acid sequence of any of (xvii) to (xix).

(xxi) A host cell comprising the nucleic acid according to any of claims (xvii) to (xlx) integrated Into Its genome or the vector according to claim 20.

(xxii) The host cell of (xxl), which Is an oleaglnous eukaryotic microalgae or oleaglnous yeast.

(xxlil) Use of a host cell according to (xxi) or (xxii) for the Industrial production of lubricants.

(xxiv) Lubricant comprising poly-a-olefins obtainable by a method according to (xiii) or (xiv).

(xxv) Lubricant according to (xxiv), wherein said poly-a-olefins are biosourced polya-oleflns.

(xxvl) Lubricant according to (xxiv) or (xxv), wherein at least 50%, preferably at least 85%, of said poly-a-olefins conslst of C33 poly-a-olefins.

(xxvfî) Lubricant according to any one of (xxiv) to (xxvi), wherein said lubricant Is an automotive lubricant.

*

BRIEF DESCRIPTION OF THE FIGURES

The teaching of the application Is illustrated by the following Figures which are to be consldered as illustrative only and do not In any way limit the scope of the claims.

Figure 1: Nucléotide (A,C,E,G) and amino acid (0,D,F,H) sequences of OleTx (Α,θ), 5 Bs168 (C,D), Aa162 (E,F) and Sm46 (G,H).

Figure 2: Plasmid map of pET28a.

Figure 3: Heterologous expression of genes encoding OleTje, 0s168, Aa162 and Sm46 in E. coli. SDS-PAGE analysis of lysâtes of E. coli cells carrying a recombinant plasmid comprising a gene encoding OleTJ, 0s168, Aa162 or Sm46, cultured under 10 conditions to induce expression of the transgene (0.4 mM IPTG) or not (unlnduced). M:

protein marker.

Figure 4: In vitro production of α-olefins by OleTjE, 0s168, Aa162 and Sm46. Genes encoding OleTJ, 0s168, Aa162 and Sm46 were recombinantly expressed in E coli. The supematant of the E. coli lysâtes was used in an in vitro assay for α-olefin 15 biosynthesis In the presence of C12· Cm or Ci® fatty acid substrate (1 mM) and H2O2 (500 pM). Cu, Cu and Cu α-olefin production by the different enzymes Is indicated as the area under the gas chromatographie (GC) peak.

Figure 5: (A) Codon-optimlzed (for expression in E. coli) nucléotide sequences encoding Sm46 and a truncated variant Sm46-del29 that has the N-terminal 29 amino 20 acids deleted (SEQ ID NO:9 and SEQ ID NO:10, respectively) with flanking restriction sites. Codon-optimlzed (for expression in E. coli) nucléotide sequence (SEQ ID NO: 9) encoding Sm46 is shown; Nde I and Xho I restriction sites are indicated in boid, the deleted sequence to encode for the truncated variant Sm46-del29 is underiined. (B) Amino acid sequence of Sm46-del29 (SEQ ID NO: 13).

Figure 6: In vitro conversion of free fatty acids Into α-olefins by a truncated variant of Sm46: Sm46-del29. Conversion percentages of the free fatty acid substrates (A) and the corresponding α-alkene products (B) are shown.

Figure 7: In vitro production of α-olefïns by Aa162, 0s168 and Sm46-del29.

Recombinantly expressed and purified enzyme (0.2 pM) was used in an in vitro assay for α-olefin biosynthesis in the presence of C« fatty acid substrate. The conversion

percentages are shown for, from left to right, Cu free fatty acid substrate, Cu a-olefin, a-hydroxy Cu fatty acid, β-hydroxy Cu fatty acid.

DETA1LED DESCRIPTION OF THE INVENTION

Unless otherwise defined, ail terms used In discloslng the Invention, including technical and scientific terms, hâve the meaning as commonly understood by one of ordinary skill in the art to which this Invention belongs. By means of further guidance, term définitions are Included to better appreciate the teaching of the présent invention.

As used herein, the singular forms a, an, and the include both singular and plural 10 referents unless the context clearly dictâtes otherwise.

The terms comprising, comprises and comprised of as used herein are synonymous with including, Includes or containing, contains, and are inclusive or open-ended and do not exclude additional, non-recited members, éléments or method steps. Where reference is made to embodiments as comprising certain éléments or 15 steps, this encompasses also embodiments which consist essentially of the recited éléments or steps.

The recitation of numerical ranges by endpolnts includes ail numbers and fractions subsumed within the respective ranges, as well as the recited endpolnts.

The term about as used herein when referring to a measurable value such as a 20 parameter, an amount, a temporal duration, and the like, Is meant to encompass variations of +/-10% or less, preferabiy +/-5% or less, more preferably +M% or less, and still more preferably +/-0.1% or less of and from the specified value, insofar such variations are appropriate to perform In the disclosed Invention, it is to be understood that the value to which the modifier about refers Is itself also specifically, and 25 preferably, disclosed.

AU documents cited In the présent spécification are hereby Incorporated by reference in their entirety.

Standard reference work setting forth the general principles of biochemistry includes

Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, ed. Michal, G,

John Wiley and Sons, Inc., New York, US, 1999.

β

The term ‘olefin’ or “alkene refera herein to molécules composed of carbon and hydrogen, containing at least one carbon-carbon double bond. Olefins containing one carbon-carbon double bond are denoted herein as mono-unsaturated hydrocarbons and hâve the chemical formula CnHîn. where n equals at least two.

Alpha-olefins, “α-olefins, 1-alkenes or “terminal olefins’ are used as synonyms herein and dénoté olefins or alkenes having a double bond at the primary or alpha (a) position. “Linear α-olefins or “LAO as used herein refer to α-olefins that hâve a linear hydrocarbon chain, whereas “branched α-olefins hâve a branch on one or more carbon atoms of the hydrocarbon chain. The term “medium-chain α-olefins is used herein to dénoté α-olefins with 7 to 13 carbons and encompasses any one or more of C? α-olefins, C_e a-olefins, C» α-olefins, Cio α-olefins, Cn α-olefins, C12 a-olefins, and C13 α-olefins. The term “uneven-numbered α-olefins refera to α-olefins wherein the number of carbon atoms is not even ln number. Thus, uneven-numbered mediumchain α-olefins encompass C7, Ce, C11 and C13 a-olefins.

As used herein, the term fatty acid or “free fatty acid means a carboxylic acid having the formula RCOOH, or a sait (RCOO-) thereof. R represents an aliphatic group, preferably an alkyl group. Fatty acids can be saturated, mono-unsaturated, or polyunsaturated. The term ‘medium-chain fatty acid or “medium-chain free fatty acid as used herein dénotés a fatty acid or free fatty acid having 8 to 14 carbon atoms. The 20 term “even-numbered fatty acids refera to fatty acids wherein the number of carbon atoms Is even in number. Thus, even-numbered medium-chain fatty acids encompass Ca, C10, C12 and Cu fatty acids.

As used herein, the term “host ceil’ refera to a cell that can be used to produce an aolefin as described herein. A host cell may be an isolated cell or a cell line grown in 25 culture, or a cell which résides in a living tissue or organism.

As used herein, the terms microbial, microbial organism or micro-organism are intended to mean any organism that existe as a microscopie cell that Is included within the domains of archaea, bacteria or eukaryotes. Therefore, the term Is Intended to encompass prokaryotlc or eukaryotic ceils or organisms having a microscopie size and • 30 includes bacteria, archaea and eubacteria such as cyanobacteria of ail species as well as eukaryotic micro-organisms such as fungi, Including yeasts, and algae. The term

also includes cell cultures of any species that can be cultured for the production of a blochemlcal.

The term “oleaginous as used herein with reference to a host cell dénotés cells characterized by their lipid accumulation capability. Typically, their biomass contains 5 over 20% lipids In dry matter.

The algae group encompasses, without limitation, (i) several eukaryotic phyla, Including the Rhodophyta (red algae), Chlorophyta (green algae), Dinoflagellata, Haptophyta, (ii) several classes from the eukaryotic phylum Heterokontophyta which include without limitation the classes Bacillariophycea (diatoms), Eustigmatophycea, 10 Phaeophyceae (brown algae), Xanthophyceae (yellow-green algae) and

Chrysophyceae (golden algae), and (iii) the prokaryotic phylum Cyanobacteria (bluegreen algae).

The term algae includes for example généra selected from : Achnanthes, Amphora, Anabaena, Anikstrodasmls, Arachnoidiscusm, Aster. Botryococcus, Chaetoceros, 15 Chlamydomonas, Chlorella, Chlomcoccum, Chorathron, Cocconeis, Coscinodiscus,

Cyclotella, Cylindrotheca, Dunalialla, Emiliana, Euglena, Fistulifara, Fragilariopsis, Gyrosigma, Hamatococcus, Isochrysis, Lampriscus, Monochrysis, Monoraphidium, Nannochloris, Nannnochloropsis, Navicula, Neochloris, Naphrochloris, Nephrosalmls, Nitzschia, Nodularia, Nostoc, Odontalla, Oochromonas, Oocystls, Oscillartoria, 20 Pavlova, Phaaodactylum, Playtmonas, Pleumchrysis, Porhyra, Pseudoanabaena,

Pyramimonas, Stichococcus, Synachococcus. Synechocystis, Tetraselmis, Thalassioslra, and Trichodasmlum.

The terms genetically engineered or genetically modified’ or ‘Tecombinanf as used herein with reference to a host cell dénoté a non-naturally occurring host cell, as well 25 as its recombinant progeny, that has at least one genetic alteration not found in a naturally occurring strain of the referenced species, including wild-type strains of the referenced species. Such genetic modification Is typically achieved by technical means (i.e. non-naturally) through human intervention and may include, e.g., the introduction of an exogenous nucleic acid and/or the modification, over-expression, or délétion of 30 an endogenous nucleic acid.

The term exogenous or ’foreign’ as used herein is intended to mean that the referenced molécule, in particular nucleic acid, is not naturally présent in the host cell.

The term endogenous or “native as used herein dénotés that the referenced molécule, in particular nucleic acid, is présent in the host cell.

By “recombinant nucleic acid when referring to a nucleic acid in a recombinant host cell, is meant that at least part of said nucleic acid is not naturally présent in the host 5 cell in the same genomic location. For instance a recombinant nucleic acid can comprise a coding sequence naturally occurring in the host cell under control of an exogenous promotor, or it can be an additional copy of a gene naturally occurring in the host cell, or a recombinant nucleic acid can comprise an exogenous coding sequence under the control of an endogenous promoter.

By nucleic acid’ is meant ollgomers and polymers of any length composed essentiaily of nucléotides, e.g., deoxyribonucleotides and/or ribonucleotides. Nucleic acids can comprise purine and/or pyrimidine bases and/or other natural (e.g., xanthine, inosine, hypoxanthine), chemically or biochemically modified (e.g., methylated), non-natural, or derivatised nucléotide bases. The backbone of nucleic acids can comprise sugars and phosphate groups, as can typically be found in RNA or DNA, and/or one or more modified or substituted sugars and/or one or more modified or substituted phosphate groups. Modifications of phosphate groups or sugars may be introduced to improve stability, résistance tô enzymatic dégradation, or some other useful property. A nucleic acid can be for example double-stranded, partly double stranded, or single-stranded.

Where single-stranded, the nucleic acid can be the sense strand or the antisense strand. The nucleic acid can be circular or linear. The term nucleic acid as used herein preferably encompasses DNA and RNA, specifically including genomic, hnRNA, pre-mRNA, mRNA, cDNA, recombinant or synthetic nucleic acids, including vectors.

By encoding is meant that a nucleic acid sequence or part(s) thereof corresponds, by 25 virtue of the genetic code of an organism in question, to a particular amino acid sequence, e.g., the amino acid sequence of a desired polypeptide or protein. By means of example, nucleic acids encoding” a particular polypeptide or protein, e.g. an enzyme, may encompass genomic, hnRNA, pre-mRNA, mRNA, cDNA, recombinant or synthetic nucleic acids.

Preferably, a nucleic acid encoding a particular polypeptide or protein may comprise an open reading frame (ORF) encoding said polypeptide or protein. An “open reading frame or “ORF refers to a succession of coding nucléotide triplets (codons) starting with a translation initiation codon and closlng with a translation termination codon

known per se, and not containing any internai ln-frame translation termination codon, and potentially capable of encoding a polypeptide or protein. Hence, the term may be synonymous with coding sequence* as used ln the art.

The nucleic acids taught herein may encode more than one polypeptide or protein.

Such nucleic acids are denoted as polycistronic* nucleic acids and typically comprise several ORFs or coding sequences, each encoding a polypeptide or protein.

The terms polypeptide and protein are used Interchangeably herein and generally refer to a polymer of amino acid residues linked by peptide bonds, and are not limited to a minimum length of the product. Thus, peptides, oiigopeptides, polypeptides, 10 dimers (hetero- and homo-), multimers (hetero- and homo-), and the like, are included within the définition. Both full-length proteins and fragments thereof are encompassed by the définition. The terms also include post-expression modifications of the polypeptide, for example, glycosylation, acétylation, phosphorylation, etc. Furthermore, for purposes of the présent invention, the terms also refer to such when including 15 modifications, such as délétions, additions and substitutions (e.g., conservative in nature), to the sequence of a native protein or polypeptide.

The term enzyme* as used herein dénotés a biological molecufe that catalyzes e chemical reaction. The term encompasses single enzymes, I.e. single catalytic entities, as well as Systems comprising more than one catalytic entity. The enzymes described 20 herein can naturally possess the recited activity or they can be englneered to exhibit said activity.

As used herein, fatty acid enzyme means any enzyme Involved in fatty acid blosynthesls. As used herein, the term fatty acid biosynthetic pathway means a biosynthetic pathway that produces fatty acids. Fatty acid enzymes can be expressed 25 or over-expressed in a host cell to produce fatty acids.

As used herein, the terms purify, purified, or purification means the removal or isolation of a molécule from its environment by, for example, isolation or séparation. As used herein, these terms also refer to the removal of contaminants from a sample. For example, when α-oleflns are produced in a host cell, the oiefins can be purified by the 30 removal of other cellular components (e.g., nucleic acids, polypeptides, iipids, carbohydrates, or other hydrocarbons). The terms purify, purified, and purification* do not require absolute purity. They are relative terms.

also includes cell cultures of any species that can be cultured for the production of a biochemical.

The term oleaginous as used herein with reference to a host cell dénotés cells characterized by their lipid accumulation capability. Typically, their biomass contains 5 over 20% liplds In dry matter.

* The algae group encompasses, without limitation, (i) several eukaryotic phyla, including the Rhodophyta (red algae), Chlorophyta (green algae), Dinoflagellata, Haptophyta, (ii) several classes from the eukaryotic phylum Heterokontophyta which include without limitation the classes Bacillariophycea (diatoms), Eustigmatophycea, 10 Phaeophyceae (brown algae), Xanthophyceae (yellow-green algae) and

Chrysophyceae (golden algae), and (iii) the prokaryotic phylum Cyanobacterla (bluegreen algae).

The term algae includes for example généra selected from : Achnanthes, Amphora, Anabaena, Anikstrodesmis, Arachnoidiscusm, Aster, Bobyococcus, Chaetoceros, 15 Chlamydomonas, Chlorella, Chlorococcum, Chorethron, Cocconeis, Cosclnodlscus, Cyclotella, CylindrOtheca, Dunaliella, Emlliana, Euglena, Fistulifera, Fragilariopsis, Gyroslgma, Hematococcus, Isochrysis, Lampriscus, Monochrysis, Monoraphîdlum, Nannochloris, Nannnochloropsis, Navicula, Neochloris, Nephrochloris, Nephroselmls, Nitzschla, Nodularia, Nostoc, Odontella, Oochromonas, Oocystis, Oscillartoria, ' ' 20 Pavlova, Phaeodactylum, Playtmonas, Pleurochrysls, Portiyra, Pseudoanabaena, Pyramlmonas, Stichococcus, Synechococcus, Synechocystls, Tetraselmls, Thalassioslra, and Trichodesmium.

The terms “genetically engineered or “genetically modified or recombinant as used herein with reference to a host cell dénoté a non-naturally occurring host cell, as well 25 as its recombinant progeny, that has at least one genetic alteration not found in a naturally occurring strain of the referenced species, including wild-type strains of the referenced species. Such genetic modification Is typically achieved by technical means (i.e. non-naturally) through human intervention and may Include, e.g., the introduction of an exogenous nucleic acid and/or the modification, over-expression, or délétion of 30 an endogenous nucleic acid.

The term exogenous or foreign as used herein Is intended to mean that the referenced molécule, in particular nucleic acid, is not naturally présent ln the host cell.

The term “endogenous or ‘native* as used herein dénotés that the referenced molécule, ln particular nucleic add, Is présent ln the host cell.

By ‘recombinant nucleic add* when referring to a nucleic add in a recombinant host cell, is meant that at least part of said nucleic acid is not naturally présent ln the host *. 5 cell in the same genomic location. For instance a recombinant nudelc acid can comprise a coding sequence naturally occurring ln the host cell under control of an exogenous promotor, or It can be an additional copy of a gene naturally occurring ln the host cell, or a recombinant nucleic acid can comprise an exogenous coding sequence under the control of an endogenous promoter.

By ‘nudeic add* Is meant oligomers and polymers of any length composed essentially of nucléotides, e.g., deoxyribonucleotides and/or ribonucleotides. Nudeic acids can comprise purine and/or pyrimidine bases and/or other natural (e.g., xanthine, inosine, hypoxanthine), chemically or biochemically modified (e.g., methylated), non-natural, or derivatised nucléotide bases. The backbone of nudeic acids can comprise sugars and phosphate groups, as can typically be found in RNA or DNA, and/or one or more modified or substituted sugars and/or one or more modified or substituted phosphate groups. Modifications of phosphate groups or sugars may be introduced to improve stability, résistance to enzymatic dégradation, or some other useful property. A nucleic ’· acid can be for example double-stranded, partly double stranded, or single-stranded. .20 Where single-stranded, the nudeic add can be the sense strand or the antisense strand. The ‘nucleic acid* can be circular or linear. The term nucleic add* as used herein preferably encompasses DNA and RNA, specificaîly including genomic, hnRNA, pre-mRNA, mRNA, cDNA, recombinant or synthetic nucleic acids, Including vectors.

By encoding* Is meant that a nucleic acid sequence or part(s) thereof corresponds, by virtue of the genetic code of an organism ln question, to a particular amino acid sequence, e.g., the amino acid sequence of a desired polypeptide or protein. By means of example, nudeic acids ‘encoding* a particular polypeptide or protein, e.g. an enzyme, may encompass genomic, hnRNA, pre-mRNA, mRNA, cDNA, recombinant or synthetic nudeic acids.

Preferably, a nucleic acid encoding a particular polypeptide or protein may comprise an open reading frame (ORF) encoding said polypeptide or protein. An ‘open reading frame’ or ‘ORF refera to a succession of coding nudeotide triplets (codons) starting with a translation initiation codon and dosing with a translation termination codon

known per se, and not containing any internai in-frame translation termination codon, and potentially capable of encoding a polypeptide or protein. Hence, the term may be synonymous with ‘coding sequence as used in the art.

The nucleic acids taught herein may encode more than one polypeptide or protein.

Such nucleic acids are denoted as “polycistronic* nucleic acids and typically comprise several ORFs or coding sequences, each encoding a polypeptide or protein.

The terms polypeptide and protein are used interchangeably herein and generally refer to a polymer of amino acid residues linked by peptide bonds, and are not limited to a minimum length of the product. Thus, peptides, oligopeptides, polypeptides, 10 dimers (hetero- and homo-), multimers (hetero- and homo-), and the like, are Included within the définition. Both fuil-length proteins and fragments thereof are encompassed by the définition. The terms also include post-expression modifications of the polypeptide, for example, glycosylation, acétylation, phosphorylation, etc. Furthermore, for purposes of the present invention, the terms also refer to such when including 15 modifications, such as délétions, additions and substitutions (e.g., conservative In nature), to the sequence of a native protein or polypeptide.

The term enzyme as used herein dénotés a biological molécule that catalyzes a chemical reaction. The term encompasses single enzymes, I.e. single catalytic entities, as well as Systems comprising more than one catalytic entity. The enzymes described 20 herein can naturally possess the redted activity or they can be engineered to exhibit said activity.

As used herein, fatty acid enzyme means any enzyme involved in fatty acid biosynthesis. As used herein, the term fatty acid biosynthetic pathway means a biosynthetic pathway that produces fatty acids. Fatty acid enzymes can be expressed 25 or over-expressed in a host cell to produce fatty acids.

As used herein, the terms purify, purified, or purification means the removal or isolation of a molécule from its environment by, for example, isolation or séparation. As used herein, these terms also refer to the removal of contaminants from a sample. For example, when α-olefins are produced in a host cell, the olefins can be purified by the 30 removal of other celiular components (e.g., nucleic acids, polypeptides, iipids, carbohydrates, or other hydrocarbons). The terms purify, purified, and purification do not require absolute purity. They are relative terms.

As used herein, the terms identity” and identical and the like refer to the sequence similarity between two polymeric molécules, e.g., between two nucieic acid molécules or polypeptides. Methods for comparing sequences and determining sequence identity are well known in the art. By. means of example, percentage of sequence Identity refers 5 to a percentage of Identical nucieic acids or amino acids between two sequences after alignmenf of these sequences. Alignments and percentages of identity can be performed and calculated with various different programs and algorithme known ln the art. Preferred alignment algorithme include BLAST (Altschul, 1990; available for instance at the NCBI website) and Clustal (reviewed in Chenna, 2003; available for 10 instance at the EBI website). Preferably, BLAST is used to calculate the percentage of

Identity between two sequences, such as the Blast 2 sequences algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174: 247-250), for example using the published default settings or other suitable settlngs (such as, e.g., for the BLASTN algorithm: cost to open a gap = 5, cost to extend a gap 2, penalty for a mlsmatch = 15 2, reward for a match = 1, gap x_dropoff = 50, expectation value ~ 10.0, word size 28; or for the BLASTP algorithm: matrix = Blosum62, cost to open a gap = 11, cost to extend a gap = 1, expectation value = 10.0, word size = 3).

The term “renewable is used herein to refer to a material (e.g. a molécule, a composition or a product) that can be produced or Is derivable from a natural resource 20 which is periodically (e.g., annually or perennially) replenished through the actions of plants of terrestrial, aquatic or oceanic ecosystems (e.g., agricultural crops, edible and non-edible grasses, forest products, seaweed, or algae), or microorganisms (e.g., bacteria, fungi, or yeast).

The term renewable resource refers to a natural resource that can be replenished 25 within a 100 year time frame. The resource may be replenished naturally,· or via agricultural techniques. Renewable resources Include, for example but without limitation, plants, animais, fish, bacteria, fungi, yeasts, algae and forestry products. They may be naturally occurring, hybrids, or geneticaily engineered organisme. Natural resources such as crude oil, coal, and peat which take longer than 100 years to form 30 are not considered to be renewable resources.

The term bio-based content refers herein to the amount of carbon from a renewable resource in a material as a percentage of the mass of the total organic carbon ln the material, as determined by standard ASTM D6866.

The term biosourced with respect to a material (e.g. a molécule, a composition or a product) means that such material Is derived from starting matériels of renewable origin (I.e. from renewable resources). Accordingly, subject to typical measurement errors, a biosourced material has a bio-based content of at least 90%, preferably at least 95%, 5 more preferably at least about 96%, 97% or 98%, even more preferably at least about

99% such as about 100%. ’

The présent application generally relates to the biosynthesis of olefins, in particular aoiefins, more particularly medium-chaln a-olefins.

More particularly, the application provides nucléotide sequences encoding mediumchain free fatty acid decarboxylases and the polypeptides encoded thereby, recombinant organisms comprising said nucléotide sequences, methods of production of medîum-chain α-olefins using said polypeptides or said recombinant organisms and products obtained by these methods.

Nucléotide sequences

The application provides nucleic acids encoding enzymes having decarboxylase activity on medium-chain free fatty acids, which are of interest for the production of the corresponding medium-chain α-olefins. Indeed, the inventors hâve identified a number of nucleic acid sequences which encode enzymes having decarboxylase activity on 20 medium-chain free fatty acids, ln particular embodiments these nucleic acids encode decarboxylase enzymes for which medium-chain free fatty acids are preferred substrates.

Nucléotide sequences encoding enzymes having medium-chain free fatty acid decarboxylase activity, in particular CrCn free fatty acid decarboxylase activity, more 25 particularly C12 free fatty acid decarboxylase activity, and accordingly suitable for use ln the methods envisaged herein include the sequence encoding the P450bsh fatty acid hydroxylase (Bs168) from Bacillus subtilis subsp. subtilis str. 168 (SEQ ID NO:3); a genomic sequence of Alicyclobacillus acidocaldarius encoding an olefin-producing enzyme (Aa162) (SEQ ID NO:5); and a genomic sequence of Staphilococcus 30 massiliensls encoding an olefin-producing enzyme (Sm46) (SEQ ID NO:7), as well as variants of these sequences. Variant nucléotide sequences may for Instance be codonoptimized sequences for recombinant expression in a host cell of cholce. For instance,

nucléotide sequences having at least about 70% or 75%, preferably at least about 80%, more preferably at least about 85%, 90% or 95%, even more preferably at least about 96%, 97%, 98% or 99% sequence Identity to SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7 and encoding enzymes having medium-chain free fatty acid decarboxylase activity, in particular Cs-Cu free fatty acid decarboxylase activity, more particularly C₁₂ free fatty acid decarboxylase activity, are envisaged for use in the methods disclosed herein. An exemplary variant nucléotide sequence of SEQ ID NO:7 Is SEQ ID NO:9, which has been codon-optimized for recombinant expression in E. coll.

ln particular embodiments, the decarboxylase enzymes encoded by the nucleic acid sequences envisaged herein hâve substrate preference for medium-chain free fatty acids, preferably CrCu free fatty acids, more preferably Ci₂ free fatty acids.

The inventors are the first to Identify the nucleic acid sequence of Allcyclobacillus acidocaldarius (SEQ ID NO:5) and a genomlc sequence of Staphilococcus massiliensls 15 (SEQ ID NO:7) encoding olefin-produclng enzymes (termed Aa162 and Sm46, respectively). More particularly, the nucleic acid sequence of Alicyclobacillus acidocaldarius (SEQ ID NO:5) was found to encode a decarboxylase (Aa162, SEQ ID NO:6) acting preferably on medium-chain free fatty acids, more particularly on C,₂ free fatty acids, which can ensure an Increased efficiency of the production of medium20 chain α-olefins, more particularly Cu α-olefins, and/or Increased purity of said aolefins. The genomic sequence of Staphilococcus massiliensls (SEQ ID NO:7) was found to encode an olefin-produclng enzyme (Sm46, SEQ ID NO:8) that has decarboxylase activity on medium-chain free fatty acids, ln particular, it was shown that Sm46 shows substrate preference for Ca-Cu free fatty acids, more particularly Ci₂ free 25 fatty acid was found to be the preferred substrate for Sm46: Also advantageously, the

Sm46 polypeptide shows spécifie decarboxylase activity, i.e. the formation of coproducts, in particular hydroxy fatty acids such as a- and β-hydroxy fatty acids, when converting free fatty acid substrate is minimal with said polypeptide.

These novel sequences allow the production of medium-chain α-olefins, ln particular

C7-C11 α-olefins, from the corresponding fatty acid substrates such as the production of

C11 α-olefins from Cu free fatty acids, ln addition, these sequences can be used to further Identify sequences encoding enzymes having medium-chain free fatty acid

decarboxylase activity, Including decarboxylases for which C12 free fatty acids are the preferred substrate.

Variants (or mutants) of sequences Îdentified herein can be naturally occurring or they can be man-made e.g. using genetic engineering techniques. Such techniques are weil 5 known in the art and include, for example but without limitation, site directed mutagenesis, random chemical mutagenesis, and standard cloning techniques. Other exemplary techniques for mutagenesis are recombination techniques such as DNA shuffling that use fragments of existing sequences and mix them ln novel combinations.

Particularly envisaged herein are variant nucléotide sequences obtained by screening 10 a shuffling library between the nucléotide sequences set forth în SEQ ID NO:1 and

SEQ ID NO:7, and a shuffling library between the nucléotide sequences set forth in SEQ ID NO:3 and SEQ ID NO:5 for recombinant nucléotide sequences encoding recomblnant polypeptides having a desired biological activity, in particular decarboxylase activity, more particularly (spécifie) medium-chain free fatty acid 15 decarboxylase activity such as CrCu free fatty acid decarboxylase activity, even more preferably the preferred substrate of these decarboxylases is a Ce-Cu free fatty acid. The technique of DNA shuffling îs weil known in the art. Reference can be made to Stemmer (1994. Nature 370:389-391) for an exemplary shuffling technique.

The nucléotide sequences envisaged herein encoding enzymes having medium-chain 20 free fatty acid decarboxylase activity are of particular interest for the recombinant production of medium-chain α-olefins, e.g. through the (over)expression of said nucleic acid sequences in a recombinant host cell, as detailed below.

Recombinant host cells

The application provides geneticalïy engineered host cells capable of producing 25 medium-chain α-olefins, wherein said host cells are characterized în that they comprise a recombinant nucleic acid encoding an enzyme having decarboxylase activity on Ce to Cu free fatty acids, preferably on C12 free fatty acids as described hereinabove. For instance, these recombinant host celis may comprise an exogenous nucleic acid encoding a medium-chain free fatty acid decarboxylase, or they may over-express an 30 endogenous nucleic acid encoding a medium-chain free fatty acid decarboxylase. ln particular embodiments, the recombinant host cells comprise a recombinant nucleic acid comprising a nucléotide sequence having at least about 70% or 75%, preferably at

least about 80%, more preferably at least about 85%, 90% or 95%, even more preferably at least about 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO:9 or SEQ ID NQ:10 and encoding an enzyme having decarboxylase activity on free fatty acids with a carbon chain length 5 comprised between 8 and 14, preferably on Ca-Cu free fatty acids, more preferably on

Cu free fatty acids, ln particular embodiments, the recombinant host cells comprise a recombinant nucleic acid comprising a nucléotide sequence having at least about 70% or 75%, preferably at least about 80%, more preferably at least about 85%, 90% or 95%, even more preferably at least about 96%, 97%, 98% or 99% sequence identity to 10 SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 3. or SEQ ID NO: 5 and encoding a decarboxylase with preferred activity on Ce- Cu free fatty acids, preferably on Ca- Ci₂ free fatty acids, more preferably on C12 free fatty acids, ln particular embodiments, the recombinant host cells comprise a recombinant nucleic acid comprising a nucléotide sequence that encodes a polypeptide comprising an amino 15 acid sequence of SEQ ID NO:8, SEQ ID NO:13, SEQ ID NO:4 or SEQ ID NO:6 or a functional variant, ln particular a functional fragment, of said polypeptide.

The genetically engineered host cells disclosed herein may be further genetically modified through expression of one or more recombinant nucleic acids encoding an enzyme Involved in a fatty acid biosynthetic pathway. For example, the recombinant 20 host cells may be further modified to overexpress a nucleic acid encoding an enzyme involved in an endogenous fatty acid biosynthetic pathway, or they may be further modified by introduction into the host cell of an exogenous nucleic acid encoding an enzyme involved in fatty acid synthesis. When expressed, the recombinant nucleic acid encoding the enzyme involved ln fatty acid synthesis confers to the host cell the ability 25 to produce or overproduce a fatty acid.

Each step within a fatty acid biosynthetic pathway can be modified to produce or overproduce a fatty acid of Interest. For example, known genes Involved in the synthesis of fatty acids can be expressed or overexpressed ln a host cell to produce a desired free fatty acid, or attenuated to inhibit production of a non-desired fatty acid.

For instance, production of hydrocarbons starting from acyl-ACP is ensured by thioesterases, whereafter the production of terminal olefins is catalyzed by a decarboxylase. Accordingly, exempiary genes involved In fatty acid synthesis include genes encoding thioesterase.

In a preferred embodiment, the host cells are further genetically engineered to express or overexpress a thioesterase to induce or increase free fatty acid production. The chain length of a fatty acid substrate is controlled by thioesterase, and hence, by (over)expressing a suitable thioesterase, a free fatty acid with desired carbon chain 5 length can be obtained. Non-limiting examples of thloesterases are provided in Table 1.

Preferably, medium-chain fatty add (MCFA)-specific thioesterases are used for (over)expression In the recombinant host cells according to the invention.

Table 1: Thloesterases

GenBank accession number (UniProtKB/SwissProt)	Source organlsm	Gene	Preferential product produced
AAC73596	E. coli	fesA without leader sequence	Cia i
AAC73555	Ecoli	tesB
AAA34215 (Q41635); AAC49001	Umbellularia Califomica	fatB	C120
AAC49269 (Q39513)	Cuphea hookeriana	fatB2	Ca o — Cio o
AAC49269; AAC72881	Cuphea hookeriana	fatB3	Ci4 0~ Ciao
AAC49151 (Q39473)	Cinnamonum camphorum	fatB	Cl4 0
CAA85388	Arabidopsis thaliana	fatB	Cia i
NP_189147; NP_193041	Arabidopsis thaliana	fatA	Cia 1
CAC39106	Bradyrhiizobium japonicum	fatA	Cia 1

AAC72883	Cuphea hookeriana	fatA	Cu 1
AAL79381	Helianthus annus	fatA1
JF338905	Cocos nucifera		C120

The thloesterase may be a thloesterase that Is naturally présent In higher plants. Two familles of acyi-ACP thloesterases are présent In higher plants: the Class I acyl-ACP thioesterases encoded by FatA genes, which are responsible for cleaving long-chain (for example, Ci« and Cie) unsaturated fatty acids from acyi-ACP, and the Class II acyl-ACP thloesterases encoded by FatB genes, which are active on saturated fatty acyl chains, and which can be spécifie for medium-chain (Ce-Cu) acyl-ACPs or which can be active on both medium- and long-chain fatty acyl-ACPs. Non-limiting examples of thloesterases which are MCFA-specifîc and naturally présent ln plants, and hence suitable for (over)expresslon ln the recombinant host cells described herein, are thioesterases encoded by FatB genes, or the thioesterases described for Instance In Voelker et al. (1992 Science 257:72-74) and Jing et al. (2011 Biochemistry 12:44). The thloesterase may also be an englneered thloesterase as described for instance In Voelker et al. (1994 Journal of Bacteriology 176:7320-7327),

Depending on the α-olefin of Interest, the expression of thloesterase enzymes may be either induced (by introduction into the host cell of an exogenous nucleic acid encoding said enzyme), stimulated (by overexpresslon of an endogenous gene encoding said enzyme) or attenuated (by modification of an endogenous gene encoding said enzyme).

in some situations, C12 free fatty acids can be produced by expressing or overexpressing thloesterases that use C12-ACP (for example, accession numbers Q41635 and JF3389Ô5) and attenuating thioesterases that produce non-Cu fatty acids, in other instances, Cu free fatty acids can be produced by attenuating endogenous thloesterases that produce non-Cu fatty acids and (over)expressing the thloesterases that use Cu- ACP (for example, accession number Q39473).

Acetyi-CoA, malonyl-CoA, and free fatty acid overproduction can be verified using methods known In the art, for example, by using radioactive precursors, HPLC, and

GC-MS subséquent to cell lysls.

For the production of Cu α-olefins, the host cells are preferably modified by the introduction of an exogenous nucleic acid encoding a thioesterase having preferentiel hydrolase activity towards C12 acyl-ACP substrate such as Q41635 or JF338905 and/or upregulating endogenous genes encoding a thioesterase having preferential hydrolase 5 activity towards C12 acyl-ACP, and optionally downregulating endogenous genes encoding thioesterases that produce non-Cu fatty acids.

The medium-chaln free fatty acids produced by the fatty acid enzymes In the host cells envisaged herein arethe substratesofthe decarboxylase enzymes described herein.

Accordingly, particularly preferred host cells for the production of medium-chain a10 olefins are recombinant host cells comprising:

- a recombinant nucleic acid encoding a thioesterase having preferential hydrolase activity towards medium-chain acyl-ACP substrate; and

- a recombinant nucleic acid encoding a medium-chain free fatty acid decarboxylase.

Particularly preferred host cells for the production of Cu α-olefins are recombinant host cells comprising:

- a recombinant nucleic acid encoding a thioesterase having preferential hydrolase activity towards C12 acyl-ACP substrate; and

- a recombinant nucleic add encoding a C12 free fatty acid decarboxylase.

In particular embodiments, the free fatty acid decarboxylase is an enzyme having at least about 70%, preferably at least about 80%, more preferably at least about 85%, 90% or 95%, even more preferably at least about 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:13 and having medium-chain free fatty acid decarboxylase activity, In particular CrC« free fatty acid decarboxylase activity. In particular embodiments, the fatty acid decarboxylase Is Sm46 (SEQ ID NO:8), Sm46-del29 (SEQ ID NO:13), Bs168 (SEQ ID NO:4) or Aa162 (SEQ ID NO:6) or a functional variant thereof since spécifie production of mediumchain α-olefins, In particular C7-C11 α-olefins, more particularly C11 α-olefins, was shown herein for these enzymes. Accordingly, in particular embodiments, the 30 application provides a genetically engineered host cell comprising a recombinant nucleic add comprising a nucléotide sequence having at least about 70% or 75%, preferably at least about 80%, more preferably at least about 85%, 90% or 95%, even

more preferably at least about 96%, 97%, 98% or 99% sequence Identity to, SEQ ID N0:3, SEQ ID N0:5, SEQ ID N0:7, SEQ ID N0:9 or SEQ ID NO:10 and encoding an enzyme having medium-chain free fatty acid decarboxylase activity, In particular Ca-Cu free fatty acid decarboxylase activity. in further particular embodiments, the 5 recombinant nucleic acid comprises a nucléotide sequence having at least about 70% or 75%, preferably at least about 80%, more preferably at least about 85%, 90% or 95%, even more preferably at least about 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 3 or SEQ ID NO: 5 and encodes an enzyme having decarboxylase activity for which C_e-Cu free fatty acids, 10 more particularly Cn free fatty acids, are the preferred substrate, ln preferred embodiments, the host cell comprises a recombinant nucleic acid encoding a polypeptide having an amino acid sequence comprising SEQ ID NO:8, SEQ ID NO: 13, SEQ ID NO:4 or SEQ ID NO:6 or a functional variant thereof. ln further embodiments, the genetlcally engineered host celi further comprises a recombinant nucleic acid 15 encoding a thloesterase having preferentiai hydrolase activity towards medium-chain . acyl-ACP substrate, preferably towards Ce-Cu acyl-ACP substrate, more preferably towards C12 acyl-ACP substrate.

ln particular embodiments, where the above nucieotide sequences are endogenously expressed by the host cell of the invention', It Is envlsaged that expression of these 20 sequences can be Increased specifically so as to ensure commercially relevant medium-chain α-olefin production.

More particularly, In particular embodiments, the host cell is selected to hâve a high endogenous thloesterase activity. Methods of selecting cells having particular properties are known in the art.

Àny celi that can be suitably transformed with and/or genetically engineered to ensure (over)expression of one or more of the described recombinant nucleic acids can be used ln the context of the présent invention. The host cells disclosed herein can be any prokaryotic or eukaryotic organisai or cell. Non-limiting examples of host celis Include plant cells, bacterial cells, yeast cells, fungal celis, and algal cells. ln embodiments, the 30 host cells are genetically engineered bacteria, or genetically engineered fungi, in particular yeasts, genetically engineered algae, or genetically engineered plant cells.

Preferably, the host cells are oleaginous host cells. For example, the host celi may be an oleaginous bacterium, an oleaginous fungus, oleaginous yeast or an oleaginous

alga. Non-limiting examples of oleaginous yeasts include Lipomycas starkeyl, Rhodosporidium toruloides, Rhodotoruia glutinis, and Yarrowia fipolytica. Non-limitîng examples of oleaginous algae généra include Botryococcus, Chaetocems, Chfore/ta, Chlorococcum, Cyiindrotheca, Dunaliella, Fistulifera, Isochrysls, Nannochloropsls, 5 Neochloris, Nitzschia, Pavlova, Scenedesmus, Skelatonema, Stichococcus and Tetra salmis.

Thus, the genetically engineered host cells disclosed herein comprise a recombinant nucleic acid encoding a medium-chain free fatty acid decarboxylase disclosed herein, and optionally one or more recombinant nucleic acids encoding a fatty acid enzyme, 10 I.e. an enzyme involved in fatty acid synthesis. Additionally or altematively the expression of one or more genes encoding enzymes Involved ln the production of fatty acids other than medium-chain free fatty acids may be suppressed, decreased or limited.

The methods for generating the genetically engineered host celis described herein 15 involve standard genetic modifications, for which well-established methods are available to the skilled person.

Genetic engineering of the host cells to contain a recombinant nucleic acid encoding a polypeptide or a fatty acid enzyme as described herein Is accomplished in one or more steps via the design and construction of appropriate vectors and transformation of the 20 host cells with those vectors.

Electroporation and/or chemical (such as calcium chloride- or lithium acetate-based) transformation methods or Agrobacterium tumefaciens-medialed transformation methods as known ln the art can be used.

The recombinant nucleic acid(s) encoding a decarboxylase enzyme and/or a fatty acid 25 enzyme that may be provided in the host cells in the context of the présent invention typically comprises a coding sequence encoding the decarboxylase enzyme and/or the fatty acid enzyme placed under the transcriptional control of one or more promoters and one or more terminators, both of which are functional in the host cell.

Promoter and terminator sequences may be native to the host cell or exogenous to the 30 host cell. Useful promoter and terminator sequences include those that are highly identical (I.e. having an Identifies score of 90% or more, preferably 95% or more, most preferably 99% or more) ln their functional portions compared to the functional portions

of promoter and terminator sequences, respectively, that are native to the host cell, particularly when the insertion of the recombinant nucleic acid is targeted at a spécifie site ln the host genome. The use of native (to the host) promoters and terminators, together with their respective upstream and downstream flanking régions, can permit 5 the targeted Intégration of the recombinant nucleic acid Into spécifie loci of the host genome.

Additionally or altematively, the coding sequence may be native to the host cell or exogenous to the host cell.

Numerous vectors are known to practitioners skilled in the art, and sélection of an 10 appropriate vector Is a matter of choice. The vectors can either be eut with particular restriction enzymes or used as circular DNA.

The vectors taught herein preferably comprise (a combination of) a recombinant nucleic acid as described herein. in particular, a vector comprises (a combination of) the coding sequence of a polypeptide or a fatty add enzyme as described herein and 15 associated promoter and terminator sequences. The vector may contain restriction sites of various types for linearization or fragmentation. Vectors may further contain a backbone portion (such as for propagation ln E. coli) many of which are conveniently obtained from commercially available yeast or bacterial vectors. The vector preferably comprises one or more sélection marker gene cassettes. A sélection marker gene Is 20 one that encodes a protein needed for the survival and/or growth of the transformed cell in a sélective culture medium. Typical sélection marker genes encode proteins that (a) confer résistance to antibiotics or other toxins such as chloramphenicol, zeocin (sh ble gene from Streptoalloteichus hindustanus), genetecin, melibiase (MEL5), hygromydn (aminoglycoside antibiotic résistance gene from E. coli), ampiciliin, 25 tétracycline, or kanamydn (kanamycin résistance gene of Tn903), (b) complément auxotrophic deficiencies of the cell. Two prominent examples of auxotrophlc deficiendes are the amino add leucine deficiency (e.g. LEU2 gene) or uracil deficiency (e.g. URA3 gene). Cells that are orotidine-5'-phosphate decarboxylase négative (ura3-) cannot grow on media lacklng uracil. Thus a functional URA3 gene can be used as a 30 marker on a cell having a uracil deficiency, and successful transformants can be selected on a medium lacking uracil. Only cells transformed with the functional URA3 gene are able to synthesize uracil and grow on such medium. If the wild-type strain does not hâve a uradl deficiency (as Is the case with /. orlentalis, for example), an

auxotrophlc mutant having the deficiency must be made in order to use URA3 as a sélection marker for the strain. Methods for accomplishing this are well known In the art. The sélection marker cassette typically further Includes a promoter and terminator sequence, operatively linked to the sélection marker gene, and which are opérable ln 5 the host.

Successful transformants can be selected for in known manner, by taking advantage of the attributes contributed by the marker gene, or by other characteristics (such as ability to produce α-olefins) contributed by the inserted recombinant nucleic acids. Screening can also be performed by PCR or Southem analysis to confirm that the 10 desired insertions, and optionally délétions hâve taken place, to confirm copy number and to Identify the point of intégration of coding sequences Into the host genome. Activity (such as α-olefin-producing activity) of the polypeptide encoded by the inserted coding sequence can be confirmed using known assay methods as described elsewhere herein.

Also disclosed herein are methods for obtaining a genetically engineered host cell capable of producing an α-olefin of Interest as described herein, which method may comprise transforming a host cell with a recombinant nucleic acid encoding an enzyme having medium-chain free fatty acid decarboxylase activity as taught herein, more particularly a decarboxylase generating the α-olefin of Interest and optionally one or 20 more recombinant nucleic acids encoding a fatty acid enzyme as taught herein, more particularly a fatty acid enzyme involved In the synthesis of the substrate for the free fatty acid decarboxylase enzyme capable of generating the α-olefin of interest. ln particular, the method may comprise the steps of:

a) transforming a host cell with a recombinant nucleic acid encoding an enzyme having medium-chain free fatty acid decarboxylase activity as taught herein and optionally one or more recombinant nucleic acids encoding a fatty acid enzyme as taught herein; and

b) selecting a host cell capable of producing an α-olefin of Interest.

In particular embodiments, the method further comprises modifylng said host cell so as 30 to reduce the endogenous production of olefins other than the α-olefin of Interest.

As detailed above, different genetic modifications are envisaged herein which Induce medium-chain α-olefin production and/or increase the yield of (one or more particular)

medium-chain α-olefins In a host cell. Accordingly, the présent invention also relates to the use of the genetically engineered host cells as described herein for the production of α-olefins, more particularly medium-chain a-olefins.

Produclna α-olefins usina recombinant host cells

In a further aspect, the Invention provides methods for the production of medium-chain α-olefins, more particularly Cn α-olefins, which method comprises providing a genetically engineered host cell as described above and culturing said genetically engineered host cell In a culture medium so as to allow the production of medium-chain α-olefins. More particularly, the host cell is cultured under conditions suitable to ensure 10 expression or overexpression of the enzyme having medium-chain free fatty acid decarboxylase activity envlsaged herein and optionally one or more fatty acid enzyme(s) Involved in the synthesis of the substrate of the enzyme having mediumchain free fatty acid decarboxylase activity.

in particular embodiments, the host cells ensure a rate of α-olefin production, more 15 particularly medium-chain α-olefin production, which is sufficiently high to be Industrially valuable. Indeed, the recombinant host cells disclosed herein may be capable of ensuring a high yield at limited production costs. Furthermore, they are capable of producing α-olefins of desired carbon chain length. Indeed, the decarboxylase enzymes envlsaged herein preferably hâve substrate preference for a 20 medium-chain free fatty acid, in particular a Ce-Cn free fatty acid, more particularly Cn free fatty acid. Also advantageously, the production of unwanted co-products such as hydroxyl fatty acids is minimal. Indeed, the polypetides envlsaged herein preferably hâve spécifie decarboxylase activity.

The recombinant host cells are cultured under conditions suitable for the production of 25 medium-chain α-olefins by the host cells. More particularly this implies conditions sufficient to allow (overexpression of the recombinant nucieic acid encoding a decarboxylase enzyme, which means any condition that allows a host cell to (over)produce a medium-chain free fatty acid decarboxylase or a fatty acid enzyme as described herein. Suitable conditions include, for example, fermentation conditions. 30 Fermentation conditions can comprise many parameters, such as température ranges, levels of aération, and media composition. Each of these conditions, individualiy and ln combination, allows the host cell to grow. To détermine if conditions are sufficient to

allow (over)expression, a host cell can be cultured, for example, for about 4, 8,12,18, 24, 36, or 48 hours. During and/or after culturing, samples can be obtained and analyzed to détermine if the conditions allow (overjexpresslon. For example, the host cells in the sample or the culture medium in which the host cells were grown can be 5 tested for the presence of a desired product. When testing for the presence of a desired product, assays, such as, but not limited to, sodium dodecyl sulfate poiyacrylamide gel electrophoresis (SDS-PAGE), TLC, HPLC, GC/FID, GC/MS, LC/MS, MS, can be used.

Exempiary culture media Include broths or gels. Mlcro-organisms are typically grown in 10 a culture medium comprising a carbon source to be used for growth of the microorganism. Exempiary carbon sources Include carbohydrates, such as glucose, fructose, cellulose, or the like, that can be directly metabolized by a micro-organlsm. ln addition, enzymes can be added to the culture medium to facilitate the mobllizatlon (e.g., the depolymerization of starch or cellulose to fermentabie sugars) and 15 subséquent metabolism of the carbon source. A culture medium may optîonally contain further nutrients as requîred by the particular strain, including Inorganic nitrogen sources such as ammonia or ammonium salts, and the like, and minerais and the like.

Other growth conditions, such as température, cell density, and the like are generally selected to provide an economlcal process. Températures during each of the growth 20 phase and the production phase may range from above the freezlng température of the medium to about 50*C.

The culturing step of the methods of the invention may be conducted aeroblcally, anaerobically, or substantially anaerobically. Briefly, anaérobie conditions refer to an environment devoid of oxygen. Substantially anaérobie conditions include, for example, 25 a culture, batch fermentation or continuous fermentation such that the dissolved oxygen concentration in the medium remains between 0 and 10% of saturation. Substantially anaérobie conditions also Includes growing or resting cells in liquid medium or on solid agar inside a sealed chamber maintalned with an atmosphère of less than 1% oxygen. The percent of oxygen can be maintained by, for example, 30 sparglng the culture with an N2/CO2 mixture or other suitable non-oxygen gas or gasses.

The cultivation step of the methods described herein can be conducted contlnuously, batch-wise, or some combination thereof.

In particular embodiments, wherein phototrophic algae are used as host cells, the method for the production of medium-chain α-olefins may comprise providing algae genetically engineered to (overjproduce medium-chain α-olefins as taught herein, and culturing said algae in photobioreactors or an open pond System using CO2 and 5 suniight as feedstock.

In certain embodiments, the conditions suitable for the production of medium-chain aoiefins may further imply cultivating the host cells In a culture medium which comprises at least one fatty acid substrate, which is converted into an α-olefin by the decarboxylase encoded by the recombinant nucleic acid comprised in the host cell.

Preferably, the fatty acid substrate is a saturated free fatty add substrate. Also preferably, the fatty acid substrate Is a straight chain free fatty acid substrate. Also preferably, the fatty acid substrate Is an even-numbered CrCu free fatty acid substrate (i.e. a free Ce, Cio, C12, or Cu free fatty acid substrate or any combination thereof), preferably an even-numbered Ce-Cu free fatty add substrate, more preferably a C12 15 free fatty acid substrate.

Particularly Intended herein Is the production of medium-chain α-olefins, more particularly Cu α-olefîns. Medium-chain α-olefins, more particularly Cu α-olefins can be obtained using a recombinant host cell described herein specifically modified for the production of medium-chain α-olefins, more particularly Cu a-olefins.

In further embodiments, methods are provided for producing medium-chain a-olefins, more particularly Cu α-olefins, which, In addition to the steps detailed above, further comprise the step of recovering the α-olefins from the host cell or the culture medium. Suitable purification can be carried out by methods known to the person skilled In the art such as by using lysls methods, extraction, Ion exchange resins, electrodialysls, 25 nanofiltration, etc.

Accordingly, methods are provided for the production of medium-chain α-olefins, more particularly Cu α-olefins, which methods comprise the steps of:

(I) providing a genetically engineered host cell as described herein;

(il) culturing the host cells in a culture medium under conditions suitable for the production of medium-chain α-olefins, and (iii) recovering the α-olefins from the host cell or the culture medium.

ln particular embodiments, wherein oleaginous yeasts are used as host cells, the method for the production of medium-chain α-olefins may comprise the following steps:

(i) providing oleaginous yeasts genetically engineered to (over)produce medium-chain α-olefins as taught herein;

(ii) cuit u ring said oleaginous yeasts ln fermentera; and (iii) recovering the α-olefins from the oleaginous yeast or the culture medium.

ln particular embodiments, wherein phototrophic algae are used as host cells, the method for the production of medium-chain α-olefins may comprise the following steps:

(i) providing algae genetically engineered to (over)produce medium-chain α-olefins as 10 taught herein;

(ii) culturing said algae In photobloreactors or an open pond system using COj and sunlight as feedstock; and (iii) recovering the α-olefins from the algae or the culture medium.

ln particular embodiments the host cells are cultivated under conditions which allow 15 sécrétion of α-olefins into the environment.

Typically, ln the methods for the production of medium chain α-olefins envisaged herein, the decarboxylase expressed by the host cell is not secreted by said host cell and the α-olefin is produced inside the host cell. However, in particular embodiments or for particular applications, it Is of interest to ençure sécrétion of the decarboxylase by 20 the host cells provided herein. This can be of interest where the enzyme Is envisaged to be active upon sécrétion into Its environment. A sécrétion signal sequence can be operably linked to the nucleic acid encoding the free fatty acid decarboxylase to this end. ln this connection, “operably linked’ dénotés that the sequence encoding the sécrétion signal peptide and the sequence encoding the polypeptide to be secreted are 25 connected in frame or in phase, such that upon expression the signai peptide facilitâtes the sécrétion of the polypeptide so-linked thereto.

Polypeptides

Also disclosed herein are enzymes having medium-chain free fatty add decarboxylase activity. ln particular embodiments, these polypeptides are encoded by nucleic acids and nucléotide sequences described herein. Accordingly, disclosed herein are polypeptides encoded by a nucleic acid comprising a nucléotide sequence having at least about 70% or 75%, preferably at least about 80%, more preferably at least about

85%, 90% or 95%, even more preferably at least about 96%, 97%, 98% or 99% sequence Identity to SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO:9 or SEQ ID NO:10 having medium-chain free fatty acid decarboxylase activity, in particular Ce-Cn free fatty acid decarboxylase activity, preferably Cn free fatty acid 5 decarboxylase activity, Indeed, in particular embodiments, the enzymes having medium-chain free fatty acid decarboxylase activity, Ce-Cn free fatty acid decarboxylase activity, preferably C12 free fatty acid decarboxylase activity can be obtained by recombinant expression of said nucleic acids in a host cell. Methods for recombinant production of polypeptides are known in the art.

in particular embodiments, the polypeptides which are enzymes having medium-chain free fatty acid decarboxylase activity, in particular Ce-Cn free fatty acid decarboxylase activity, more particularly Cn free fatty acid decarboxylase activity, include polypeptides having an amino acid sequence comprising, consisting essentially of or consisting of, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:13, and 15 variants, including active fragments, of these polypeptides having medium-chain free fatty acid decarboxylase activity, in particular Ce-Cn free fatty acid decarboxylase activity, more particularly C12 free fatty acid decarboxylase activity. Preferred polypeptides are those consisting of the amino acid sequence of SEQ ID NO:4 (I.e. Bs168), SEQ ID NO:6 (Le. Aa162), SEQ ID NO:8 (i.e. Sm46), or SEQ ID NO:13 (Le.

Sm46-del29) and functional variants of these polypeptides. Indeed, SEQ ID NO:8, and its active fragment of SEQ ID NO:13, are novel polypeptides provided herein having medium-chain free fatty acid decarboxylase activity, in particular Ce-Cn free fatty acid decarboxylase activity, more particularly C12 free fatty acid decarboxylase activity.

In particular embodiments, the polypeptides hâve decarboxylase activity with a 25 preferred activity on medium-chain free fatty acids, in particular on a Ce-Cn free fatty acid, more particularly on Cn free fatty acids, I.e. the preferred substrate for these decarboxylase enzymes are medium-chain free fatty acids, in particular Ce-Cn free fatty acids, more particularly Cn free fatty acids. In particular embodiments, these enzymes hâve at least about 80%, 85%, 90% or 95%, even more preferably at least 30 about 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:8, SEQ ID NO:13, SEQ

ID NO:4 or to SEQ ID NO: 6. Preferred enzymes comprise or consist of SEQ ID NO:8,

SEQ ID NO:13, SEQ ID NO:4 or SEQ ID NO: 6 and functional variants thereof such as but not limited to an active fragment or variant thereof which maintains the activity of

the enzyme comprising or consisting of SEQ ID N0:8, SEQ ID NO: 13, SEQ ID NO:4 or SEQ ID NO: 6.

As used herein In connection to a decarboxylase enzyme, a ‘preferred substrate* refers to the free fatty acid for which the decarboxylase enzyme has the highest activity, I.e.

when reacting with a number of free fatty acids, the decarboxylase enzyme has the highest activity when the substrate Is the preferred free fatty acid substrate. The activity of a decarboxylase enzyme can be determined by measuring the concentration of the corresponding α-olefin product when the decarboxylase acid Is reacted with a free fatty acid substrate. The α-olefin concentration in a reaction or culture medium can be 10 measured by methods well known in the art, such as by GC/MS analysis. The substrate preference for a decarboxylase enzyme can hence be determined by calculating the conversion ratio of each free fatty acid substrate tested Into corresponding α-olefin product, wherein the preferred substrate Is the free fatty acid substrate with the highest conversion ratio. The substrate preference for a 15 decarboxylase enzyme can also be determined by calculating the conversion ratio of each free fatty acid substrate tested, wherein the preferred substrate is the free fatty acid substrate with the highest conversion ratio. The “conversion ratio or ‘substrate conversion ratio* means herein the ratio between consumed substrate (for instance fatty acid substrate concentration (e.g. in mM)) and produced reaction product(s) (for 20 instance α-olefin concentration (e.g. ln mM) and also potential co-product(s) is quantified (for instance hydroxyl fatty acid concentration (e.g. ln mM)). The conversion ratio or conversion percentage for a spécifie reaction product can be calculated as the ratio between consumed substrate (for Instance fatty acid substrate concentration (e.g. ln mM)) and the spécifie reaction product produced (for Instance α-olefin concentration 25 (e.g. ln mM). ·

Also envlsaged herein are variant polypeptides ofthe polypeptides described herein. It is understood that the variant polypeptides described herein may hâve conservative or non-essential amino acid substitutions, which do not hâve a substantial effect on the polypeptide fùnctions. Whether or not a particular substitution will be tolerated (i.e., will 30 not adversely affect desired biological properties) can be determined as described in Bowle et al. (1990) (Science 247:1306 1310). A conservative amino acid substitution is one ln which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains hâve

been defined ln the art. These families Include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartîc acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, 5 proline, phenylalanlne, méthionine, tryptophan), beta-branched side chains (e.g., threonine, valine, Isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

Additional polypeptide variants are those ln which additional amino acids are fused to the polypeptide, such as a sécrétion signal sequence, or a sequence which facilitâtes 10 purification of the polypeptide.

Yet other polypeptide variants include functional or active fragments comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100 or 150 consecutive amino acids, and which retain the same biological function as Bs168, Aa162, or Sm46 (e.g. retain olefinproducing activity, more particularly improved decarboxylase activity towards medium15 chain free fatty acids, more preferably on Cu FFA substrate). Exemplary functional or active fragments include without limitation truncated forms of the polypeptides described herein, which retain the decarboxylase activity of Bs168, Aa162, or Sm46. These functional or active fragments hence retain at least the decarboxylase catalytlc domain of the polypeptide, i.e. the part of the polypeptide that is involved ln the 20 decarboxylase reaction. A particular example of such truncated form is the polypeptide having an amino acid sequence of SEQ ID NO:13 (encoded by the nucléotide sequence of SEQ ID NO:10), which polypeptide Is a functional fragment of Sm46 wherein the 29 N-terminal amino acids were deleted.

Functional variants of the polypeptides described herein retain the decarboxylase 25 activity of the polypeptides. Accordingly, the functional variants may comprise or consist of an amino acid sequence having at least about 70%, preferably at least about 80%, more preferably at least about 85%, 90% or 95%, even more preferably at least about 96%, 97%, 98% or 99% sequence Identity ln the decarboxylase catalytic domain of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, or SEQ ID NO: 13. The polypeptide 30 variants may hâve an amino acid sequence substantially Identical to SEQ ID NO:4,

SEQ ID NO:6, SEQ ID NO:8, or SEQ ID NO:13 or they may hâve an amino acid sequence having at least about 70%, preferably at least about 80%, more preferably at least about 85%, 90% or 95%, even more preferably at least about 96%, 97%, 98% or

99% sequence Identity to SEQ ID NO:4, SEQ ID N0:6, SEQ ID N0:8, or SEQ ID NO:13. The polypeptide variants, In particular the active or functional fragments, may hâve an amino acid sequence wherein the 40 or less, preferably 35 or less, more preferably 30 or less such as 29 or less, N-terminal amino acids of SEQ ID NO:4, SEQ 5 ID NO.6, SEQ ID NO:8 or SEQ ID NO: 13 hâve been deleted.

The polypeptides disclosed herein hâve free fatty acid decarboxylase activity, in particular decarboxylase activity on Ce-Cu free fatty acids, more particularly on evennumbered Ce-Cu free fatty acids such as on Ce, Cio, Cu and/or C« free fatty acids, even more particulariy Ce-Cu free fatty acid decarboxylase activity such as Cu free 10 fatty acid decarboxylase activity, Indeed, as shown In the experimental section, decarboxylase activity has been shown for OleTjE, Bs168, Aa162, Sm46 or Sm46del29, more particulariy decarboxylase activity on Cu, Cu and Cu free fatty acids. The Sm46, Sm46-del29, Aa162 and Bs168 enzymes showed higher activity on Cu free fatty acid, resulting in higher production of Cu a-olefins.

Decarboxylase activity of a polypeptide can be assayed using routine methods. For example, the polypeptide can be contacted with a substrate, In particular a free fatty acid substrate, under conditions that allow the polypeptide to function. A decrease In the level of the substrate or an Increase In the level of an α-olefin can be measured to détermine decarboxylase or olefin-producing activity.

The polypeptides described herein may further catalyze the hydroxylation of fatty acids, in particular the a- and β-hydroxylation of fatty acids, as side reactions. Preferred polypeptides are those for which the décarboxylation activity is the dominant activity,

i.e. which hâve spécifie decarboxylase activity. In preferred embodiments, the conversion of a free fatty substrate into hydroxy fatty acid, in particular a- and β25 hydroxy fatty acid by the polypeptide Is only marginal (such as less than 25%, preferably less than 20%, more preferably less than 10% of total products) as compared to the conversion of the fatty acid substrate into the corresponding a-olefin. In embodiments, the conversion percentage for hydroxy fatty acids is less than 25%, preferably less than 20%, more preferably less than 10%. The conversion percentage for hydroxy fatty acids can be calculated as the ratio between consumed substrate (for instance fatty acid substrate concentration (e.g. in mM)) and produced hydroxyl fatty acids (for instance hydroxyl fatty acid concentration (e.g. in mM)). Particular examples of polypeptides with spécifie decarboxylase activity are Sm46 or functional variants

thereof, including active fragments thereof, such as the truncated form of Sm46 wherein the 29 N-termlnal amino acids were deleted (i.e. the polypeptide encoded by the nucléotide sequence of SEQ ID NO:10 or the polypeptide of SEQ ID N0:13).

The polypeptides envisaged herein can be produced by recombinant expression ln a host cell. ln particular embodiments, the polypeptide is secreted by the host cell.

Production of g-olefins

Also provided herein is the use of the medium-chain free fatty acid decarboxylase enzymes disclosed herein for the production of medium-chain α-olefins, more particularly Cn a-olefins.

Some methods described herein relate to the production of medium-chain a-olefins, more particularly Cu α-olefins, using a (purified) medium-chain free fatty acid decarboxylase enzyme disclosed herein and a free fatty acid substrate. Accordingly, disclosed herein Is a method for the production of medium-chain α-olefins, more particularly Cu α-oiefins, comprising contacting a medium-chain free fatty acid 15 decarboxylase enzyme with a suitable free fatty acid substrate so as to produce medium-chain α-olefins, more particularly Cu a-olefins.

In particular embodiments, the medium-chain free fatty acid decarboxylase is a polypeptide having an amino acid sequence of SEQ ID NO:4, SEQ ID NO:6 SEQ ID NO:8 or SEQ ID NO:13 or a functional variant, including a functional or active fragment, 20 of said polypeptide, ln particular embodiments, the medium-chain free fatty acid decarboxylase is a polypeptide having an amino acid sequence having at least about 70%, preferably at least about 80%, more preferably at least about 85%, 90% or 95%, even more preferably at least about 96%, 97%, 98% or 99% sequence Identity to SEQ

ID NO:4, SEQ ID NO:6 SEQ ID NO:8 or SEQ ID NO:13. ln particular embodiments, the 25 enzyme has a preferred activity on medium-chain free fatty acids, more preferably on

Cb-Cw free fatty acids. Most particularly, the enzyme Is a decarboxylase having preferred activity on Cn free fatty acids and having an amino acid sequence having at least about 85%, 90% or 95%, even more preferably at ieast about 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:8, SEQ ID NO:13, SEQ ID NO: 4 or SEQ ID NO: 30 6. ln particular embodiments, the enzyme has 95% amino acid sequence Identity to

SEQ ID NO:8, SEQ ID NO:13, SEQ ID NO: 4 or SEQ ID NO: 6.

For example, a host cell can be genetically engineered to overexpress a medium-chain free fatty acid decarboxylase as disclosed herein. The recombinant host cell can be cultured under conditions sufficient to allow (over)express!on of the decarboxylase. Cell-free extracts can then be generated using known methods. For example, the host 5 cells can be lysed using détergents or by sonication. The overexpressed polypeptides can be purified using known methods, or the cell-free extracts can be used as such for the production of olefins. The host cells can also be genetically engineered to overexpress a medium-chain free fatty acid decarboxylase as disclosed herein and to secrete said polypeptide Into the growth medium as described elsewhere. The secreted 10 polypeptides can then be separated from the growth medium and optionally purified using known methods without the need for obtaining cell-free extracts,

Next, free fatty acid substrates can be added to the cell-free extracts or (purified) enzymes and maintained under conditions to allow conversion of the free fatty acid substrates to α-olefins. The α-olefins can then be separated and purified using known 15 techniques.

Olefins having particular branchlng patterns, levels of saturation, and carbon chain length can be produced from free fatty acid substrates having those particular characteristics using the described methods. For example, the fatty acid substrate may be an unsaturated free fatty acid substrate (e.g. a monounsaturated free fatty acid 20 substrate), or a saturated free fatty acid substrate. The fatty acid substrate may be a straight chain free fatty acid substrate, a branched chain free fatty acid substrate, or a free fatty acid substrate that Includes a cyclic moiety.

Preferably, the fatty acid substrate Is a saturated free fatty acid substrate. Also preferably, the fatty acid substrate Is a straight chain free fatty acid substrate. Also 25 preferably, the fatty acid substrate is an even-numbered CrCu free fatty acid substrate (i.e. a Ca, Cio, Cw and/or Cu free fatty acid substrate), more preferably an evennumbered Ca-Ci₂ free fatty acid substrate, most preferably a C12 fatty acid substrate.

Particularly intended herein Is the production of Ch α-olefins. Ch α-olefins can be obtained from a C« free fatty acid substrate using a C_t2 free fatty acid decarboxylase enzyme described herein. As shown ln the experimental section, Sm46, Sm46-del29,

Bs168 and Aa162 speciflcally show decarboxylase activity on C» free fatty acid substrates, i.e. Ci₂ free fatty acid substrate is the preferred substrate for a-olefin

production for Sm46, Sm46-del29, Bs166 and Aa162. Hence, in particular embodiments, the présent invention relates to a method for the production of Cn aolefins, which method comprises contacting a C12 free fatty acid decarboxylase encoded by a nucleic acid comprising a nucléotide sequence having at least about 5 70% or 75%, preferably at least about 80%, more preferably at least about 85%, 90% or 95%, even more preferably at least about 96%, 97%, 96% or 99% sequence identity to SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:3 or SEQ !D NO:5. ln embodiments, the method comprises contacting a a polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:8_t SEQ ID NO: 13, SEQ ID NO:4 or 10 SEQ ID NO:6 or a functional variant of said polypeptide, preferably a polypeptide consisting of SEQ !D NO:8, SEQ ID NO: 13, SEQ ID NO:4 or SEQ ID NO:6, with a C12 free fatty acid substrate, preferably dodecanoic acid (or lauric acid).

Also provided herein are medium-chain α-olefins, more particularly the Cn a-olefins, obtainable by the methods disclosed herein.

Medium-chain a-olefins

Also disclosed herein are the medium-chain α-olefins, and compositions comprising medium-chain α-oiefins more particularly the Cn α-olefins, produced by the methods as herein described. The methods described herein advantageously resuit ln the production of homogenous α-olefins, wherein the a-olefins produced hâve a uniform 20 carbon chain length. These processes are hence more efficient than conventional processes which resuit in the production of mixture of α-olefins with different carbon chain length and which require séparation of the different α-olefins for subséquent reactions.

Post-production processing

The produced α-olefins, more particularly medium-chain α-olefins such as Cn aoiefins, can be used as or converted Into a fuel, in particular a biofuel. These a-olefins, more particularly medium-chain α-olefins such as Cn α-olefins, can also be used as starting material for the production of chemicals or Personal care additives (e.g. polymers, surfactants, plastics, textiles, solvents, adhesives, etc.). They can also be 30 used as feedstock for subséquent réactions, such as hydrogénation and/or oligomérization reactions, to make other products.

A further aspect of the Invention relates to a method for the production of poly-a-olefins (PAO), said method comprising:

a) producing α-olefins, more particularly medium-chain α-olefins, according to a method disclosed herein;

b) olîgomerizing the α-olefins produced ln step a); and optionally

c) hydrogenating the oligomer produced In step b).

ln particular embodiments, a method is provided for the production of C33 PAOs, which comprises:

a) producing Cu α-olefins according to a method disclosed herein;

b) trimerizing the Cu α-olefins produced in step a); and optionally

c) hydrogenating the trimer produced ln step b).

Oligomérization of medium-chain α-olefins In the presence of a catalyst Is well known in the art. Catalysts that can be used for the oligomérization step are for example, but not limited to, AlCb, BF₃, BFs complexes for cationic oligomérization, and métal based 15 catalysts like metallocenes.

Following the oligomérization step, residual unsaturation that Is potentially présent In the oligomers Is saturated by catalytic hydrogénation resulting ln saturated alîphatic hydrocarbons with one or more side branches.

The oligomers obtained by methods as described herein are known under the generic 20 name of poly-a-olefins (PAO). The PAO production methods described herein advantageously resuit in the homogenous production of PAOs of a well-defined carbon chain length. Accordingly, the application also provides a composition of PAO's obtainable by a PAO production method described herein, characterized in that at least 50%, preferably at least 85% or 90%, more preferably at least 95% such as 96%, 97%, 25 98% or even 99% of the PAOs hâve a well-defined carbon chain length such as C33

PAOs. Such a homogenous composition of poly-a-oiefins has not previously been disclosed.

The methods provided herein allow obtaining a base oil with a well-defined viscosity.

The PAOs, more particularly the C33 PAOs, obtainable by a method as described herein can be used as base oils, which display very attractive viscosity indices, with the viscosity increasing with the number of carbons. These base oils can be used,

together with additives and optionally other base oils, to formulate lubricants. In particular, PAOs with a number of carbons of about 30, more particularly 33 carbons, are preferred for automotive lubricants.

Accordingly, In a further aspect, the présent Invention relates to the use of the medium5 chain free fatty acid decarboxylase enzymes and the recombinant host cells described herein for the industrial production of lubricants.

Also provided herein are lubricants comprising poly-a-olefins, more particularly lubricants comprising poly-a-olefins which contain a more homogenous composition of poly-a-olefins, more particularly a high concentration of poly-olefins of a well-defined tO length, such as those obtainable by a method as described herein. Indeed, the Invention allows for the production of lubricants which are produced based on blosourced medium-chain alpha-olefins. More particularly, the Invention allows for the provision of lubricants comprising poly-a-olefins, whereby at least 50%, preferably at least 85% or 90%, more preferably at least 95% such as 96%, 97%, 98% or even 99% 15 of said poly-a-olefins are poly-a-olefins of a well defined carbon chain length, such as

C33 poly-a-olefins. Lubricants comprising such a homogenous composition of poly-aolefins hâve not previously been disclosed.

Further disclosed herein are methods for the production of alkanes, said methods comprising: (a) production of α-olefins more particularly medium-chain a-olefins, 20 according to a method disclosed herein; and (b) hydrogénation of the a-olefins obtained in step (a) to produce alkanes.

The présent invention will now be further Illustrated by means of the following non limiting examples.

EXAMPLES

Example 1: Production of Cn α-oleflns by OleTje. Sm46, Bs168 and Aa162

Material and methods

Molecular cloning

The genes encoding OleT_JE (SEQ ID N0:1), Sm46 (SEQ ID N0:3), Bs168 (SEQ ID N0:5) and Aa162 (SEQ ID N0:7) were cloned Into the Ncfel/BamHI sites of the pET28a plasmid (Novagen, Fig. 2) by standard molecular biology techniques.

Protein overexpression and purification

E. coli BL21(DE3) cells (Novagen) carrying a recombinant plasmid or an empty PET28a plasmid (control) were cultured for several cycles to ensure best growth state at 37*C in 10 mL LB medium supplemented with 50 pg/ml of kanamycin, followed by inoculation (1:100 ratio) Into 50 mL fresh Terrifie Broth medium containing 50 pg/ml of kanamycin, 1 mM thlamine, 10% glycerol and a rare sait solution (6750 mg/l FeClj, 500 mg/l ZnCk, 500 mg/l CoCl_a, 500 mg/l Na₂MoO4, 250 mg/l CaCb, 465 mg/l CuSO4, and 125 mg/l H3BO3) at 37’C. Cells were grown at 37'C for 3 to 4 h until the optical density at 600 nm (ODeoo) reached 0.6 to 0.8, at which 0.2 or 0.4 mM lsopropyl-β-οthiogalactopyranoside (IPTG) and 0.5 mM δ-amlnolevulinic acid were added, followed by 18 h of cultivation at 16°C.

Then, the cell cultures were recovered by centrifugation (at 4’C) and re-suspended in

1.5 mL 50 mM Tris buffer, pH 7.5, containing 0.1 M NaCI. The re-suspended cell cultures were disrupted by sonicatlon and centrifuged at 13,000 x g for 30 min (4 °C). The supernatant was collected and the pellet was re-suspended in 1.5 mL 50 mM Tris buffer, pH 7.5, containing 0.1 M NaCI for further analysis. An SDS gel was run to 20 check the expression of the genes using 15 pL of supernatant or pellet solution mixed with 5 pL of 4x loading buffer (Fig. 3).

The amount of total proteins within the supernatant was quantified using Pierce BCA kit according to the manufacturer^ instructions.

• ln vitro enzymatic assays ln vitro olefin biosynthesis was evaluated by adding to the supernatant a fatty acid substrate in DMSO to a final concentration of 0.2 mM (1:100 dilution) or 1 mM (1:10 dilution), and 500 pM H₂O₂. The reaction mixture was incubated at 28’C for 2-3 h, or stopped using 50 pL of 10 M HCl at t=0, 15, 30, 60 and 120 min for a dynamic test. Then, Cie fatty acid was added at a final concentration of 0.2 mM (1:100 dilution) as an internai standard. 300 pL réaction mixture of each reaction condition was extracted with equal volume of ethyl acetate, and the organic phase was analyzed for hydrocarbons by gas chromatography/mass spectrometry (GC/MS). In the meanwhile, undecene of

different concentrations (0, 0.05 mM, 0.1 mM, 0.2 mM and 0.5 mM) were tested to produce a standard curve.

Results

Figure 4 shows fatty acid decarboxylase activity for ali tested enzymes OleTjE, Sm46, 5 Bs168 and Aa162. Bs168 and Aa162 show preference for Cu fatty acid substrate, thereby specrfically producing Cu α-olefins. ln later experiments, Sm46 was also shown to hâve substrate preference for Cu fatty acid substrate (data not shown).

Example 2: Production of α-oleflns by a truncated Sm46 from Staphylococcus 10 Masslllensls

The construct pET28b-Sm46 of Example 1 did show poor expression in E. coli BL21(DE3), which did not Improve upon subcloning into another expression vector pCWori or optimization of the expression conditions, ln order to maximize expression 15 level and to assess potential of Sm46 as a decarboxylase enzyme with Cu as preferred substrate, a truncated version of codon-optlmlzed (for expression in E. coli) Sm46, Sm46-de!29, was designed, which has the N-termlnal 29 amino acids deleted, and the activity ofthe recombinant truncated Sm46-del29 was tested.

Material and methods

Matériels

Fatty acid substrates and terminal alkene authentic standards were purchased from TCI (Shanghaï, China). Antibiotics were obtained from Solar-Blo (Beijing, China). Other chemicals were purchased from Sigma Aldrich (St Louis, MO, USA) or Ameresco (Solon, OH, USA). Molecular cloning kits, such as E.Z.N.A.TM Plasmid Miniprep Kit 25 and Wizard SV Gel and PCR Clean-up System, were purchased from OMEGA Bio-Tek (Jlnan, China) and Promega (Madison, Wl, USA) respectively. Oligonucleotides and codon-optlmlzed gene were synthesized by Genewiz (Suzhou, China). The Pfu DNA polymerases and ail restriction endonucleases were obtained from Takara (Dalian, China). Ni-NTA resin used for protein purification was from Qlagen (Valencla, CA, 30 USA); Millipore Amlcon Ultra centrifugal fliters (Bilierica, MA, USA) and PD-10 desalting columns were from GE Healthcare (Piscataway, NJ, USA).

Molecular cloning Sm46-del29 gene

The 1,275 bp fragment of the truncated gene, Sm46-de!29, was PCR-amplified from the Initial construct of pET28b-Srri46 (see Example 1) using Pfu DNA polymerase and subsequently subcloned Into pET28b vector at the Nde l/Xho I restriction sites. The sequences of primera used are as follows:

GTCCATATGGCAAAAAAGCTGCCTAAAGTG (Sm46-del29-F, forward primer, SEQ ID N0:11) and GTACTCGAGTTATTTGCGGGCAACACGCGG (Sm46-del29-R, reverse primer, SEQ ID NO: 12). Ail recombinant plasmid constructs were confirmed by DNA sequencing (Sangon Biotech, Shanghai, China). Upon sequence vérification, plasmids were used to transform E. coli strain BL21 (DE3) for protein expression.

Heterologous expression and purification ofSm46-de!29

The £ coil BL21 (DE3) cells transformed with the recombinant pET28b-Sm46-de/29 plasmid were grown ovemlght at 37 ’C with shaking at 220 rpm in LB medium containîng 50 pg/ml kanamycin. The ovemight culture was used as seed culture to 15 Inoculate (1:100 dilution) 1 to 3 litres of modified Terrifie Broth contalning 4 % glycerol, mM thiamine, trace métal and the corresponding antibiotics. Cells were then grown at 37 ’C for 3 to 4 h until the optical density at 600 nm (QD600) reached - 0.6, at which point δ-aminolevulinic acid (0.5 mM final concentration) was supplemented and the expression of Sm46-del29 was Induced by the addition of 0.2 mM isopropyl-B-D20 thiogalactopyranoside (IPTG). Cells were then further cultured for 24 h at a reduced température of 18’C before being harvested by centrifugation at 6000 rpm, 4 ’C. The cell pellet was frozen at-80 ’C until requlred.

Purification of the His-tagged protein was carried out as described by Liu et al. (2014 25 Biotechnol. Biofuels 7:28) with minor modifications. Ail protein purification steps were performed at 4 ’C. Specifically, the cell pellets were thawed and re-suspended ln 40 ml Tysis buffer (50 mM NaH₂PO4, 300 mM NaCI, 10% glycerol and 10 mM imidazole, pH 8.0) through vortexing. After cell disruption by ultrasonication, the cell lysate was centrifuged at 12,000 ^x g for 30 min to remove cellular débris. To the clarified cell 30 lysate, 1 ml of Ni-NTA resin was added and gently mixed at 4’C for 1 h. The slurry was then loaded onto an empty column, and washed with approximately 100 ml of wash buffer (50 mM NaH₂PO4, 300 mM NaCI, 10% glycerol and 20 mM imidazole, pH 8.0) until no proteins were détectable in flow-through. The bound target proteins were eluted with elutîon buffer (50 mM NaH₂PO4, 300 mM NaCI, 10% glycerol and 250 mM

Imidazole, pH 8.0). The eluates were pooled and concentrated with an Amicon Ultra centrifugal filter, and buffer exchanged on a PD-10 column into storage buffer (50 mM NahhPOx, 300 mM NaCI 10% glycerol, pH 7.4). The final purified protein was flashfrozen in liquid nitrogen and stored at -80’C for later use.

UV-visibia Spectroscopy—Spectroscoplc characterization ofSm46-dei29

Analysis of the UV-visible spectroscopic properties of Sm46-del29 was performed on a Cary 60 UV-visible spectrophotometer (Varian, UK). The ferrous-CO complex of Sm46del29 was prepared by slow bubbling of carbon monoxide gas into a solution of ferrie 10 P450, and subséquent réduction of the protein with sodium dithionite. The CO-bound reduced différence spectrum of the enzyme was obtained through recording the respective spectrum before and after the addition of sodium dithionite (Omura and Sato 1964. J Biol Chem 239:2379-2385, Amaya et al. 2018 J Inorg Biochem. 158:11-16).

ln vitro enzymatic assays

The fatty acid décarboxylation assays containing 1.0 pM Sm46-del29, 200 pM fatty acid substrate (from C« to C₂o), 220 pM HjOj in 200 pl of storage buffer were carried out at 28*C for 2 h. Reactions were quenched by the addition of 20 pl of 10 M HCl. Heptadecanoic acid was added as Internai standard and the mixture was extracted by 20 200 pl ethyl acetate. Following extraction, the organic phase was collected and analyzed by gas chromatography as described below.

Gas chromatography (GC)

The GC analytical method for hydrocarbon and fatty acid samples was adapted from 25 Guan et al. (2011 J Chromatogr A 1218:8289-8293). The analyses were performed on an Agitent 7Θ90Β gas chromatograph equipped with a capillary column HP-INNOWAX (Agitent Technologies, Santa Clara, CA, USA; cross-linked polyethylene glycerol, l.d.

0,25 pm film thickness, 30 m by 0.25 mm). The hélium flow rate was set to 1 ml per minute. The oven température was controlled initially at 40’C for 4 min, then Increased 30 at the rate of 10*C per min to 250’C, and held for 5 min. The Injecting température was set to 280’C with the injection volume of 1 pl under splitless injection conditions. The response factors between fatty acids and alkenes were determined by analyzing known authentic fatty acids (C10-C20), 1-alkenes (C9-C19) and 1-heptadecanoic acid standards as described in Liu et al. (2014 Biotechnol. Biofuels 7:28).

Results

The truncated variant of Sm46 (i.e. Sm46-del29) had decarboxylase activity and showed substrate préférence for C12 free fatty acid for α-olefin production among the 5 tested fatty acid substrates (Fig. 6). Sm46-del29 was also able to decarboxylate Cw free fatty acid, but technical problems (due to volatility) hlndered détection of the formed C# a-olefin.

Example 3: Production of α-oleflns and hydroxy fatty acids by Sm46-del29, 10 Bs168and Aa162

Recomblnantly expressed and purified Bs168 and Aa162 from Example 1 and Sm46del29 of Example 2 were reacted with Cm fatty acid and the products of décarboxylation (Cu α-olefin) and hydroxylation (α-ΟΗ-Cu fatty acid and β-ΟΗ-Cu fatty acid) reactions were analyzed.

All enzymes tested were able to decarboxylate myristic acid (Ct4), but also catalyzed aand β-hydroxylation of myristic acid as side reactions. Fatty acid décarboxylation was the dominant reaction for all tested enzymes, but Sm46-del29 formed less hydroxy fatty acids, Indicating that these enzymes hâve spécifie decarboxylase activity.

Claims (20)

1. A method for the production of C7-C11 α-olefins comprising culturing a recombinant host cell comprising a recombinant nucleic acid encoding a decarboxylase enzyme under conditions suitable for the production of C₇ to C_n α-olefins by said host cell, wherein said decarboxylase enzyme has the highest activity on an C₆-C₁₂free fatty acid substrate, wherein said recombinant nucleic acid encoding a decarboxylase enzyme comprises a nucléotide sequence having at least 75% sequence identity to SEQ ID NO:10, SEQ ID N0:7, or SEQ ID NO: 5 and wherein said recombinant nucleic acid ensures expression or overexpression of said decarboxylase enzyme.

2. The method according to claim 1, wherein said recombinant nucleic acid encodes a polypeptide comprising an amino add sequence having at least 80% identity to SEQ ID NO:13, SEQ ID NO: 8, or SEQ ID NO: 6, or an active fragment of said polypeptide.

3. The method according to any one of daims 1 or 2, wherein said recombinant nucleic acid encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:13.

4. The method according to any one of claims 1 to 3, wherein said decarboxylase enzyme has the highest activity on C₁₂ free fatty acids, and wherein said a-olefins are Cu a-olefins.

5. The method according to any one of claims 1 to 4, wherein said host cell is cultivated in a medium comprising C_a-C₁₂free fatty acids.

6. The method according to daim 5, wherein said host cell is cultivated in a medium comprising Ci₂free fatty acids.

7. The method according to any one of claims 1 to 6, wherein the host cell further comprises a recombinant nucleic add encoding a thioesterase having activity on C_a to C₁₂ acyl-ACP.

8. The method according to claim 7, wherein said thioesterase has activity on C₁₂ acylACP.

9. The method according to any one of claims 1 to 8, wherein the host cell is an oleaginous host cell.

10. The method according to any one of claims 1 to 9, wherein the host cell is selected from the group consisting of bacteria, yeasts, fungi, plants and algae.

11. The method according to any one of claims 1 to 10, further comprising the step of recovering the α-olefins from the host cell or the culture medium.

12. A method for the production of poly-a-olefins comprising the following steps:

i) producing Cr-Cn a-olefins according to a method according to any one of claims 1 to 11 ; and ii) performing an oligomérization reaction using the α-olefins obtained in step i) as monomer to produce an oligomer.

13. The method according to claim 12, further comprising the step of hydrogenating the oligomer produced in step ii).

14. The method according to claim 12 or 13, wherein the poly-a-olefins are C₃₃ poly-aolefins, wherein step i) comprises the production of Cn a-olefins, and wherein the oligomérization reaction in step ii) is a trimerization reaction.

15. A composition comprising poly-a-olefins obtainable by the method according to claim 14, wherein at least 85% of the poly-a-olefins are C₃₃ poly-a-olefins.

16. Use of a host cell comprising a nucleic acid comprising a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO:7 or SEQ ID NO:5 integrated into its genome, or comprising a vector comprising at least one regulatory sequence operatively coupled to a nucleic acid sequence having at least 80% sequence identity to DEQ ID NO:7 or SEQ ID NO:5 for the industrial production of lubricants.

17. Use according to claim 16, wherein the host cell is an oleaginous eukaryotic microalga or oleaginous yeast.

18. Lubricant comprising poly-a-olefins obtainable by a method according to any one of claims 12 to 14.

19. Lubricant according to claim 18, wherein said poly-a-olefins are biosourced polya-olefins.

20. Lubricant according to claim 18 or 19, wherein at least 50% of said poly-a-olefins consist of C₃₃ poly-a-olefins.

1/10

A) SEQ ID NO:1: Jeotgalicoccus sp. ATCC 8456 terminal olefin-forming fatty acid decarboxylase gene, complété cds