WO2013172922A1 - Lmtk3 genotype analysis for use in predicting outcome and therapy selection - Google Patents
Lmtk3 genotype analysis for use in predicting outcome and therapy selection Download PDFInfo
- Publication number
- WO2013172922A1 WO2013172922A1 PCT/US2013/029699 US2013029699W WO2013172922A1 WO 2013172922 A1 WO2013172922 A1 WO 2013172922A1 US 2013029699 W US2013029699 W US 2013029699W WO 2013172922 A1 WO2013172922 A1 WO 2013172922A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- patient
- therapy
- cancer
- genotype
- gene
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- polymorphism In nature, organisms of the same species usually differ from each other in some aspects, e.g., their appearance. The differences are genetically determined and are referred to as polymorphism. Genetic polymorphism is the occurrence in a population of two or more genetically determined alternative phenotypes due to different alleles. Polymorphism can be observed at the level of the whole individual (phenotype), in variant forms of proteins and blood group substances (biochemical polymorphism), morphological features of chromosomes (chromosomal polymorphism) or at the level of DNA in differences of nucleotides (DNA polymorphism).
- Polymorphism also plays a role in determining differences in an individual's response to drugs.
- Pharmacogenetics and pharmacogenomics are multidisciplinary research efforts to study the relationship between genotype, gene expression profiles, and phenotype, as expressed in variability between individuals in response to or toxicity from drugs. Indeed, it is now known that cancer chemotherapy is limited by the predisposition of specific populations to drug toxicity or poor drug response.
- germline polymorphisms in clinical oncology, see Lenz (2004) J. Clin. Oncol. 22(13):2519-2521; Park et al. (2006) Curr. Opin. Pharma.
- a method for treating a Japanese gastrointestinal cancer patient selected for a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, administration of an effective amount of an adjuvant chemotherapy regimen or equivalent thereof, wherein the patient is selected for the therapy based on the determination of a genotype of A/G or A/G for LMTK3 rs9989661 (r9) (A/G), thereby treating the patient.
- the patient is a male patient.
- the patient is a female patient.
- a method for treating a Japanese gastrointestinal cancer patient selected for a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, administration of an effective amount of an aggressive chemotherapy regimen, wherein the patient is selected for the therapy based on the determination of a genotype of A/A for LMTK3 rs9989661 (r9) (A/G) in a sample isolated from the patient, thereby treating the patient.
- the patient is a male patient.
- the patient is a female patient.
- a method for aiding in the determination of and/or identifying a Japanese gastrointestinal cancer patient that is likely or less likely to show responsiveness to a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, adjuvant chemotherapy, comprising, or alternatively consisting esstenially of, or yet further consisting of, screening a patient cell or tissue sample for the genotype of LMTK3 rs9989661 (r9) (A/G), wherein a genotype of A/G or A/G identifies or determines that the patient is likely to show responsiveness, and A/G identifies or determines tha the patient is not likely to show responsiveness to the therapy.
- the patient is a female.
- the patient is a male.
- a method also is disclosed for aiding in the determination of and/or identifying a Japanese gastrointestinal cancer patient that is likely to require aggressive therapy, comprising, or alternatively consisting essentially of, or yet futher consisting of, screening a patient cell or tissue sample for the genotype of LMTK3 rs9989661 (r9) (A/G), wherein a genotype of A/A identifies or determines that the patient is likely to require aggressive therapy, and G/G or A/G identifies or determines that the patient is not likely to require as aggressive therapy.
- the patient is a female.
- the patient is a male.
- the gastrointestinal cancer is a metastatic or non- metastatic (localized) cancer selected from the group of gastric adenocarcinoma, rectal cancer colorectal cancer, colon cancer, gastric cancer or esophageal cancer.
- PCR 1 A PRACTICAL APPROACH (M. MacPherson et al. IRL Press at Oxford University Press (1991)); PCR 2: A PRACTICAL APPROACH (M.J. MacPherson, B.D. Hames and G.R. Taylor eds. (1995)); ANTIBODIES, A LABORATORY MANUAL (Harlow and Lane eds. (1999)); CULTURE OF ANIMAL CELLS: A MANUAL OF BASIC TECHNIQUE (R.I. Freshney 5 th edition (2005)); OLIGONUCLEOTIDE SYNTHESIS (M.
- a cell includes a single cell as well as a plurality of cells, including mixtures thereof.
- compositions and methods include the recited elements, but not excluding others.
- Consisting essentially of when used to define compositions and methods shall mean excluding other elements of any essential significance to the composition or method.
- Consisting of shall mean excluding more than trace elements of other ingredients for claimed compositions and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this invention. Accordingly, it is intended that the methods and compositions can include additional steps and components (comprising) or alternatively including steps and compositions of no significance (consisting essentially of) or alternatively, intending only the stated method steps or
- compositions consisting of.
- Bevacizumab (BV) is sold under the trade name Avastin by Genentech. It is a humanized monoclonal antibody that binds to and inhibits the biologic activity of human vascular endothelial growth factor (VEGF).
- VEGF vascular endothelial growth factor
- Biological equivalent antibodies are identified herein as modified antibodies which bind to the same epitope of the antigen, prevent the interaction of VEGF to its receptors (FltOl, KDR a.k.a. VEGFR2) and produce a substantially equivalent response, e.g., the blocking of endothelial cell proliferation and angiogenesis.
- BV Equivalents to BV include Ranibizumab (Lucentis, anti-VEGF antibody), an affinity-matured antibody Fab domain approved for use in age-related macular degeneration (AMD).
- Ranibizumab Luciferizumab
- AMD age-related macular degeneration
- bevacizumab Avastin, anti-VEGF antibody
- ranibizumab Ranibizumab
- Fluorouracil (5-FU) belongs to the family of therapy drugs call pyrimidine based antimetabolites. It is a pyrimidine analog, which is transformed into different cytotoxic metabolites that are then incorporated into DNA and RNA thereby inducing cell cycle arrest and apoptosis. Chemical equivalents are pyrimidine analogs which result in disruption of DNA replication. Chemical equivalents inhibit cell cycle progression at S phase resulting in the disruption of cell cycle and consequently apoptosis.
- 5-FU Equivalents to 5-FU include prodrugs, analogs and derivative thereof such as 5'-deoxy-5-fluorouridine (doxifluroidine), l-tetrahydrofuranyl-5 -fluorouracil (ftorafur), Capecitabine (Xeloda), S-l (MBMS-247616, consisting of tegafur and two modulators, a 5-chloro-2,4-dihydroxypyridine and potassium oxonate), ralititrexed (tomudex), nolatrexed (Thymitaq, AG337), LY231514 and ZD9331, as described for example in
- Capecitabine is a prodrug of (5-FU) that is converted to its active form by the tumor- specific enzyme PynPase following a pathway of three enzymatic steps and two intermediary metabolites, 5'-deoxy-5-fluorocytidine (5'-DFCR) and 5'-deoxy-5-fluorouridine (5'-DFUR).
- Capecitabine is marketed by Roche under the trade name Xeloda®.
- Leucovorin (Folinic acid) is an adjuvant used in cancer therapy. It is used in synergistic combination with 5-FU to improve efficacy of the chemotherapeutic agent. Without being bound by theory, addition of Leucovorin is believed to enhance efficacy of 5-FU by inhibiting thymidylate synthase. It has been used as an antidote to protect normal cells from high doses of the anticancer drug methotrexate and to increase the antitumor effects of fluorouracil (5-FU) and tegafur-uracil. It is also known as citrovorum factor and Wellcovorin.
- This compound has the chemical designation of L-Glutamic acid N[4[[(2amino-5-formyl- l,4,5,6,7,8hexahydro4oxo6-pteridinyl)methyl]amino]benzoyl], calcium salt (1 : 1).
- Oxaliplatin (Eloxatin®) is a platinum-based chemotherapy drug in the same family as cisplatin and carboplatin. It is typically administered in combination with fluorouracil and leucovorin in a combination known as FOLFOX for the treatment of colorectal cancer.
- Oxaliplatin Compared to cisplatin the two amine groups are replaced by cyclohexyldiamine for improved antitumour activity.
- the chlorine ligands are replaced by the oxalato bidentate derived from oxalic acid in order to improve water solubility.
- Equivalents to Oxaliplatin are known in the art and include without limitation cisplatin, carboplatin, aroplatin, lobaplatin, nedaplatin, and JM- 216 (see McKeage et al. (1997) J. Clin. Oncol. 201:1232-1237 and in general,
- FOLFOX is an abbreviation for a type of combination therapy that is used to treat colorectal cancer. This therapy includes 5-FU, oxaliplatin and leucovorin.
- FOLFOX4 is a specific FOLFOX chemotherapy regimen known in the art and described herein. Information regarding these treatments are available on the National Cancer Institute's web site, cancer.gov, last accessed on January 16, 2008.
- FOLFOX/BV is an abbreviation for a type of combination therapy that is used to treat colorectal cancer.
- This therapy includes 5-FU, oxaliplatin, leucovorin and Bevacizumab.
- XELOX/BV is another combination therapy used to treat colorectal cancer, which includes the prodrug to 5-FU, known as Capecitabine (Xeloda) in combination with oxaliplatin and bevacizumab.
- Information regarding these treatments are available on the National Cancer Institute's web site, cancer.gov or from the National Comprehensive Cancer Network's web site, nccn.org, last accessed on May 27, 2008.
- PTK/ZK is a "small" molecule tyrosine kinase inhibitor with broad specificity that targets all VEGF receptors (VEGFR), the platelet-derived growth factor (PDGF) receptor, c-KIT and c-Fms. Drevs (2003) Idrugs 6(8):787-794. PTK/ZK is a targeted drug that blocks angiogenesis and lymphangio genesis by inhibiting the activity of all known receptors that bind VEGF including VEGFR- 1 (Flt-1), VEGFR-2 (KDR/Flk-1) and VEGFR- 3 (Flt-4).
- VEGFR- 1 Flt-1
- VEGFR-2 KDR/Flk-1
- VEGFR- 3 Flt-4
- PTK/ZK The chemical names of PTK/ZK are l-[4-Chloroanilino]-4-[4-pyridylmethyl]phthalazine Succinate or 1-Phthalazinamine, N-(4-chlorophenyl)-4-(4-pyridinylmethyl)-, butanedioate (1 : 1).
- PTK/ZK Synonyms and analogs of PTK/ZK are known as Vatalanib, CGP79787D, PTK787/ZK 222584, CGP-79787, DE-00268, PTK-787, PTK-787A, VEGFR-TK inhibitor, ZK 222584 and ZK 232934.
- Irinotecan (CPT-11) is sold under the trade name of Camptosar®. It is a semi-synthetic analogue of the alkaloid camptothecin, which is activated by hydrolysis to SN-38 and targets topoisomerase I. Chemical equivalents are those that inhibit the interaction of topoisomerase I and DNA to form a catalytically active topoisomerase I-DNA complex. Chemical equivalents inhibit cell cycle progression at G2-M phase resulting in the disruption of cell proliferation.
- 5-FU adjuvant therapy refers to the combination of 5-FU with other treatments, such as without limitation, radiation, methyl-CCNU, Leucovorin, Oxaliplatin, irinotecin, mitomycin, cytarabine, levamisole.
- Specific treatment adjuvant regimens are known in the art as FOLFOX, FOLFOX4, MOF (semustine (methyl-CCNU), vincrisine (Oncovin) and 5-FU).
- FOLFOX FOLFOX4
- MOF semustine (methyl-CCNU)
- 5-FU 5-FU adjuvant therapy
- An example of such is an effective amount of 5-FU and Leucovorin.
- Other chemotherapeutics can be added, e.g., Oxaliplatin.
- first line or “second line” refers to the order of treatment received by a patient.
- First line therapy regimens are treatments given first, whereas second or third line therapy are given after the first line therapy or after the second line therapy, respectively.
- the National Cancer Institute defines first line therapy as "the first treatment for a disease or condition.
- primary treatment can be surgery, chemotherapy, radiation therapy, or a combination of these therapies.
- First line therapy is also referred to those skilled in the art as primary therapy and primary treatment.” See National Cancer Institute website as www.cancer.gov, last visited on May 1, 2008.
- a patient is given a subsequent chemotherapy regimen because the patient did not shown a positive clinical or sub-clinical response to the first line therapy or the first line therapy has stopped.
- adjuvant refers to administration of a therapy or
- chemotherapeutic regimen to a patient after removal of a tumor by surgery.
- Adjuvant chemotherapy is typically given to minimize or prevent a possible cancer reoccurrence.
- “neoadjuvant” chemotherapy refers to administration of therapy or
- chemotherapeutic regimen before surgery, typically in an attempt to shrink the tumor prior to a surgical procedure to minimize the extent of tissue removed during the procedure.
- the "biological equivalent” means the ability of the antibody to selectively bind its epitope protein or fragment thereof as measured by ELISA or other suitable methods.
- Biologically equivalent antibodies include, but are not limited to, those antibodies, peptides, antibody fragments, antibody variant, antibody derivative and antibody mimetics that bind to the same epitope as the reference antibody.
- An example of an equivalent Bevacizumab antibody is one which binds to and inhibits the biologic activity of human vascular endothelial growth factor (VEGF).
- the "chemical equivalent” means the ability of the chemical to selectively interact with its target protein, DNA, RNA or fragment thereof as measured by the inactivation of the target protein, incorporation of the chemical into the DNA or RNA or other suitable methods.
- Chemical equivalents include, but are not limited to, those agents with the same or similar biological activity and include, without limitation a pharmaceutically acceptable salt or mixtures thereof that interact with and/or inactivate the same target protein, DNA, or RNA as the reference chemical.
- the phrase "aggressive cancer treatment” refers to the cancer treatment, combination of treatments, or a chemotherapy regimen that is effective for treating the target cancer tumor or cell, but is associated with or known to cause higher toxicity, more side effects or is known in the art to be less efficacious than another type of treatment for the specified cancer type.
- a cancer treatment, combination of treatments, or chemotherapy regimen is less, more, or most aggressive.
- a less aggressive treatment for a colon cancer patient may include adjuvant chemotherapy comprising surgical resection of the primary tumor and a chemotherapy regimen comprising 5-FU, leucovorin and bevacizumab.
- a more aggressive cancer treatment may include adjuvant chemotherapy comprising surgical resection and a chemotherapy regimen comprising FOLFOX and BV
- the most aggressive cancer treatment may include surgical resection and a
- chemotherapy regime comprising Irinotecan and Cetuximab.
- VEGF is an example of an antigen.
- a "native” or “natural” or “wild-type” antigen is a polypeptide, protein or a fragment which contains an epitope and which has been isolated from a natural biological source. It also can specifically bind to an antigen receptor.
- an “antibody” includes whole antibodies and any antigen binding fragment or a single chain thereof.
- the term “antibody” includes any protein or peptide containing molecule that comprises at least a portion of an immunoglobulin molecule. Examples of such include, but are not limited to a complementarity determining region (CDR) of a heavy or light chain or a ligand binding portion thereof, a heavy chain or light chain variable region, a heavy chain or light chain constant region, a framework (FR) region, or any portion thereof, or at least one portion of a binding protein, any of which can be incorporated into an antibody of the present invention.
- CDR complementarity determining region
- the antibodies can be polyclonal or monoclonal and can be isolated from any suitable biological source, e.g., murine, rat, sheep and canine. Additional sources are identified infra.
- antibody is further intended to encompass digestion fragments, specified portions, derivatives and variants thereof, including antibody mimetics or comprising portions of antibodies that mimic the structure and/or function of an antibody or specified fragment or portion thereof, including single chain antibodies and fragments thereof.
- binding fragments encompassed within the term "antigen binding portion" of an antibody include a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH, domains; a F(ab') 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment consisting of the VH and CH, domains; a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, a dAb fragment (Ward et al. (1989) Nature 341:544-546), which consists of a VH domain; and an isolated complementarity determining region (CDR).
- Fab fragment a monovalent fragment consisting of the VL, VH, CL and CH, domains
- F(ab') 2 fragment a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region
- a Fd fragment consisting of the VH and CH, domains
- the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv)).
- scFv single chain Fv
- Single chain antibodies are also intended to be encompassed within the term "fragment of an antibody.” Any of the above-noted antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for binding specificity and
- epitope means a protein determinant capable of specific binding to an antibody.
- Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. Conformational and nonconformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.
- antibody variant is intended to include antibodies produced in a species other than a mouse. It also includes antibodies containing post-translational modifications to the linear polypeptide sequence of the antibody or fragment. It further encompasses fully human antibodies.
- antibody derivative is intended to encompass molecules that bind an epitope as defined above and which are modifications or derivatives of a native monoclonal antibody of this invention.
- Derivatives include, but are not limited to, for example, bispecific, multispecific, heterospecific, trispecific, tetraspecific, multispecific antibodies, diabodies, chimeric, recombinant and humanized.
- bispecific molecule is intended to include any agent, e.g., a protein, peptide, or protein or peptide complex, which has two different binding specificities.
- multispecific molecule or “heterospecific molecule” is intended to include any agent, e.g. a protein, peptide, or protein or peptide complex, which has more than two different binding specificities.
- heteroantibodies refers to two or more antibodies, antibody binding fragments (e.g., Fab), derivatives thereof, or antigen binding regions linked together, at least two of which have different specificities.
- human antibody as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences.
- the human antibodies of the invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).
- the term "human antibody” as used herein is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
- human antibody refers to an antibody in which substantially every part of the protein (e.g., CDR, framework, C L , C H domains (e.g., C H I , Cm, Cm), hinge, (VL, VH)) is substantially non-immunogenic in humans, with only minor sequence changes or variations.
- antibodies designated primate monkey, baboon, chimpanzee, etc.
- rodent mouse, rat, rabbit, guinea pig, hamster, and the like
- other mammals designate such species, sub-genus, genus, sub-family, family specific antibodies.
- chimeric antibodies include any combination of the above.
- a human antibody is distinct from a chimeric or humanized antibody. It is pointed out that a human antibody can be produced by a non-human animal or prokaryotic or eukaryotic cell that is capable of expressing functionally rearranged human immunoglobulin (e.g., heavy chain and/or light chain) genes. Further, when a human antibody is a single chain antibody, it can comprise a linker peptide that is not found in native human antibodies.
- an Fv can comprise a linker peptide, such as two to about eight glycine or other amino acid residues, which connects the variable region of the heavy chain and the variable region of the light chain.
- linker peptides are considered to be of human origin.
- a human antibody is "derived from” a particular germline sequence if the antibody is obtained from a system using human immunoglobulin sequences, e.g., by immunizing a transgenic mouse carrying human immunoglobulin genes or by screening a human immunoglobulin gene library.
- a human antibody that is "derived from” a human germline immunoglobulin sequence can be identified as such by comparing the amino acid sequence of the human antibody to the amino acid sequence of human germline
- a selected human antibody typically is at least 90% identical in amino acids sequence to an amino acid sequence encoded by a human germline immunoglobulin gene and contains amino acid residues that identify the human antibody as being human when compared to the germline immunoglobulin amino acid sequences of other species (e.g., murine germline sequences).
- a human antibody may be at least 95%, or even at least 96%, 97%, 98%), or 99%) identical in amino acid sequence to the amino acid sequence encoded by the germline immunoglobulin gene.
- a human antibody derived from a particular human germline sequence will display no more than 10 amino acid differences from the amino acid sequence encoded by the human germline immunoglobulin gene.
- the human antibody may display no more than 5, or even no more than 4, 3, 2, or 1 amino acid difference from the amino acid sequence encoded by the germline immunoglobulin gene.
- monoclonal antibody or “monoclonal antibody composition” as used herein refer to a preparation of antibody molecules of single molecular composition.
- a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
- a "human monoclonal antibody” refers to antibodies displaying a single binding specificity which have variable and constant regions derived from human germline
- recombinant human antibody includes all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom, antibodies isolated from a host cell transformed to express the antibody, e.g., from a transfectoma, antibodies isolated from a recombinant, combinatorial human antibody library, and antibodies prepared, expressed, created or isolated by any other means that involve splicing of human immunoglobulin gene sequences to other DNA sequences.
- Such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences.
- such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.
- isotype refers to the antibody class (e.g., IgM or IgGl) that is encoded by heavy chain constant region genes.
- alleles refers to alternative forms of a gene or portions thereof. Alleles occupy the same locus or position on homologous chromosomes. When a subject has two identical alleles of a gene, the subject is said to be homozygous for the gene or allele. When a subject has two different alleles of a gene, the subject is said to be heterozygous for the gene. Alleles of a specific gene can differ from each other in a single nucleotide, or several nucleotides, and can include substitutions, deletions and insertions of nucleotides. An allele of a gene can also be a form of a gene containing a mutation.
- protein protein
- polypeptide peptide
- recombinant protein refers to a polypeptide which is produced by recombinant DNA techniques, wherein generally, DNA encoding the polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein.
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication.
- Preferred vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked.
- Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors".
- expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer generally to circular double stranded DNA loops which, in their vector form are not bound to the
- plasmid and "vector” are used interchangeably as the plasmid is the most commonly used form of vector.
- vector is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
- genetic marker refers to an allelic variant of a polymorphic region of a gene of interest and/or the expression level of a gene of interest.
- wild-type allele refers to an allele of a gene which, when present in two copies in a subject results in a wild-type phenotype. There can be several different wild-type alleles of a specific gene, since certain nucleotide changes in a gene may not affect the phenotype of a subject having two copies of the gene with the nucleotide changes.
- polymorphism refers to the coexistence of more than one form of a gene or portion thereof.
- a portion of a gene of which there are at least two different forms, i.e., two different nucleotide sequences, is referred to as a "polymorphic region of a gene.”
- polymorphic region can be a single nucleotide, the identity of which differs in different alleles.
- a "polymorphic gene” refers to a gene having at least one polymorphic region.
- allelic variant of a polymorphic region of the gene of interest refers to a region of the gene of interest having one of a plurality of nucleotide sequences found in that region of the gene in other individuals.
- genotype refers to the specific allelic composition of an entire cell or a certain gene and in some aspects a specific polymorphism associated with that gene, whereas the term “phenotype' refers to the detectable outward manifestations of a specific genotype.
- gene or “recombinant gene” refers to a nucleic acid molecule comprising an open reading frame and including at least one exon and (optionally) an intron sequence.
- intron refers to a DNA sequence present in a given gene which is spliced out during mR A maturation.
- “Expression” as applied to a gene refers to the differential production of the mRNA transcribed from the gene or the protein product encoded by the gene.
- a differentially expressed gene may be over expressed (high expression) or under expressed (low expression) as compared to the expression level of a normal or control cell, a given patient population or with an internal control gene (house keeping gene). In one aspect, it refers to a differential that is about 1.5 times, or alternatively, about 2.0 times, alternatively, about 2.0 times, alternatively, about 3.0 times, or alternatively, about 5 times, or alternatively, about 10 times, alternatively about 50 times, or yet further alternatively more than about 100 times higher or lower than the expression level detected in a control sample.
- a "internal control" or “house keeping” gene refers to any constitutively or globally expressed gene whose presence enables an assessment of the gene of interests expression level. Such an assessment comprises a determination of the overall constitutive level of gene transcription and a control for variation in sampling error. Examples of such genes include, but are not limited to, ⁇ -actin, the transferring receptor gene, GAPDH gene or equivalents thereof. In one aspect of the invention, the internal control gene is ⁇ -actin.
- Cells "host cells” or “recombinant host cells” are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
- amplification of polynucleotides includes methods such as PCR, ligation amplification (or ligase chain reaction, LCR) and amplification methods. These methods are known and widely practiced in the art. See, e.g., U.S. Pat. Nos. 4,683,195 and 4,683,202 and Innis et al, 1990 (for PCR); and Wu, D.Y. et al. (1989) Genomics 4:560-569 (for LCR).
- the PCR procedure describes a method of gene amplification which is comprised of (i) sequence-specific hybridization of primers to specific genes within a DNA sample (or library), (ii) subsequent amplification involving multiple rounds of annealing, elongation, and denaturation using a DNA polymerase, and (iii) screening the PCR products for a band of the correct size.
- the primers used are oligonucleotides of sufficient length and appropriate sequence to provide initiation of polymerization, i.e. each primer is specifically designed to be complementary to each strand of the genomic locus to be amplified.
- Reagents and hardware for conducting PCR are commercially available. Primers useful to amplify sequences from a particular gene region are preferably complementary to, and hybridize specifically to sequences in the target region or in its flanking regions. Nucleic acid sequences generated by amplification may be sequenced directly. Alternatively the amplified sequence(s) may be cloned prior to sequence analysis. A method for the direct cloning and sequence analysis of enzymatically amplified genomic segments is known in the art.
- Homology refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or “nonhomologous” sequence shares less than 40% identity, though preferably less than 25% identity, with one of the sequences of the present invention.
- a homolog of a nucleic acid refers to a nucleic acid having a nucleotide sequence having a certain degree of homology with the nucleotide sequence of the nucleic acid or complement thereof.
- a homolog of a double stranded nucleic acid is intended to include nucleic acids having a nucleotide sequence which has a certain degree of homology with or with the complement thereof.
- homo logs of nucleic acids are capable of hybridizing to the nucleic acid or complement thereof.
- interact as used herein is meant to include detectable interactions between molecules, such as can be detected using, for example, a hybridization assay.
- interact is also meant to include "binding" interactions between molecules. Interactions may be, for example, protein-protein, protein-nucleic acid, protein-small molecule or small molecule-nucleic acid in nature.
- isolated refers to molecules or biological or cellular materials being substantially free from other materials.
- isolated refers to nucleic acid, such as DNA or RNA, or protein or polypeptide, or cell or cellular organelle, or tissue or organ, separated from other DNAs or RNAs, or proteins or polypeptides, or cells or cellular organelles, or tissues or organs, respectively, that are present in the natural source.
- isolated also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
- an "isolated nucleic acid” is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state.
- isolated is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides.
- isolated is also used herein to refer to cells or tissues that are isolated from other cells or tissues and is meant to encompass both cultured and engineered cells or tissues.
- a "normal cell corresponding to the tumor tissue type” refers to a normal cell from a same tissue type as the tumor tissue.
- a non-limiting examples is a normal lung cell from a patient having lung tumor, or a normal colon cell from a patient having colon tumor.
- a "blood cell” refers to any of the cells contained in blood.
- a blood cell is also referred to as an erythrocyte or leukocyte, or a blood corpuscle.
- Non-limiting examples of blood cells include white blood cells, red blood cells, and platelets.
- determining the genotype of a cell or tissue sample intends to identify the genotypes of polymorphic loci of interest in the cell or tissue sample.
- a polymorphic locus is a single nucleotide polymorphic (SNP) locus. If the allelic composition of a SNP locus is heterozygous, the genotype of the SNP locus will be identified as "X/Y" wherein X and Y are two different nucleotides, e.g., G/C for the IL-6 gene at position - 174.
- the genotype of the SNP locus will be identified as "X/X" wherein X identifies the nucleotide that is present at both alleles, e.g., G/G for IL-6 gene at position -174.
- a polymorphic locus harbors allelic variants of nucleotide sequences of different length. The genotype of the polymorphic locus will be identified with the length of the allelic variant, e.g., both alleles with ⁇ 20 CA repeats at intron 1 of the EGFR gene.
- oligonucleotide or “polynucleotide”, or “portion,” or “segment” thereof refer to a stretch of polynucleotide residues which is long enough to use in PCR or various hybridization procedures to identify or amplify identical or related parts of mRNA or DNA molecules.
- the polynucleotide compositions of this invention include RNA, cDNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art.
- Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides),
- uncharged linkages e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.
- charged linkages e.g., phosphorothioates, phosphorodithioates, etc.
- pendent moieties e.g., polypeptides
- intercalators e.g., acridine, psoralen, etc.
- chelators e.g., EDTA, EDTA, etc.
- alkylators e.g., EDTA, EDTA, EDTA, etc.
- modified linkages e.g., alpha anomeric nucleic acids, etc.
- synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.
- a genetic marker or polymorphism is used as a basis or to aid in determination of, or for selecting a patient for a treatment described herein, the genetic marker or
- polymorphism is measured before and/or during treatment, and the values obtained are used by a clinician in assessing any of the following: (a) probable or likely suitability of an individual to initially receive treatment(s); (b) probable or likely unsuitability of an individual to initially receive treatment(s); (c) responsiveness to treatment; (d) probable or likely suitability of an individual to continue to receive treatment(s); (e) probable or likely unsuitability of an individual to continue to receive treatment(s); (f) adjusting dosage; (g) predicting likelihood of clinical benefits; or (h) toxicity.
- measurement of the genetic marker or polymorphism in a clinical setting is a clear indication that this parameter was used as a basis for initiating, continuing, adjusting and/or ceasing administration of the treatments described herein.
- a response to treatment includes a reduction in cachexia, increase in survival time, elongation in time to tumor progression, reduction in tumor mass, reduction in tumor burden and/or a prolongation in time to tumor metastasis, time to tumor recurrence, tumor response, complete response, partial response, stable disease, progressive disease, progression free survival, overall survival, each as measured by standards set by the National Cancer Institute and the U.S. Food and Drug Administration for the approval of new drugs. See Johnson et al. (2003) J. Clin. Oncol. 21(7):1404-1411.
- An effective amount intends to indicated the amount of a compound or agent administered or delivered to the patient which is most likely to result in the desired response to treatment.
- the amount is empirically determined by the patient's clinical parameters including, but not limited to the stage of disease, age, gender, histology, and likelihood for tumor recurrence.
- clinical outcome refers to any clinical observation or measurement relating to a patient's reaction to a therapy.
- clinical outcomes include tumor response (TR), overall survival (OS), progression free survival (PFS), disease free survival (DFS), time to tumor recurrence (TTR), time to tumor progression (TTP), relative risk (RR), toxicity or side effects.
- the term "likely to respond” intends to mean that the patient of a genotype is relatively more likely to experience a more favorable outcome as compared to patients similarly situated without the genotype.
- the term “not likely to respond” intends to mean that the patient of a genotype is relatively less likely to experience a favorable outcome than patients similarly situated without the genotype.
- suitable for a therapy or “suitably treated with a therapy” shall mean that the patient is likely to exhibit one or more more desirable clinical outcome as compared to patients having the same disease and receiving the same therapy but possessing a different characteristic that is under consideration for the purpose of the comparison.
- the characteristic under consideration is a genetic polymorphism or a somatic mutation.
- the characteristic under consideration is expression level of a gene or a polypeptide.
- a more desirable clinical outcome is relatively higher likelihood of or relatively better tumor response such as tumor load reduction.
- a more desirable clinical outcome is relatively longer overall survival.
- a more desirable clinical outcome is relatively longer progression free survival or time to tumor progression.
- a more desirable clinical outcome is relatively longer disease free survival.
- a more desirable clinical outcome is relative reduction or delay in tumor recurrence.
- a more desirable clinical outcome is relatively decreased metastasis.
- a more desirable clinical outcome is relatively lower relative risk.
- a more desirable clinical outcome is relatively reduced toxicity or side effects.
- more than one clinical outcomes are considered simultaneously.
- a patient possessing a characteristic such as a genotype of a genetic polymorphism, may exhibit more than one more desirable clinical outcomes as compared to patients having the same disease and receiving the same therapy but not possessing the characteristic. As defined herein, the patients is considered suitable for the therapy.
- a patient possessing a characteristic may exhibit one or more more desirable clinical outcome but simultaneously exhibit one or more less desirable clinical outcome.
- the clinical outcomes will then be considered collectively, and a decision as to whether the patient is suitable for the therapy will be made accordingly, taking into account the patient's specific situation and the relevance of the clinical outcomes.
- progression free survival or overall survival is weighted more heavily than tumor response in a collective decision making.
- a "complete response" (CR) to a therapy defines patients with evaluable but non- measurable disease, whose tumor and all evidence of disease had disappeared.
- a "partial response" (PR) to a therapy defines patients with anything less than complete response that were simply categorized as demonstrating partial response.
- SD stable disease
- Progressive disease indicates that the tumor has grown (i.e. become larger), spread (i.e. metastasized to another tissue or organ) or the overall cancer has gotten worse following treatment. For example, tumor growth of more than 20 percent since the start of treatment typically indicates progressive disease.
- DFS Disease free survival
- Non-response (NR) to a therapy defines patients whose tumor or evidence of disease has remained constant or has progressed.
- OS Global System for Mobile Communications
- Progression free survival indicates the length of time during and after treatment that the cancer does not grow.
- Progression-free survival includes the amount of time patients have experienced a complete response or a partial response, as well as the amount of time patients have experienced stable disease.
- No Correlation refers to a statistical analysis showing no relationship between the allelic variant of a polymorphic region or gene expression levels and clinical parameters.
- Tumor Recurrence as used herein and as defined by the National Cancer Institute is cancer that has recurred (come back), usually after a period of time during which the cancer could not be detected. The cancer may come back to the same place as the original (primary) tumor or to another place in the body. It is also called recurrent cancer.
- TTR Time to Tumor Recurrence
- Relative Risk in statistics and mathematical epidemiology, refers to the risk of an event (or of developing a disease) relative to exposure. Relative risk is a ratio of the probability of the event occurring in the exposed group versus a non-exposed group.
- stage I cancer As used herein, the terms “stage I cancer,” “stage II cancer,” “stage III cancer,” and “stage IV” refer to the TNM staging classification for cancer.
- Stage I cancer typically identifies that the primary tumor is limited to the organ of origin.
- Stage II intends that the primary tumor has spread into surrounding tissue and lymph nodes immediately draining the area of the tumor.
- Stage III intends that the primary tumor is large, with fixation to deeper structures.
- Stage IV intends that the primary tumor is large, with fixation to deeper structures. See pages 20 and 21, CANCER BIOLOGY, 2 nd Ed., Oxford University Press (1987).
- a "tumor” is an abnormal growth of tissue resulting from uncontrolled, progressive multiplication of cells and serving no physiological function.
- a “tumor” is also known as a neoplasm.
- a "lymph node” refers to a rounded mass of lymphatic tissue that is surrounded by a capsule of connective tissue, which filter lymphatic fluid and stores white blood cells. Cancers described herein can spread to the lymphatic system and this spreading is used, in part, to determine the cancer stage. For example, if a cancer is "lymph node negative,” the cancer has not spread to the surrounding or nearby lymph nodes and thus the lymphatic system.
- the cancer is "lymph node positive.”
- blood refers to blood which includes all components of blood circulating in a subject including, but not limited to, red blood cells, white blood cells, plasma, clotting factors, small proteins, platelets and/or cryoprecipitate. This is typically the type of blood which is donated when a human patent gives blood.
- hazard ratio is a survival analysis in the effect of an explanatory variable on the hazard or risk of an event. In another aspect, "hazard ratio" is an estimate of relative risk, which is the risk of an event or development of a disease relative to treatment and in some aspects the expression levels of the gene of interest. Statistical methods for determining hazard ratio are well known in the art.
- a method for treating a Japanese gastrointestinal cancer patient selected for a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, administration of an effective amount of an adjuvant chemotherapy regimen or equivalent thereof, wherein the patient is selected for the therapy based on the determination of a genotype of A/G or A/G for LMTK3 rs9989661 (r9) (A/G), thereby treating said patient.
- the patient is a male patient.
- the patient is a female patient.
- Also disclosed is a method for treating a Japanese gastrointestinal cancer patient selected for a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, administration of an effective amount of an aggressive chemotherapy regimen, wherein the patient is selected for the therapy based on the determination of a genotype of A/A for LMTK3 rs9989661 (r9) (A/G) in a sample isolated from the patient, thereby treating said patient.
- the patient is a male patient.
- the patient is a female patient.
- the gastrointestinal cancer is a metastatic or non- metastatic (localized) cancer selected from the group of gastric adenocarcinoma, rectal cancer colorectal cancer, colon cancer, gastric cancer or esophageal cancer.
- a mammal includes but is not limited to a simian, a murine, a bovine, an equine, a porcine or an ovine.
- the disclosure further provides diagnostic methods, which are based, at least in part, on determination of the identity of the polymorphic region of the gene identified herein.
- a method for aiding in the determination of and/or identifying a Japanese gastrointestinal cancer patient that is likely or less likely to show responsiveness to a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, adjuvant chemotherapy, comprising screening a patient cell or tissue sample for the genotype of LMTK3 rs9989661 (r9) (A/G), wherein a genotype of A/G or A/G identifies or determines that the patient is likely to show responsiveness, and A/G identifies or determines tha the patient is not likely to show responsiveness to the therapy.
- the patient is a female.
- the patient is a male.
- a method for aiding in the determination of and/or identifying a Japanese gastrointestinal cancer patient that is likely to require aggressive therapy, comprising, or alternatively consisting essentially of, or yet futher consisting of, screening a patient cell or tissue sample for the genotype of LMTK3 rs9989661 (r9) (A/G), wherein a genotype of A/A identifies or determines that the patient is likely to require aggressive therapy, and G/G or A/G identifies or determines that the patient is not likely to require as aggressive therapy.
- the patient is a female.
- the patient is a male.
- the method further comprises administering an effective amount of the appropriate therapy to the patient identified or determined for the therapy.
- the gastrointestinal cancer is a metastatic or non- metastatic (localized) cancer selected from the group of gastric adenocarcinoma, rectal cancer colorectal cancer, colon cancer, gastric cancer or esophageal cancer.
- Non-limiting samples to be screened diagnostic and therapeutic methods disclosed herein comprise, or alternatively consisting essentially of, or yet further consisting of, tissue or cells selected from non-metastatic tumor tissue, a non-metastatic tumor cell, metastatic tumor tissue, a metastatic tumor cell, blood or peripheral blood lymphocytes.
- patient sample comprises blood or a peripheral blood lymphocytes.
- the cells or tissue can be analzyzed using methods known in the art, e.g., method comprising hybridization, direct DNA-sequencing or PCR.
- responsiveness to therapy is measured by a longer time of disease free survival, longer overall survival and/or lower risk of disease recurrence.
- information obtained using the diagnostic assays described herein is useful for determining if a subject will likely, more likely, or less likely to respond to cancer treatment of a given type. Based on the prognostic information, a doctor can recommend a therapeutic protocol, useful for treating reducing the malignant mass or tumor in the patient or treat cancer in the individual.
- knowledge of the identity of a particular allele in an individual allows customization of therapy for a particular disease to the individual's genetic profile, the goal of "pharmacogenomics".
- an individual's genetic profile can enable a doctor: 1) to more effectively prescribe a drug that will address the molecular basis of the disease or condition; 2) to better determine the appropriate dosage of a particular drug and 3) to identify novel targets for drug development.
- the identity of the genotype or expression patterns of individual patients can then be compared to the genotype or expression profile of the disease to determine the appropriate drug and dose to administer to the patient.
- Detection of point mutations or additional base pair repeats can be accomplished by molecular cloning of the specified allele and subsequent sequencing of that allele using techniques known in the art, in some aspects, after isolation of a suitable nucleic acid sample using methods known in the art.
- the gene sequences can be amplified directly from a genomic DNA preparation from the tumor tissue using PCR, and the sequence composition is determined from the amplified product.
- numerous methods are available for isolating and analyzing a subject's DNA for mutations at a given genetic locus such as the gene of interest.
- a detection method is allele specific hybridization using probes overlapping the polymorphic site and having about 5, or alternatively 10, or alternatively 20, or alternatively 25, or alternatively 30 nucleotides around the polymorphic region.
- several probes capable of hybridizing specifically to the allelic variant are attached to a solid phase support, e.g., a "chip".
- Oligonucleotides can be bound to a solid support by a variety of processes, including lithography. For example a chip can hold up to 250,000 oligonucleotides (GeneChip, Affymetrix). Mutation detection analysis using these chips comprising oligonucleotides, also termed "DNA probe arrays" is described e.g., in Cronin et al. (1996) Human Mutation 7:244.
- Amplification can be performed, e.g., by PCR and/or LCR, according to methods known in the art.
- genomic DNA of a cell is exposed to two PCR primers and amplification for a number of cycles sufficient to produce the required amount of amplified DNA.
- Alternative amplification methods include: self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques known to those of skill in the art. These detection schemes are useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.
- any of a variety of sequencing reactions known in the art can be used to directly sequence at least a portion of the gene of interest and detect allelic variants, e.g., mutations, by comparing the sequence of the sample sequence with the corresponding wild-type (control) sequence.
- Exemplary sequencing reactions include those based on techniques developed by Maxam and Gilbert (1997) Proc. Natl. Acad. Sci, USA 74:560) or Sanger et al. (1977) Proc. Nat. Acad. Sci, 74:5463).
- any of a variety of automated sequencing procedures can be utilized when performing the subject assays (Biotechniques (1995) 19:448), including sequencing by mass spectrometry (see, for example, U.S. Patent No. 5,547,835 and International Patent Application Publication Number WO 94/16101, entitled DNA Sequencing by Mass Spectrometry by Koster; U.S. Patent No. 5,547,835 and international patent application Publication Number WO 94/21822 entitled "DNA Sequencing by Mass Spectrometry Via Exonuclease Degradation" by Koster; U.S. Patent No. 5,605,798 and
- the presence of the specific allele in DNA from a subject can be shown by restriction enzyme analysis.
- the specific nucleotide polymorphism can result in a nucleotide sequence comprising a restriction site which is absent from the nucleotide sequence of another allelic variant.
- protection from cleavage agents can be used to detect mismatched bases in RNA/RNA DNA/DNA, or RNA/DNA heteroduplexes (see, e.g., Myers et al. (1985) Science 230:1242).
- the technique of "mismatch cleavage” starts by providing heteroduplexes formed by hybridizing a control nucleic acid, which is optionally labeled, e.g., RNA or DNA, comprising a nucleotide sequence of the allelic variant of the gene of interest with a sample nucleic acid, e.g., RNA or DNA, obtained from a tissue sample.
- a control nucleic acid which is optionally labeled, e.g., RNA or DNA
- sample nucleic acid e.g., RNA or DNA
- RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with SI nuclease to enzymatically digest the mismatched regions.
- either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine whether the control and sample nucleic acids have an identical nucleotide sequence or in which nucleotides they are different. See, for example, U.S. Patent No. 6,455,249, Cotton et al. (1988) Proc. Natl. Acad. Sci. USA 85:4397; Saleeba et al. (1992) Methods Enzy. 217:286- 295.
- the control or sample nucleic acid is labeled for detection.
- alterations in electrophoretic mobility is used to identify the particular allelic variant.
- SSCP single strand conformation polymorphism
- SSCP single strand conformation polymorphism
- Single-stranded DNA fragments of sample and control nucleic acids are denatured and allowed to renature.
- the secondary structure of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change.
- the DNA fragments may be labeled or detected with labeled probes.
- the sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence.
- the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet. 7:5).
- the identity of the allelic variant is obtained by analyzing the movement of a nucleic acid comprising the polymorphic region in polyacrylamide gels containing a gradient of denaturant, which is assayed using denaturing gradient gel
- DGGE electrophoresis
- a temperature gradient is used in place of a denaturing agent gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys. Chem. 265:1275).
- Examples of techniques for detecting differences of at least one nucleotide between 2 nucleic acids include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension.
- oligonucleotide probes may be prepared in which the known polymorphic nucleotide is placed centrally (allele-specific probes) and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324: 163); Saiki et al. (1989) Proc. Natl. Acad. Sci. USA 86:6230 and Wallace et al. (1979) Nucl. Acids Res. 6:3543).
- oligonucleotide hybridization techniques may be used for the detection of the nucleotide changes in the polymorphic region of the gene of interest.
- oligonucleotides having the nucleotide sequence of the specific allelic variant are attached to a hybridizing membrane and this membrane is then hybridized with labeled sample nucleic acid.
- hybridization signal will then reveal the identity of the nucleotides of the sample nucleic acid.
- allele specific amplification technology which depends on selective PCR amplification may be used in conjunction with the instant invention.
- Oligonucleotides used as primers for specific amplification may carry the allelic variant of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11:238 and Newton et al. (1989) Nucl. Acids Res. 17:2503). This technique is also termed "PROBE" for Probe Oligo Base Extension.
- identification of the allelic variant is carried out using an oligonucleotide ligation assay (OLA), as described, e.g., in U.S. Patent No. 4,998,617 and in Landegren et al. (1988) Science 241: 1077-1080.
- OLA oligonucleotide ligation assay
- the OLA protocol uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target.
- One of the oligonucleotides is linked to a separation marker, e.g., biotinylated, and the other is detectably labeled.
- oligonucleotides will hybridize such that their termini abut, and create a ligation substrate. Ligation then permits the labeled oligonucleotide to be recovered using avidin, or another biotin ligand.
- Nickerson et al. have described a nucleic acid detection assay that combines attributes of PCR and OLA (Nickerson et al. (1990) Proc. Natl. Acad. Sci. (U.S.A.) 87:8923-8927). In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA.
- each OLA reaction can be detected by using hapten specific antibodies that are labeled with different enzyme reporters, alkaline phosphatase or horseradish peroxidase.
- This system permits the detection of the two alleles using a high throughput format that leads to the production of two different colors.
- the single base polymorphism can be detected by using a specialized exonuclease-resistant nucleotide, as disclosed, e.g., in Mundy, C. R. (U.S. Patent No. 4,656,127).
- a primer complementary to the allelic sequence immediately 3 ' to the polymorphic site is permitted to hybridize to a target molecule obtained from a particular animal or human. If the polymorphic site on the target molecule contains a nucleotide that is complementary to the particular exonuclease-resistant nucleotide derivative present, then that derivative will be incorporated onto the end of the hybridized primer.
- a solution-based method is used for determining the identity of the nucleotide of the polymorphic site.
- Cohen, D. et al. (French Patent 2,650,840; PCT Appln. No. WO91/02087).
- a primer is employed that is complementary to allelic sequences immediately 3' to a polymorphic site. The method determines the identity of the nucleotide of that site using labeled dideoxynucleotide derivatives, which, if complementary to the nucleotide of the polymorphic site will become incorporated onto the terminus of the primer.
- GBA TM Genetic Bit Analysis
- Goelet, P. et al. PCT Appln. No. 92/157112.
- This method uses mixtures of labeled terminators and a primer that is complementary to the sequence 3' to a polymorphic site.
- the labeled terminator that is incorporated is thus determined by, and complementary to, the nucleotide present in the polymorphic site of the target molecule being evaluated.
- the method of Goelet, P. et al. supra is preferably a heterogeneous phase assay, in which the primer or the target molecule is immobilized to a solid phase.
- allelic variant If the polymorphic region is located in the coding region of the gene of interest, yet other methods than those described above can be used for determining the identity of the allelic variant. For example, identification of the allelic variant, which encodes a mutated signal peptide, can be performed by using an antibody specifically recognizing the mutant protein in, e.g., immunohistochemistry or immunoprecipitation. Antibodies to the wild-type or signal peptide mutated forms of the signal peptide proteins can be prepared according to methods known in the art.
- a solid phase support is used as a support capable of binding of a primer, probe, polynucleotide, an antigen or an antibody.
- Well-known supports include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite.
- the nature of the support can be either soluble to some extent or insoluble for the purposes of the present invention.
- the support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to an antigen or antibody.
- the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod.
- the surface may be flat such as a sheet, test strip, etc. or alternatively polystyrene beads.
- suitable supports for binding antibody or antigen or will be able to ascertain the same by use of routine experimentation.
- any of the above methods for detecting alterations in a gene or gene product or polymorphic variants can be used to monitor the course of treatment or therapy.
- the methods described herein may be performed, for example, by utilizing prepackaged diagnostic kits, such as those described below, comprising at least one probe or primer nucleic acid described herein, which may be conveniently used, e.g., to determine whether a subject is likely responsive to the therapy as described herein or has or is at risk of developing disease such as colorectal cancer.
- Sample nucleic acid for use in the above-described diagnostic and prognostic methods can be obtained from any suitable cell type or tissue of a subject.
- a subject's bodily fluid e.g. blood
- venipuncture e.g., venipuncture
- nucleic acid tests can be performed on dry samples (e.g., hair or skin).
- Fetal nucleic acid samples can be obtained from maternal blood as described in International Patent Application No. W091/07660 to Bianchi.
- amniocytes or chorionic villi can be obtained for performing prenatal testing.
- Diagnostic procedures can also be performed in situ directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary. Nucleic acid reagents can be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, G. J. (1992) PCR IN SITU HYBRIDIZATION:
- Fingerprint profiles can be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT-PCR.
- Antibodies directed against wild type or mutant peptides encoded by the allelic variants of the gene of interest may also be used in disease diagnostics and prognostics. Such diagnostic methods, may be used to detect abnormalities in the level of expression of the peptide, or abnormalities in the structure and/or tissue, cellular, or subcellular location of the peptide.
- Protein from the tissue or cell type to be analyzed may easily be detected or isolated using techniques which are well known to one of skill in the art, including but not limited to Western blot analysis.
- Western blot analysis For a detailed explanation of methods for carrying out Western blot analysis, see Sambrook and Russell (2001) supra.
- the protein detection and isolation methods employed herein can also be such as those described in Harlow and Lane, (1999) supra. This can be accomplished, for example, by immunofluorescence techniques employing a fluorescently labeled antibody (see below) coupled with light microscopic, flow cytometric, or fluorimetric detection.
- the antibodies (or fragments thereof) useful in the present invention may, additionally, be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of the peptides or their allelic variants.
- In situ detection may be accomplished by removing a histological specimen from a patient, and applying thereto a labeled antibody of the present invention.
- the antibody (or fragment) is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample.
- the nucleic acid sequences of the gene of interest, or portions thereof can be the basis for probes or primers, e.g., in methods for determining expression level of the gene of interest or the allelic variant of a polymorphic region of a gene of interest identified in the experimental section below.
- they can be used in the methods of the invention to determine which therapy is most likely to treat an individual's cancer.
- the methods of the invention can use nucleic acids isolated from vertebrates.
- the vertebrate nucleic acids are mammalian nucleic acids.
- the nucleic acids used in the methods of the invention are human nucleic acids.
- Primers for use in the methods of the invention are nucleic acids which hybridize to a nucleic acid sequence which is adjacent to the region of interest or which covers the region of interest and is extended.
- a primer can be used alone in a detection method, or a primer can be used together with at least one other primer or probe in a detection method.
- Primers can also be used to amplify at least a portion of a nucleic acid.
- Probes for use in the methods of the invention are nucleic acids which hybridize to the gene of interest and which are not further extended.
- a probe is a nucleic acid which hybridizes to the gene of interest, and which by hybridization or absence of hybridization to the DNA of a subject will be indicative of the identity of the allelic variant of the expression levels of the gene of interest.
- Primers and/or probes for use in the methods can be provided as isolated single stranded oligonucleotides or alternatively, as isolated double stranded oligonucleotides.
- primers comprise a nucleotide sequence which comprises a region having a nucleotide sequence which hybridizes under stringent conditions to about: 6, or alternatively 8, or alternatively 10, or alternatively 12, or alternatively 25, or alternatively 30, or alternatively 40, or alternatively 50, or alternatively 75 consecutive nucleotides of the gene of interest.
- Primers can be complementary to nucleotide sequences located close to each other or further apart, depending on the use of the amplified DNA.
- primers can be chosen such that they amplify DNA fragments of at least about 10 nucleotides or as much as several kilobases.
- the primers of the invention will hybridize selectively to nucleotide sequences located about 100 to about 1000 nucleotides apart.
- a forward primer i.e., 5' primer
- a reverse primer i.e., 3' primer
- Forward and reverse primers hybridize to complementary strands of a double stranded nucleic acid, such that upon extension from each primer, a double stranded nucleic acid is amplified.
- amplification of LMTK3 rs9989661 include: Forward TTGGACTACAACTCCCGTGATGCT SEQ ID No. 1
- primers of the invention are nucleic acids which are capable of selectively hybridizing to the gene of interest.
- primers can be specific for the gene of interest sequence, so long as they have a nucleotide sequence which is capable of hybridizing to the gene of interest.
- nucleic acids used as probes or primers may be modified to become more stable.
- exemplary nucleic acid molecules which are modified include
- nucleic acids used in the methods of the invention can also be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule.
- the nucleic acids, e.g., probes or primers may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane. See, e.g., Letsinger et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556;
- nucleic acid used in the methods of the invention may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
- the isolated nucleic acids used in the methods of the invention can also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose or, alternatively, comprise at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
- nucleic acids, or fragments thereof, to be used in the methods of the invention can be prepared according to methods known in the art and described, e.g., in Sambrook et al. (2001) supra.
- discrete fragments of the DNA can be prepared and cloned using restriction enzymes.
- discrete fragments can be prepared using the Polymerase Chain Reaction (PCR) using primers having an appropriate sequence under the manufacturer's conditions, (described above).
- Oligonucleotides can be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.).
- an automated DNA synthesizer such as are commercially available from Biosearch, Applied Biosystems, etc.
- phosphorothioate oligonucleotides can be synthesized by the method of Stein et al. (1988) Nucl. Acids Res. 16:3209
- methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports. Sarin et al. (1988) Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451.
- a method for treating a Japanese gastric cancer patient selected for a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, administration of an effective amount of an adjuvant chemotherapy regimen or equivalent thereof, wherein the patient is selected for the therapy based on the determination of a genotype of A/G or A/G for LMTK3 rs9989661 (r9) (A/G) in a sample isolated from the patient, thereby treating said patient.
- the patient is a male patient.
- the patient is a female patient.
- the methods further comprise identifying a patient for treatment by screening a cell or tissue sample using the methods disclosed above and identifying and/or selecting the patient for the therapy or vice versa.
- the methods comprise administrering an effective amount of the therapy.
- a formulation comprising the necessary chemotherapy or biological equivalent thereof is further provided herein.
- the formulation can further comprise one or more preservatives or stabilizers.
- Any suitable concentration or mixture can be used as known in the art, such as 0.001-5%, or any range or value therein, such as, but not limited to 0.001, 0.003, 0.005, 0.009, 0.01, 0.02, 0.03, 0.05, 0.09, 0.1, 0.2, 0.3, O.4., 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.3, 4.5, 4.6, 4.7, 4.8, 4.9, or any range or value therein.
- Non-limiting examples include, no preservative, 0.1-2% m-cresol (e.g., 0.2, 0.3. 0.4, 0.5, 0.9, 1.0%), 0.1-3% benzyl alcohol (e.g., 0.5, 0.9, 1.1., 1.5, 1.9, 2.0, 2.5%), 0.001-0.5% thimerosal (e.g., 0.005, 0.01), 0.001-2.0% phenol (e.g., 0.05, 0.25, 0.28, 0.5, 0.9, 1.0%), 0.0005-1.0% alkylparaben(s) (e.g., 0.00075, 0.0009, 0.001, 0.002, 0.005, 0.0075, 0.009, 0.01, 0.02, 0.05, 0.075, 0.09, 0.1, 0.2, 0.3, 0.5, 0.75, 0.9, and 1.0%).
- 0.1-2% m-cresol e.g., 0.2, 0.3. 0.4, 0.5, 0.9, 1.0%
- compositions typically intends a combination of the active agent and another carrier, e.g., compound or composition, inert (for example, a detectable agent or label) or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers.
- another carrier e.g., compound or composition, inert (for example, a detectable agent or label) or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers.
- Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, terra-, and oligosaccharides; derivatized sugars such as alditols, aldonic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in combination 1-99.99% by weight or volume.
- Exemplary protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like.
- amino acid/antibody components which can also function in a buffering capacity, include alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like.
- Carbohydrate excipients are also intended within the scope of this invention, examples of which include but are not limited to monosaccharides such as fructose, maltose, galactose, glucose, D- mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffmose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and myoinositol.
- monosaccharides such as fructose, maltose, galactose, glucose, D- mannose, sorbose, and the like
- disaccharides such as lactose, sucrose,
- the term carrier further includes a buffer or a pH adjusting agent; typically, the buffer is a salt prepared from an organic acid or base.
- Representative buffers include organic acid salts such as salts of citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid, or phthalic acid; Tris, tromethamine hydrochloride, or phosphate buffers.
- Additional carriers include polymeric excipients/additives such as polyvinylpyrrolidones, ficolls (a polymeric sugar), dextrates (e.g., cyclodextrins, such as 2-hydroxypropyl-. quadrature. - cyclodextrin), polyethylene glycols, flavoring agents, antimicrobial agents, sweeteners, antioxidants, antistatic agents, surfactants (e.g., polysorbates such as "TWEEN 20" and
- TWEEN 80 lipids (e.g., phospholipids, fatty acids), steroids (e.g., cholesterol), and chelating agents (e.g., EDTA).
- lipids e.g., phospholipids, fatty acids
- steroids e.g., cholesterol
- chelating agents e.g., EDTA
- the term "pharmaceutically acceptable carrier” encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents.
- the compositions also can include stabilizers and preservatives and any of the above noted carriers with the additional provisio that they be acceptable for use in vivo.
- stabilizers and adjuvants see Martin REMINGTON'S PHARM. SCI., 15th Ed. (Mack Publ. Co., Easton (1975) and Williams & Williams, (1995), and in the "PHYSICIAN'S DESK REFERENCE", 52 nd ed., Medical Economics, Montvale, N.J. (1998).
- capecitabine/docetaxel the "Cooper regimen” fluorouracil-levamisole, fluorouracil-leucovorin, fluorouracil/oxaliplatin, methotrexate-leucovorin, and the like.
- Combinations of chemotherapies and molecular targeted therapies, biologic therapies, and radiation therapies are also well known to the art; including therapies such as trastuzumab plus paclitaxel, alone or in further combination with platinum compounds such as oxaliplatin, for certain breast cancers, and many other such regimens for other cancers; and the "Dublin regimen” 5-fluorouracil IV over 16 hours on days 1-5 and 75 mg/m cisplatin IV or oxaliplatin over 8 hours on day 7, with repetition at 6 weeks, in combination with 40 Gy radiotherapy in 15 fractions over the first 3 weeks) and the "Michigan regimen” (fluorouracil plus cisplatin or oxaliplatin plus vinblastine plus radiotherapy), both for esophageal cancer, and many other such regimens for other cancers, including colorectal cancer.
- therapies such as trastuzumab plus paclitaxel, alone or in further combination with platinum compounds such as oxaliplatin, for certain breast cancers, and many
- the method for treating a patient comprises, or alternatively consists essentially of, or yet further consists of surgical resection of a metastatic or non-metastatic solid malignant tumor and, in some aspects, in combination with radiation.
- the invention provides an article of manufacture, comprising packaging material and at least one vial comprising a solution of the chemotherapy as described herein and/or or at least one antibody or its biological equivalent with the prescribed buffers and/or preservatives, optionally in an aqueous diluent, wherein said packaging material comprises a label that indicates that such solution can be held over a period of 1, 2, 3, 4, 5, 6, 9, 12, 18, 20, 24, 30, 36,40, 48, 54, 60, 66, 72 hours or greater.
- the invention further comprises an article of manufacture, comprising packaging material, a first vial comprising the chemotherapy and/or at least one lyophilized antibody or its biological equivalent and a second vial comprising an aqueous diluent of prescribed buffer or preservative, wherein said packaging material comprises a label that instructs a patient to reconstitute the therapeutic in the aqueous diluent to form a solution that can be held over a period of twenty- four hours or greater.
- the antibody or equivalent thereof is prepared to a concentration includes amounts yielding upon reconstitution, if in a wet/dry system,
- concentrations from about 1.0 ⁇ g/ml to about 1000 mg/ml, although lower and higher concentrations are operable and are dependent on the intended delivery vehicle, e.g., solution formulations will differ from transdermal patch, pulmonary, transmucosal, or osmotic or micro pump methods.
- Chemotherapeutic formulations of the present invention can be prepared by a process which comprises mixing at least one antibody or biological equivalent and a preservative selected from the group consisting of phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, alkylparaben, (methyl, ethyl, propyl, butyl and the like), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate and thimerosal or mixtures thereof in an aqueous diluent.
- a preservative selected from the group consisting of phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, alkylparaben, (methyl, ethyl, propyl, butyl and the like), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate and thimerosal or mixtures thereof in an
- a measured amount of at least one antibody in buffered solution is combined with the desired preservative in a buffered solution in quantities sufficient to provide the antibody and preservative at the desired concentrations.
- Variations of this process would be recognized by one of skill in the art, e.g., the order the components are added, whether additional additives are used, the temperature and pH at which the formulation is prepared, are all factors that can be optimized for the
- compositions and formulations can be provided to patients as clear solutions or as dual vials comprising a vial of lyophilized antibody that is reconstituted with a second vial containing the aqueous diluent.
- Either a single solution vial or dual vial requiring reconstitution can be reused multiple times and can suffice for a single or multiple cycles of patient treatment and thus provides a more convenient treatment regimen than currently available.
- Recognized devices comprising these single vial systems include those pen-injector devices for delivery of a solution such as BD Pens, BD Autojectore, Humaject® NovoPen®, B-D®Pen, AutoPen®, and OptiPen®, GenotropinPen®, Genotronorm Pen®, Humatro Pen®, Reco-Pen®, Roferon Pen®, Biojector®, iject®, J-tip Needle-Free Injector®, Intraject®, Medi-Ject®, e.g., as made or developed by Becton Dickensen (Franklin Lakes, N.J.
- chemotherapeutic agent of the invention e.g., encapsulation in liposomes, microparticles, microcapsules, expression by recombinant cells, receptor-mediated endocytosis. See e.g., Wu and Wu (1987) J. Biol. Chem. 262:4429-4432 for construction of a therapeutic nucleic acid as part of a retroviral or other vector, etc.
- Methods of delivery include but are not limited to intra-arterial, intramuscular, intravenous, intranasal and oral routes.
- agents identified herein as effective for their intended purpose can be administered to subjects or individuals identified by the methods herein as suitable for the therapy.
- Therapeutic amounts can be empirically determined and will vary with the pathology being treated, the subject being treated and the efficacy and toxicity of the agent.
- a medicament comprising an effective amount of a chemotherapeutic as described herein for treatment of a human cancer patient having high or low gene expression or the polymorphism of the gene of interest as identified in the experimental examples.
- Kits [0166] As set forth herein, the invention provides diagnostic methods for determining the polymorphic region or expression level of the gene of interest. In some embodiments, the methods use probes or primers comprising nucleotide sequences which are complementary to the gene of interest. Accordingly, the invention provides kits for performing these methods as well as instructions for carrying out the methods of this invention such as collecting tissue and/or performing the screen, and/or analyzing the results, and/or administration of an effective amount of a selected therapy.
- the invention provides a kit for determining whether a subject is likely responsive to cancer treatment or alternatively one of various treatment options.
- the kits contain one of more of the compositions described above and instructions for use.
- the invention also provides kits for determining response to cancer treatment containing a first and a second oligonucleotide specific for the polymorphic region of the gene. Oligonucleotides "specific for" the gene of interest bind either to the gene of interest or bind adjacent to the gene of interest. For oligonucleotides that are to be used as primers for amplification, primers are adjacent if they are sufficiently close to be used to produce a polynucleotide comprising the gene of interest.
- oligonucleotides are adjacent if they bind within about 1-2 kb, and preferably less than 1 kb from the gene of interest. Specific oligonucleotides are capable of hybridizing to a sequence, and under suitable conditions will not bind to a sequence differing by a single nucleotide.
- the kit can comprise at least one probe or primer which is capable of specifically hybridizing to the gene of interest and instructions for use.
- the kits preferably comprise at least one of the above described nucleic acids.
- Preferred kits for amplifying at least a portion of the gene of interest comprise two primers, at least one of which is capable of hybridizing to the allelic variant sequence.
- Such kits are suitable for detection of genotype by, for example, fluorescence detection, by electrochemical detection, or by other detection.
- Oligonucleotides whether used as probes or primers, contained in a kit can be detectably labeled. Labels can be detected either directly, for example for fluorescent labels, or indirectly. Indirect detection can include any detection method known to one of skill in the art, including biotin-avidin interactions, antibody binding and the like. Fluorescently labeled oligonucleotides also can contain a quenching molecule. Oligonucleotides can be bound to a surface. In one embodiment, the preferred surface is silica or glass. In another embodiment, the surface is a metal electrode. [0170] Yet other kits of the invention comprise at least one reagent necessary to perform the assay. For example, the kit can comprise an enzyme. Alternatively the kit can comprise a buffer or any other necessary reagent.
- test samples used in the diagnostic kits include cells, protein or membrane extracts of cells, or biological fluids such as sputum, blood, serum, plasma, or urine.
- the test samples may also be a tumor cell, a normal cell adjacent to a tumor, a normal cell corresponding to the tumor tissue type, a blood cell, a peripheral blood lymphocyte, or combinations thereof.
- the test sample used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing protein extracts or membrane extracts of cells are known in the art and can be readily adapted in order to obtain a sample which is compatible with the system utilized.
- Conditions for incubating a nucleic acid probe with a test sample depend on the format employed in the assay, the detection methods used, and the type and nature of the nucleic acid probe used in the assay.
- One skilled in the art will recognize that any one of the commonly available hybridization, amplification or immunological assay formats can readily be adapted to employ the nucleic acid probes for use in the present invention. Examples of such assays can be found in Chard, T. (1986) AN INTRODUCTION TO RADIOIMMUNOASSAY AND
- test samples used in the diagnostic kits include cells, protein or membrane extracts of cells, or biological fluids such as sputum, blood, serum, plasma, or urine.
- the test sample used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing protein extracts or membrane extracts of cells are known in the art and can be readily adapted in order to obtain a sample which is compatible with the system utilized.
- kits can include all or some of the positive controls, negative controls, reagents, primers, sequencing markers, probes and antibodies described herein for determining the subject's genotype in the polymorphic region of the gene of interest.
- these suggested kit components may be packaged in a manner customary for use by those of skill in the art.
- these suggested kit components may be provided in solution or as a liquid dispersion or the like.
- the identification of the polymorphic region or the expression level of the gene of interest can also be useful for identifying an individual among other individuals from the same species.
- DNA sequences can be used as a fingerprint for detection of different individuals within the same species. Thompson, J. S. and Thompson, eds., (1991) GENETICS IN MEDICINE, W B Saunders Co., Philadelphia, Pa. This is useful, e.g., in forensic studies.
- LMTK3 is an estrogen receptor a (ERa) regulator. Recent studies show that
- rs808419(r8) and rs9989661(r9)] and LMTK3 expression are prognostic in breast and colon cancers. It was prevsiously demonstrated that r9AA is associated with shorter time to recurrence in Caucasian(C) and Hispanic(H) females(F) with GAC. Applicant investigated the significance of LMTK3 polymorphism in Japanese (J) patients with GAC.
Abstract
The invention provides compositions and methods for determining the likelihood of successful treatment with various treatment regimens available to gastrointestinal cancer patients, wherein the determining of the likelihood comprises determining the genotype of the patient for the LMTK3 rs9989661 (r9) allele and the patient is Japanese. After determining if a patient is likely to be successfully treated, the invention also provides methods for treating these patients.
Description
LMTK3 GENOTYPE ANALYSIS FOR USE IN PREDICTING OUTCOME AND
THERAPY SELECTION
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 61/647,448, filed May 15, 2012, the contents of which is incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
[0002] In nature, organisms of the same species usually differ from each other in some aspects, e.g., their appearance. The differences are genetically determined and are referred to as polymorphism. Genetic polymorphism is the occurrence in a population of two or more genetically determined alternative phenotypes due to different alleles. Polymorphism can be observed at the level of the whole individual (phenotype), in variant forms of proteins and blood group substances (biochemical polymorphism), morphological features of chromosomes (chromosomal polymorphism) or at the level of DNA in differences of nucleotides (DNA polymorphism).
[0003] Polymorphism also plays a role in determining differences in an individual's response to drugs. Pharmacogenetics and pharmacogenomics are multidisciplinary research efforts to study the relationship between genotype, gene expression profiles, and phenotype, as expressed in variability between individuals in response to or toxicity from drugs. Indeed, it is now known that cancer chemotherapy is limited by the predisposition of specific populations to drug toxicity or poor drug response. For a review of the use of germline polymorphisms in clinical oncology, see Lenz (2004) J. Clin. Oncol. 22(13):2519-2521; Park et al. (2006) Curr. Opin. Pharma.
6(4):337-344; Zhang et al. (2006) Pharma. and Genomics 16(7):475-483 and U.S. Patent Publ. No. 2006/0115827. For a review of pharmaco genetic and pharmacogenomics in therapeutic antibody development for the treatment of cancer, see Yan and Beckman (2005) Biotechniques 39:565-568.
[0004] The expression level of a variety of genes also have been linked to cancer prognosis and treatment protocol selection. Microarray gene expression profiling has been used to predict the prognosis of patients suffering from cancers including colon cancer, breast cancer, lung cancer and lymphomas. Barrier et al. (2005) Oncogene 24:6155-6164. Tumor tissue in these cancers have been shown to have both overexpression and underexpression of prognostic predictive genes. Furthermore, not only the tumor tissue itself can be predictive, but tumor-
adjacent normal tissue has been show to predict tumor recurrence in patients suffering from rectal cancer treated with adjuvant chemoradiation. Schneider et al. (2006) Pharmacogenetics and Genomics 16(8):555-563. One recent study (Yang et al. (2006) Clinical Colorectal Cancer 6(4): 305 -311) showed that gene expression levels of EGFR, Survivin and VEGF in tumor tissue were predictive markers for lymph node involvement in patients with locally advanced rectal cancer treated with surgical resection and adjuvant chemoradiation therapy.
[0005] Although considerable research correlating gene expression and/or polymorphisms has been reported, much work remains to be done. This invention supplements the existing body of knowledge and provides related advantages as well.
SUMMARY
[0006] Disclosed herein is a method for treating a Japanese gastrointestinal cancer patient selected for a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, administration of an effective amount of an adjuvant chemotherapy regimen or equivalent thereof, wherein the patient is selected for the therapy based on the determination of a genotype of A/G or A/G for LMTK3 rs9989661 (r9) (A/G), thereby treating the patient. In one aspect, the patient is a male patient. In another aspect, the patient is a female patient.
[0007] A method for treating a Japanese gastrointestinal cancer patient selected for a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, administration of an effective amount of an aggressive chemotherapy regimen, wherein the patient is selected for the therapy based on the determination of a genotype of A/A for LMTK3 rs9989661 (r9) (A/G) in a sample isolated from the patient, thereby treating the patient. In one aspect, the patient is a male patient. In another aspect, the patient is a female patient.
[0008] In one aspect, a method is provided for aiding in the determination of and/or identifying a Japanese gastrointestinal cancer patient that is likely or less likely to show responsiveness to a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, adjuvant chemotherapy, comprising, or alternatively consisting esstenially of, or yet further consisting of, screening a patient cell or tissue sample for the genotype of LMTK3 rs9989661 (r9) (A/G), wherein a genotype of A/G or A/G identifies or determines that the patient is likely to show responsiveness, and A/G identifies or determines tha the patient is not likely to show responsiveness to the therapy. In one aspect the patient is a female. In another aspect, the patient is a male.
[0009] A method also is disclosed for aiding in the determination of and/or identifying a Japanese gastrointestinal cancer patient that is likely to require aggressive therapy, comprising, or alternatively consisting essentially of, or yet futher consisting of, screening a patient cell or tissue sample for the genotype of LMTK3 rs9989661 (r9) (A/G), wherein a genotype of A/A identifies or determines that the patient is likely to require aggressive therapy, and G/G or A/G identifies or determines that the patient is not likely to require as aggressive therapy. In one aspect the patient is a female. In another aspect, the patient is a male.
[0010] In the methods disclosed herein, the gastrointestinal cancer is a metastatic or non- metastatic (localized) cancer selected from the group of gastric adenocarcinoma, rectal cancer colorectal cancer, colon cancer, gastric cancer or esophageal cancer.
DETAILED DESCRIPTION
[0011] Throughout this disclosure, various publications, patents and published patent specifications are referenced by an identifying citation. The disclosures of these publications, patents and published patent specifications are hereby incorporated by reference into the present disclosure to more fully describe the state of the art to which this invention pertains.
[0012] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature for example in the following publications. See, e.g., Sambrook and Russell eds. MOLECULAR CLONING: A LABORATORY MANUAL, 3rd edition (2001); the series CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel et al. eds. (2007)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc., N.Y.); PCR 1 : A PRACTICAL APPROACH (M. MacPherson et al. IRL Press at Oxford University Press (1991)); PCR 2: A PRACTICAL APPROACH (M.J. MacPherson, B.D. Hames and G.R. Taylor eds. (1995)); ANTIBODIES, A LABORATORY MANUAL (Harlow and Lane eds. (1999)); CULTURE OF ANIMAL CELLS: A MANUAL OF BASIC TECHNIQUE (R.I. Freshney 5th edition (2005)); OLIGONUCLEOTIDE SYNTHESIS (M. J. Gait ed. (1984)); Mullis et al. U.S. Patent No. 4,683,195; NUCLEIC ACID HYBRIDIZATION (B. D. Hames & S. J. Higgins eds. (1984)); NUCLEIC ACID HYBRIDIZATION (M.L.M. Anderson (1999)); TRANSCRIPTION AND TRANSLATION (B. D. Hames & S. J. Higgins eds. (1984)); IMMOBILIZED CELLS AND ENZYMES (IRL Press (1986)); B. Perbal, A PRACTICAL GUIDE TO MOLECULAR CLONING (1984); GENE TRANSFER VECTORS FOR MAMMALIAN CELLS (J. H. Miller
and M. P. Calos eds. (1987) Cold Spring Harbor Laboratory); GENE TRANSFER AND
EXPRESSION IN MAMMALIAN CELLS (S.C. Makrides ed. (2003)) IMMUNOCHEMICAL METHODS IN CELL AND MOLECULAR BIOLOGY (Mayer and Walker, eds., Academic Press, London (1987)); WEIR'S HANDBOOK OF EXPERIMENTAL IMMUNOLOGY (L.A. Herzenberg et al. eds (1996)).
Definitions
[0013] As used herein, certain terms may have the following defined meanings. As used in the specification and claims, the singular form "a," "an" and "the" include singular and plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes a single cell as well as a plurality of cells, including mixtures thereof.
[0014] As used herein, the term "comprising" is intended to mean that the compositions and methods include the recited elements, but not excluding others. "Consisting essentially of when used to define compositions and methods, shall mean excluding other elements of any essential significance to the composition or method. "Consisting of shall mean excluding more than trace elements of other ingredients for claimed compositions and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this invention. Accordingly, it is intended that the methods and compositions can include additional steps and components (comprising) or alternatively including steps and compositions of no significance (consisting essentially of) or alternatively, intending only the stated method steps or
compositions (consisting of).
[0015] All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied ( + ) or ( - ) by increments of 0.1. It is to be understood, although not always explicitly stated that all numerical designations are preceded by the term "about". The term "about" also includes the exact value "X" in addition to minor increments of "X" such as "X + 0.1" or "X - 0.1." It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.
[0016] The term "determining" or "identify" or "identifying" is to associate or affiliate a patient closely to a group or population of patients who likely experience the same or a similar clinical response to treatment.
[0017] Bevacizumab (BV) is sold under the trade name Avastin by Genentech. It is a humanized monoclonal antibody that binds to and inhibits the biologic activity of human vascular endothelial growth factor (VEGF). Biological equivalent antibodies are identified herein as modified antibodies which bind to the same epitope of the antigen, prevent the interaction of VEGF to its receptors (FltOl, KDR a.k.a. VEGFR2) and produce a substantially equivalent response, e.g., the blocking of endothelial cell proliferation and angiogenesis.
Equivalents to BV include Ranibizumab (Lucentis, anti-VEGF antibody), an affinity-matured antibody Fab domain approved for use in age-related macular degeneration (AMD). In clinical trials and as FDA-approved therapeutics, these two anti-VEGF antibodies, bevacizumab (Avastin, anti-VEGF antibody) and ranibizumab (Lucentis, anti-VEGF antibody), have demonstrated therapeutic utility in blocking VEGF-induced angiogenesis.
[0018] Fluorouracil (5-FU) belongs to the family of therapy drugs call pyrimidine based antimetabolites. It is a pyrimidine analog, which is transformed into different cytotoxic metabolites that are then incorporated into DNA and RNA thereby inducing cell cycle arrest and apoptosis. Chemical equivalents are pyrimidine analogs which result in disruption of DNA replication. Chemical equivalents inhibit cell cycle progression at S phase resulting in the disruption of cell cycle and consequently apoptosis. Equivalents to 5-FU include prodrugs, analogs and derivative thereof such as 5'-deoxy-5-fluorouridine (doxifluroidine), l-tetrahydrofuranyl-5 -fluorouracil (ftorafur), Capecitabine (Xeloda), S-l (MBMS-247616, consisting of tegafur and two modulators, a 5-chloro-2,4-dihydroxypyridine and potassium oxonate), ralititrexed (tomudex), nolatrexed (Thymitaq, AG337), LY231514 and ZD9331, as described for example in
Papamicheal (1999) The Oncologist 4:478-487.
[0019] Capecitabine is a prodrug of (5-FU) that is converted to its active form by the tumor- specific enzyme PynPase following a pathway of three enzymatic steps and two intermediary metabolites, 5'-deoxy-5-fluorocytidine (5'-DFCR) and 5'-deoxy-5-fluorouridine (5'-DFUR). Capecitabine is marketed by Roche under the trade name Xeloda®.
[0020] Leucovorin (Folinic acid) is an adjuvant used in cancer therapy. It is used in synergistic combination with 5-FU to improve efficacy of the chemotherapeutic agent. Without being bound by theory, addition of Leucovorin is believed to enhance efficacy of 5-FU by inhibiting thymidylate synthase. It has been used as an antidote to protect normal cells from high doses of the anticancer drug methotrexate and to increase the antitumor effects of fluorouracil (5-FU) and tegafur-uracil. It is also known as citrovorum factor and Wellcovorin.
This compound has the chemical designation of L-Glutamic acid N[4[[(2amino-5-formyl- l,4,5,6,7,8hexahydro4oxo6-pteridinyl)methyl]amino]benzoyl], calcium salt (1 : 1).
[0021] "Oxaliplatin" (Eloxatin®) is a platinum-based chemotherapy drug in the same family as cisplatin and carboplatin. It is typically administered in combination with fluorouracil and leucovorin in a combination known as FOLFOX for the treatment of colorectal cancer.
Compared to cisplatin the two amine groups are replaced by cyclohexyldiamine for improved antitumour activity. The chlorine ligands are replaced by the oxalato bidentate derived from oxalic acid in order to improve water solubility. Equivalents to Oxaliplatin are known in the art and include without limitation cisplatin, carboplatin, aroplatin, lobaplatin, nedaplatin, and JM- 216 (see McKeage et al. (1997) J. Clin. Oncol. 201:1232-1237 and in general,
CHEMOTHERAPY FOR GYNECOLOGICAL NEOPLASM, CURRENT THERAPY AND NOVEL APPROACHES, in the Series Basic and Clinical Oncology, Angioli et al. Eds., 2004).
[0022] "FOLFOX" is an abbreviation for a type of combination therapy that is used to treat colorectal cancer. This therapy includes 5-FU, oxaliplatin and leucovorin. FOLFOX4 is a specific FOLFOX chemotherapy regimen known in the art and described herein. Information regarding these treatments are available on the National Cancer Institute's web site, cancer.gov, last accessed on January 16, 2008.
[0023] "FOLFOX/BV" is an abbreviation for a type of combination therapy that is used to treat colorectal cancer. This therapy includes 5-FU, oxaliplatin, leucovorin and Bevacizumab. Furthermore, "XELOX/BV" is another combination therapy used to treat colorectal cancer, which includes the prodrug to 5-FU, known as Capecitabine (Xeloda) in combination with oxaliplatin and bevacizumab. Information regarding these treatments are available on the National Cancer Institute's web site, cancer.gov or from the National Comprehensive Cancer Network's web site, nccn.org, last accessed on May 27, 2008.
[0024] PTK/ZK is a "small" molecule tyrosine kinase inhibitor with broad specificity that targets all VEGF receptors (VEGFR), the platelet-derived growth factor (PDGF) receptor, c-KIT and c-Fms. Drevs (2003) Idrugs 6(8):787-794. PTK/ZK is a targeted drug that blocks angiogenesis and lymphangio genesis by inhibiting the activity of all known receptors that bind VEGF including VEGFR- 1 (Flt-1), VEGFR-2 (KDR/Flk-1) and VEGFR- 3 (Flt-4). The chemical names of PTK/ZK are l-[4-Chloroanilino]-4-[4-pyridylmethyl]phthalazine Succinate or 1-Phthalazinamine, N-(4-chlorophenyl)-4-(4-pyridinylmethyl)-, butanedioate (1 : 1).
Synonyms and analogs of PTK/ZK are known as Vatalanib, CGP79787D, PTK787/ZK 222584,
CGP-79787, DE-00268, PTK-787, PTK-787A, VEGFR-TK inhibitor, ZK 222584 and ZK 232934.
[0025] Irinotecan (CPT-11) is sold under the trade name of Camptosar®. It is a semi-synthetic analogue of the alkaloid camptothecin, which is activated by hydrolysis to SN-38 and targets topoisomerase I. Chemical equivalents are those that inhibit the interaction of topoisomerase I and DNA to form a catalytically active topoisomerase I-DNA complex. Chemical equivalents inhibit cell cycle progression at G2-M phase resulting in the disruption of cell proliferation.
[0026] "5-FU adjuvant therapy" refers to the combination of 5-FU with other treatments, such as without limitation, radiation, methyl-CCNU, Leucovorin, Oxaliplatin, irinotecin, mitomycin, cytarabine, levamisole. Specific treatment adjuvant regimens are known in the art as FOLFOX, FOLFOX4, MOF (semustine (methyl-CCNU), vincrisine (Oncovin) and 5-FU). For a review of these therapies see Beaven and Goldberg (2006) Oncology 20(5):461-460. An example of such is an effective amount of 5-FU and Leucovorin. Other chemotherapeutics can be added, e.g., Oxaliplatin.
[0027] The phrase "first line" or "second line" refers to the order of treatment received by a patient. First line therapy regimens are treatments given first, whereas second or third line therapy are given after the first line therapy or after the second line therapy, respectively. The National Cancer Institute defines first line therapy as "the first treatment for a disease or condition. In patients with cancer, primary treatment can be surgery, chemotherapy, radiation therapy, or a combination of these therapies. First line therapy is also referred to those skilled in the art as primary therapy and primary treatment." See National Cancer Institute website as www.cancer.gov, last visited on May 1, 2008. Typically, a patient is given a subsequent chemotherapy regimen because the patient did not shown a positive clinical or sub-clinical response to the first line therapy or the first line therapy has stopped.
[0028] The term "adjuvant" chemotherapy refers to administration of a therapy or
chemotherapeutic regimen to a patient after removal of a tumor by surgery. Adjuvant chemotherapy is typically given to minimize or prevent a possible cancer reoccurrence.
Alternatively, "neoadjuvant" chemotherapy refers to administration of therapy or
chemotherapeutic regimen before surgery, typically in an attempt to shrink the tumor prior to a surgical procedure to minimize the extent of tissue removed during the procedure.
[0029] In one aspect, the "biological equivalent" means the ability of the antibody to selectively bind its epitope protein or fragment thereof as measured by ELISA or other suitable
methods. Biologically equivalent antibodies include, but are not limited to, those antibodies, peptides, antibody fragments, antibody variant, antibody derivative and antibody mimetics that bind to the same epitope as the reference antibody. An example of an equivalent Bevacizumab antibody is one which binds to and inhibits the biologic activity of human vascular endothelial growth factor (VEGF).
[0030] In one aspect, the "chemical equivalent" means the ability of the chemical to selectively interact with its target protein, DNA, RNA or fragment thereof as measured by the inactivation of the target protein, incorporation of the chemical into the DNA or RNA or other suitable methods. Chemical equivalents include, but are not limited to, those agents with the same or similar biological activity and include, without limitation a pharmaceutically acceptable salt or mixtures thereof that interact with and/or inactivate the same target protein, DNA, or RNA as the reference chemical.
[0031] The phrase "aggressive cancer treatment" refers to the cancer treatment, combination of treatments, or a chemotherapy regimen that is effective for treating the target cancer tumor or cell, but is associated with or known to cause higher toxicity, more side effects or is known in the art to be less efficacious than another type of treatment for the specified cancer type. One of skill in the art will be able to determine if a cancer treatment, combination of treatments, or chemotherapy regimen is less, more, or most aggressive. For example, a less aggressive treatment for a colon cancer patient may include adjuvant chemotherapy comprising surgical resection of the primary tumor and a chemotherapy regimen comprising 5-FU, leucovorin and bevacizumab. While a more aggressive cancer treatment may include adjuvant chemotherapy comprising surgical resection and a chemotherapy regimen comprising FOLFOX and BV, whereas the most aggressive cancer treatment may include surgical resection and a
chemotherapy regime comprising Irinotecan and Cetuximab.
[0032] The term "antigen" is well understood in the art and includes substances which are immunogenic. VEGF is an example of an antigen.
[0033] A "native" or "natural" or "wild-type" antigen is a polypeptide, protein or a fragment which contains an epitope and which has been isolated from a natural biological source. It also can specifically bind to an antigen receptor.
[0034] As used herein, an "antibody" includes whole antibodies and any antigen binding fragment or a single chain thereof. Thus the term "antibody" includes any protein or peptide containing molecule that comprises at least a portion of an immunoglobulin molecule.
Examples of such include, but are not limited to a complementarity determining region (CDR) of a heavy or light chain or a ligand binding portion thereof, a heavy chain or light chain variable region, a heavy chain or light chain constant region, a framework (FR) region, or any portion thereof, or at least one portion of a binding protein, any of which can be incorporated into an antibody of the present invention.
[0035] If an antibody is used in combination with the above -noted chemotherapy or for diagnosis or as an alternative to the chemotherapy, the antibodies can be polyclonal or monoclonal and can be isolated from any suitable biological source, e.g., murine, rat, sheep and canine. Additional sources are identified infra.
[0036] The term "antibody" is further intended to encompass digestion fragments, specified portions, derivatives and variants thereof, including antibody mimetics or comprising portions of antibodies that mimic the structure and/or function of an antibody or specified fragment or portion thereof, including single chain antibodies and fragments thereof. Examples of binding fragments encompassed within the term "antigen binding portion" of an antibody include a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH, domains; a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment consisting of the VH and CH, domains; a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, a dAb fragment (Ward et al. (1989) Nature 341:544-546), which consists of a VH domain; and an isolated complementarity determining region (CDR). Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv)). Bird et al. (1988) Science 242:423-426 and Huston et al. (1988) Proc. Natl. Acad Sci. USA 85:5879-5883. Single chain antibodies are also intended to be encompassed within the term "fragment of an antibody." Any of the above-noted antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for binding specificity and
neutralization activity in the same manner as are intact antibodies.
[0037] The term "epitope" means a protein determinant capable of specific binding to an antibody. Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. Conformational and
nonconformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.
[0038] The term "antibody variant" is intended to include antibodies produced in a species other than a mouse. It also includes antibodies containing post-translational modifications to the linear polypeptide sequence of the antibody or fragment. It further encompasses fully human antibodies.
[0039] The term "antibody derivative" is intended to encompass molecules that bind an epitope as defined above and which are modifications or derivatives of a native monoclonal antibody of this invention. Derivatives include, but are not limited to, for example, bispecific, multispecific, heterospecific, trispecific, tetraspecific, multispecific antibodies, diabodies, chimeric, recombinant and humanized.
[0040] The term "bispecific molecule" is intended to include any agent, e.g., a protein, peptide, or protein or peptide complex, which has two different binding specificities. The term "multispecific molecule" or "heterospecific molecule" is intended to include any agent, e.g. a protein, peptide, or protein or peptide complex, which has more than two different binding specificities.
[0041] The term "heteroantibodies" refers to two or more antibodies, antibody binding fragments (e.g., Fab), derivatives thereof, or antigen binding regions linked together, at least two of which have different specificities.
[0042] The term "human antibody" as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of the invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). However, the term "human antibody" as used herein, is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences. Thus, as used herein, the term "human antibody" refers to an antibody in which substantially every part of the protein (e.g., CDR, framework, CL, CH domains (e.g., CHI , Cm, Cm), hinge, (VL, VH)) is substantially non-immunogenic in humans, with only minor sequence changes or variations. Similarly, antibodies designated primate (monkey, baboon, chimpanzee, etc.), rodent (mouse, rat, rabbit, guinea pig, hamster, and the like) and other mammals designate such species, sub-genus, genus, sub-family, family specific antibodies.
Further, chimeric antibodies include any combination of the above. Such changes or variations optionally and preferably retain or reduce the immunogenicity in humans or other species relative to non-modified antibodies. Thus, a human antibody is distinct from a chimeric or humanized antibody. It is pointed out that a human antibody can be produced by a non-human animal or prokaryotic or eukaryotic cell that is capable of expressing functionally rearranged human immunoglobulin (e.g., heavy chain and/or light chain) genes. Further, when a human antibody is a single chain antibody, it can comprise a linker peptide that is not found in native human antibodies. For example, an Fv can comprise a linker peptide, such as two to about eight glycine or other amino acid residues, which connects the variable region of the heavy chain and the variable region of the light chain. Such linker peptides are considered to be of human origin.
[0043] As used herein, a human antibody is "derived from" a particular germline sequence if the antibody is obtained from a system using human immunoglobulin sequences, e.g., by immunizing a transgenic mouse carrying human immunoglobulin genes or by screening a human immunoglobulin gene library. A human antibody that is "derived from" a human germline immunoglobulin sequence can be identified as such by comparing the amino acid sequence of the human antibody to the amino acid sequence of human germline
immunoglobulins. A selected human antibody typically is at least 90% identical in amino acids sequence to an amino acid sequence encoded by a human germline immunoglobulin gene and contains amino acid residues that identify the human antibody as being human when compared to the germline immunoglobulin amino acid sequences of other species (e.g., murine germline sequences). In certain cases, a human antibody may be at least 95%, or even at least 96%, 97%, 98%), or 99%) identical in amino acid sequence to the amino acid sequence encoded by the germline immunoglobulin gene. Typically, a human antibody derived from a particular human germline sequence will display no more than 10 amino acid differences from the amino acid sequence encoded by the human germline immunoglobulin gene. In certain cases, the human antibody may display no more than 5, or even no more than 4, 3, 2, or 1 amino acid difference from the amino acid sequence encoded by the germline immunoglobulin gene.
[0044] The terms "monoclonal antibody" or "monoclonal antibody composition" as used herein refer to a preparation of antibody molecules of single molecular composition. A monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
[0045] A "human monoclonal antibody" refers to antibodies displaying a single binding specificity which have variable and constant regions derived from human germline
immunoglobulin sequences.
[0046] The term "recombinant human antibody", as used herein, includes all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom, antibodies isolated from a host cell transformed to express the antibody, e.g., from a transfectoma, antibodies isolated from a recombinant, combinatorial human antibody library, and antibodies prepared, expressed, created or isolated by any other means that involve splicing of human immunoglobulin gene sequences to other DNA sequences. Such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.
[0047] As used herein, "isotype" refers to the antibody class (e.g., IgM or IgGl) that is encoded by heavy chain constant region genes.
[0048] The term "allele," which is used interchangeably herein with "allelic variant" refers to alternative forms of a gene or portions thereof. Alleles occupy the same locus or position on homologous chromosomes. When a subject has two identical alleles of a gene, the subject is said to be homozygous for the gene or allele. When a subject has two different alleles of a gene, the subject is said to be heterozygous for the gene. Alleles of a specific gene can differ from each other in a single nucleotide, or several nucleotides, and can include substitutions, deletions and insertions of nucleotides. An allele of a gene can also be a form of a gene containing a mutation.
[0049] The terms "protein", "polypeptide" and "peptide" are used interchangeably herein when referring to a gene product.
[0050] The term "recombinant protein" refers to a polypeptide which is produced by recombinant DNA techniques, wherein generally, DNA encoding the polypeptide is inserted into
a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein.
[0051] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Preferred vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer generally to circular double stranded DNA loops which, in their vector form are not bound to the
chromosome. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
[0052] The term "genetic marker" refers to an allelic variant of a polymorphic region of a gene of interest and/or the expression level of a gene of interest.
[0053] The term "wild-type allele" refers to an allele of a gene which, when present in two copies in a subject results in a wild-type phenotype. There can be several different wild-type alleles of a specific gene, since certain nucleotide changes in a gene may not affect the phenotype of a subject having two copies of the gene with the nucleotide changes.
[0054] The term "polymorphism" refers to the coexistence of more than one form of a gene or portion thereof. A portion of a gene of which there are at least two different forms, i.e., two different nucleotide sequences, is referred to as a "polymorphic region of a gene." A
polymorphic region can be a single nucleotide, the identity of which differs in different alleles.
[0055] A "polymorphic gene" refers to a gene having at least one polymorphic region.
[0056] The term "allelic variant of a polymorphic region of the gene of interest" refers to a region of the gene of interest having one of a plurality of nucleotide sequences found in that region of the gene in other individuals.
[0057] The term "genotype" refers to the specific allelic composition of an entire cell or a certain gene and in some aspects a specific polymorphism associated with that gene, whereas the term "phenotype' refers to the detectable outward manifestations of a specific genotype.
[0058] As used herein, the term "gene" or "recombinant gene" refers to a nucleic acid molecule comprising an open reading frame and including at least one exon and (optionally) an intron sequence. The term "intron" refers to a DNA sequence present in a given gene which is spliced out during mR A maturation.
[0059] "Expression" as applied to a gene, refers to the differential production of the mRNA transcribed from the gene or the protein product encoded by the gene. A differentially expressed gene may be over expressed (high expression) or under expressed (low expression) as compared to the expression level of a normal or control cell, a given patient population or with an internal control gene (house keeping gene). In one aspect, it refers to a differential that is about 1.5 times, or alternatively, about 2.0 times, alternatively, about 2.0 times, alternatively, about 3.0 times, or alternatively, about 5 times, or alternatively, about 10 times, alternatively about 50 times, or yet further alternatively more than about 100 times higher or lower than the expression level detected in a control sample.
[0060] A "internal control" or "house keeping" gene refers to any constitutively or globally expressed gene whose presence enables an assessment of the gene of interests expression level. Such an assessment comprises a determination of the overall constitutive level of gene transcription and a control for variation in sampling error. Examples of such genes include, but are not limited to, β-actin, the transferring receptor gene, GAPDH gene or equivalents thereof. In one aspect of the invention, the internal control gene is β-actin.
[0061] "Cells," "host cells" or "recombinant host cells" are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
[0062] The phrase "amplification of polynucleotides" includes methods such as PCR, ligation amplification (or ligase chain reaction, LCR) and amplification methods. These methods are known and widely practiced in the art. See, e.g., U.S. Pat. Nos. 4,683,195 and 4,683,202 and Innis et al, 1990 (for PCR); and Wu, D.Y. et al. (1989) Genomics 4:560-569 (for LCR). In general, the PCR procedure describes a method of gene amplification which is comprised of (i) sequence-specific hybridization of primers to specific genes within a DNA sample (or library), (ii) subsequent amplification involving multiple rounds of annealing, elongation, and denaturation using a DNA polymerase, and (iii) screening the PCR products for a band of the correct size. The primers used are oligonucleotides of sufficient length and appropriate
sequence to provide initiation of polymerization, i.e. each primer is specifically designed to be complementary to each strand of the genomic locus to be amplified.
[0063] Reagents and hardware for conducting PCR are commercially available. Primers useful to amplify sequences from a particular gene region are preferably complementary to, and hybridize specifically to sequences in the target region or in its flanking regions. Nucleic acid sequences generated by amplification may be sequenced directly. Alternatively the amplified sequence(s) may be cloned prior to sequence analysis. A method for the direct cloning and sequence analysis of enzymatically amplified genomic segments is known in the art.
[0064] "Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "nonhomologous" sequence shares less than 40% identity, though preferably less than 25% identity, with one of the sequences of the present invention.
[0065] The term "a homolog of a nucleic acid" refers to a nucleic acid having a nucleotide sequence having a certain degree of homology with the nucleotide sequence of the nucleic acid or complement thereof. A homolog of a double stranded nucleic acid is intended to include nucleic acids having a nucleotide sequence which has a certain degree of homology with or with the complement thereof. In one aspect, homo logs of nucleic acids are capable of hybridizing to the nucleic acid or complement thereof.
[0066] The term "interact" as used herein is meant to include detectable interactions between molecules, such as can be detected using, for example, a hybridization assay. The term interact is also meant to include "binding" interactions between molecules. Interactions may be, for example, protein-protein, protein-nucleic acid, protein-small molecule or small molecule-nucleic acid in nature.
[0067] The term "isolated" as used herein refers to molecules or biological or cellular materials being substantially free from other materials. In one aspect, the term "isolated" refers to nucleic acid, such as DNA or RNA, or protein or polypeptide, or cell or cellular organelle, or tissue or organ, separated from other DNAs or RNAs, or proteins or polypeptides, or cells or cellular organelles, or tissues or organs, respectively, that are present in the natural source. The
term "isolated" also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Moreover, an "isolated nucleic acid" is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state. The term "isolated" is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides. The term "isolated" is also used herein to refer to cells or tissues that are isolated from other cells or tissues and is meant to encompass both cultured and engineered cells or tissues.
[0068] A "normal cell corresponding to the tumor tissue type" refers to a normal cell from a same tissue type as the tumor tissue. A non-limiting examples is a normal lung cell from a patient having lung tumor, or a normal colon cell from a patient having colon tumor.
[0069] A "blood cell" refers to any of the cells contained in blood. A blood cell is also referred to as an erythrocyte or leukocyte, or a blood corpuscle. Non-limiting examples of blood cells include white blood cells, red blood cells, and platelets.
[0070] As used herein, the term "determining the genotype of a cell or tissue sample" intends to identify the genotypes of polymorphic loci of interest in the cell or tissue sample. In one aspect, a polymorphic locus is a single nucleotide polymorphic (SNP) locus. If the allelic composition of a SNP locus is heterozygous, the genotype of the SNP locus will be identified as "X/Y" wherein X and Y are two different nucleotides, e.g., G/C for the IL-6 gene at position - 174. If the allelic composition of a SNP locus is homozygous, the genotype of the SNP locus will be identified as "X/X" wherein X identifies the nucleotide that is present at both alleles, e.g., G/G for IL-6 gene at position -174. In another aspect, a polymorphic locus harbors allelic variants of nucleotide sequences of different length. The genotype of the polymorphic locus will be identified with the length of the allelic variant, e.g., both alleles with < 20 CA repeats at intron 1 of the EGFR gene.
[0071] The terms "oligonucleotide" or "polynucleotide", or "portion," or "segment" thereof refer to a stretch of polynucleotide residues which is long enough to use in PCR or various hybridization procedures to identify or amplify identical or related parts of mRNA or DNA molecules. The polynucleotide compositions of this invention include RNA, cDNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for
example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides),
intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.
[0072] When a genetic marker or polymorphism "is used as a basis or to aid in determination of, or for selecting a patient for a treatment described herein, the genetic marker or
polymorphism is measured before and/or during treatment, and the values obtained are used by a clinician in assessing any of the following: (a) probable or likely suitability of an individual to initially receive treatment(s); (b) probable or likely unsuitability of an individual to initially receive treatment(s); (c) responsiveness to treatment; (d) probable or likely suitability of an individual to continue to receive treatment(s); (e) probable or likely unsuitability of an individual to continue to receive treatment(s); (f) adjusting dosage; (g) predicting likelihood of clinical benefits; or (h) toxicity. As would be well understood by one in the art, measurement of the genetic marker or polymorphism in a clinical setting is a clear indication that this parameter was used as a basis for initiating, continuing, adjusting and/or ceasing administration of the treatments described herein.
[0073] The term "treating" as used herein is intended to encompass curing as well as ameliorating at least one symptom of the condition or disease. For example, in the case of cancer, a response to treatment includes a reduction in cachexia, increase in survival time, elongation in time to tumor progression, reduction in tumor mass, reduction in tumor burden and/or a prolongation in time to tumor metastasis, time to tumor recurrence, tumor response, complete response, partial response, stable disease, progressive disease, progression free survival, overall survival, each as measured by standards set by the National Cancer Institute and the U.S. Food and Drug Administration for the approval of new drugs. See Johnson et al. (2003) J. Clin. Oncol. 21(7):1404-1411.
[0074] "An effective amount" intends to indicated the amount of a compound or agent administered or delivered to the patient which is most likely to result in the desired response to treatment. The amount is empirically determined by the patient's clinical parameters including,
but not limited to the stage of disease, age, gender, histology, and likelihood for tumor recurrence.
[0075] The term "clinical outcome", "clinical parameter", "clinical response", or "clinical endpoint" refers to any clinical observation or measurement relating to a patient's reaction to a therapy. Non-limiting examples of clinical outcomes include tumor response (TR), overall survival (OS), progression free survival (PFS), disease free survival (DFS), time to tumor recurrence (TTR), time to tumor progression (TTP), relative risk (RR), toxicity or side effects.
[0076] The term "likely to respond" intends to mean that the patient of a genotype is relatively more likely to experience a more favorable outcome as compared to patients similarly situated without the genotype. Alternatively, the term "not likely to respond" intends to mean that the patient of a genotype is relatively less likely to experience a favorable outcome than patients similarly situated without the genotype.
[0077] The term "suitable for a therapy" or "suitably treated with a therapy" shall mean that the patient is likely to exhibit one or more more desirable clinical outcome as compared to patients having the same disease and receiving the same therapy but possessing a different characteristic that is under consideration for the purpose of the comparison. In one aspect, the characteristic under consideration is a genetic polymorphism or a somatic mutation. In another aspect, the characteristic under consideration is expression level of a gene or a polypeptide. In one aspect, a more desirable clinical outcome is relatively higher likelihood of or relatively better tumor response such as tumor load reduction. In another aspect, a more desirable clinical outcome is relatively longer overall survival. In yet another aspect, a more desirable clinical outcome is relatively longer progression free survival or time to tumor progression. In yet another aspect, a more desirable clinical outcome is relatively longer disease free survival. In further another aspect, a more desirable clinical outcome is relative reduction or delay in tumor recurrence. In another aspect, a more desirable clinical outcome is relatively decreased metastasis. In another aspect, a more desirable clinical outcome is relatively lower relative risk. In yet another aspect, a more desirable clinical outcome is relatively reduced toxicity or side effects. In some embodiments, more than one clinical outcomes are considered simultaneously. In one such aspect, a patient possessing a characteristic, such as a genotype of a genetic polymorphism, may exhibit more than one more desirable clinical outcomes as compared to patients having the same disease and receiving the same therapy but not possessing the characteristic. As defined herein, the patients is considered suitable for the therapy. In another such aspect, a patient possessing a characteristic may exhibit one or more more desirable clinical
outcome but simultaneously exhibit one or more less desirable clinical outcome. The clinical outcomes will then be considered collectively, and a decision as to whether the patient is suitable for the therapy will be made accordingly, taking into account the patient's specific situation and the relevance of the clinical outcomes. In some embodiments, progression free survival or overall survival is weighted more heavily than tumor response in a collective decision making.
[0078] A "complete response" (CR) to a therapy defines patients with evaluable but non- measurable disease, whose tumor and all evidence of disease had disappeared.
[0079] A "partial response" (PR) to a therapy defines patients with anything less than complete response that were simply categorized as demonstrating partial response.
[0080] "Stable disease" (SD) indicates that the patient is stable.
[0081] "Progressive disease" (PD) indicates that the tumor has grown (i.e. become larger), spread (i.e. metastasized to another tissue or organ) or the overall cancer has gotten worse following treatment. For example, tumor growth of more than 20 percent since the start of treatment typically indicates progressive disease.
[0082] "Disease free survival" (DFS) indicates the length of time after treatment of a cancer or tumor during which a patient survives with no signs of the cancer or tumor.
[0083] "Non-response" (NR) to a therapy defines patients whose tumor or evidence of disease has remained constant or has progressed.
[0084] "Overall Survival" (OS) intends a prolongation in life expectancy as compared to naive or untreated individuals or patients.
[0085] "Progression free survival" (PFS) or "Time to Tumor Progression" (TTP) indicates the length of time during and after treatment that the cancer does not grow. Progression-free survival includes the amount of time patients have experienced a complete response or a partial response, as well as the amount of time patients have experienced stable disease.
[0086] "No Correlation" refers to a statistical analysis showing no relationship between the allelic variant of a polymorphic region or gene expression levels and clinical parameters.
[0087] "Tumor Recurrence" as used herein and as defined by the National Cancer Institute is cancer that has recurred (come back), usually after a period of time during which the cancer
could not be detected. The cancer may come back to the same place as the original (primary) tumor or to another place in the body. It is also called recurrent cancer.
[0088] "Time to Tumor Recurrence" (TTR) is defined as the time from the date of diagnosis of the cancer to the date of first recurrence, death, or until last contact if the patient was free of any tumor recurrence at the time of last contact. If a patient had not recurred, then TTR was censored at the time of death or at the last follow-up.
[0089] "Relative Risk" (RR), in statistics and mathematical epidemiology, refers to the risk of an event (or of developing a disease) relative to exposure. Relative risk is a ratio of the probability of the event occurring in the exposed group versus a non-exposed group.
[0090] As used herein, the terms "stage I cancer," "stage II cancer," "stage III cancer," and "stage IV" refer to the TNM staging classification for cancer. Stage I cancer typically identifies that the primary tumor is limited to the organ of origin. Stage II intends that the primary tumor has spread into surrounding tissue and lymph nodes immediately draining the area of the tumor. Stage III intends that the primary tumor is large, with fixation to deeper structures. Stage IV intends that the primary tumor is large, with fixation to deeper structures. See pages 20 and 21, CANCER BIOLOGY, 2nd Ed., Oxford University Press (1987).
[0091] A "tumor" is an abnormal growth of tissue resulting from uncontrolled, progressive multiplication of cells and serving no physiological function. A "tumor" is also known as a neoplasm.
[0092] A "lymph node" refers to a rounded mass of lymphatic tissue that is surrounded by a capsule of connective tissue, which filter lymphatic fluid and stores white blood cells. Cancers described herein can spread to the lymphatic system and this spreading is used, in part, to determine the cancer stage. For example, if a cancer is "lymph node negative," the cancer has not spread to the surrounding or nearby lymph nodes and thus the lymphatic system.
Conversely, if the cancer has spread to the surrounding or nearby lymph nodes, the cancer is "lymph node positive."
[0093] The term "blood" refers to blood which includes all components of blood circulating in a subject including, but not limited to, red blood cells, white blood cells, plasma, clotting factors, small proteins, platelets and/or cryoprecipitate. This is typically the type of blood which is donated when a human patent gives blood.
[0094] The term "hazard ratio" is a survival analysis in the effect of an explanatory variable on the hazard or risk of an event. In another aspect, "hazard ratio" is an estimate of relative risk, which is the risk of an event or development of a disease relative to treatment and in some aspects the expression levels of the gene of interest. Statistical methods for determining hazard ratio are well known in the art.
Descriptive Embodiments
[0095] Disclosed herein is a method for treating a Japanese gastrointestinal cancer patient selected for a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, administration of an effective amount of an adjuvant chemotherapy regimen or equivalent thereof, wherein the patient is selected for the therapy based on the determination of a genotype of A/G or A/G for LMTK3 rs9989661 (r9) (A/G), thereby treating said patient. In one aspect, the the patient is a male patient. In another aspect, the patient is a female patient.
[0096] Also disclosed is a method for treating a Japanese gastrointestinal cancer patient selected for a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, administration of an effective amount of an aggressive chemotherapy regimen, wherein the patient is selected for the therapy based on the determination of a genotype of A/A for LMTK3 rs9989661 (r9) (A/G) in a sample isolated from the patient, thereby treating said patient. In one aspect, the the patient is a male patient. In another aspect, the patient is a female patient.
[0097] In the methods disclosed herein, the gastrointestinal cancer is a metastatic or non- metastatic (localized) cancer selected from the group of gastric adenocarcinoma, rectal cancer colorectal cancer, colon cancer, gastric cancer or esophageal cancer.
[0098] The methods are useful in the assistance of an animal, a mammal or yet further a human patient. For the purpose of illustration only, a mammal includes but is not limited to a simian, a murine, a bovine, an equine, a porcine or an ovine.
Diagnostic Methods
[0099] The disclosure further provides diagnostic methods, which are based, at least in part, on determination of the identity of the polymorphic region of the gene identified herein.
[0100] In one aspect, a method is provided for aiding in the determination of and/or identifying a Japanese gastrointestinal cancer patient that is likely or less likely to show
responsiveness to a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, adjuvant chemotherapy, comprising screening a patient cell or tissue sample for the genotype of LMTK3 rs9989661 (r9) (A/G), wherein a genotype of A/G or A/G identifies or determines that the patient is likely to show responsiveness, and A/G identifies or determines tha the patient is not likely to show responsiveness to the therapy. In one aspect the patient is a female. In another aspect, the patient is a male.
[0101] A method also is disclosed for aiding in the determination of and/or identifying a Japanese gastrointestinal cancer patient that is likely to require aggressive therapy, comprising, or alternatively consisting essentially of, or yet futher consisting of, screening a patient cell or tissue sample for the genotype of LMTK3 rs9989661 (r9) (A/G), wherein a genotype of A/A identifies or determines that the patient is likely to require aggressive therapy, and G/G or A/G identifies or determines that the patient is not likely to require as aggressive therapy. In one aspect the patient is a female. In another aspect, the patient is a male.
[0102] In a futher aspect, the method further comprises administering an effective amount of the appropriate therapy to the patient identified or determined for the therapy.
[0103] In the methods disclosed herein, the gastrointestinal cancer is a metastatic or non- metastatic (localized) cancer selected from the group of gastric adenocarcinoma, rectal cancer colorectal cancer, colon cancer, gastric cancer or esophageal cancer.
[0104] Non-limiting samples to be screened diagnostic and therapeutic methods disclosed herein comprise, or alternatively consisting essentially of, or yet further consisting of, tissue or cells selected from non-metastatic tumor tissue, a non-metastatic tumor cell, metastatic tumor tissue, a metastatic tumor cell, blood or peripheral blood lymphocytes. In one aspect, patient sample comprises blood or a peripheral blood lymphocytes.
[0105] The cells or tissue can be analzyzed using methods known in the art, e.g., method comprising hybridization, direct DNA-sequencing or PCR.
[0106] In these methods, responsiveness to therapy is measured by a longer time of disease free survival, longer overall survival and/or lower risk of disease recurrence.
Polymorphic Region
[0107] For example, information obtained using the diagnostic assays described herein is useful for determining if a subject will likely, more likely, or less likely to respond to cancer
treatment of a given type. Based on the prognostic information, a doctor can recommend a therapeutic protocol, useful for treating reducing the malignant mass or tumor in the patient or treat cancer in the individual.
[0108] In addition, knowledge of the identity of a particular allele in an individual (the gene profile) allows customization of therapy for a particular disease to the individual's genetic profile, the goal of "pharmacogenomics". For example, an individual's genetic profile can enable a doctor: 1) to more effectively prescribe a drug that will address the molecular basis of the disease or condition; 2) to better determine the appropriate dosage of a particular drug and 3) to identify novel targets for drug development. The identity of the genotype or expression patterns of individual patients can then be compared to the genotype or expression profile of the disease to determine the appropriate drug and dose to administer to the patient.
[0109] The ability to target populations expected to show the highest clinical benefit, based on the normal or disease genetic profile, can enable: 1) the repositioning of marketed drugs with disappointing market results; 2) the rescue of drug candidates whose clinical development has been discontinued as a result of safety or efficacy limitations, which are patient subgroup- specific; and 3) an accelerated and less costly development for drug candidates and more optimal drug labeling.
[0110] Detection of point mutations or additional base pair repeats can be accomplished by molecular cloning of the specified allele and subsequent sequencing of that allele using techniques known in the art, in some aspects, after isolation of a suitable nucleic acid sample using methods known in the art. Alternatively, the gene sequences can be amplified directly from a genomic DNA preparation from the tumor tissue using PCR, and the sequence composition is determined from the amplified product. As described more fully below, numerous methods are available for isolating and analyzing a subject's DNA for mutations at a given genetic locus such as the gene of interest.
[0111] A detection method is allele specific hybridization using probes overlapping the polymorphic site and having about 5, or alternatively 10, or alternatively 20, or alternatively 25, or alternatively 30 nucleotides around the polymorphic region. In another embodiment of the invention, several probes capable of hybridizing specifically to the allelic variant are attached to a solid phase support, e.g., a "chip". Oligonucleotides can be bound to a solid support by a variety of processes, including lithography. For example a chip can hold up to 250,000 oligonucleotides (GeneChip, Affymetrix). Mutation detection analysis using these chips
comprising oligonucleotides, also termed "DNA probe arrays" is described e.g., in Cronin et al. (1996) Human Mutation 7:244.
[0112] In other detection methods, it is necessary to first amplify at least a portion of the gene of interest prior to identifying the allelic variant. Amplification can be performed, e.g., by PCR and/or LCR, according to methods known in the art. In one embodiment, genomic DNA of a cell is exposed to two PCR primers and amplification for a number of cycles sufficient to produce the required amount of amplified DNA.
[0113] Alternative amplification methods include: self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques known to those of skill in the art. These detection schemes are useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.
[0114] In one embodiment, any of a variety of sequencing reactions known in the art can be used to directly sequence at least a portion of the gene of interest and detect allelic variants, e.g., mutations, by comparing the sequence of the sample sequence with the corresponding wild-type (control) sequence. Exemplary sequencing reactions include those based on techniques developed by Maxam and Gilbert (1997) Proc. Natl. Acad. Sci, USA 74:560) or Sanger et al. (1977) Proc. Nat. Acad. Sci, 74:5463). It is also contemplated that any of a variety of automated sequencing procedures can be utilized when performing the subject assays (Biotechniques (1995) 19:448), including sequencing by mass spectrometry (see, for example, U.S. Patent No. 5,547,835 and International Patent Application Publication Number WO 94/16101, entitled DNA Sequencing by Mass Spectrometry by Koster; U.S. Patent No. 5,547,835 and international patent application Publication Number WO 94/21822 entitled "DNA Sequencing by Mass Spectrometry Via Exonuclease Degradation" by Koster; U.S. Patent No. 5,605,798 and
International Patent Application No. PCT/US96/03651 entitled DNA Diagnostics Based on Mass Spectrometry by Koster; Cohen et al. (1996) Adv. Chromat. 36:127-162; and Griffin et al. (1993) Appl. Biochem. Bio. 38:147-159). It will be evident to one skilled in the art that, for certain embodiments, the occurrence of only one, two or three of the nucleic acid bases need be determined in the sequencing reaction. For instance, A-track or the like, e.g., where only one nucleotide is detected, can be carried out.
[0115] Yet other sequencing methods are disclosed, e.g., in U.S. Patent No. 5,580,732 entitled "Method of DNA Sequencing Employing A Mixed DNA-Polymer Chain Probe" and U.S. Patent No. 5,571,676 entitled "Method For Mismatch-Directed In Vitro DNA Sequencing."
[0116] In some cases, the presence of the specific allele in DNA from a subject can be shown by restriction enzyme analysis. For example, the specific nucleotide polymorphism can result in a nucleotide sequence comprising a restriction site which is absent from the nucleotide sequence of another allelic variant.
[0117] In a further embodiment, protection from cleavage agents (such as a nuclease, hydroxylamine or osmium tetroxide and with piperidine) can be used to detect mismatched bases in RNA/RNA DNA/DNA, or RNA/DNA heteroduplexes (see, e.g., Myers et al. (1985) Science 230:1242). In general, the technique of "mismatch cleavage" starts by providing heteroduplexes formed by hybridizing a control nucleic acid, which is optionally labeled, e.g., RNA or DNA, comprising a nucleotide sequence of the allelic variant of the gene of interest with a sample nucleic acid, e.g., RNA or DNA, obtained from a tissue sample. The double- stranded duplexes are treated with an agent which cleaves single-stranded regions of the duplex such as duplexes formed based on basepair mismatches between the control and sample strands. For instance, RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with SI nuclease to enzymatically digest the mismatched regions. In other embodiments, either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine whether the control and sample nucleic acids have an identical nucleotide sequence or in which nucleotides they are different. See, for example, U.S. Patent No. 6,455,249, Cotton et al. (1988) Proc. Natl. Acad. Sci. USA 85:4397; Saleeba et al. (1992) Methods Enzy. 217:286- 295. In another embodiment, the control or sample nucleic acid is labeled for detection.
[0118] In other embodiments, alterations in electrophoretic mobility is used to identify the particular allelic variant. For example, single strand conformation polymorphism (SSCP) may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (Orita et al. (1989) Proc. Natl. Acad. Sci USA 86:2766; Cotton (1993) Mutat. Res.
285: 125-144 and Hayashi (1992) Genet Anal Tech. Appl. 9:73-79). Single-stranded DNA fragments of sample and control nucleic acids are denatured and allowed to renature. The secondary structure of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change. The
DNA fragments may be labeled or detected with labeled probes. The sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence. In another preferred embodiment, the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet. 7:5).
[0119] In yet another embodiment, the identity of the allelic variant is obtained by analyzing the movement of a nucleic acid comprising the polymorphic region in polyacrylamide gels containing a gradient of denaturant, which is assayed using denaturing gradient gel
electrophoresis (DGGE) (Myers et al. (1985) Nature 313:495). When DGGE is used as the method of analysis, DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR.
[0120] In a further embodiment, a temperature gradient is used in place of a denaturing agent gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys. Chem. 265:1275).
[0121] Examples of techniques for detecting differences of at least one nucleotide between 2 nucleic acids include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide probes may be prepared in which the known polymorphic nucleotide is placed centrally (allele-specific probes) and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324: 163); Saiki et al. (1989) Proc. Natl. Acad. Sci. USA 86:6230 and Wallace et al. (1979) Nucl. Acids Res. 6:3543). Such allele specific oligonucleotide hybridization techniques may be used for the detection of the nucleotide changes in the polymorphic region of the gene of interest. For example, oligonucleotides having the nucleotide sequence of the specific allelic variant are attached to a hybridizing membrane and this membrane is then hybridized with labeled sample nucleic acid. Analysis of the
hybridization signal will then reveal the identity of the nucleotides of the sample nucleic acid.
[0122] Alternatively, allele specific amplification technology which depends on selective PCR amplification may be used in conjunction with the instant invention. Oligonucleotides used as primers for specific amplification may carry the allelic variant of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11:238 and Newton et al. (1989) Nucl. Acids Res. 17:2503). This technique is also
termed "PROBE" for Probe Oligo Base Extension. In addition it may be desirable to introduce a novel restriction site in the region of the mutation to create cleavage-based detection (Gasparini et al. (1992) Mol. Cell Probes 6: 1).
[0123] In another embodiment, identification of the allelic variant is carried out using an oligonucleotide ligation assay (OLA), as described, e.g., in U.S. Patent No. 4,998,617 and in Landegren et al. (1988) Science 241: 1077-1080. The OLA protocol uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target. One of the oligonucleotides is linked to a separation marker, e.g., biotinylated, and the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate. Ligation then permits the labeled oligonucleotide to be recovered using avidin, or another biotin ligand. Nickerson et al. have described a nucleic acid detection assay that combines attributes of PCR and OLA (Nickerson et al. (1990) Proc. Natl. Acad. Sci. (U.S.A.) 87:8923-8927). In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA.
[0124] Several techniques based on this OLA method have been developed and can be used to detect the specific allelic variant of the polymorphic region of the gene of interest. For example, U.S. Patent No. 5,593,826 discloses an OLA using an oligonucleotide having 3 '-amino group and a 5'-phosphorylated oligonucleotide to form a conjugate having a phosphoramidate linkage. In another variation of OLA described in Tobe et al. (1996) Nucleic Acids Res. 24: 3728, OLA combined with PCR permits typing of two alleles in a single microtiter well. By marking each of the allele-specific primers with a unique hapten, i.e. digoxigenin and fluorescein, each OLA reaction can be detected by using hapten specific antibodies that are labeled with different enzyme reporters, alkaline phosphatase or horseradish peroxidase. This system permits the detection of the two alleles using a high throughput format that leads to the production of two different colors.
[0125] In one embodiment, the single base polymorphism can be detected by using a specialized exonuclease-resistant nucleotide, as disclosed, e.g., in Mundy, C. R. (U.S. Patent No. 4,656,127). According to the method, a primer complementary to the allelic sequence immediately 3 ' to the polymorphic site is permitted to hybridize to a target molecule obtained from a particular animal or human. If the polymorphic site on the target molecule contains a nucleotide that is complementary to the particular exonuclease-resistant nucleotide derivative present, then that derivative will be incorporated onto the end of the hybridized primer. Such
incorporation renders the primer resistant to exonuclease, and thereby permits its detection. Since the identity of the exonuclease-resistant derivative of the sample is known, a finding that the primer has become resistant to exonucleases reveals that the nucleotide present in the polymorphic site of the target molecule was complementary to that of the nucleotide derivative used in the reaction. This method has the advantage that it does not require the determination of large amounts of extraneous sequence data.
[0126] In another embodiment of the invention, a solution-based method is used for determining the identity of the nucleotide of the polymorphic site. Cohen, D. et al. (French Patent 2,650,840; PCT Appln. No. WO91/02087). As in the Mundy method of U.S. Patent No. 4,656,127, a primer is employed that is complementary to allelic sequences immediately 3' to a polymorphic site. The method determines the identity of the nucleotide of that site using labeled dideoxynucleotide derivatives, which, if complementary to the nucleotide of the polymorphic site will become incorporated onto the terminus of the primer.
[0127] An alternative method, known as Genetic Bit Analysis or GBA™ is described by Goelet, P. et al. (PCT Appln. No. 92/15712). This method uses mixtures of labeled terminators and a primer that is complementary to the sequence 3' to a polymorphic site. The labeled terminator that is incorporated is thus determined by, and complementary to, the nucleotide present in the polymorphic site of the target molecule being evaluated. In contrast to the method of Cohen et al. (French Patent 2,650,840; PCT Appln. No. W091/02087) the method of Goelet, P. et al. supra, is preferably a heterogeneous phase assay, in which the primer or the target molecule is immobilized to a solid phase.
[0128] Recently, several primer-guided nucleotide incorporation procedures for assaying polymorphic sites in DNA have been described (Komher, J. S. et al. (1989) Nucl. Acids. Res. 17:7779-7784; Sokolov, B. P. (1990) Nucl. Acids Res. 18:3671; Syvanen, A.-C. et al. (1990) Genomics 8:684-692; Kuppuswamy, M. N. et al. (1991) Proc. Natl. Acad. Sci. (U.S.A.)
88: 1143-1147; Prezant, T. R. et al. (1992) Hum. Mutat. 1: 159-164; Ugozzoli, L. et al. (1992) GATA 9: 107-112; Nyren, P. et al. (1993) Anal. Biochem. 208: 171-175). These methods differ from GBA™ in that they all rely on the incorporation of labeled deoxynucleotides to discriminate between bases at a polymorphic site. In such a format, since the signal is proportional to the number of deoxynucleotides incorporated, polymorphisms that occur in runs of the same nucleotide can result in signals that are proportional to the length of the run
(Syvanen, A.-C. et al. (1993) Amer. J. Hum. Genet. 52:46-59).
[0129] If the polymorphic region is located in the coding region of the gene of interest, yet other methods than those described above can be used for determining the identity of the allelic variant. For example, identification of the allelic variant, which encodes a mutated signal peptide, can be performed by using an antibody specifically recognizing the mutant protein in, e.g., immunohistochemistry or immunoprecipitation. Antibodies to the wild-type or signal peptide mutated forms of the signal peptide proteins can be prepared according to methods known in the art.
[0130] Often a solid phase support is used as a support capable of binding of a primer, probe, polynucleotide, an antigen or an antibody. Well-known supports include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite. The nature of the support can be either soluble to some extent or insoluble for the purposes of the present invention. The support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to an antigen or antibody. Thus, the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod.
Alternatively, the surface may be flat such as a sheet, test strip, etc. or alternatively polystyrene beads. Those skilled in the art will know many other suitable supports for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation.
[0131] Moreover, it will be understood that any of the above methods for detecting alterations in a gene or gene product or polymorphic variants can be used to monitor the course of treatment or therapy.
[0132] The methods described herein may be performed, for example, by utilizing prepackaged diagnostic kits, such as those described below, comprising at least one probe or primer nucleic acid described herein, which may be conveniently used, e.g., to determine whether a subject is likely responsive to the therapy as described herein or has or is at risk of developing disease such as colorectal cancer.
[0133] Sample nucleic acid for use in the above-described diagnostic and prognostic methods can be obtained from any suitable cell type or tissue of a subject. For example, a subject's bodily fluid (e.g. blood) can be obtained by known techniques (e.g., venipuncture).
Alternatively, nucleic acid tests can be performed on dry samples (e.g., hair or skin). Fetal nucleic acid samples can be obtained from maternal blood as described in International Patent Application No. W091/07660 to Bianchi. Alternatively, amniocytes or chorionic villi can be obtained for performing prenatal testing.
[0134] Diagnostic procedures can also be performed in situ directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary. Nucleic acid reagents can be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, G. J. (1992) PCR IN SITU HYBRIDIZATION:
PROTOCOLS AND APPLICATIONS, Raven Press, NY).
[0135] In addition to methods which focus primarily on the detection of one nucleic acid sequence, profiles can also be assessed in such detection schemes. Fingerprint profiles can be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT-PCR.
[0136] Antibodies directed against wild type or mutant peptides encoded by the allelic variants of the gene of interest may also be used in disease diagnostics and prognostics. Such diagnostic methods, may be used to detect abnormalities in the level of expression of the peptide, or abnormalities in the structure and/or tissue, cellular, or subcellular location of the peptide.
Protein from the tissue or cell type to be analyzed may easily be detected or isolated using techniques which are well known to one of skill in the art, including but not limited to Western blot analysis. For a detailed explanation of methods for carrying out Western blot analysis, see Sambrook and Russell (2001) supra. The protein detection and isolation methods employed herein can also be such as those described in Harlow and Lane, (1999) supra. This can be accomplished, for example, by immunofluorescence techniques employing a fluorescently labeled antibody (see below) coupled with light microscopic, flow cytometric, or fluorimetric detection. The antibodies (or fragments thereof) useful in the present invention may, additionally, be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of the peptides or their allelic variants. In situ detection may be accomplished by removing a histological specimen from a patient, and applying thereto a labeled antibody of the present invention. The antibody (or fragment) is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample. Through the use of such a procedure, it is possible to determine not only the presence of the subject polypeptide, but also its distribution in the examined tissue. Using the present invention, one of ordinary skill will readily perceive that any of a wide variety of histological methods (such as staining procedures) can be modified in order to achieve such in situ detection.
Nucleic Acids
[0137] In one aspect, the nucleic acid sequences of the gene of interest, or portions thereof, can be the basis for probes or primers, e.g., in methods for determining expression level of the gene
of interest or the allelic variant of a polymorphic region of a gene of interest identified in the experimental section below. Thus, they can be used in the methods of the invention to determine which therapy is most likely to treat an individual's cancer.
[0138] The methods of the invention can use nucleic acids isolated from vertebrates. In one aspect, the vertebrate nucleic acids are mammalian nucleic acids. In a further aspect, the nucleic acids used in the methods of the invention are human nucleic acids.
[0139] Primers for use in the methods of the invention are nucleic acids which hybridize to a nucleic acid sequence which is adjacent to the region of interest or which covers the region of interest and is extended. A primer can be used alone in a detection method, or a primer can be used together with at least one other primer or probe in a detection method. Primers can also be used to amplify at least a portion of a nucleic acid. Probes for use in the methods of the invention are nucleic acids which hybridize to the gene of interest and which are not further extended. For example, a probe is a nucleic acid which hybridizes to the gene of interest, and which by hybridization or absence of hybridization to the DNA of a subject will be indicative of the identity of the allelic variant of the expression levels of the gene of interest. Primers and/or probes for use in the methods can be provided as isolated single stranded oligonucleotides or alternatively, as isolated double stranded oligonucleotides.
[0140] In one embodiment, primers comprise a nucleotide sequence which comprises a region having a nucleotide sequence which hybridizes under stringent conditions to about: 6, or alternatively 8, or alternatively 10, or alternatively 12, or alternatively 25, or alternatively 30, or alternatively 40, or alternatively 50, or alternatively 75 consecutive nucleotides of the gene of interest.
[0141] Primers can be complementary to nucleotide sequences located close to each other or further apart, depending on the use of the amplified DNA. For example, primers can be chosen such that they amplify DNA fragments of at least about 10 nucleotides or as much as several kilobases. Preferably, the primers of the invention will hybridize selectively to nucleotide sequences located about 100 to about 1000 nucleotides apart.
[0142] For amplifying at least a portion of a nucleic acid, a forward primer (i.e., 5' primer) and a reverse primer (i.e., 3' primer) will preferably be used. Forward and reverse primers hybridize to complementary strands of a double stranded nucleic acid, such that upon extension from each primer, a double stranded nucleic acid is amplified. Example primers useful for the
amplification of LMTK3 rs9989661 include:
Forward TTGGACTACAACTCCCGTGATGCT SEQ ID No. 1
Forward CCAAGGCATTGTGGGAGTTGTAGT SEQ ID No.2
Forward GCATTGTGGGAGTTGTAGTTTGGG SEQ ID No.3
Reverse CACTCCTCTTTCCTTCAACCCTCA SEQ ID No.4
Reverse AGCTCCAGACTTCACTATCACTCC SEQ ID No.5
Reverse GCTCCAGACTTCACTATCACTCCT SEQ ID No.6
[0143] Yet other preferred primers of the invention are nucleic acids which are capable of selectively hybridizing to the gene of interest. Thus, such primers can be specific for the gene of interest sequence, so long as they have a nucleotide sequence which is capable of hybridizing to the gene of interest.
[0144] Additionally, the isolated nucleic acids used as probes or primers may be modified to become more stable. Exemplary nucleic acid molecules which are modified include
phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S. Patent Nos. 5,176,996; 5,264,564 and 5,256,775).
[0145] The nucleic acids used in the methods of the invention can also be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule. The nucleic acids, e.g., probes or primers, may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane. See, e.g., Letsinger et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556;
Lemaitre et al. (1987) Proc. Natl. Acad. Sci. 84:648-652; and PCT Publ. No. WO 88/09810, published Dec. 15, 1988), hybridization-triggered cleavage agents, (see, e.g., Krol et al. (1988) BioTechniques 6:958-976) or intercalating agents (see, e.g., Zon (1988) Pharm. Res. 5:539-549. To this end, the nucleic acid used in the methods of the invention may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
[0146] The isolated nucleic acids used in the methods of the invention can also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose or, alternatively, comprise at least one modified
phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
[0147] The nucleic acids, or fragments thereof, to be used in the methods of the invention can be prepared according to methods known in the art and described, e.g., in Sambrook et al. (2001) supra. For example, discrete fragments of the DNA can be prepared and cloned using restriction enzymes. Alternatively, discrete fragments can be prepared using the Polymerase Chain Reaction (PCR) using primers having an appropriate sequence under the manufacturer's conditions, (described above).
[0148] Oligonucleotides can be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides can be synthesized by the method of Stein et al. (1988) Nucl. Acids Res. 16:3209, methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports. Sarin et al. (1988) Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451.
Methods of Treatment
[0149] Disclosed herein is a method for treating a Japanese gastric cancer patient selected for a therapy comprising, or alternatively consisting essentially of, or yet futher consisting of, administration of an effective amount of an adjuvant chemotherapy regimen or equivalent thereof, wherein the patient is selected for the therapy based on the determination of a genotype of A/G or A/G for LMTK3 rs9989661 (r9) (A/G) in a sample isolated from the patient, thereby treating said patient. In one aspect, the the patient is a male patient. In another aspect, the patient is a female patient.
[0150] Also described is a method for treating a Japanese gastric cancer patient selected for a therapy comprising, or alternatively consisting essentially of, or yet futher consisting
coadministration of an effective amount of an aggressive chemotherapy regimen, wherein the patient is selected for the therapy based on the determination of a genotype of A/A for LMTK3 rs9989661 (r9) (A/G) in a sample isolated from the patient, thereby treating said patient. In one aspect, the patient is a male patient. In another aspect, the patient is a female patient.
[0151] In one aspect, the methods further comprise identifying a patient for treatment by screening a cell or tissue sample using the methods disclosed above and identifying and/or selecting the patient for the therapy or vice versa.
[0152] In accordance with these disclosures, the methods comprise administrering an effective amount of the therapy. Accordingly, a formulation comprising the necessary chemotherapy or biological equivalent thereof is further provided herein. The formulation can further comprise one or more preservatives or stabilizers. Any suitable concentration or mixture can be used as known in the art, such as 0.001-5%, or any range or value therein, such as, but not limited to 0.001, 0.003, 0.005, 0.009, 0.01, 0.02, 0.03, 0.05, 0.09, 0.1, 0.2, 0.3, O.4., 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.3, 4.5, 4.6, 4.7, 4.8, 4.9, or any range or value therein. Non-limiting examples include, no preservative, 0.1-2% m-cresol (e.g., 0.2, 0.3. 0.4, 0.5, 0.9, 1.0%), 0.1-3% benzyl alcohol (e.g., 0.5, 0.9, 1.1., 1.5, 1.9, 2.0, 2.5%), 0.001-0.5% thimerosal (e.g., 0.005, 0.01), 0.001-2.0% phenol (e.g., 0.05, 0.25, 0.28, 0.5, 0.9, 1.0%), 0.0005-1.0% alkylparaben(s) (e.g., 0.00075, 0.0009, 0.001, 0.002, 0.005, 0.0075, 0.009, 0.01, 0.02, 0.05, 0.075, 0.09, 0.1, 0.2, 0.3, 0.5, 0.75, 0.9, and 1.0%).
[0153] The chemotherapeutic agents or drugs can be administered as a composition. A "composition" typically intends a combination of the active agent and another carrier, e.g., compound or composition, inert (for example, a detectable agent or label) or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers. Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, terra-, and oligosaccharides; derivatized sugars such as alditols, aldonic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in combination 1-99.99% by weight or volume. Exemplary protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like.
Representative amino acid/antibody components, which can also function in a buffering capacity, include alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like. Carbohydrate excipients are also intended within the scope of this invention, examples of which include but are not limited to monosaccharides such as fructose, maltose, galactose, glucose, D- mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffmose, melezitose, maltodextrins, dextrans, starches, and
the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and myoinositol.
[0154] The term carrier further includes a buffer or a pH adjusting agent; typically, the buffer is a salt prepared from an organic acid or base. Representative buffers include organic acid salts such as salts of citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid, or phthalic acid; Tris, tromethamine hydrochloride, or phosphate buffers. Additional carriers include polymeric excipients/additives such as polyvinylpyrrolidones, ficolls (a polymeric sugar), dextrates (e.g., cyclodextrins, such as 2-hydroxypropyl-. quadrature. - cyclodextrin), polyethylene glycols, flavoring agents, antimicrobial agents, sweeteners, antioxidants, antistatic agents, surfactants (e.g., polysorbates such as "TWEEN 20" and
"TWEEN 80"), lipids (e.g., phospholipids, fatty acids), steroids (e.g., cholesterol), and chelating agents (e.g., EDTA).
[0155] As used herein, the term "pharmaceutically acceptable carrier" encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents. The compositions also can include stabilizers and preservatives and any of the above noted carriers with the additional provisio that they be acceptable for use in vivo. For examples of carriers, stabilizers and adjuvants, see Martin REMINGTON'S PHARM. SCI., 15th Ed. (Mack Publ. Co., Easton (1975) and Williams & Williams, (1995), and in the "PHYSICIAN'S DESK REFERENCE", 52nd ed., Medical Economics, Montvale, N.J. (1998).
[0156] Many combination chemotherapeutic regimens are known to the art, such as combinations of platinum compounds and taxanes, e.g. carboplatin/paclitaxel,
capecitabine/docetaxel, the "Cooper regimen", fluorouracil-levamisole, fluorouracil-leucovorin, fluorouracil/oxaliplatin, methotrexate-leucovorin, and the like.
[0157] Combinations of chemotherapies and molecular targeted therapies, biologic therapies, and radiation therapies are also well known to the art; including therapies such as trastuzumab plus paclitaxel, alone or in further combination with platinum compounds such as oxaliplatin, for certain breast cancers, and many other such regimens for other cancers; and the "Dublin regimen" 5-fluorouracil IV over 16 hours on days 1-5 and 75 mg/m cisplatin IV or oxaliplatin over 8 hours on day 7, with repetition at 6 weeks, in combination with 40 Gy radiotherapy in 15 fractions over the first 3 weeks) and the "Michigan regimen" (fluorouracil plus cisplatin or oxaliplatin plus vinblastine plus radiotherapy), both for esophageal cancer, and many other such regimens for other cancers, including colorectal cancer.
[0158] In another aspect of the invention, the method for treating a patient comprises, or alternatively consists essentially of, or yet further consists of surgical resection of a metastatic or non-metastatic solid malignant tumor and, in some aspects, in combination with radiation.
[0159] The invention provides an article of manufacture, comprising packaging material and at least one vial comprising a solution of the chemotherapy as described herein and/or or at least one antibody or its biological equivalent with the prescribed buffers and/or preservatives, optionally in an aqueous diluent, wherein said packaging material comprises a label that indicates that such solution can be held over a period of 1, 2, 3, 4, 5, 6, 9, 12, 18, 20, 24, 30, 36,40, 48, 54, 60, 66, 72 hours or greater. The invention further comprises an article of manufacture, comprising packaging material, a first vial comprising the chemotherapy and/or at least one lyophilized antibody or its biological equivalent and a second vial comprising an aqueous diluent of prescribed buffer or preservative, wherein said packaging material comprises a label that instructs a patient to reconstitute the therapeutic in the aqueous diluent to form a solution that can be held over a period of twenty- four hours or greater.
[0160] When an antibody is administered, the antibody or equivalent thereof is prepared to a concentration includes amounts yielding upon reconstitution, if in a wet/dry system,
concentrations from about 1.0 μg/ml to about 1000 mg/ml, although lower and higher concentrations are operable and are dependent on the intended delivery vehicle, e.g., solution formulations will differ from transdermal patch, pulmonary, transmucosal, or osmotic or micro pump methods.
[0161] Chemotherapeutic formulations of the present invention can be prepared by a process which comprises mixing at least one antibody or biological equivalent and a preservative selected from the group consisting of phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, alkylparaben, (methyl, ethyl, propyl, butyl and the like), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate and thimerosal or mixtures thereof in an aqueous diluent. Mixing of the antibody and preservative in an aqueous diluent is carried out using conventional dissolution and mixing procedures. For example, a measured amount of at least one antibody in buffered solution is combined with the desired preservative in a buffered solution in quantities sufficient to provide the antibody and preservative at the desired concentrations. Variations of this process would be recognized by one of skill in the art, e.g., the order the components are added, whether additional additives are used, the temperature and pH at which the formulation is prepared, are all factors that can be optimized for the
concentration and means of administration used.
[0162] The compositions and formulations can be provided to patients as clear solutions or as dual vials comprising a vial of lyophilized antibody that is reconstituted with a second vial containing the aqueous diluent. Either a single solution vial or dual vial requiring reconstitution can be reused multiple times and can suffice for a single or multiple cycles of patient treatment and thus provides a more convenient treatment regimen than currently available. Recognized devices comprising these single vial systems include those pen-injector devices for delivery of a solution such as BD Pens, BD Autojectore, Humaject® NovoPen®, B-D®Pen, AutoPen®, and OptiPen®, GenotropinPen®, Genotronorm Pen®, Humatro Pen®, Reco-Pen®, Roferon Pen®, Biojector®, iject®, J-tip Needle-Free Injector®, Intraject®, Medi-Ject®, e.g., as made or developed by Becton Dickensen (Franklin Lakes, N.J. available at bectondickenson.com), Disetronic (Burgdorf, Switzerland, available at disetronic.com; Bioject, Portland, Oregon (available at bioject.com); National Medical Products, Weston Medical (Peterborough, UK, available at weston-medical.com), Medi-Ject Corp (Minneapolis, Minn., available at
mediject.com).
[0163] Various delivery systems are known and can be used to administer a chemotherapeutic agent of the invention, e.g., encapsulation in liposomes, microparticles, microcapsules, expression by recombinant cells, receptor-mediated endocytosis. See e.g., Wu and Wu (1987) J. Biol. Chem. 262:4429-4432 for construction of a therapeutic nucleic acid as part of a retroviral or other vector, etc. Methods of delivery include but are not limited to intra-arterial, intramuscular, intravenous, intranasal and oral routes. In a specific embodiment, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment; this may be achieved by, for example, and not by way of limitation, local infusion during surgery, by injection or by means of a catheter.
[0164] The agents identified herein as effective for their intended purpose can be administered to subjects or individuals identified by the methods herein as suitable for the therapy.
Therapeutic amounts can be empirically determined and will vary with the pathology being treated, the subject being treated and the efficacy and toxicity of the agent.
[0165] Also provided is a medicament comprising an effective amount of a chemotherapeutic as described herein for treatment of a human cancer patient having high or low gene expression or the polymorphism of the gene of interest as identified in the experimental examples.
Kits
[0166] As set forth herein, the invention provides diagnostic methods for determining the polymorphic region or expression level of the gene of interest. In some embodiments, the methods use probes or primers comprising nucleotide sequences which are complementary to the gene of interest. Accordingly, the invention provides kits for performing these methods as well as instructions for carrying out the methods of this invention such as collecting tissue and/or performing the screen, and/or analyzing the results, and/or administration of an effective amount of a selected therapy.
[0167] In an embodiment, the invention provides a kit for determining whether a subject is likely responsive to cancer treatment or alternatively one of various treatment options. The kits contain one of more of the compositions described above and instructions for use. As an example only, the invention also provides kits for determining response to cancer treatment containing a first and a second oligonucleotide specific for the polymorphic region of the gene. Oligonucleotides "specific for" the gene of interest bind either to the gene of interest or bind adjacent to the gene of interest. For oligonucleotides that are to be used as primers for amplification, primers are adjacent if they are sufficiently close to be used to produce a polynucleotide comprising the gene of interest. In one embodiment, oligonucleotides are adjacent if they bind within about 1-2 kb, and preferably less than 1 kb from the gene of interest. Specific oligonucleotides are capable of hybridizing to a sequence, and under suitable conditions will not bind to a sequence differing by a single nucleotide.
[0168] The kit can comprise at least one probe or primer which is capable of specifically hybridizing to the gene of interest and instructions for use. The kits preferably comprise at least one of the above described nucleic acids. Preferred kits for amplifying at least a portion of the gene of interest comprise two primers, at least one of which is capable of hybridizing to the allelic variant sequence. Such kits are suitable for detection of genotype by, for example, fluorescence detection, by electrochemical detection, or by other detection.
[0169] Oligonucleotides, whether used as probes or primers, contained in a kit can be detectably labeled. Labels can be detected either directly, for example for fluorescent labels, or indirectly. Indirect detection can include any detection method known to one of skill in the art, including biotin-avidin interactions, antibody binding and the like. Fluorescently labeled oligonucleotides also can contain a quenching molecule. Oligonucleotides can be bound to a surface. In one embodiment, the preferred surface is silica or glass. In another embodiment, the surface is a metal electrode.
[0170] Yet other kits of the invention comprise at least one reagent necessary to perform the assay. For example, the kit can comprise an enzyme. Alternatively the kit can comprise a buffer or any other necessary reagent.
[0171] The test samples used in the diagnostic kits include cells, protein or membrane extracts of cells, or biological fluids such as sputum, blood, serum, plasma, or urine. The test samples may also be a tumor cell, a normal cell adjacent to a tumor, a normal cell corresponding to the tumor tissue type, a blood cell, a peripheral blood lymphocyte, or combinations thereof. The test sample used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing protein extracts or membrane extracts of cells are known in the art and can be readily adapted in order to obtain a sample which is compatible with the system utilized.
[0172] Conditions for incubating a nucleic acid probe with a test sample depend on the format employed in the assay, the detection methods used, and the type and nature of the nucleic acid probe used in the assay. One skilled in the art will recognize that any one of the commonly available hybridization, amplification or immunological assay formats can readily be adapted to employ the nucleic acid probes for use in the present invention. Examples of such assays can be found in Chard, T. (1986) AN INTRODUCTION TO RADIOIMMUNOASSAY AND
RELATED TECHNIQUES Elsevier Science Publishers, Amsterdam, The Netherlands; Bullock, G.R. et al, TECHNIQUES IN IMMUNOCYTOCHEMISTRY Academic Press, Orlando, FL Vol. 1 (1982), Vol. 2 (1983), Vol. 3 (1985); Tijssen, P. (1985) PRACTICE AND THEORY OF IMMUNOASSAYS: LABORATORY TECHNIQUES IN BIOCHEMISTRY AND
MOLECULAR BIOLOGY, Elsevier Science Publishers, Amsterdam, The Netherlands.
[0173] The test samples used in the diagnostic kits include cells, protein or membrane extracts of cells, or biological fluids such as sputum, blood, serum, plasma, or urine. The test sample used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing protein extracts or membrane extracts of cells are known in the art and can be readily adapted in order to obtain a sample which is compatible with the system utilized.
[0174] The kits can include all or some of the positive controls, negative controls, reagents, primers, sequencing markers, probes and antibodies described herein for determining the subject's genotype in the polymorphic region of the gene of interest.
[0175] As amenable, these suggested kit components may be packaged in a manner customary for use by those of skill in the art. For example, these suggested kit components may be provided in solution or as a liquid dispersion or the like.
Other Uses for the Nucleic Acids of the Invention
[0176] The identification of the polymorphic region or the expression level of the gene of interest can also be useful for identifying an individual among other individuals from the same species. For example, DNA sequences can be used as a fingerprint for detection of different individuals within the same species. Thompson, J. S. and Thompson, eds., (1991) GENETICS IN MEDICINE, W B Saunders Co., Philadelphia, Pa. This is useful, e.g., in forensic studies.
[0177] The invention now being generally described, it will be more readily understood by reference to the following example which is included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention.
EXPERIMENTAL
[0178] LMTK3 is an estrogen receptor a (ERa) regulator. Recent studies show that
[rs808419(r8) and rs9989661(r9)] and LMTK3 expression are prognostic in breast and colon cancers. It was prevsiously demonstrated that r9AA is associated with shorter time to recurrence in Caucasian(C) and Hispanic(H) females(F) with GAC. Applicant investigated the significance of LMTK3 polymorphism in Japanese (J) patients with GAC.
[0179] Methods: Blood or tissue samples of 169 J PTS who had surgery with/without adjuvant chemotherapy (ACT) were analyzed. Genomic DNA was extracted using the QIAmp kit; all samples were analyzed using PCR-based direct DNA-sequencing. The endpoints of the study were disease-free survival (DFS) and overall survival (OS). Kaplan-Meier curves and log-rank test were used for univariate analysis. Multivariate analysis was performed to test the interaction between polymorphism and gender adjusting for other variables. Results: 60 F and 109 males were enrolled in this study, 17% stage(s) IB, 31% s II, 36% s III, 17% s IV (AJCC-6). The median age was 67 (31-88). 65%> of PTS received S-l based ACT. Median follow-up was 4 years(ys). Prognosis was worse in men with r9 AA than AG/GG, at 1 year 67%> (95%> CI 40- 83%) with AA vs 99% (95% CI 91-99%) of AG/GG were alive (p= 0.039). Median survival was not reached in the AG/GG group; in the AA group median DFS and OS was lyr (p= 0.03) and 2ys (p= 0.039) respectively. In the multivariate analysis adjusting for s, age, and ACT, males
carrying AA had increased risk of disease recurrence (HR 3.84 95%CI 1.86-7.92, p< 0.001) and dying (HR 3.47 95%CI 1.58-7.62 p=0.002) compared to those with AG/GG (HR=1, reference).
[0180] Conclusions: r9 AA was associated with significantly worse DFS and OS in Japanese male with GAC. These results confirm our previous findings that LMTK3 is an independent prognostic factor for localized GAC; interestingly the relationship between gender and prognostic significance is the opposite in Japanese vs. Caucasian/Hispanics. The gender disparity can be due to the differences in the etiology (histological subtypes), management strategies, allele frequency, and degree of estrogen exposure in the two populations. Additional studies are warranted to identify the underlying biological mechanism.
[0181] It is to be understood that while the invention has been described in conjunction with the above embodiments, that the foregoing description and examples are intended to illustrate and not limit the scope of the invention. Other aspects, advantages and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains.
Claims
1. A method for treating a Japanese gastrointestinal cancer patient selected for a therapy comprising administration of an effective amount of an adjuvant chemotherapy regimen or equivalent thereof, wherein the patient is selected for the therapy based on the determination of a genotype of A/G or A/G for LMTK3 rs9989661 (r9) (A/G), thereby treating said patient.
2. A method for treating a Japanese gastrointestinal cancer patient selected for a therapy comprising administration of an effective amount of an aggressive chemotherapy regimen, wherein the patient is selected for the therapy based on the determination of a genotype of A/A for LMTK3 rs9989661 (r9) (A/G), thereby treating said patient.
3. The method of claim 1 or 2, wherein the patient is a male patient.
4. The method of any preceding claim, wherein the determination is by screening a cell or tissue sample isolated from the patient for the genotype of for LMTK3 rs9989661 (r9) (A/G) in the patient sample.
5. The method of any preceding claim, wherein the gastrointestinal cancer is a metastatic or non-metastatic (localized) cancer selected from the group of gastric
adenocarcinoma, rectal cancer colorectal cancer, colon cancer, gastric cancer or esophageal cancer.
6. The method of any preceding claim, wherein the gastrointestinal cancer is localized gastric adenocarcinoma.
7. A method for aiding in the determination of and/or identifying a Japanese gastrointestinal cancer patient that is likely or less likely to show responsiveness to a therapy comprising adjuvant chemotherapy, comprising screening a patient cell or tissue sample for the genotype of LMTK3 rs9989661 (r9) (A/G), wherein a genotype of A/G or A/G identifies or determines that the patient is likely to show responsiveness, and A/G identifies or determines tha the patient is not likely to show responsiveness to the therapy.
8. A method for aiding in the determination of and/or identifying a Japanese gastrointestinal cancer patient that is likely to require aggressive therapy, comprising screening a patient cell or tissue sample for the genotype of LMTK3 rs9989661 (r9) (A/G), wherein a genotype of A/A identifies or determines that the patient is likely to require aggressive therapy,
and and G/G or A/G identifies or determines that the patient is not likely to require as aggressive therapy.
9. The method of claim 7, wherein the patient is a male patient.
10. The method of any of claims 7 to 9, further comprising administering an effective amount of the appropriate therapy to the patient identified or determined for the therapy.
11. The method of any one of claims 7 to 10, wherein the patient sample comprises tissue or cells selected from non-metastatic tumor tissue, a non-metastatic tumor cell, metastatic tumor tissue, a metastatic tumor cell, blood or peripheral blood lymphocytes.
12. The method of any one of claims 7 to 10, wherein the patient sample comprises blood or a peripheral blood lymphocytes.
13. The method of any one of claims 7 to 12, wherein the genotype is determined by a method comprising hybridization, direct DNA-sequencing or PCR.
14. The method of any preceding claim, wherein responsiveness to therapy is measured by longer disease free survival, longer overall survival and/or reduced risk of disease recurrence.
15. A kit for treating and/or for aiding in the determination of and/or identifying a Japanese gastrointestinal cancer patient that is likely to require aggressive therapy, probes and/or primers for screening a patient cell or tissue sample for the genotype of LMTK3 rs9989661 (r9) (A/G) and instructions for use.
16. The kit of claim 15, wherein the instructions provide that if the screened sample comprises a LMTK3 genotype of A/A, the patient is likely to require aggressive therapy, and and if the screened sample comprises a LMTK3 genotype of G/G or A/G, the patient is not likely to require aggressive therapy.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201261647448P | 2012-05-15 | 2012-05-15 | |
US61/647,448 | 2012-05-15 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2013172922A1 true WO2013172922A1 (en) | 2013-11-21 |
Family
ID=49584112
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2013/029699 WO2013172922A1 (en) | 2012-05-15 | 2013-03-07 | Lmtk3 genotype analysis for use in predicting outcome and therapy selection |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2013172922A1 (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011124884A2 (en) * | 2010-04-07 | 2011-10-13 | Imperial Innovations Limited | Methods |
-
2013
- 2013-03-07 WO PCT/US2013/029699 patent/WO2013172922A1/en active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011124884A2 (en) * | 2010-04-07 | 2011-10-13 | Imperial Innovations Limited | Methods |
Non-Patent Citations (4)
Title |
---|
BARZI, A. ET AL.: "Prognostic value of lemur tyrosine kinase-3 (LMTK3) polymorphism in Japanese (J) patients (PTS) with localized gastric adenocarcinoma (GAC)", JOURNAL OF CLINICAL ONCOLOGY, vol. 30, no. 15, 20 May 2012 (2012-05-20) * |
LOUPAKIS, F. ET AL.: "LMTK3 polymorphism in patients with metastatic colon cancer", JOURNAL OF CLINICAL ONCOLOGY, vol. 30, no. 4, 1 February 2012 (2012-02-01) * |
WAKATSUKI, T.: "Use of genetic variants of LMTK3 to predict tumor recurrence in female localized gastric adenocarcinoma", JOURNAL OF CLINICAL ONCOLOGY, vol. 30, no. 4, 1 February 2012 (2012-02-01) * |
ZHANG, W. ET AL.: "Association of gender-related tumor recurrence with a polymorphic variant of LMTK3 in stage II and III colon cancer", JOURNAL OF CLINICAL ONCOLOGY, vol. 30, no. 4, 1 February 2012 (2012-02-01) * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20120100997A1 (en) | Cd133 polymorphisms and expression predict clinical outcome in patients with cancer | |
US20120100134A1 (en) | Genetic variants in angiogenesis pathway associated with clinical outcome | |
US20100099720A1 (en) | Gene Polymorphisms as Sex-Specific Predictors in Cancer Therapy | |
WO2013172933A1 (en) | Ethnic gene profile of genes involved in angiogenesis may predict regional bevacizumab efficacy difference in gastric cancer | |
US20110178110A1 (en) | Genotype and Expression Analysis for Use in Predicting Outcome and Therapy Selection | |
US8216781B2 (en) | Gene polymorphisms as predictors of tumor progression and their use in cancer therapy | |
WO2013172918A1 (en) | Ksr1 gene polymorphism for use in predicting outcome and therapy selection | |
US20100152202A1 (en) | Tissue Factor Promoter Polymorphisms | |
US20110160216A1 (en) | Thymidylate Synthase Haplotype is Associated with Tumor Recurrence in Stage II and Stage III Colon Cancer Patients | |
US20120100135A1 (en) | Genetic polymorphisms associated with clinical outcomes of topoisomerase inhibitor therapy for cancer | |
WO2013172932A1 (en) | Colon cancer tumor suppressor gene, b-defensin 1, predicts recurrence in patients with stage ii and iii colon cancer | |
US20120094844A1 (en) | Genetic variants in il-6, p53, mmp-9 and cxcr predict clinical outcome in patients with cancer | |
WO2013172922A1 (en) | Lmtk3 genotype analysis for use in predicting outcome and therapy selection | |
US20120107308A1 (en) | Gene expression levels of egfr, vegfr2, and ercc1 associated with clinical outcomes of chemotherapy | |
US20130023430A1 (en) | Cancer stem cell gene variants are associated with tumor recurrence | |
US20110105529A1 (en) | ERCC-1 Gene Expression Predicts Chemotherapy Outcome | |
US20120107309A1 (en) | Polymorphism in k-ras 3' untranslated region associated with clinical outcomes of cancer treatments independent of k-ras mutation status | |
US20120289410A1 (en) | Genetic variant in formyl peptide receptor 2 (fpr2) predicts clinical outcome in cancer patients | |
US20120289424A1 (en) | Igf1r polymorphism predicts tumor recurrence in breast cancer patients | |
WO2011146411A1 (en) | Grp78 gene polymorphism rs391957 is associated with tumor recurrence and survival in gastrointestinal cancer patients | |
WO2011146405A1 (en) | Egf +61g/a and ts 5'utr 2r/3r polymorphisms predict clinical outcomes in cancer patients undergoing anti-egfr therapy | |
WO2011085334A1 (en) | Cd44 polymorphisms predict clinical outcome in patients with gastric cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13791228 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 13791228 Country of ref document: EP Kind code of ref document: A1 |