NZ624442B2 - Responsiveness to angiogenesis inhibitors - Google Patents

Responsiveness to angiogenesis inhibitors Download PDF

Info

Publication number
NZ624442B2
NZ624442B2 NZ624442A NZ62444212A NZ624442B2 NZ 624442 B2 NZ624442 B2 NZ 624442B2 NZ 624442 A NZ624442 A NZ 624442A NZ 62444212 A NZ62444212 A NZ 62444212A NZ 624442 B2 NZ624442 B2 NZ 624442B2
Authority
NZ
New Zealand
Prior art keywords
cancer
patient
bevacizumab
snp
genotype
Prior art date
Application number
NZ624442A
Other versions
NZ624442A (en
Inventor
Peter Carmeliet
Haas Sanne Lysbet De
Diether Lambrechts
Stefan Scherer
Original Assignee
F Hoffmann La Roche Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by F Hoffmann La Roche Ag filed Critical F Hoffmann La Roche Ag
Priority claimed from PCT/EP2012/072953 external-priority patent/WO2013076029A1/en
Publication of NZ624442A publication Critical patent/NZ624442A/en
Publication of NZ624442B2 publication Critical patent/NZ624442B2/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/18Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Abstract

Disclosed is an in vitro method of determining whether a patient suffering from cancer or physiological or pathological angiogenic abnormalities is suitably treated by a therapy with an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, said method comprising: (a) determining in a sample derived from a patient suffering from cancer or physiological or pathological angiogenic abnormalities the genotype at the synonymous T/C SNP located in exon 28 of VEGFR-1 corresponding respectively to TAT codon and TAC codon for tyrosine at position 1213, and (b) identifying said patient as more or less suitably treated by a therapy with an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of each T allele at said SNP indicates an increased likelihood that the patient is more suitably treated, or the presence of each C allele at said SNP indicates an increased likelihood that the patient is less suitably treated. vacizumab, said method comprising: (a) determining in a sample derived from a patient suffering from cancer or physiological or pathological angiogenic abnormalities the genotype at the synonymous T/C SNP located in exon 28 of VEGFR-1 corresponding respectively to TAT codon and TAC codon for tyrosine at position 1213, and (b) identifying said patient as more or less suitably treated by a therapy with an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of each T allele at said SNP indicates an increased likelihood that the patient is more suitably treated, or the presence of each C allele at said SNP indicates an increased likelihood that the patient is less suitably treated.

Description

Case 30723 siveness to enesis Inhibitors Field of the Invention The t invention is directed to methods for fying which patients will most benefit from ent with anti-cancer agents and monitoring patients for their sensitivity and responsiveness to treatment with ancer agents.
Background of the Invention Angiogenesis contributes to benign and malignant diseases such as cancer development and, especially in cancer, is necessary for primary tumor growth, invasiveness and metastasis. In order to grow, a tumor must undergo an angiogenic switch. Vascular endothelial growth factor (VEGF) is required to induce this angiogenic . VEGF and the genes in the VEGF pathway are considered important ors of cancer progression. The VEGF gene family includes the VEGF gene, also referred to as VEGFA, homologues to VEGF including, placenta growth factor (PlGF), VEGFB, VEGFC, VEGFD, the VEGF receptors, including VEGFR-1 and VEGFR-2 (also referred to as FLT1 and FLK1/KDR, respectively), the VEGF inducers, including hypoxiainducible s HIF1α, HIF2 α, and the oxygen sensors PHD1, PHD2 and PHD3.
The importance of this pathway in cancer cell growth and metastasis has led to the development of anti-angiogenesis agents for use in cancer therapy. These therapies include, among others, bevacizumab, pegaptanib, sunitinib, sorafenib and vatalanib. Despite significantly prolonged survival obtained with angiogenesis inhibitors, such as bevacizumab, patients still succumb to cancer. Further, not all patients respond to angiogenesis inhibitor therapy. The mechanism underlying the sponsiveness remains unknown. Moreover, angiogenesis inhibitor therapy is associated with side effects, such as gastrointestinal perforation, thrombosis, bleeding, hypertension and proteinuria.
AOK / 30.08.2012 Accordingly, there is a need for methods of determining which patients respond particular well to angiogenesis inhibitor therapy.
It has been described in WO 15348 that one or more t alleles of the VEGFR-1 gene are associated with improved outcome of the anti-angiogenesis treatment. Among the SNPs disclosed in are rs9554316, rs9582036, rs9513070 and rs9554320, while other SNPs are fied by linkage disequilibrium and therfore linked to these four SNPs.
Summary of the Invention It has been found that one of the SNPs identified by linkage disequilibrium and disclosed in WO 2011/015348 is particularly useful as a predictive ker for the treatment outcome of an angiogenesis inhibitor, such as bevacizumab.
The present invention therefore s to a method of determining whether a patient is more or less suitably d by a therapy with an angiogenesis inhibitor, such as bevacizumab, by determing the pe at the synonymous T/C SNP located in exon 28 of VEGFR-1 corresponding respectively to TAT codon and TAC codon for tyrosine at position 1213. The present invention also relates to the use of a pharmaceutical ition comprising bevacizumab, for the ation of a medicament for treatment of a patient suffering from cancer and having the genotype associated with an improved treatment effect at the synonymous T/C SNP located in exon 28 of VEGFR-1 corresponding respectively to TAT codon and TAC codon for tyrosine at position 1213. Also described herein is a method for improving the treatment effect of chemotherapy of a patient suffering from cancer by adding an enesis inhibitor, such as bevacizumab, based on the genotype at the synonymous T/C SNP located in exon 28 of VEGFR-1 corresponding tively to TAT codon and TAC codon for tyrosine at on 1213.
In another embodiment, the invention relates to the use of an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab for the preparation of a medicament for improving the treatment effect of a chemotherapeutic agent or chemotherapy regimen of a patient suffering from cancer or physiological or pathological enic abnormalities, wherein the patient has been identified by a method comprising: (a) determining in a sample derived from a patient suffering from cancer or physiological or pathological angiogenic abnormalities the genotype at the synonymous T/C SNP located in exon 28 of VEGFR-1 corresponding respectively to TAT codon and TAC codon for tyrosine at position 1213; and (b) fying said patient as more suitably treated by the addition of an angiogenesis inhibitor comprising zumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of each T allele at said SNP indicates an increased likelihood that the patient is more suitably treated.
Detailed Description of the ments 1. Definitions The term "administering" means the administration of a pharmaceutical composition, such as an enesis inhibitor, to the patient. For example, 2.5 mg/kg of body weight to 15 mg/kg of body weight bevacizumab (Avastin®) can be administered every week, every 2 weeks or every 3 weeks, depending on the type of cancer being treated. Particular dosages include 5 mg/kg, 7.5 mg/kg, 10 mg/kg and 15 mg/kg. Even more particular dosages are 5 mg/kg every 2 weeks, 10 mg/kg every 2 weeks and 15 mg/kg every 3 weeks.
The term "angiogenesis inhibitor" in the context of the present invention refers to all agents that alter enesis (e.g. the process of forming blood vessels) and includes agents that inhibit the angiogenesis, including, but not limited to, tumor angiogenesis. In this context, inhibition can refer to blocking the ion of blood vessels and halting or slowing down the growth of blood vessels. Examples of angiogenesis tors include bevacizumab (also known as Avastin®), pegaptanib, sunitinib, nib and vatalanib. Bevacizumab is a recombinant humanized monoclonal IgG1 antibody that binds to and inhibits the biological activity of human VEGFA in in vitro and in vivo assay system. The term "bevacizumab" encompass all corresponding anti- VEGF antibodies that fulfill the requirements necessary for ing a marketing authorization as an cal or biosimilar product in a country or ory selected from the group of countries consisting of the USA, Europe and Japan. In the context of the present invention, an angiogenesis inhibitor includes an antibody that binds essentially the same epitope on VEGF as bevacizumab, more specifically an antibody that binds to the same e on VEGF as bevacizumab. An antibody binds "essentially the same e" as a reference antibody, when the two antibodies recognize identical or sterically overlapping epitopes. The most widely used and rapid methods for determining whether two epitopes bind to identical or sterically overlapping epitopes are competition assays, which can be configured in all number of different formats, using either labeled n or labeled antibody. Usually, the antigen is immobilized on a 96-well plate, and the ability of unlabeled antibodies to block the binding of labeled antibodies is measured using radioactive or enzyme labels.
The term “cancer” refers to the physiological condition in mammals that is typically terized by unregulated cell eration. Examples of cancer include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma and leukemia. More particular examples of such cancers include squamous cell cancer, lung cancer (including small-cell lung cancer, all cell lung cancer, arcinoma of the lung, and squamous carcinoma of the lung), cancer of the neum, hepatocellular cancer, gastric or stomach cancer (including intestinal cancer), pancreatic cancer (including ic pancreatic cancer), glioblastoma, cervical cancer, ovarian cancer, liver , bladder cancer, hepatoma, breast cancer (including locally advanced, recurrent or metastatic HER-2 negative breast cancer), colon cancer, colorectal cancer, endometrial or uterine carcinoma, ry gland carcinoma, kidney or renal cancer, liver , prostate cancer, vulval , thyroid cancer, hepatic carcinoma and various types of head and neck cancer, as well as B-cell lymphoma (including low grade/follicular non-Hodgkin's lymphoma (NHL); small lymphocytic (SL) NHL; intermediate grade/follicular NHL; intermediate grade diffuse NHL; high grade immunoblastic NHL; high grade lymphoblastic NHL; high grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; and Waldenstrom's Macroglobulinemia); chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); Hairy cell ia; chronic myeloblastic leukemia; and post-transplant lymphoproliferative disorder , as well as abnormal vascular proliferation associated with phakomatoses, edema (such as that associated with brain tumors), and Meigs' syndrome.
Examples of ological or pathological angiogenic abnormalities” include, but are not limited to, eye disease such as age-related macular degeneration (AMD), high grade glioma, glioblastoma, M. Rendu-Osler, von-Hippel-Lindau diseases, iomas, psoriasis, Kaposi's a, ocular neovascularisation, rheumatoid arthritis, endometriosis, atherosclerosis, myochardial ischemia, peripheral ischemia, cerebral ischemia and wound healing.
The term "chemotherapeutic agent" or therapy regimen" includes any active agent that can provide an anticancer therapeutic effect and may be a chemical agent or a biological agent, in particular, that are capable of interfering with cancer or tumor cells. Particular active agents are those that act as anti-neoplastic (chemotoxic or chemostatic) agents which inhibit or prevent the development, maturation or proliferation of malignant cells. Examples of chemotherapeutic agents include alkylating agents such as nitrogen mustards (e.g., mechlorethamine, cyclophosphamide, ifosfamide, melphalan and chlorambucil), nitrosoureas (e.g., carmustine (BCNU), lomustine (CCNU), and semustine (methyl-CCNU)), ethylenimines/ methylmelamines (e.g., thriethylenemelamine (TEM), triethylene, thiophosphoramide (thiotepa), thylmelamine (HMM, altretamine)), alkyl sulfonates (e.g., busulfan), and triazines (e.g., dacarbazine (DTIC)); antimetabolites such as folic acid analogs (e.g., methotrexate, trimetrexate), pyrimidine analogs (e.g., 5-fluorouracil, capecitabine, fluorodeoxyuridine, gemcitabine, cytosine arabinoside (AraC, cytarabine), 5-azacytidine, 2,2′-difluorodeoxycytidine), and purine analogs (e.g., aptopurine, 6-thioguanine, azathioprine, 2′-deoxycoformycin (pentostatin), erythrohydroxynonyladenine (EHNA), fludarabine phosphate, and rodeoxyadenosine (cladribine, 2-CdA)); antimitotic drugs developed from natural products (e.g., paclitaxel, vinca alkaloids (e.g., vinblastine (VLB), vincristine, and vinorelbine), docetaxel, estramustine, and ustine phosphate), epipodophylotoxins (.e.g., etoposide, teniposide), antibiotics (.e.g, actimomycin D, daunomycin omycin), daunorubicon, bicin, epirubicin, mitoxantrone, idarubicin, bleomycins, plicamycin (mithramycin), mitomycinC, actinomycin), enzymes (e.g., L-asparaginase), and biological se modifiers (e.g., interferon-alpha, IL-2, G-CSF, GM-CSF); miscellaneous agents including platinum coordination complexes (e.g., cisplatin, carboplatin, oxaliplatin), anthracenediones (e.g., mitoxantrone), substituted urea (i.e., hydroxyurea), hydrazine derivatives (e.g., N-methylhydrazine (MIH), procarbazine), cortical suppressants (e.g., mitotane (o,p′-DDD), aminoglutethimide); hormones and antagonists including adrenocorticosteroid antagonists (.e.g, sone and lents, dexamethasone, aminoglutethimide), progestins (e.g., hydroxyprogesterone caproate, medroxyprogesterone acetate, rol acetate), ens (e.g., diethylstilbestrol, ethinyl iol and equivalents thereof); antiestrogens (e.g., tamoxifen), androgens (e.g., testosterone propionate, fluoxymesterone and equivalents f), antiandrogens (e.g., flutamide, gonadotropin-releasing hormone analogs, leuprolide), non-steroidal antiandrogens (e.g., flutamide), epidermal growth factor inhibitors (e.g., erlotinib, lapatinib, gefitinib) antibodies (e.g., trastuzumab), irinotecan and other agents such as leucovorin. For the treatment of metastatic pancreatic cancer, chemotherapeutic agents for administration with bevacizumab include gemcitabine and erlotinib and combinations thereof (see also the examples herein ed). For the treatment of renal cell cancer, chemotherapeutic agents for administration with bevacizumab include eron alpha (see also the examples herein provided).
The term “allele” refers to a nucleotide sequence t of a gene of interest.
The term “genotype” refers to a description of the s of a gene contained in an individual or a sample. In the context of this invention, no distinction is made between the genotype of an individual and the genotype of a sample originating from the individual. Although typically a genotype is ined from samples of diploid cells, a genotype can be determined from a sample of haploid cells, such as a sperm cell.
The terms nucleotide" and "polynucleotide" are used interchangeably and refer to a molecule comprised of two or more deoxyribonucleotides or ribonucleotides, preferably more than three. Its exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. An oligonucleotide can be derived synthetically or by g. as of deoxyribonucleotides and ribonucleotides may also be in the scope of the present invention.
The term “polymorphism” refers to the occurrence of two or more genetically determined alternative sequences of a gene in a population. Typically, the first identified allelic form is arbitrarily designated as the nce form and other allelic forms are designated as alternative or variant alleles. The allelic form occurring most frequently in a selected population is sometimes referred to as the wildtype form.
The term a “single nucleotide polymorphism” or “SNP” is a site of one nucleotide that varies n alleles. Single tide polymorphisms may occur at any region of the gene. In some instances the polymorphism can result in a change in protein sequence. The change in protein sequence may affect protein function or not.
The term "patient" refers to any single , more specifically a mammal (including such non- human animals as, for example, dogs, cats, horses, rabbits, zoo animals, cows, pigs, sheep, and non-human primates) for which treatment is desired. Even more specifically, the patient herein is a human. In the context of the present invention, the patient may be Caucasian.
The term “subject” herein is any single human subject, including a t, eligible for treatment who is experiencing or has experienced one or more signs, symptoms, or other indicators of an angiogenic disorder. Intended to be included as a subject are any ts involved in clinical research trials not showing any clinical sign of disease, or subjects involved in epidemiological studies, or subjects once used as controls. The subject may have been previously treated with an anti-cancer agent, or not so treated. The subject may be naïve to an additional agent(s) being used when the treatment herein is started, i.e., the subject may not have been previously treated with, for example, an anti-neoplastic agent, a chemotherapeutic agent, a growth inhibitory agent, a cytotoxic agent at “baseline” (i.e., at a set point in time before the administration of a first dose of an anti-cancer in the ent method herein, such as the day of ing the subject before treatment is commenced). Such "naïve" subjects are generally considered to be candidates for treatment with such additional agent(s).
The term "a patient ing from" refers to a patient showing clinical signs in respect to a certain ant e, such as cancer, a e involving physiological and pathological angiogenesis and/or tumorous disease.
As used herein, “therapy” or “treatment” refers to clinical intervention in an attempt to alter the l course of the individual or cell being treated, and can be performed either for prophylaxis or during the course of al pathology. Desirable effects of treatment include preventing occurrence or recurrence of disease, alleviation of symptoms, shment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
The term "treatment effect" encompasses the terms "overall survival" and "progression-free survival".
The term "overall survival" refers to the length of time during and after treatment the t survives. As the skilled person will appreciate, a patient's overall survival is improved or enhanced, if the patient belongs to a subgroup of patients that has a statistically significant longer mean survival time as compared to another up of patients.
The term "progression-free survival" refers to the length of time during and after treatment during which, according to the assessment of the treating physician or investigator, the patient's disease does not become worse, i.e., does not progress. As the skilled person will appreciate, a patient's progression-free al is improved or enhanced if the patient s to a subgroup of patients that has a longer length of time during which the disease does not progress as compared to the average or mean progression free survival time of a control group of similarly situated patients.
The term "pharmaceutical composition" refers to a sterile preparation that is in such form as to permit the biological ty of the medicament to be effective, and which contains no additional components that are unacceptably toxic to a subject to which the ation would be administered. 2. Detailed Embodiments In the present invention, rs7993418 SNP in the VEGFR-1 gene was identified as markers or predictive biomarkers for overall survival (OS) and/or progression-free survival (PFS) to treatment with an angiogenesis inhibitor. The terms "marker" and "predictive biomarker" can be used hangeably and refer to ic allele variants of genes. The variation or marker may also be referred to as a single nucleotide polymorphism (SNP). ce information on the SNP as well as an amino acid and nucleic acid of VEGFR-1 is available on the NCBI website using respective reference/accession numbers, e.g.. rs7993418, NP_002010 and NM_002019.
Sequence information of rs7993418 is further shown in Table 1. In the context of the present invention, the term “VEGFR-1” also asses variants and/or ms thereof.
Table 1 mRNA ID Allele Sequence Codon ATGAACTTGAAAGCATTTAC[A/G]TATCTAATGAA 418 A/G C GAAACAGAAAGAAT (SEQ ID NO:1) In accordance with the methods of the present invention, SNPs of VEGFR-1 were analysed using the samples derived from two Phase III trials with bevacizumab, i.e. AVITA (pancreatic cancer, see, Van Cutsem, J. Clin. Oncol. 2009 27:2231-2237) and AVOREN (renal cancer, see, Escudier et al., Lancet 2007 370:2103).
As shown in the es, the 418 SNP in VEGFR-1 was identified as the functional variant underling the association between the VEGFR-1 locus represented by four tagging SNPs, i.e. rs9554316, rs9582036, rs9513070 and rs9554320, and PFS and OS in bevacizumab-treated patients from AVITA. Further, 418 correlated with PFS in bevacizumab-treated patients in AVOREN (per-allele HR=1.8, P=0.033). No effect was seen in placebo subjects (per-allele HR=0.8, P=0.49), suggesting that 418 can serve as a predictive marker for favourable outcome with bevacizumab treatment.
Accordingly, the present invention provides an in vitro method of determining whether a patient suffering from cancer is suitably treated by a therapy with an angiogenesis inhibitor sing bevacizumab or an antibody that binds essentially the same epitope on VEGF as zumab, said method comprising: (a) determining in a sample d from a patient suffering from cancer the genotype at the synonymous T/C SNP located in exon 28 of VEGFR-1 corresponding respectively to TAT codon and TAC codon for tyrosine at position 1213, and (b) fying said patient as more or less suitably treated by a therapy with an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of each T allele at said SNP indicates an increased likelihood that the patient is more suitably treated, or the presence of each C allele at said SNP indicates an increased likelihood that the patient is less suitably treated. Also described is such a method which further comprises treating the patient by the therapy with an angiogenesis inhibitor.
More specifically, the present invention provides an in vitro method of determining whether a patient is suitably treated by a therapy with an angiogenesis inhibitor comprising bevacizumab or an antibody that binds ially the same epitope on VEGF as zumab, said method comprising: (a) determining in a sample derived from a patient suffering from cancer the genotype at the synonymous T/C SNP d in exon 28 of VEGFR-1 corresponding respectively to TAT codon and TAC codon for tyrosine at position 1213, and (b) identifying said patient as more or less suitably treated by a therapy with an angiogenesis inhibitor sing bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of TT or TC pe at said SNP indicates an increased likelihood that the patient is more suitably treated than a patient having CC pe at said SNP, or the presence of CC genotype at said SNP tes an increased likelihood that the patient is less suitably treated than a patient having TT or TC genotype at said SNP, or (b’) identifying a patient as more or less suitably treated by a therapy with an enesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of TT genotype at said SNP indicates an increased likelihood that the patient is more suitably d than a patient having TC or CC genotype at said SNP, or the presence of TC or CC pe at said SNP indicates an increased likelihood that the patient is less suitably treated than a patient having TT genotype at said SNP. Also described is such a method which r comprises treating the patient by the therapy with an angiogenesis inhibitor.
Also bed herein is a pharmaceutical ition comprising an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab for the treatment of a patient suffering from cancer, wherein the patient has been identified as more suitably treated with the angiogenesis inhibitor by an invitro method comprising: (a) determining in a sample derived from a patient suffering from cancer the genotype at the synonymous T/C SNP located in exon 28 of VEGFR-1 corresponding respectively to TAT codon and TAC codon for tyrosine at position 1213, and (b) identifying said patient as more or less suitably treated by a therapy with an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of each T allele at said SNP indicates an increased likelihood that the patient is more suitably treated, or the presence of each C allele at said SNP indicates an increased likelihood that the patient is less ly treated.
Also bed herein is a pharmaceutical composition comprising an angiogenesis inhibitor that comprises bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, for the treatment of a patient in need thereof, n the t has been identified as more le treated with the angiogenesis inhibitor by an in vitro method comprising: (a) determining in a sample derived from a patient suffering from cancer the genotype at the mous T/C SNP located in exon 28 of VEGFR-1 corresponding respectively to TAT codon and TAC codon for tyrosine at position 1213, and (b) identifying said patient as more or less suitably treated by a therapy with an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of TT or TC genotype at said SNP indicates an increased hood that the patient is more suitably treated than a patient having CC genotype at said SNP, or the presence of CC genotype at said SNP tes an increased likelihood that the patient is less suitably treated than a patient having TT or TC genotype at said SNP, or (b’) identifying a patient as more or less suitably treated by a therapy with an angiogenesis inhibitor comprising zumab or an antibody that binds essentially the same e on VEGF as bevacizumab based on said genotype, wherein the presence of TT genotype at said SNP indicates an increased likelihood that the t is more suitably d than a patient having TC or CC genotype at said SNP, or the presence of TC or CC genotype at said SNP indicates an increased likelihood that the patient is less suitably d than a t having TT genotype at said SNP.
Also described herein is a method for improving the treatment effect of a chemotherapeutic agent or chemotherapy regimen of a patient suffering from cancer by adding an angiogenesis inhibitor sing zumab or an dy that binds essentially the same epitope on VEGF as bevacizumab, said method comprising: (a) determining in a sample derived from a patient suffering from cancer the genotype at the synonymous T/C SNP located in exon 28 of VEGFR-1 corresponding respectively to TAT codon and TAC codon for tyrosine at position 1213; (b) identifying said patient as more suitably treated by the addition of an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the ce of each T allele at said SNP indicates an increased likelihood that the patient is more suitably treated; and (c) stering said angiogenesis inhibitor in combination with a herapeutic agent or chemotherapy regimen to the t identified as more suitably treated in accordance with (b).
More specifically, described herein is a method for improving the treatment effect of a chemotherapeutic agent or chemotherapy regimen of a patient suffering from cancer by adding an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, said method comprising: (a) determining in a sample derived from a patient suffering from cancer the genotype at the mous T/C SNP located in exon 28 of VEGFR-1 corresponding respectively to TAT codon and TAC codon for tyrosine at on 1213; (b) identifying said patient as more or less suitably treated by a therapy with an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, n the ce of TT or TC genotype at said SNP indicates an increased hood that the t is more suitably treated than a patient having CC genotype at said SNP, or the presence of CC genotype at said SNP indicates an increased likelihood that the patient is less suitably treated than a patient having TT or TC pe at said SNP, or (b’) identifying a patient as more or less suitably treated by a therapy with an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of TT genotype at said SNP indicates an increased likelihood that the patient is more suitably treated than a patient having TC or CC genotype at said SNP, or the presence of TC or CC genotype at said SNP indicates an increased hood that the patient is less suitably treated than a patient having TT genotype at said SNP; and (c) administering said angiogenesis inhibitor in combination with a herapeutic agent or chemotherapy regimen to a t identified as more suitably treated in accordance with (b) or (b’).
In an embodiment, whether a patient is suitably treated by a therapy with an angiogenesis inhibitor is determined in terms of whether PFS or OS is improved, more specifically whether PFS is improved.
In an embodiment, cancer is selected from the group consisting of colorectal cancer, glioblastoma, renal cancer, ovarian , breast , pancreatic cancer, gastric cancer and lung cancer, more specifically the group consisting of renal cancer and pancreatic cancer.
In an embodiment, a patient can be a patient diagnosed with physiological or pathological angiogenic abnormalities.
In an embodiment, the angiogenesis inhibitor is administered as a co-treatment with a chemotherapeutic agent or chemotherapy regimen. In a further embodiment, the angiogenesis inhibitor is administered with one or more agents selected from the group consisting of taxanes such as docetaxel and paclitaxel, interferon alpha, 5-fluorouracil, leucovorin, gemcitabine, nib and um-based chemotherapeutic agents such as carboplatin, cisplatin and oxaliplatin. More specifically, the angiogenesis inhibitor is stered as a co-treatment with a chemotherapeutic agent or chemotherapy regimen selected from the group ting of gemcitabine-erlotinib and interferon alpha. Further, the angiogenesis inhibitor may be stered as a co-treatment with radiotherapy.
In the context of the t invention, the sample is a ical sample and may be a blood and/or tissue sample. In an embodiment, the sample is a blood sample, more specifically a peripheral blood sample. In the context of the present invention, the sample is a DNA sample.
The DNA sample may be germline DNA or somatic DNA, more specifically germline DNA.
In one embodiment, the genotype is determined by means of MALDI-TOF mass spectrometry.
In addition to the detailed ption of the detection of SNPs below, the following reference provides ce for MALDI-TOF mass spectrometry-based SNP genotyping, e.g. Storm et al., Methods Mol. Biol. 212:241-62, 2003. 3. Detection of Nucleic Acid rphisms Detection techniques for evaluating nucleic acids for the presence of a SNP involve procedures well known in the field of molecular genetics. Many, but not all, of the methods involve amplification of nucleic acids. Ample guidance for performing amplification is ed in the art. Exemplary references include manuals such as PCR Technology: Principles and Applications for DNA Amplification (ed. H. A. Erlich, Freeman Press, NY, N.Y., 1992); PCR Protocols: A Guide to Methods and Applications (eds. Innis, et al., Academic Press, San Diego, Calif., 1990); Current Protocols in Molecular Biology, Ausubel, 1994-1999, including supplemental updates through April 2004; Sambrook & Russell, lar Cloning, A tory Manual (3rd Ed, 2001). l methods for detection of single nucleotide polymorphisms are disclosed in Single Nucleotide Polymorphisms: s and ols, Pui- Yan Kwok, ed., 2003, Humana Press.
Although the methods typically employ PCR steps, other amplification protocols may also be used. Suitable amplification methods include ligase chain reaction (see, e.g., Wu & Wallace, Genomics 4:560-569, 1988); strand displacement assay (see, e.g. Walker et al., Proc. Natl. Acad.
Sci. USA 89:392-396, 1992; U.S. Pat. No. 5,455,166); and several transcription-based amplification systems, including the s described in U.S. Pat. Nos. 990; 5,409,818; and 5,399,491; the transcription amplification system (TAS) (Kwoh et al., Proc. Natl. Acad. Sci.
USA 86:1173-1177, 1989); and self-sustained sequence replication (3SR) (Guatelli et al., Proc.
Natl. Acad. Sci. USA 87:1874-1878, 1990; WO 92/08800). Alternatively, methods that amplify the probe to detectable levels can be used, such as Qβ-replicase amplification (Kramer & Lizardi, Nature 339:401-402, 1989; Lomeli et al., Clin. Chem. 35:1826-1831, 1989). A review of known amplification methods is ed, for example, by Abramson and Myers in Current n in Biotechnology 4:41-47, 1993.
Detection of the genotype, haplotype, SNP, atellite or other polymorphism of an individual can be med using oligonucleotide primers and/or probes. Oligonucleotides can be prepared by any le , usually chemical synthesis. Oligonucleotides can be synthesized using commercially available reagents and instruments. Alternatively, they can be purchased through commercial sources. Methods of synthesizing oligonucleotides are well known in the art (see, e.g, Narang et al., Meth. Enzymol. 99, 1979; Brown et al., Meth.
Enzymol. 68:109-151, 1979; Beaucage et al., Tetrahedron Lett. 22:1859-1862, 1981; and the solid support method of U.S. Pat. No. 4,458,066). In addition, modifications to the abovedescribed methods of synthesis may be used to desirably impact enzyme behavior with respect to the sized oligonucleotides. For example, incorporation of modified phosphodiester linkages (e.g., phosphorothioate, methylphosphonates, phosphoamidate, or boranophosphate) or linkages other than a phosphorous acid derivative into an oligonucleotide may be used to prevent cleavage at a ed site. In addition, the use of 2’-amino modified sugars tends to favor displacement over digestion of the oligonucleotide when ized to a nucleic acid that is also the template for synthesis of a new nucleic acid strand.
The genotype of an individual can be determined using many detection methods that are well known in the art. Most assays entail one of several general ols: hybridization using allelespecific oligonucleotides, primer ion, allele-specific ligation, sequencing, or electrophoretic separation techniques, e.g., single-stranded conformational polymorphism (SSCP) and heteroduplex is. Exemplary assays include 5’-nuclease assays, template-directed dyeterminator incorporation, molecular beacon allele-specific oligonucleotide assays, single-base extension assays, and SNP scoring by real-time pyrophosphate sequences. is of amplified sequences can be performed using various logies such as microchips, fluorescence polarization assays, and MALDI-TOF (matrix assisted laser desorption ionization-time of flight) mass spectrometry. Two methods that can also be used are assays based on invasive cleavage with Flap nucleases and methodologies ing k probes.
Determination of the presence or absence of a particular allele is generally performed by analyzing a nucleic acid sample that is obtained from the individual to be ed. Often, the nucleic acid sample comprises genomic DNA. The genomic DNA is typically obtained from blood samples, but may also be obtained from other cells or tissues.
It is also possible to e RNA samples for the presence of polymorphic alleles. For example, mRNA can be used to determine the genotype of an individual at one or more rphic sites.
In this case, the nucleic acid sample is obtained from cells in which the target nucleic acid is expressed, e.g., adipocytes. Such an analysis can be performed by first e-transcribing the target RNA using, for example, a viral reverse transcriptase, and then amplifying the ing cDNA; or using a combined high-temperature reverse-transcription-polymerase chain reaction (RT-PCR), as described in U.S. Pat. Nos. 5,310,652; 5,322,770; 058; 5,641,864; and ,693,517.
Frequently used methodologies for analysis of nucleic acid samples to detect SNPs are briefly described. However, any method known in the art can be used in the invention to detect the presence of single nucleotide substitutions. a. Allele-Specific Hybridization This que, also commonly referred to as allele specific oligonucleotide ization (ASO) (e.g., Stoneking et al., Am. J. Hum. Genet. 48:70-382, 1991; Saiki et al., Nature 324, 163-166, 1986; EP 235,726; and WO 89/11548), relies on guishing between two DNA molecules differing by one base by hybridizing an oligonucleotide probe that is specific for one of the variants to an amplified product obtained from amplifying the nucleic acid sample. This method typically employs short oligonucleotides, e.g. 15-20 bases in length. The probes are designed to differentially hybridize to one variant versus another. Principles and guidance for designing such probe is available in the art, e.g. in the references cited herein. Hybridization conditions should be sufficiently stringent that there is a icant difference in hybridization intensity between alleles, and producing an ially binary se, whereby a probe hybridizes to only one of the alleles. Some probes are designed to hybridize to a segment of target DNA such that the polymorphic site aligns with a central position (e.g., in a 15-base oligonucleotide at the 7 position; in a 16-based ucleotide at either the 8 or 9 position) of the probe, but this design is not required.
The amount and/or presence of an allele is determined by measuring the amount of allelespecific oligonucleotide that is hybridized to the sample. Typically, the ucleotide is labeled with a label such as a fluorescent label. For example, an allele-specific oligonucleotide is applied to immobilized oligonucleotides representing SNP sequences. After stringent hybridization and washing conditions, fluorescence intensity is measured for each SNP oligonucleotide.
In one embodiment, the nucleotide present at the polymorphic site is fied by hybridization under sequence-specific hybridization conditions with an oligonucleotide probe or primer y complementary to one of the polymorphic alleles in a region encompassing the polymorphic site. The probe or primer hybridizing ce and sequence-specific hybridization conditions are ed such that a single mismatch at the polymorphic site destabilizes the hybridization duplex sufficiently so that it is effectively not formed. Thus, under ce- specific hybridization conditions, stable duplexes will form only between the probe or primer and the exactly complementary c sequence. Thus, oligonucleotides from about 10 to about nucleotides in length, usually from about 15 to about 35 nucleotides in length, which are exactly complementary to an allele sequence in a region which encompasses the polymorphic site are within the scope of the invention.
In an alternative embodiment, the nucleotide present at the polymorphic site is identified by ization under sufficiently ent hybridization conditions with an oligonucleotide substantially complementary to one of the SNP alleles in a region encompassing the polymorphic site, and exactly complementary to the allele at the polymorphic site. Because mismatches which occur at non-polymorphic sites are mismatches with both allele sequences, the difference in the number of mismatches in a duplex formed with the target allele sequence and in a duplex formed with the corresponding non-target allele sequence is the same as when an oligonucleotide exactly complementary to the target allele sequence is used. In this embodiment, the hybridization conditions are d sufficiently to allow the formation of stable duplexes with the target sequence, while maintaining sufficient stringency to de the formation of stable duplexes with non-target ces. Under such sufficiently stringent hybridization conditions, stable duplexes will form only between the probe or primer and the target allele. Thus, oligonucleotides from about 10 to about 35 nucleotides in length, usually from about 15 to about 35 nucleotides in length, which are substantially mentary to an allele sequence in a region which encompasses the polymorphic site, and are exactly mentary to the allele sequence at the polymorphic site, are within the scope of the invention.
The use of substantially, rather than exactly, complementary oligonucleotides may be desirable in assay formats in which optimization of hybridization conditions is limited. For example, in a typical multi-target immobilized-oligonucleotide assay format, probes or primers for each target are immobilized on a single solid support. Hybridizations are carried out simultaneously by contacting the solid support with a solution containing target DNA. As all izations are carried out under cal conditions, the hybridization ions cannot be separately optimized for each probe or . The incorporation of mismatches into a probe or primer can be used to adjust duplex stability when the assay format des adjusting the hybridization conditions. The effect of a particular introduced mismatch on duplex stability is well known, and the duplex stability can be routinely both estimated and empirically determined, as described above. Suitable hybridization conditions, which depend on the exact size and sequence of the probe or primer, can be selected empirically using the guidance provided herein and well known in the art. The use of oligonucleotide probes or primers to detect single base pair differences in sequence is described in, for e, Conner et al., 1983, Proc. Natl. Acad. Sci. USA 80:278- 282, and U.S. Pat. Nos. 5,468,613 and 5,604,099, each incorporated herein by nce.
The proportional change in stability between a perfectly matched and a single-base mismatched ization duplex depends on the length of the hybridized oligonucleotides. Duplexes formed with shorter probe sequences are destabilized proportionally more by the presence of a mismatch.
Oligonucleotides between about 15 and about 35 nucleotides in length are often used for sequence-specific detection. Furthermore, e the ends of a hybridized oligonucleotide undergo continuous random dissociation and re-annealing due to thermal energy, a mismatch at either end destabilizes the hybridization duplex less than a mismatch occurring internally. For discrimination of a single base pair change in target sequence, the probe sequence is selected which izes to the target sequence such that the polymorphic site occurs in the interior region of the probe.
The above criteria for selecting a probe sequence that hybridizes to a specific allele apply to the hybridizing region of the probe, i.e., that part of the probe which is involved in hybridization with the target sequence. A probe may be bound to an additional nucleic acid sequence, such as a poly-T tail used to immobilize the probe, t significantly altering the hybridization teristics of the probe. One of skill in the art will recognize that for use in the present methods, a probe bound to an additional c acid sequence which is not complementary to the target sequence and, thus, is not involved in the hybridization, is essentially equivalent to the unbound probe.
Suitable assay formats for detecting hybrids formed between probes and target nucleic acid sequences in a sample are known in the art and include the immobilized target (dot-blot) format and immobilized probe (reverse ot or line-blot) assay formats. Dot blot and reverse dot blot assay formats are described in U.S. Pat. Nos. 5,310,893; 5,451,512; 5,468,613; and 5,604,099; each incorporated herein by nce.
In a dot-blot format, amplified target DNA is immobilized on a solid support, such as a nylon membrane. The membrane-target complex is incubated with labeled probe under suitable hybridization conditions, unhybridized probe is removed by washing under suitably ent conditions, and the membrane is monitored for the presence of bound probe.
In the reverse dot-blot (or line-blot) format, the probes are immobilized on a solid support, such as a nylon ne or a microtiter plate. The target DNA is d, typically during amplification by the incorporation of labeled primers. One or both of the primers can be labeled.
The membrane-probe complex is incubated with the labeled amplified target DNA under suitable hybridization conditions, unhybridized target DNA is removed by g under suitably stringent conditions, and the membrane is monitored for the presence of bound target DNA. A reverse line-blot detection assay is described in the example.
An allele-specific probe that is specific for one of the polymorphism variants is often used in conjunction with the allele-specific probe for the other polymorphism variant. In some ments, the probes are immobilized on a solid support and the target ce in an individual is analyzed using both probes simultaneously. Examples of nucleic acid arrays are described by WO 95/11995. The same array or a different array can be used for analysis of characterized polymorphisms. WO 95/11995 also describes ays that are zed for detection of variant forms of a pre-characterized polymorphism. Such a subarray can be used in detecting the presence of the polymorphisms described herein. b. Allele-Specific Primers Polymorphisms are also commonly detected using allele-specific amplification or primer extension methods. These reactions typically involve use of primers that are designed to specifically target a polymorphism via a ch at the 3’-end of a primer. The presence of a mismatch effects the y of a polymerase to extend a primer when the polymerase lacks error- correcting activity. For example, to detect an allele sequence using an allele-specific amplification- or extension-based , a primer complementary to one allele of a polymorphism is designed such that the 3’-terminal tide hybridizes at the polymorphic position. The presence of the particular allele can be determined by the ability of the primer to initiate extension. If the 3’-terminus is mismatched, the ion is impeded.
In some embodiments, the primer is used in conjunction with a second primer in an amplification reaction. The second primer hybridizes at a site unrelated to the polymorphic position.
Amplification proceeds from the two primers leading to a detectable product signifying the particular allelic form is present. Allele-specific amplification- or extension-based methods are described in, for e, WO 93/22456; U.S. Pat. Nos. 5,137,806; 5,595,890; 5,639,611; and U.S. Pat. No. 4,851,331.
Using allele-specific amplification-based ping, identification of the alleles requires only detection of the ce or absence of amplified target sequences. Methods for the detection of amplified target sequences are well known in the art. For example, gel electrophoresis and probe hybridization assays described are often used to detect the presence of nucleic acids.
In an alternative probe-less method, the amplified c acid is detected by monitoring the increase in the total amount of double-stranded DNA in the on mixture, is described, e.g. in U.S. Pat. No. 5,994,056; and European Patent Publication Nos. 487,218 and 512,334. The ion of double-stranded target DNA relies on the increased fluorescence various DNA- binding dyes, e.g., SYBR Green, exhibit when bound to double-stranded DNA.
As iated by one in the art, allele-specific amplification methods can be performed in reaction that employ multiple allele-specific primers to target particular s. Primers for such multiplex ations are generally labeled with distinguishable labels or are selected such that the amplification products produced from the alleles are distinguishable by size. Thus, for example, both alleles in a single sample can be identified using a single ication by gel analysis of the amplification product.
As in the case of allele-specific , an allele-specific oligonucleotide primer may be y complementary to one of the polymorphic alleles in the hybridizing region or may have some mismatches at positions other than the 3’-terminus of the oligonucleotide, which mismatches occur at non-polymorphic sites in both allele sequences. c. Detectable Probes i) 5’-Nuclease Assay Probes Genotyping can also be performed using a “ TaqMan®” or “ 5’-nuclease assay” , as described in U.S. Pat. Nos. 5,210,015; 5,487,972; and 5,804,375; and Holland et al., 1988, Proc.
Natl. Acad. Sci. USA 88:7276-7280. In the TaqMan® assay, labeled detection probes that hybridize within the ied region are added during the amplification reaction. The probes are modified so as to prevent the probes from acting as primers for DNA synthesis. The amplification is performed using a DNA polymerase having 5’- to 3’-exonuclease activity.
During each synthesis step of the amplification, any probe which hybridizes to the target nucleic acid downstream from the primer being ed is degraded by the 5’- to 3’-exonuclease activity of the DNA polymerase. Thus, the synthesis of a new target strand also s in the degradation of a probe, and the lation of degradation product provides a measure of the synthesis of target sequences.
The hybridization probe can be an allele-specific probe that discriminates between the SNP alleles. Alternatively, the method can be performed using an allele-specific primer and a labeled probe that binds to amplified product.
Any method suitable for detecting degradation t can be used in a 5’-nuclease assay. Often, the ion probe is d with two fluorescent dyes, one of which is capable of quenching the fluorescence of the other dye. The dyes are attached to the probe, usually one attached to the ’-terminus and the other is attached to an internal site, such that quenching occurs when the probe is in an unhybridized state and such that cleavage of the probe by the 5’- to 3’-exonuclease ty of the DNA rase occurs in between the two dyes. Amplification results in cleavage of the probe between the dyes with a concomitant elimination of ing and an increase in the scence observable from the initially quenched dye. The accumulation of degradation product is monitored by measuring the increase in reaction fluorescence. U.S. Pat.
Nos. 5,491,063 and 5,571,673, both incorporated herein by nce, describe alternative methods for detecting the degradation of probe which occurs concomitant with amplification. ii) Secondary Structure Probes Probes detectable upon a ary ural change are also suitable for detection of a polymorphism, including SNPs. Exemplified secondary structure or stem-loop structure probes include molecular beacons or Scorpion® primer/probes. Molecular beacon probes are singlestranded oligonucleic acid probes that can form a hairpin structure in which a phore and a quencher are usually placed on the opposite ends of the oligonucleotide. At either end of the probe short complementary sequences allow for the formation of an intramolecular stem, which enables the phore and the quencher to come into close proximity. The loop portion of the molecular beacon is complementary to a target nucleic acid of interest. Binding of this probe to its target nucleic acid of interest forms a hybrid that forces the stem apart. This causes a conformation change that moves the fluorophore and the quencher away from each other and leads to a more intense fluorescent signal. Molecular beacon probes are, however, highly sensitive to small ce variation in the probe target (Tyagi S. and Kramer F. R., Nature Biotechnology, Vol. 14, pages 303-308 (1996); Tyagi et al., Nature Biotechnology, Vol. 16, pages 49-53(1998); Piatek et al., Nature hnology, Vol. 16, pages 359-363 (1998); Marras S. et al., Genetic Analysis: Biomolecular Engineering, Vol. 14, pages 151-156 (1999); Tpp I. et al, BioTechniques, Vol 28, pages 732-738 (2000)). A Scorpion® primer/probe comprises a stemloop structure probe covalently linked to a primer. d. DNA Sequencing and Single Base Extensions SNPs can also be detected by direct sequencing. Methods include e.g. dideoxy sequencing-based methods and other s such as Maxam and Gilbert sequence (see, e.g. Sambrook and Russell, supra).
Other detection methods include Pyrosequencing™ of oligonucleotide-length products. Such methods often employ amplification techniques such as PCR. For example, in pyrosequencing, a sequencing primer is hybridized to a single stranded, PCR-amplified, DNA template; and incubated with the enzymes, DNA polymerase, ATP sulfurylase, luciferase and apyrase, and the substrates, ine 5’ phosphosulfate (APS) and luciferin. The first of four deoxynucleotide triphosphates (dNTP) is added to the reaction. DNA polymerase catalyzes the incorporation of the deoxynucleotide triphosphate into the DNA , if it is complementary to the base in the template strand. Each incorporation event is accompanied by release of pyrophosphate (PPi) in a quantity lar to the amount of incorporated nucleotide. ATP sulfurylase quantitatively converts PPi to ATP in the presence of adenosine 5’ phosphosulfate. This ATP drives the luciferase-mediated conversion of rin to oxyluciferin that generates visible light in amounts that are proportional to the amount of ATP. The light produced in the luciferase-catalyzed reaction is detected by a charge coupled device (CCD) camera and seen as a peak in a Pyrogram™. Each light signal is tional to the number of nucleotides incorporated.
Apyrase, a nucleotide degrading enzyme, continuously degrades unincorporated dNTPs and excess ATP. When degradation is te, another dNTP is added.
Another r method for characterizing SNPs does not require use of a complete PCR, but typically uses only the extension of a primer by a single, fluorescence-labeled dideoxyribonucleic acid molecule (ddNTP) that is complementary to the nucleotide to be investigated. The nucleotide at the polymorphic site can be identified via detection of a primer that has been extended by one base and is fluorescently labeled (e.g., Kobayashi et al, Mol. Cell.
Probes, 9:175-182, 1995). e. Electrophoresis Amplification ts ted using the rase chain reaction can be analyzed by the use of denaturing nt gel electrophoresis. Different alleles can be fied based on the different sequence-dependent melting properties and electrophoretic migration of DNA in solution (see, e.g. Erlich, ed., PCR Technology, Principles and ations for DNA Amplification, W. H. Freeman and Co, New York, 1992, Chapter 7).
Distinguishing of microsatellite polymorphisms can be done using capillary electrophoresis.
Capillary electrophoresis conveniently allows identification of the number of repeats in a particular microsatellite allele. The application of capillary electrophoresis to the analysis of DNA polymorphisms is well known to those in the art (see, for example, Szantai, et al, J Chromatogr A. (2005) 1079(1-2):41-9; im and Ekstrom, Electrophoresis (2005) 26(13):2520-30 and Mitchelson, Mol Biotechnol. (2003) 24(1):41-68). f. Single-Strand Conformation Polymorphism Analysis Alleles of target sequences can be differentiated using -strand conformation polymorphism analysis, which identifies base differences by alteration in electrophoretic migration of single ed PCR products, as described, e.g, in Orita et al., Proc. Nat. Acad. Sci. 86, 2766-2770 (1989). Amplified PCR products can be generated as described above, and heated or otherwise red, to form single stranded amplification products. Single-stranded nucleic acids may refold or form secondary ures which are partially ent on the base sequence. The different electrophoretic mobilities of single-stranded amplification products can be related to base-sequence difference between alleles of target SNP detection methods often employ labeled oligonucleotides. Oligonucleotides can be labeled by incorporating a label able by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Useful labels include fluorescent dyes, radioactive labels, e.g. 32P, electron-dense ts, enzyme, such as peroxidase or alkaline phosphatase, biotin, or haptens and ns for which antisera or monoclonal antibodies are available. Labeling ques are well known in the art (see, e.g. t Protocols in Molecular Biology, supra; Sambrook & Russell, supra). 4. Methods of Treatment Dosages of with bevacizumab (Avastin®) for treatments of specific cancers, according to the EMEA, are as follows. For metastatic carcinoma of the colon or rectum (mCRC) recommended dosages are 5 mg/kg or 10 mg/kg of body weight given once every 2 weeks or 7.5 mg/kg or 15 mg/kg of body weight given once every 3 weeks, for atic breast cancer (mBC) ended dosages are 10 mg/kg of body weight given once every 2 weeks or 15 mg/kg of body weight given once every 3 weeks as an intravenous on, and for non-small cell lung cancer (NSCLC) recommended dosages are 7.5 mg/kg or 15 mg/kg of body weight given once every 3 weeks as an intravenous infusion. al t in NSCLC ts has been demonstrated with both 7.5 mg/kg and 15 mg/kg doses. For details refer to section 5.1 Pharmacodynamic Properties, Non-small cell lung cancer (NSCLC). For advanced and/or metastatic Renal Cell Cancer (mRCC) preferred dosages are 10 mg/kg of body weight given once every 2 weeks as an intravenous infusion(in addition to um-based chemotherapy for up to 6 cycles of treatment followed by zumab (Avastin®) as a single agent until disease progression). For gliablastoma a particular dosage is 10 mg/kg every 2 weeks.
In the context of the present ion, the angiogenesis inhibitor may be administered in addition to or as a co-therapy or a co-treatment with one or more chemotherapeutic agents administered as part of standard chemotherapy regimen as known in the art. Examples of agents included in such standard herapy regimens include 5-fluorouracil, leucovorin, irinotecan, gemcitabine, erlotinib, capecitabine, taxanes, such as docetaxel and paclitaxel, interferon alpha, vinorelbine, and platinum-based chemotherapeutic , such as paclitaxel, carboplatin, cisplatin and oxaliplatin. Examples of co-treatments for metastatic pancreatic cancer include gemcitabine-erlotinib plus bevacizumab at a dosage of 5mg/kg or 10 mg/kg of body weight given once every two weeks or 7.5 mg/kg or 15 mg/kg of body weight given once every three weeks. Examples of co-treatments for renal cell cancer include interferon alpha plus bevacizumab at a dosage of or 10 mg/kg of body weight given once every two weeks. Further, a patient may be co-treated with a combination of irinotecan, 5-fluorouracil, leucovorin, also referred to as IFL, as, for example, a IFL, with a combination of oxaliplatin, orin, and 5-fluorouracil, also referred to a FOLFOX4 regimen, or with a combination of capecitabine and oxaliplatin, also referred to as XELOX. Accordingly, in a further embodiment of the invention, the patient suffering from a malignant disease or a disease involving physiological and pathological angiogenesis is being treated with one or more chemotherapeutic agents such as -fluorouracil, leucovorin, irinotecan, abine-erlotinib, capecitabine and/or platinum-based chemotherapeutic agents, such as paclitaxel, carboplatin and oxaliplatin. Examples of co- therapy or co-treatment include 5 mg/kg bevacizumab (Avastin®) every two week with bolus- IFL or 10 mg/kg bevacizumab (Avastin®) every 2 weeks with FOLFOX4 for metastatic colorectal , 15 mg/kg bevacizumab (Avastin®) every 3 weeks with caboplatis/paclitaxel for non-squamous all cell lung cancer, and 10 mg/kg bevacizumab (Avastin®) every 2 weeks with axel for metastatic breast cancer. r, the angiogenesis inhibitor to be administered may be administered as a rapy or a atment with radiotherapy.
. Kit Also bed herein is a diagnostic ition or kit comprising any of the mentioned oligonucleotides and optionally suitable means for detection.
The kit described herein may advantageously be used for carrying out a method of the invention and could be, inter alia, employed in a variety of applications, e.g., in the diagnostic field or as a ch tool. The parts of the kit can be packages individually in vials or in combination in containers or multicontainer units. Manufacture of the kit follows preferably standard procedures which are known to the person skilled in the art. The kit or diagnostic compositions may be used for detection of the one or more variant alleles in accordance with the herein-described methods of the invention, employing, for example, amplification techniques as bed herein.
Also described herein is a kit useful for carrying out the methods herein described, comprising oligonucleotides or polynucleotides capable of determining the genotype of one or more SNPs.
The oligonucleotides or polynucleotides may comprise primers and/or probes.
The present invention is further described by reference to the following non-limited figures and examples as well as with specific reference to Examples 1 and 2 and Figures 1 to 16 of .
Examples PATIENTS AND METHODS Study design AVITA (BO17706) and AVOREN (BO17705) were enter, randomized phase III trials that respectively included 607 patients with metastatic pancreatic adenocarcinoma and 649 patients with metastatic renal cell carcinoma. In AVITA, patients were randomly assigned to receive gemcitabine–erlotinib plus bevacizumab (n=306) or placebo (n=301). In AVOREN, patients were ly assigned to e interferon alfa-2a plus bevacizumab (n=327) or placebo (n=322). s of these studies have been described: - AVITA: Van Cutsem et al. Phase III trial of bevacizumab in combination with gemcitabine and erlotinib in patients with metastatic pancreatic . J. Clinc. Oncol. 27, 2231-7 (2009) - AVOREN: Escudier B, Pluzanska A, wski P, Ravaud A, Bracarda S, ik C, et al.
Bevacizumab plus interferon alfa-2a for treatment of metastatic renal cell carcinoma: a randomised, double-blind phase III trial. Lancet. 2007;370(9605):2103-2111.
Trial protocols and genetic ker studies were approved by the institutional review board at each site and were conducted in accordance with the Declaration of Helsinki, current US Food and Drug Administration Good Clinical Practices, and local ethical and legal requirements. All patients included in the biomarker studies provided separate written informed consent for c biomarker testing. Blood samples for these analyses were collected before study treatment began.
Single nucleotide polymorphism selection The following genes in the VEGF signaling cascade were selected: the VEGF ligand, the VEGF homologs (placenta growth factor [PlGF], VEGF-B, VEGF-C, and VEGF-D [also known as c- fos-induced growth factor or FlGF]), VEGF receptor-2 (VEGFR-2 or KDR) and VEGF receptor- 1 (VEGFR-1 or FLT1), regulators of hypoxia (hypoxia-inducible factor-1α ], HIF-2α [EPAS1], the factor inhibiting HIF-1α , the von Hippel–Lindau tumor suppressor [VHL], the histone acetyltransferase EP300), and the oxygen sensors l hydroxylase domaincontaining protein-1, -2, and -3 [EGLN-2, -1, and -3], respectively). Genomic sequences up to 5kb upstream of the ation start site and downstream of the 3’-poly-A-adenylation site of each gene were used to select SNPs from the HapMap database (release 24/phase II). Tagging SNPs were ed using the Tagger (Pe'er I, de Bakker PI, Maller J, Yelensky R, Altshuler D, Daly MJ. Evaluating and improving power in whole-genome association s using fixed marker sets. Nat Genet 2006;38:663-7) provided in the HAPLOVIEW software package (Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps.
Bioinformatics 2005;21:263-5). Only common SNPs, i.e. with minor allele frequency (f)≥0.1 and r2 threshold >0.8, were considered. In total, 140 tagging SNPs were selected using these criteria. Additionally, 14 SNPs located in exonic ces and inducing non-synonymous amino acid changes at a frequency f≥0.1 were selected from the dbSNP database, as were additional SNPs in VEGF (rs699947, rs833061, rs2010963, and rs3025039), VEGFR-1 458691) and VEGFR-2 (rs2071559), which were previously reported to affect function or sion of these genes. With future analyses in mind, 24 SNPs known to increase susceptibility to hypertension and thrombosis were also included in the design. In total, 184 SNPs were thus selected for genotyping.
Genotyping Peripheral blood was sampled in K2EDTA Vacutainer® tubes and germline DNA was extracted from the precipitated leukocyte cell fraction. Genotyping was carried out in a d manner at the Vesalius Research Center (Leuven, Belgium) with MassARRAY® iPLEX Gold (Sequenom Inc, San Diego, CA, USA). SNPs that failed in the first ping round were redesigned using a ent set of polymerase chain reaction primers and ed. The 27 SNPs that also failed the second design were considered failures. Overall, 157 SNPs ) were successfully genotyped with an overall success rate of 98.5% in AVITA. DNA samples from AVOREN and functional tion studies were genotyped for a limited set of SNPs ing rs7993418, rs9554320, rs9582036, rs9554316, and rs9513070 using RAY®.
Statistics Nineteen SNPs occurred at a frequency f≤0.1 in AVITA and were therefore excluded from further analysis. Hardy–Weinberg equilibrium was assessed for the remaining 138 SNPs using a standard χ2 with one degree of freedom. No major violations were detected. Linkage ilibrium (LD) strength was evaluated with r2 and Lewontin's D’ statistic using the Haploview software package (Broad Institute, Cambridge, MA, USA). Associations between SNP genotypes and time to event outcomes (PFS and OS) were first evaluated using the Cox proportional hazards method according to an additive genetic model. OS analysis was performed separately for each of the 138 SNPs in the bevacizumab arm only. The significance threshold for an overall type I error rate of 0.05 was set at P<0.00036 based on the Bonferroni correction for multiple comparison in AVITA. Significant SNPs identified in this step were r analyzed considering a threshold of P<0.05 and using a Cox regression analysis: (i) in the bevacizumab arm only, while adjusting for other baseline prognostic covariates; (ii) in the placebo arm only, to assess whether observed associations were ndent of treatment, and (iii) in both treatment groups, to assess genotype by treatment interaction. A stepwise model selection approach was applied to the subgroup available for genetic ker analysis in order to fy a set of baseline covariates affecting treatment outcome. The selected variables used as adjustment covariates were: neutrophil count, C-reactive protein, and tumor on. The association of rs7993418 was replicated in AVOREN considering a old of P<0.05 and using Cox regression analyses similar to AVITA.
RESULTS AVITA study teristics Blood samples from AVITA were available from 160 out of 607 patients (26.4%); 6 patients were Asian and 154 were ian. Since SNP frequencies differ between ethnic groups, only DNA specimens from Caucasian patients were analyzed. The genetic biomarker subgroup was comparable with the full patient cohort with respect to age and gender distribution, smoking status, OS and PFS (Table 2). The median OS in the subgroup was 7.4 and 6.7 months in the bevacizumab and placebo arms, respectively 9), and median PFS was 5.3 and 4.1 months, respectively (p=0.078).
Table 2. AVITA patient demographics and clinical characteristics at baseline Demographics and al characteristics are given for the full AVITA trial cohort and for the subgroup available for genetic biomarker analysis. Bev denotes bevacizumab; CI confidence interval, GE gemcitabine–erlotinib, mo months.
AVITA population Biomarker subgroup Characteristic GE Bev+GE GE Bev+GE (N=301) (N=306) (N=77) (N=77) Sex — no. (%) Female 113 (38) 132 (43) 25 (32) 29 (37) Male 188 (62) 174 (57) 52 (68) 48 (62) Age category — no. (%) <65 yr 194 (64) 182 (59) 50 (65) 45 (58) ≥65 yr 107 (36) 124 (41) 27 (35) 32 (42) Smoking status — no. (%) Current smoker 63 (21) 50 (16) 18 (23) 14 (18) Past smoker 99 (33) 104 (34) 36 (47) 32 (42) Never smoker 137 (46) 151 (49) 22 (29) 31 (40) Unknown 2 (<1) 1 (<1) 1 (1) 0 (0) Karnofsky performance status— no. (%) 60 11 (4) 12 (4) 2 (3) 2 (3) 70 26 (9) 28 (9) 5 (6) 6 (8) 80 71 (24) 78 (25) 14 (18) 20 (26) 90 120 (40) 119 (39) 37 (48) 30 (39) 100 73 (24) 69 (23) 19 (25) 19 (25) Visual analogue scale score for pain — no. (%) <20 137 (61) 162 (64) 50 (75) 47 (67) ≥20 89 (39) 91 (36) 17 (25) 23 (33) Progression-free survival Patients with event — no. (%) 295 (98.0) 295 (96.4) 76 (98.7) 72 (93.5) Patients without event — no. (%) 6 (2.0) 11 (3.6) 1 (1.3) 5 (6.5) Median time to event — 3.6 (3.4–3.7) 4.6 (3.8–5.4) 4.1 (3.5–5.3) 5.3 (4.0–7.0) mo (95% CI) Hazard ratio (95% CI) 0.74 (0.64–0.87) 0.75 (1.03–0.54) Overall al Patients with event — no. (%) 277 (92.0) 276 (90.2) 75 (97.4) 69 (89.6) ts without event — no. (%) 24 (8.0) 30 (9.8) 2 (2.6) 8 (10.4) Median time to event — 6.1 (5.5–6.8) 7.2 (6.6– 6.7 (5.3; 8.9) 7.4 (6.1; 9.9) mo (95% CI) 8.0) Hazard ratio (95% CI) 0.89 (0.76–1.05) 0.80 (1.12–0.58) The rs9582036 SNP in VEGFR-1 correlates with bevacizumab treatment outcome Of all 138 SNPs, only the 036 SNP in 1 passed the P value old adjusted for multiple testing. The overall effect of this SNP on OS was significant in the zumab arm (per-allele HR=2.1, 014) and consistent with an additive risk effect model (Fig. 3 of WO 2011/015348). Median OS increased from 4.8 months and 6.0 months in CC and AC carriers, respectively, to 10.3 months in AA carriers. After adjustment for neutrophil count, C-reactive protein level and tumor location, the association of rs9582036 with OS in the bevacizumab arm was slightly attenuated but still significant (HR=1.9, P=0.002). Subsequent Cox regression analysis for rs9582036 in the placebo arm did not show a statistically significant ation between OS and SNP genotypes (Fig. 4 of ). A formal test of interaction between rs9582036 and treatment (bevacizumab or o) was tically significant (P=0.041), ting that rs9582036 was a predictive marker for treatment outcome in AVITA.
Cox regression analysis also revealed a correlation between rs9582036 and PFS in the bevacizumab arm (per-allele HR=1.89, P=0.00081; Fig. 5 of ). No such effect for PFS was observed in the placebo arm (P=0.58; Fig. 6 of ).
Associated SNPs define a locus in the VEGFR-1 TK domain Three other SNPs in VEGFR-1 (rs9554316, rs9513070, and rs9554320) also correlated with OS in the bevacizumab arm, but did not pass the P value threshold adjusted for multiple testing (P=0.00042, 81, and 97, respectively). The predictive effects of these SNPs were r to those of rs9582036 (Figures 7 to 10 of ). All four SNPs were located close to each other, i.e. in introns 25, 27, 28, and 29 for rs9554320, 036, rs9554316, and rs9513070, respectively, and represented four consecutive regions of high linkage disequilibrium within VEGFR-1. When considering the P value of every SNP as a me asure of its association with OS and plotting these values as a function of the location of the SNP in VEGFR-1, an association signal encompassing exons 25 to 29, which code for amino acid residues 1029 to 1272 in the TK domain, was observed in the bevacizumab arm. As expected, no such signal was observed in the placebo group.
Fine-mapping of the 1 locus To identify all SNPs located in 1, we used whole-genome sequencing data from 60 Caucasian HapMap samples in the 1000 Genomes project (CEU population, Release July 2010; www.1000genomes.org). Using the VCF Tools version 0.1.5, SNPs in the coding region of VEGFR-1 and in the 15kb up- and downstream sequence (i.e., the 27763000-27982000 Ensembl 36.3 coordinates) were ed. In total, we identified 628 SNPs, of which 381 had a minor allele frequency (MAF) ≥0.05. Using the Haploview 4.2 software, we identified 48 SNPs that were in LD with one of the four tagging SNPs associated with treatment outcome after bevacizumab in AVITA (i.e., rs9582036, rs9554316, rs9513070 and rs9554320). The threshold for LD was set at r2≥0.12 as this was the lowest r2 between one of the four tag SNPs in the samples analyzed (Table 3).
Table 3 r2 value rs9513070 rs9554316 rs9582036 rs9554320 rs9513070 - 0.28 0.21 0.12 rs9554316 0.28 - 0.67 0.33 rs9582036 0.21 0.67 - 0.48 rs9554320 0.12 0.33 0.48 - The se linkage disequilibrium between the 4 tagging SNPs in the VEGFR-1 locus is shown.
SNPs, which are in perfect correlation and are completely mous, have a r2 value of 1.
SNPs with an r2 value of 0 occur independently from each other.
To identify which of these 48 SNPs affect VEGFR-1 function and causally contribute to treatment outcome after bevacizumab, we used the ite (Reumers J, Conde L, Medina I, et al. Joint annotation of coding and non-coding single tide polymorphisms and ons in the SNPeffect and PupaSuite databases. Nucleic Acids Res 2008;36:D825-9) and AnnoVar (Wang K, Li M, Hakonarson H. ANNOVAR: functional tion of genetic variants from high-throughput cing data. c Acids :e164) tools. In particular, we assessed which of these SNPs were located in coding regions, transcription factor binding sites, exonic splicing enhancers/silencers or miRNA binding sites, or in other evolutionary conserved sequence s. Only one SNP was located in one of the VEGFR-1 exons, i.e., rs7993418 was d in exon 28 of VEGFR-1. Two SNPs (i.e., rs9513071 and rs7982283) were loc ated in a predicted CCCTC-binding factor (CTCF) binding motif, but were unlikely to functionally affect VEGFR-1 function since they did not disrupt the core-binding domain of the CTCF motif. Five other SNPs were located on conserved positions, which were defined as conservation of the respective nucleotide position in at least 10 s out of the 44 species in the database. These SNPs were located downstream of the VEGFR-1 gene (rs9554309), in intronic sequences (rs9513073, rs9551471, rs7992940) and in exon 28 of VEGFR-1 (rs7993418). No other relevant SNPs were identified. Notably, of these 5 SNPs, 418 showed the highest degree of LD with the four tag SNPs in the VEGFR-1 TK locus (r2 values of 0.34, 0.83, 0.67 and 0.36 for LD with rs9513070, rs9554316, rs9582036 and rs9554320, respectively). Overall, based on this finemapping and in silico analysis, 418 was considered to be the SNP with the t potential to affect VEGFR-1 function. Rs7993418 is a mous T/C SNP located in exon 28 of VEGFR-1 that changes the TAT codon of tyrosine 1213 into a TAC codon (Tyr1213Tyr) and is located in the ype block of rs9554316.
The rs7993418 variant functionally affects VEGFR-1 expression 1. In vitro transcription/translation of VEGFR-1 cDNA constructs To demonstrate that rs7993418 functionally affects VEGFR-1 expression, its effect on transcription and translation of VEGFR-1 cDNA was assessed in vitro using the rabbit reticulocyte lysate system. Two versions of the VEGFR-1 cDNA, carrying either the TAT or TAC codon for Tyr1213, were generated. Both cDNAs were cloned into the pcDNA3 expression vector and were used for in vitro transcription/translation using the commercial TnT T7 Quickcoupled rabbit reticulocyte lysate kit (Promega, Cat# L1170). ength VEGFR-1 cDNA carrying either the wild-type TAT or mutant TAC codon yielded equal s of transcribed mRNA but different amounts of translated VEGFR-1 protein. In particular, a 27% increase in VEGFR-1 protein was ed for TAC versus TAT-carrying cDNA constructs (P<0.001).
Likewise, transient overexpression in HEK293T cells confirmed that, although VEGFR-1 mRNA expression was equal between cells expressing the TAC and TAT-carrying construct, up to 15% more VEGFR-1 protein was translated by TAC-expressing cells (P<0.001). Expression of the e VEGFR-1 isoform (sVEGFR-1) produced by proteolytic cleavage of full-length transmembrane VEGFR-1 (tmVEGFR-1) was similarly increased in cells expressing the TAC- carrying construct (P<0.001). 2. -1 expression levels in human plasma Furthermore, since R-1 and sVEGFR-1 protein levels are strongly correlated and sVEGFR-1 can easily be assessed in human plasma, -1 plasma levels were measured in two ndent cohorts and stratified for rs7993418. Plasma was collected from 369 healthy individuals of Flemish ancestry via the Red Cross (Leuven, Belgium) and DNA from these individuals was genotyped for 418. We compared sVEGFR-1 plasma levels from 30 and 28 randomly selected TT and TC carriers against each of the 11 CC (mutant) carriers via the Human Soluble VEGF -1 assay (R&D systems, catalog # DVR100B). We observed that CC carriers have an 18% increased median VEGFR-1 expression compared to TT and TC rs (P=0.006). y ANOVA was used to te the effect of rs7993418 on sVEGFR-1 sion; a two-sided P value <0.05 was ered statistically significant. We replicated this association in an independent cohort of plasma samples from breast cancer patients (collected at the Leuven Multidisciplinary Breast Center). Briefly, DNA from 263 patients was genotyped for rs7993418 and sVEGFR-1 plasma levels from 23 and 27 randomly selected TT (wildtype) and TC rs was compared against each of the 9 detected CC (mutant) carriers. A similar increase in sVEGFR-1 expression (19%) was noticed in CC carriers versus TT and TC carriers (P=0.014). One-way ANOVA was used to evaluate the effect of rs7993418 on sVEGFR-1 expression; a two-sided P value <0.05 was considered statistically significant. 3. VEGFR-1 expression in HUVECs stratified for rs7993418 genotypes y, by comparing HUVECs that carry rs7993418 TT, TC and CC genotypes, we could not identify any differences for tmVEGFR-1 0) and sVEGFR-1 1) mRNA expression levels. r, similar to the in vitro translation experiments, these HUVECs showed slightly increased tmVEGFR-1 protein expression levels for CC carriers versus TT or TC carriers (23% increase; 9). Similar effects between CC versus TC or TT carriers were observed for sVEGFR-1 (39% increase; P=0.044). 4. ERK1/2 activation upon PlGF stimulation The above findings te that rs7993418, by enhancing mRNA translation efficacy, increases expression of tmVEGFR-1 and sVEGFR-1. Furthermore, as expected by the increase in VEGFR-1 expression, HUVEC cultures homozygous for the C-allele exhibited increased downstream 1 signaling upon activation with the selective VEGFR-1 ligand, PlGF.
This is shown by increased levels of phospho-ERK1 and phospho-ERK2 in CC versus TT rs7993418 carriers (2.0 versus 1.6 fold induction for phospho-ERK1 and 2.1 versus 1.4 fold induction for phospho-ERK2; P=0.045 and P=0.046; n=3 versus 5). ERK1 and ERK2 phosphorylation was measured using the Phospho-MAPK array kit (R&D systems).
Phosphorylated proteins were detected using the Pierce ECL chemiluminescent substrate (Thermo Scientific) and blots were developed using Scientific imaging film ). Blots were scanned and intensities were quantified using the ImageJ 1.43 software. Intensities were background corrected and scaled relative to the internal positive control of the Phospho-MAPK array kit. Experiments were performed twice and average values of both experiments are shown.
Since the Human Phospho-MAPK array kit does not correct for the total amount of ERK1 or 2, we measured total ERK1/2 concentrations using SureFire technology (Perkin Elmer). Total ERK1/2 levels were similar for TT and CC carriers under ulated and stimulated conditions (P=0.2 and 0.34, respectively).
Association of the 1 locus replicates in AVOREN Finally, in an attempt to replicate the association of the VEGFR-1 locus with bevacizumab treatment outcome, we investigated a second phase III al study involving metastatic renal cell carcinoma patients (AVOREN). Blood samples from AVOREN were available from 110 out of 649 patients (16.9%), 59 of which received bevacizumab (Table 4).
Table 4. AVOREN patient aphics and clinical characteristics at baseline Demographics and characteristics are given for the full AVOREN trial cohort and for the subgroup available for genetic biomarker analysis. Bev denotes bevacizumab; CI confidence al, IFN Interferon alfa-2a, mo .
AVOREN population Biomarker subgroup Characteristic IFN Bev+IFN IFN Bev+IFN (N=322) (N=327) (N=51) (N=59) Sex — no. (%) Female 87 (27) 105 (32) 13 (25) 29 (29) Male 235 (73) 222 (68) 38 (75) 48 (71) Age category — no. (%) <65 yr 204 (63) 206 (63) 30 (59) 37 (63) ≥65 yr 118 (37) 121 (37) 21 (41) 22 (37) Smoking status — no. (%) Current smoker 43 (13) 45 (14) 9 (18) 6 (10) Past smoker 129 (40) 126 (39) 20 (39) 23 (39) Never smoker 148 (46) 154 (47) 22 (43) 30 (51) Unknown 2 (<1) 2 (<1) 0 (0) 0 (0) ssion-free al Patients with event — no. (%) 298 (92.5) 301 (92.0) 42 (82.4) 56 (94.9) Patients without event — no. (%) 24 (7.5) 26 (8.0) 9 (17.6) 3 (5.1) Median time to event — 5.5 (4.2–5.7) 10.2 (7.7– 8.7 (7.2– 15.5 (13.5– mo (95% CI) 11.1) 14.2) 18.4) Hazard ratio (95% CI) 0.75 (0.64–0.88) 0.93 (0.62–1.40) Overall survival Patients with event — no. (%) 224 (69.6) 220 (67.3) 28 (54.9) 30 (50.8) Patients without event — no. (%) 98 (30.4) 107 (32.7) 23 (45.1) 29 (49.2) Median time to event — 21.3 (18.4– 23.3 (20.4– 37.2 (28.2– 34.9 (30.0–.) mo (95% CI) 24.5) 27.0) 39.7) Hazard ratio (95% CI) 0.91 (0.76–1.10) 0.93 (0.55–1.55) A similar SNP analysis as for the AVITA trial, as described above, was performed on the genetic samples from patients in the AVOREN trial. Since AVOREN patients receiving zumab switched to heterogeneous second-line therapies upon disease progression, we only assessed correlation to PFS. Although the c biomarker subgroup was characterized by a longer PFS than the full patient cohort, rs7993418 correlated with PFS in the bevacizumab llele HR=1.8, P=0.033, Table 5), but not in the placebo arm (per-allele HR=0.8, P=0.49).
Table 5. –Meier estimates of PFS in bevacizumab and o d groups in AVOREN, according to rs7993418, rs9554316 and 070 genotype.
Progression-Free Survival Median time to event — mo IFN Bev+IFN Genotype (N=51) (N=59) rs7993418 or rs9554316* TT 7.95 (N=26) 16.66 (N=36) TC 13.37 (N=17) 10.15 (N=18) CC 8.11 (N=2) 14.52 (N=1) Hazard ratio (95% CI) 0.83 (0.47 – 1.44) 1.81 (1.08 – 3.05) P value 0.49 0.033 Bev denotes bevacizumab; CI confidence interval, IFN Interferon alfa-2a, mo months.
* Rs7993418 and rs9554316 were synonymous to each other and the analysis in Table 5 was conducted on rs9554316.
In Table 5, the CC genotype of rs7993418 involves only one patient; therefore, no conclusion can be drawn about the median survival of CC carries. Nevertheless, the combined genotypic effect by both TC and CC carriers of rs7993418 in AVOREN is tically significant (P=0.033). The results shown in Table 5 together with the described functional characterization of rs7993418 support the findings of the present invention that the C allele adversely affects the survival in bevacizumab-treated patients by increasing expression of VEGFR-1, which could amplify the well-recognized phenomenon of compensatory angiogenesis driven by the PlGF ligand. l, this indicates that the VEGFR-1 locus may also be predictive for zumab treatment outcome in renal cell carcinoma patients.
A genetic locus in the VEGFR-1 TK domain that is associated with PFS and OS in atic pancreatic cancer patients (AVITA) has been identified in the present invention and replicated with PFS in renal cell carcinoma patients (AVOREN). Importantly, this association was specific for patients receiving bevacizumab as no significant s were observed in placebo-treated patients. We also validated this locus at the functional level by demonstrating that rs7993418 enhances VEGFR-1 mRNA translation efficacy, leading to increased expression of VEGFR-1 protein.
Concerning how increased VEGFR-1 expression could contribute to reduced zumab treatment outcome, it is well known that activation of VEGFR-1 triggers angiogenesis, either directly by transmitting intracellular s or indirectly by transphosphorylation of VEGFR-2, ing in increased VEGFRdriven angiogenesis. Interestingly, tumors that overexpress the VEGFR-1 selective ligand, PlGF, grow less rapidly in mice lacking the VEGFR-1 TK domain as a result of reduced vascularization of these tumors. Since PlGF levels are also increased in patients treated with bevacizumab, a c locus that amplifies downstream signaling of VEGFR-1 could render the vasculature more dependent on PlGF and cause resistance to anti- VEGF treatment. Similarly, increased -1 levels can sequester tumor-derived VEGF, thereby reducing its pro-angiogenic effects transduced via VEGFR-2 and limiting the benefits of VEGF lization h bevacizumab. , Mazzone et al. have shown that high tmVEGFR-1 and sVEGFR-1 expressing endothelial cells contribute to tumor vasculature normalization, in part because these cells are less responsive to the mitogenic and migratory ty of VEGF (Mazzone M, Dettori D, Leite de Oliveira R, et al. Heterozygous deficiency of PHD2 restores tumor oxygenation and inhibits metastasis via endothelial normalization. Cell 2009;136:839-51). ably, rectal cancer patients with increased plasma sVEGFR-1 expression before and during treatment have a reduced benefit from bevacizumab, thereby underscoring the observations of the present invention about the potential value of VEGFR-1 as a biomarker of bevacizumab ent (Duda DG, et al. Plasma soluble VEGFR-1 is a potential dual biomarker of response and toxicity for bevacizumab with chemoradiation in locally advanced rectal cancer. Oncologist. 2010;15(6):577-83) At first glance, it may seem surprising that a synonymous SNP affects VEGFR-1 expression without changing the amino acid ce. However, synonymous mutations have previously been reported to affect n expression and have already been implicated in >40 diseases. One potential mechanism whereby synonymous SNPs may affect protein sion is through codon bias. In particular, the rs7993418 variant may affect codon usage of the tyrosine located on position 1213 in the TK domain of VEGFR-1. This domain is characterized by a strong bias s TAC codons, i.e. 16 TAC codons versus 5 TAT codons, which both code for a tyrosine.
Such codon bias is also present in highly expressed genes across various s, in which it represents a ism to promote efficient translation of highly expressed genes. More efficient VEGFR-1 translation d by the TAC codon can be achieved through s mechanisms, including i) the more favorable interaction of the TAC codon with its tRNA anticodon due to the stronger G-C hydrogen bond interaction at the third codon position (Grosjean H, Fiers W. Preferential codon usage in prokaryotic genes: the optimal codon- don interaction energy and the selective codon usage in efficiently expressed genes. Gene 1982;18:199-209), ii) increased availability of tRNAs for the TAC codon (the TAT tRNA is encoded by only a single gene, whereas 14 tRNA genes exist for TAC) (Juhling F, Morl M, Hartmann RK, Sprinzl M, Stadler PF, Putz J. tRNAdb 2009: compilation of tRNA sequences and tRNA genes. Nucleic Acids Res 2009;37:D159-62), and iii) the effect of ‘tRNA recycling’ by ribosomes, which favors re-use of the most frequently-used codon to e translation efficacy (Cannarozzi G, Schraudolph NN, Faty M, et al. A role for codon order in translation dynamics. Cell;141:355-67). All er, these isms support the notion that codon bias mediates the effect of rs7993418 on VEGFR-1 expression and its association with treatment outcome of bevacizumab.

Claims (12)

Claims
1. An in vitro method of determining whether a patient suffering from cancer or physiological or pathological angiogenic abnormalities is suitably treated by a therapy with an enesis inhibitor comprising bevacizumab or an antibody that binds essentially the same 5 epitope on VEGF as bevacizumab, said method comprising: (a) determining in a sample derived from a patient suffering from cancer or physiological or pathological angiogenic abnormalities the genotype at the synonymous T/C SNP located in exon 28 of VEGFR-1 corresponding respectively to TAT codon and TAC codon for tyrosine at position 1213, and 10 (b) identifying said patient as more or less suitably treated by a therapy with an enesis inhibitor sing bevacizumab or an dy that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, n the ce of each T allele at said SNP indicates an increased likelihood that the patient is more suitably treated, or the ce of each C allele at said SNP indicates an increased likelihood that the patient is less 15 ly treated.
2. The method of claim 1, wherein whether a patient is suitably treated by a therapy with an enesis inhibitor is determined in termes of whether progression-free survival or overall survival is improved.
3. The method of any one of claims 1 to 2, wherein the therapy comprises the angiogenesis tor and a chemotherapeutic agent or herapy regimen.
4. The method of any one of claims 1 to 3, wherein the therapy comprises the 25 angiogenesis inhibitor and one or more agents selected from the group consisting of taxanes, interferon alpha, 5-fluorouracil, capecitabine, leucovorin, gemcitabine, erlotinib and platinumbased chemotherapeutic agents.
5. The method of any one of claims 1 to 4, wherein the cancer is atic cancer, 30 renal cell cancer, colorectal cancer, breast cancer or lung cancer.
6. The use of a pharmaceutical composition comprising bevacizumab for the preparation of a medicament for the treatment of a patient suffering from cancer or physiological or pathological angiogenic abnormalities, wherein the patient has been identified as more suitably treated with bevacizumab in accordance with the method of any one of claims 1 to 5.
7. The use of an angiogenesis inhibitor comprising zumab or an antibody that 5 binds essentially the same epitope on VEGF as bevacizumab for the preparation of a medicament for improving the ent effect of a chemotherapeutic agent or chemotherapy regimen of a patient ing from cancer or physiological or pathological angiogenic abnormalities, wherein the t has been identified by a method comprising: (a) determining in a sample derived from a patient suffering from cancer or physiological 10 or pathological enic abnormalities the genotype at the synonymous T/C SNP located in exon 28 of VEGFR-1 ponding respectively to TAT codon and TAC codon for tyrosine at position 1213; and (b) identifying said patient as more suitably treated by the addition of an angiogenesis inhibitor comprising zumab or an antibody that binds essentially the same epitope on 15 VEGF as bevacizumab based on said genotype, wherein the ce of each T allele at said SNP indicates an increased likelihood that the patient is more suitably treated.
8. The use of claim 7, wherein whether a patient is suitably treated by a therapy with an angiogenesis tor is determined in terms of whether ssion-free survival or overall 20 survival is improved.
9. The use of any one of claims 7 to 8, wherein the chemotherapeutic agent comprises one or more agents selected from the group consisting of taxanes, interferon alpha, 5- fluorouracil, capecitabine, leucovorin, gemcitabine, erlotinib and platinum-based 25 chemotherapeutic agents.
10. The use of any one of claims 7 to 9, wherein the cancer is pancreatic cancer, renal cell cancer, colorectal cancer, breast cancer or lung cancer. 30
11. An in vitro method according to any one of claims 1 to 3 substantially as herein described with reference to any example thereof.
12. The use according to any one of claims 6 to 10 substantially as herein described with nce to any example thereof. case 30723_
NZ624442A 2011-11-23 2012-11-19 Responsiveness to angiogenesis inhibitors NZ624442B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP11190229.2 2011-11-23
EP11190229 2011-11-23
PCT/EP2012/072953 WO2013076029A1 (en) 2011-11-23 2012-11-19 Responsiveness to angiogenesis inhibitors

Publications (2)

Publication Number Publication Date
NZ624442A NZ624442A (en) 2016-07-29
NZ624442B2 true NZ624442B2 (en) 2016-11-01

Family

ID=

Similar Documents

Publication Publication Date Title
US7727724B2 (en) Polymorphisms in voltage-gated sodium channel α 1-subunit as markers for therapy selection
US20170066822A1 (en) Responsiveness to angiogenesis inhibitors
AU2016203889A1 (en) Responsiveness to angiogenesis inhibitors
JP2020120625A (en) Risk assessment method for non-alcoholic liver disease using single nucleotide polymorphism
US20140294768A1 (en) Responsiveness to angiogenesis inhibitors
US8323896B2 (en) Epidermal growth factor (EGF) expression and/or polymorphisms thereof for predicting the risk of developing cancer
EP2751280B1 (en) Method for predicting risk of hypertension associated with anti-angiogenesis therapy
NZ624442B2 (en) Responsiveness to angiogenesis inhibitors
NZ620345B2 (en) Responsiveness to angiogenesis inhibitors
AU2010281043B8 (en) Responsiveness to angiogenesis inhibitors
NZ620343B2 (en) Method for predicting risk of hypertension associated with anti-angiogenesis therapy
WO2013172922A1 (en) Lmtk3 genotype analysis for use in predicting outcome and therapy selection