NZ620343B2 - Method for predicting risk of hypertension associated with anti-angiogenesis therapy - Google Patents

Abstract

Disclosed is an in vitro method of determining susceptibility of a patient to developing hypertension associated with a therapy comprising an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, said method comprising: (a) determining in a sample derived from a patient suffering from cancer the genotype at polymorphism rs4444903 (SEQ ID NO. 4), and (b) identifying a patient as more or less susceptible to developing hypertension associated with a therapy by an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of GA genotype at polymorphism rs rs4444903 (SEQ ID NO. 4) indicates that said patient is more susceptible to developing hypertension than a patient having a genotype of GG or AA at polymorphism rs4444903 (SEQ ID NO. 4), or the presence of GG or AA genotype at polymorphism rs4444903 (SEQ ID NO. 4) indicates that said patient is less susceptible to developing hypertension than a patient having a genotype of GA at polymorphism rs4444903 (SEQ ID NO. 4). rmining in a sample derived from a patient suffering from cancer the genotype at polymorphism rs4444903 (SEQ ID NO. 4), and (b) identifying a patient as more or less susceptible to developing hypertension associated with a therapy by an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of GA genotype at polymorphism rs rs4444903 (SEQ ID NO. 4) indicates that said patient is more susceptible to developing hypertension than a patient having a genotype of GG or AA at polymorphism rs4444903 (SEQ ID NO. 4), or the presence of GG or AA genotype at polymorphism rs4444903 (SEQ ID NO. 4) indicates that said patient is less susceptible to developing hypertension than a patient having a genotype of GA at polymorphism rs4444903 (SEQ ID NO. 4).

Description

Case 30616 Method for predicting risk of hypertension ated with anti-angiogenesis therapy Field of the Invention The present invention is directed to methods of predicting the risk of hypertension in patients undergoing anti-angiogenesis therapy, including a therapy with bevacizumab. ound of the Invention Angiogenesis contributes to benign and malignant diseases such as cancer development and, ally in cancer, is ary for primary tumor growth, invasiveness and metastasis. In order to grow, a tumor must undergo an angiogenic switch. Vascular endothelial growth factor (VEGF) is required to induce this enic switch. VEGF and the genes in the VEGF pathway are considered important mediators of cancer progression. The VEGF gene family includes the VEGF gene, also ed to as VEGFA, homologues to VEGF including, placenta growth factor (PlGF), VEGFB, VEGFC, VEGFD, the VEGF ors, ing 1 and VEGFR-2 (also referred to as FLT1 and FLK1/KDR, respectively), the VEGF inducers, including hypoxiainducible factors HIF1α, HIF2 α, and the oxygen sensors PHD1, PHD2 and PHD3.

The importance of this pathway in cancer cell growth and metastasis has led to the development of anti-angiogenesis agents for use in cancer therapy. These therapies include, among others, bevacizumab, pegaptanib, sunitinib, sorafenib and vatalanib. Despite significantly prolonged al obtained with angiogenesis inhibitors, such as bevacizumab, patients still succumb to cancer. Further, not all patients respond to angiogenesis inhibitor y. The mechanism underlying the non-responsiveness remains unknown. Moreover, angiogenesis inhibitor therapy is associated with side effects, such as gastrointestinal perforation, thrombosis, bleeding, hypertension and proteinuria.

AOK / 31.07.2012 Accordingly, there is a need for methods of determining which patients respond particular well to angiogenesis inhibitor therapy and/or which patients are tible to side effects associated with anti-angiogenesis treatments.

Summary of the Invention Described herein is a method of determining susceptibility of a patient to developing hypertension associated with a therapy by an angiogenesis inhibitor, such as bevacizumab, by determining the pe at polymorphism rs2305949 (SEQ ID NO. 3) in KDR and/or rs4444903 (SEQ ID NO. 4) in EGF, which is ated with a reduced risk of hypertension.

Also described herein is a pharmaceutical composition comprising an angiogenesis inhibitor, such as zumab, for the treatment of a patient ing from cancer and having the genotype at polymorphism rs2305949 (SEQ ID NO. 3) and/or rs4444903 (SEQ ID NO. 4) associated with a reduced risk of hypertension. Also described herein is a method for reducing the risk of ension associated with an anti-angiogenesis therapy, such as bevacizumab, in a patient ing from cancer by detecting the genotype at rs2305949 (SEQ ID NO. 3) and/or rs4444903 (SEQ ID NO. 4) which is linked with a reduced risk of hypertension.

Described herein are methods of ining susceptibility of a patient to developing hypertension associated with a therapy comprising an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab.

The methods comprise (a) determining in a sample derived from a t suffering from cancer the genotype at rphism rs2305949 (SEQ ID NO. 3), and (b) identifying a patient as more or less susceptible to developing hypertension associated with a therapy by an enesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the ce of CC genotype at polymorphism rs2305949 (SEQ ID NO. 3) indicates that said patient is more susceptible to ping hypertension than a patient having a genotype of CT or TT at polymorphism rs2305949 (SEQ ID NO. 3), or the presence of CT or TT pe at polymorphism rs2305949 (SEQ ID NO. 3) indicates that said patient is less susceptible to developing hypertension than a patient having a genotype of CC at polymorphism rs2305949 (SEQ ID NO. 3). In some embodiments, the methods are in vitro methods. In some embodiments, the therapy further comprises a chemotherapeutic agent or chemotherapy regimen.

In some embodiments, the angiogenesis inhibitor is administered with one or more agents selected from the group consisting of taxanes, interferon alpha, 5-fluorouracil, leucovorin, irinotecan, gemcitabine-erlotinib and platinum-based chemotherapeutic agents. In some embodiments, the cancer is pancreatic cancer, renal cell cancer, colorectal cancer, breast cancer or lung cancer. In some embodiments, the sample is a blood sample. In some ments, the genotype is determined by means of MALDI-TOF mass spectrometry. In some embodiments, the methods further se administering the therapy to the patient.

Also described are pharmaceutical compositions comprising an enesis inhibitor as defined herein for the treatment of a patient in need f, wherein said patient has been determined to be less susceptible to developing hypertension ated with a therapy comprising by the angiogenesis inhibitor in accordance with the method described herein.

Also described are kits for carrying out the methods described herein. The kits comprise oligonucleotides capable of determining the genotype at rphism rs2305949 (SEQ ID NO. 3).

Also described herein are methods of reducing the risk of developing ension associated with a therapy comprising an angiogenesis inhibitor comprising bevacizumab or an dy that binds essentially the same epitope on VEGF as bevacizumab. The methods comprise (a) determining in a sample derived from a patient ing from cancer the genotype at polymorphism rs2305949 (SEQ ID NO. 3); (b) identifying a patient as less tible to ping hypertensin associated with a therapy by an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, wherein the presence of CT or TT genotype at polymorphism rs2305949 (SEQ ID NO. 3) indicates that said patient is less susceptible to developing hypertension than a patient having a genotype of CC at polymorphism rs2305949 (SEQ ID NO. 3); and (c) administering said angiogenesis inhibitor to a patient with the CT or TT genotype at polymorphism rs2305949 (SEQ ID NO. 3) identified as less susceptible to developing ension in accordance with (b). In some ments, the therapy further comprises a chemotherapeutic agent or chemotherapy regimen. In some embodiments, the angiogenesis inhibitor is stered with one or more agents selected from the group consisting of taxanes, interferon alpha, 5-fluorouracil, leucovorin, irinotecan, gemcitabineerlotinib and platinum-based chemotherapeutic agents. In some embodiments, the cancer is pancreatic cancer, renal cell cancer, colorectal cancer, breast cancer or lung cancer. In some embodiments, the sample is a blood . In some embodiments, the genotype is determined by means of MALDI-TOF mass spectrometry.

Also described herein are methods of treating a patient. The methods comprise administering to the patient therapy comprising an angiogenensis inhibitor comprising bevacizumab or an antibody that binds ially the same epitope on VEGF as bevacizumab wherein the patient genotype at polymorphism rs2305949 (SEQ ID NO. 3) has been determined to be CT or TT.

In an embodiment, the invention es in vitro methods of determining susceptibility of a patient to developing hypertension associated with a therapy comprising an angiogenesis inhibitor comprising zumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab The methods comprise (a) determining in a sample derived from a patient suffering from cancer the pe at polymorphism rs4444903 (SEQ ID NO. 4), and (b) identifying a patient as more or less tible to developing hypertension associated with a therapy by an angiogenesis inhibitor comprising bevacizumab or an dy that binds essentially the same epitope on VEGF as zumab based on said genotype, wherein the presence of GA genotype at polymorphism rs 903 (SEQ ID NO. 4) indicates that said t is more susceptible to developing hypertension than a patient having a genotype of GG or AA at polymorphism rs4444903 (SEQ ID NO. 4), or the presence of GG or AA genotype at polymorphism rs4444903 (SEQ ID NO. 4) indicates that said patient is less susceptible to developing hypertension than a patient having a genotype of GA at polymorphism rs4444903 (SEQ ID NO. 4). In some embodiments, the therapy further comprises a chemotherapeutic agent or chemotherapy n. In some embodiments, the enesis inhibitor is administered with one or more agents selected from the group consisting of taxanes, interferon alpha, 5- fluorouracil, leucovorin, irinotecan, gemcitabine-erlotinib and platinum-based chemotherapeutic agents. In some ments, the cancer is pancreatic cancer, renal cell cancer, colorectal cancer, breast cancer or lung cancer. In some embodiments, the sample is a blood sample. In some embodiments, the genotype is determined by means of MALDI-TOF mass spectrometry.

Also described are methods that further comprise administering the therapy to the patient.

A further embodiment of the invention es the use of an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same e on VEGF as bevacizumab, for the manufacture of a medicament for the treatment of cancer in a t in need thereof, wherein said patient has been determined to be less susceptible to developing hypertension associated with a therapy by the angiogenesis inhibitor in accordance with the method of the ion.

Also described herein are pharmaceutical itions comprising an angiogenesis inhibitor as defined herein for the treatment of a patient in need thereof, wherein said patient has been determined to be less susceptible to developing ension associated with a therapy by the angiogenesis inhibitor in accordance with the methods described herein.

Also described herien is the use of an angiogenensis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab for the manufacture of a medicament for treating cancer in a patient, n the patient genotype at polymorphism rs4444903 (SEQ ID NO. 4) has been determined to be GG or AA.

Also described are kits for carrying out the methods bed herein. The kits comprise ucleotides capable of determining the genotype at polymorphism rs4444903 (SEQ ID NO.

A r embodiment of the invention provides the use of an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab in the manufacture of a medicament for the treatment of cancer in a patient in need f, n said t has been determined to be less susceptible to developing hypertension associated with a therapy by the angiogenesis inhibitor by an in vitro method comprising: (a) determining in a sample derived from a patient suffering from cancer the genotype at polymorphism rs4444903 (SEQ ID NO. 4); and (b) identifying a patient as less susceptible to developing hypertension associated with a therapy by an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as zumab, wherein the presence of GG or AA genotype at rphism rs4444903 (SEQ ID NO. 4) indicates that said patient is less susceptible to developing hypertension than a patient having a genotype of GA at polymorphism rs4444903 (SEQ ID NO. 4).

Also described herein are methods of reducing the risk of developing ension associated with a therapy comprising an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab. The methods comprise (a) determining in a sample derived from a patient suffering from cancer the genotype at polymorphism 903 (SEQ ID NO. 4); (b) identifying a patient as less tible to developing hypertensin associated with a therapy by an angiogenesis inhibitor comprising zumab or an antibody that binds ially the same epitope on VEGF as bevacizumab, wherein the presence of GG or AA genotype at polymorphism rs4444903 (SEQ ID NO. 4) indicates that said patient is less susceptible to developing hypertension than a patient having a pe of GA at polymorphism rs4444903 (SEQ ID NO. 4); and (c) stering said angiogenesis inhibitor to a patient with the GG or AA genotype at polymorphism rs4444903 (SEQ ID NO. 4) fied as less susceptible to developing hypertension in accordance with (b).

In some embodiments, the y further comprises a chemotherapeutic agent or chemotherapy regimen. In some ments, the angiogenesis inhibitor is administered with one or more agents selected from the group consisting of taxanes, interferon alpha, 5-fluorouracil, leucovorin, irinotecan, gemcitabine-erlotinib and platinum-based chemotherapeutic agents. In some embodiments, the cancer is pancreatic cancer, renal cell cancer, colorectal cancer, breast cancer or lung cancer. In some embodiments, the sample is a blood sample. In some embodiments, the genotype is determined by means of MALDI-TOF mass spectrometry.

Also described are methods of treating a patient. The methods sing administering to the patient therapy comprising an angiogenensis inhibitor comprising bevacizumab or an antibody that binds essentially the same e on VEGF as bevacizumab wherein the patient genotype at polymorphism rs4444903 (SEQ ID NO. 4) has been determined to be GG or AA.

Brief Description of the Drawings Figure 1: Endpoint distributions of clinical data. Kaplan-Meier plot of Progression-free Survival (PFS).

Figure 2: Endpoint distributions of al data. Kaplan-Meier plot of Overall Survival (OS).

Figure 3: Endpoint distributions of clinical data. Bar chart of Best Overall Response (BOR).

Rates of BOR were 49% in BEV-treated subjects and 46% in PBO-treated subjects.

Figure 4: Endpoint distributions of clinical data. Bar chart of Hypertension not unrelated to study drug. Rates of hypertension were 18% in BEV-treated subjects and 7% in PBO-treated subjects.

Figure 5: Association analysis s for VEGFA and PFS in the Leuven efficacy panel analysis.

Figure 6: Forest plot for rs699946 (SEQ ID NO. 1) in VEGFA when tested for association against PFS.

Figure 7: Forest plot for the association of rs12505758 (SEQ ID NO. 2) with OS in white BEV- treated subjects.

Figure 8: Kaplan Meier plots for association between rs12505758 (SEQ ID NO. 2) and OS.

Figure 9: Hypertension frequencies in correlation to rs2305949 (SEQ ID NO. 3) (KDR).

Figure 10: Forest plot for rs2305949 (SEQ ID NO. 3) in KDR, for hypertension in white BEV- treated subjects.

Figure 11: Hypertension frequencies in correlation to rs4444903 (SEQ ID NO. 4) (EGF).

Figure 12: Forest plot for rs4444903 (SEQ ID NO. 4) in EGF and hypertension in PGx-SP-BEV- White.

Figure 13: Forest plot for the association of rs11133360 (SEQ ID NO. 5) with PFS in white BEV-treated subjects.

Figure 14: ce of SNPs genotyped in the meta-analysis and associated with bevacizumab outcome. SEQ ID NO.1 corresponds to rs699946, wherein on 51 is A or G. SEQ ID NO.2 corresponds to rs12505758, n position 51 is C or T. SEQ ID NO.3 corresponds to rs2305949, wherein position 51 is C or T. SEQ ID NO.4 corresponds to 903, n position 51 is A or G. SEQ ID NO.5 corresponds to rs11133360, wherein on 51 is C or T.

Detailed Description of the Embodiments 1. Definitions The term "administering" means the administration of a pharmaceutical composition, such as an angiogenesis inhibitor, to the patient. For example, 2.5 mg/kg of body weight to 15 mg/kg of body weight bevacizumab (Avastin®) can be stered every week, every 2 weeks or every 3 weeks, ing on the type of cancer being treated. Particular dosages include 5 mg/kg, 7.5 mg/kg, 10 mg/kg and 15 mg/kg. Even more particular dosages are 5 mg/kg every 2 weeks, 10 mg/kg every 2 weeks and 15 mg/kg every 3 weeks.

The term "angiogenesis inhibitor" in the context of the present ion refers to all agents that alter angiogenesis (e.g. the process of forming blood vessels) and includes agents that inhibit the angiogenesis, including, but not limited to, tumor angiogenesis. In this context, inhibition can refer to blocking the formation of blood vessels and halting or slowing down the growth of blood vessels. Examples of angiogenesis inhibitors include bevacizumab (also known as Avastin®), pegaptanib, sunitinib, sorafenib and vatalanib. Bevacizumab is a recombinant humanized monoclonal IgG1 antibody that binds to and ts the biological activity of human VEGFA in in vitro and in vivo assay system. The term "bevacizumab" encompass all corresponding anti- VEGF antibodies that fulfill the ements necessary for obtaining a marketing authorization as an identical or biosimilar t in a country or territory ed from the group of countries consisting of the USA, Europe and Japan. In the context of the present invention, an angiogenesis inhibitor includes an antibody that binds essentially the same epitope on VEGF as bevacizumab, more specifically an antibody that binds to the same epitope on VEGF as bevacizumab. An antibody binds "essentially the same epitope" as a reference antibody, when the two antibodies recognize identical or sterically pping epitopes. The most widely used and rapid methods for determining whether two epitopes bind to identical or sterically overlapping epitopes are competition assays, which can be configured in all number of different formats, using either labeled n or d antibody. Usually, the n is immobilized on a 96-well plate, and the ability of unlabeled antibodies to block the binding of labeled antibodies is measured using radioactive or enzyme labels.

The term “cancer” refers to the physiological condition in mammals that is typically characterized by unregulated cell proliferation. Examples of cancer include but are not limited to, carcinoma, ma, blastoma, sarcoma and leukemia. More particular examples of such cancers include squamous cell cancer, lung cancer ding small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, and squamous carcinoma of the lung), cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer (including gastrointestinal cancer), pancreatic cancer (including metastic atic cancer), glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer (including locally advanced, recurrent or metastatic HER-2 negative breast cancer), colon , colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic oma and s types of head and neck , as well as B-cell ma (including low grade/follicular non-Hodgkin's lymphoma (NHL); small lymphocytic (SL) NHL; intermediate grade/follicular NHL; intermediate grade diffuse NHL; high grade immunoblastic NHL; high grade lymphoblastic NHL; high grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; and Waldenstrom's Macroglobulinemia); c cytic leukemia (CLL); acute lymphoblastic leukemia (ALL); Hairy cell leukemia; chronic myeloblastic leukemia; and post-transplant lymphoproliferative disorder (PTLD), as well as abnormal vascular proliferation associated with phakomatoses, edema (such as that associated with brain tumors), and Meigs' me.

The term "chemotherapeutic agent" or "chemotherapy regimen" includes any active agent that can e an anticancer therapeutic effect and may be a chemical agent or a biological agent, in particular, that are capable of interfering with cancer or tumor cells. Particular active agents are those that act as anti-neoplastic (chemotoxic or chemostatic) agents which inhibit or prevent the pment, maturation or proliferation of malignant cells. Examples of chemotherapeutic agents include alkylating agents such as nitrogen ds (e.g., mechlorethamine, hosphamide, ifosfamide, melphalan and chlorambucil), nitrosoureas (e.g., carmustine (BCNU), ine , and semustine (methyl-CCNU)), ethylenimines/ methylmelamines (e.g., thriethylenemelamine (TEM), triethylene, thiophosphoramide (thiotepa), hexamethylmelamine (HMM, altretamine)), alkyl sulfonates (e.g., busulfan), and triazines (e.g., dacarbazine ); antimetabolites such as folic acid analogs (e.g., methotrexate, rexate), pyrimidine s (e.g., 5-fluorouracil, capecitabine, fluorodeoxyuridine, abine, cytosine arabinoside (AraC, cytarabine), 5-azacytidine, 2,2′-difluorodeoxycytidine), and purine s (e.g., 6-mercaptopurine, guanine, azathioprine, 2′-deoxycoformycin (pentostatin), erythrohydroxynonyladenine (EHNA), fludarabine phosphate, and 2-chlorodeoxyadenosine (cladribine, 2-CdA)); antimitotic drugs developed from natural products (e.g., paclitaxel, vinca alkaloids (e.g., vinblastine (VLB), vincristine, and vinorelbine), docetaxel, estramustine, and estramustine phosphate), epipodophylotoxins (.e.g., etoposide, teniposide), antibiotics (.e.g, mycin D, daunomycin (rubidomycin), daunorubicon, doxorubicin, epirubicin, mitoxantrone, idarubicin, bleomycins, plicamycin (mithramycin), mitomycinC, actinomycin), enzymes (e.g., L-asparaginase), and biological response modifiers (e.g., interferon-alpha, IL-2, G-CSF, GM-CSF); miscellaneous agents including platinum coordination complexes (e.g., cisplatin, carboplatin, oxaliplatin), anthracenediones (e.g., mitoxantrone), substituted urea (i.e., hydroxyurea), methylhydrazine tives (e.g., N-methylhydrazine (MIH), bazine), adrenocortical suppressants (e.g., mitotane (o,p′-DDD), aminoglutethimide); hormones and antagonists including adrenocorticosteroid antagonists (.e.g, prednisone and equivalents, dexamethasone, aminoglutethimide), progestins (e.g., hydroxyprogesterone caproate, medroxyprogesterone acetate, megestrol acetate), estrogens (e.g., diethylstilbestrol, ethinyl estradiol and lents thereof); trogens (e.g., tamoxifen), androgens (e.g., testosterone propionate, fluoxymesterone and equivalents thereof), antiandrogens (e.g., flutamide, gonadotropin-releasing hormone analogs, leuprolide), non-steroidal antiandrogens (e.g., flutamide), epidermal growth factor tors (e.g., erlotinib, lapatinib, gefitinib) antibodies (e.g., trastuzumab), irinotecan and other agents such as leucovorin. For the treatment of metastatic pancreatic cancer, chemotherapeutic agents for stration with zumab include gemcitabine and erlotinib and combinations thereof (see also the es herein provided). For the treatment of renal cell cancer, chemotherapeutic agents for administration with bevacizumab e interferon alpha (see also the es herein provided).

The term “allele” refers to a nucleotide sequence variant of a gene of interest.

The term “genotype” refers to a description of the alleles of a gene contained in an individual or a sample. In the context of this invention, no distinction is made n the genotype of an individual and the genotype of a sample originating from the individual. Although typically a genotype is determined from samples of diploid cells, a genotype can be determined from a sample of d cells, such as a sperm cell.

The terms "oligonucleotide" and "polynucleotide" are used interchangeably and refer to a molecule comprised of two or more deoxyribonucleotides or ribonucleotides, preferably more than three. Its exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. An oligonucleotide can be derived synthetically or by cloning. Chimeras of ibonucleotides and ribonucleotides may also be in the scope of the present invention.

The term “polymorphism” refers to the occurrence of two or more genetically determined ative sequences of a gene in a tion. Typically, the first identified allelic form is arbitrarily designated as the reference form and other allelic forms are designated as alternative or variant alleles. The allelic form occurring most frequently in a selected population is sometimes referred to as the wildtype form.

The term a “single nucleotide polymorphism” or “SNP” is a site of one nucleotide that varies n s. Single nucleotide polymorphisms may occur at any region of the gene. In some instances the polymorphism can result in a change in protein sequence. The change in protein sequence may affect protein function or not.

The term "hypertension" refers to high blood pressure. The “hypertension associated with a therapy” can be measured with different grades according to the National Cancer Institute’s Common Terminology ia for Adverse Events (CTCAE v2-3). As the skilled person will appreciate, a patient is more susceptible to developing hypertension, if the patient belongs to a subgroup of patients that has a statistically significant likelihood of developing hypertension as compared to r subgroup of patients. Likewise, a patient is less susceptible to developing hypertension, if the patient belongs to a subgroup of ts that has a statistically significant likelihood of not developing hypertension as compared to another subgroup of patients.

The term "patient" refers to any single animal, more specifically a mammal (including such nonhuman animals as, for e, dogs, cats, horses, s, zoo animals, cows, pigs, sheep, and non-human primates) for which treatment is d. Even more specifically, the patient herein is a human. In the context of the present invention, the patient may be a white subject.

The term “subject” herein is any single human subject, including a patient, eligible for treatment who is experiencing or has experienced one or more signs, ms, or other indicators of an angiogenic disorder. Intended to be included as a subject are any subjects involved in al research trials not showing any clinical sign of disease, or subjects involved in iological studies, or subjects once used as controls. The subject may have been previously treated with an anti-cancer agent, or not so treated. The subject may be naïve to an additional agent(s) being used when the ent herein is started, i.e., the subject may not have been previously treated with, for example, an anti-neoplastic agent, a herapeutic agent, a growth inhibitory agent, a cytotoxic agent at ine” (i.e., at a set point in time before the administration of a first dose of an anti-cancer in the treatment method herein, such as the day of screening the subject before treatment is commenced). Such "naïve" subjects are generally considered to be candidates for treatment with such additional agent(s).

The term "a patient suffering from" refers to a patient showing clinical signs in respect to a n malignant disease, such as cancer, a disease involving logical and pathological angiogenesis and/or tumorous disease.

As used herein, “therapy” or “treatment” refers to clinical intervention in an attempt to alter the natural course of the individual or cell being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable s of treatment include preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of e progression, amelioration or palliation of the e state, and remission or improved prognosis.

The term ll survival" refers to the length of time during and after ent the patient survives.

The term "progression-free survival" refers to the length of time during and after treatment during which, according to the assessment of the treating ian or investigator, the patient's e does not become worse, i.e., does not progress.

The term "pharmaceutical composition" refers to a sterile preparation that is in such form as to permit the biological activity of the medicament to be effective, and which contains no additional components that are unacceptably toxic to a subject to which the formulation would be administered. 2. Detailed Embodiments In the present ion, variations in the KDR and EGF genes were surprisingly identified as markers/predictors for susceptibility to developing hypertension associated with treatment by an angiogenesis inhibitor. The terms "marker" and "predictor" can be used interchangeably and refer to specific allele variants of genes. The variation or marker may also be referred to as a single nucleotide polymorphism (SNP).

In accordance with the methods of the present invention, a meta-analysis of SNPs was conducted using the samples derived from five Phase II and Phase III trials with bevacizumab, i.e.

NO16966 (advanced y colorectal cancer, see, Saltz et al., 2008, J. Clin. Oncol. 26:2013- 2019 and z et al., 2004, N. Engl. J. Med. 350:2335-2342), AVITA (pancreatic cancer, see, Van Cutsem, J. Clin. Oncol. 2009 27:2231-2237), AVAiL (non-small cell lung cancer, see, Reck et al., J. Clin. Oncol. 2009 27:1227), AVOREN (renal cancer, see, er et al., J. Clin. Oncol. 2010 28:2144) and AVADO (breast cancer, see, Miles, J. Clin. Oncol. 2010 28:3239).

As shown in the examples, ten SNPs were associated with bevacizumab-induced hypertension ), but none of these surpassed the threshold for multiple testing (p<0.0003). The two SNPs showing the strongest association (p<0.01) were: rs2305949 (SEQ ID NO. 3) in KDR (allelic OR 0.93, 95% CI 0.88–0.98, p=0.0067) and rs4444903 (SEQ ID NO. 4) in EGF (allelic OR 1.06, 95% CI 1.02–1.11, 52). For rs2305949 (SEQ ID NO. 3) (KDR), CC carriers (wildtype) showed a higher ncy of developing hypertension when treated with BEV, while patients treated with placebo did show a rather opposite result, showing highest hypetrtension frequency in patients carrying TT. For rs4444903 (SEQ ID NO. 4) (EGF), the heterozygote GA carriers showed the highest frequency of hypertension, an effect that was not seen in the placebo treated patients, as no ences were seen between different genotypes. Interestingly, rs2305949 (SEQ ID NO. 3) and rs4444903 (SEQ ID NO. 4) were closely linked to amino acid changes occurring on position 273 and 708 of KDR and EGF, suggesting that these changes may functionally affect both genes and thereby bute to hypertension.

Accordingly, described herein is an in vitro method of ining susceptibility of a patient to developing hypertension associated with a y by an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, said method comprising: (a) determining in a sample derived from a patient suffering from cancer the genotype at polymorphism rs2305949 (SEQ ID NO. 3), and (b) identifying a patient as more or less tible to developing hypertension associated with a therapy by an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of CC pe at polymorphism rs2305949 (SEQ ID NO. 3) indicates that said patient is more susceptible to developing hypertension than a patient having a genotype of CT or TT at polymorphism 949 (SEQ ID NO. 3), or the presence of CT or TT genotype at polymorphism rs2305949 (SEQ ID NO. 3) indicates that said patient is less tible to ping hypertension than a patient having a pe of CC at polymorphism rs2305949 (SEQ ID NO. 3). In an embodiment, cancer is selected from the group consisting of colorectal cancer, glioblastoma, renal , ovarian cancer, breast cancer, pancreatic cancer, gastric cancer and lung cancer, more specifically colorectal cancer, renal cancer, breast cancer, pancreatic cancer and lung cancer, even more specifically colorectal cancer, renal cancer and lung cancer.

Also described herein is a pharmaceutical composition comprising an angiogenesis inhibitor that ses bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, for the treatment of a patient in need f, wherein said patient has been determined to be less susceptible to developing hypertension associated with a therapy by the angiogenesis inhibitor by an in vitro method comprising: (a) determining in a sample derived from a patient suffering from cancer the genotype at rphism rs2305949 (SEQ ID NO. 3), and (b) identifying a patient as more or less susceptible to developing hypertension associated with a therapy by an angiogenesis inhibitor sing bevacizumab or an antibody that binds essentially the same epitope on VEGF as zumab based on said genotype, wherein the presence of CC genotype at polymorphism 949 (SEQ ID NO. 3) indicates that said patient is more susceptible to developing hypertension than a patient having a pe of CT or TT at polymorphism rs2305949 (SEQ ID NO. 3), or the presence of CT or TT genotype at polymorphism rs2305949 (SEQ ID NO. 3) indicates that said patient is less tible to developing hypertension than a patient having a genotype of CC at rphism rs2305949 (SEQ ID NO. 3). In an embodiment, cancer is selected from the group consisting of colorectal cancer, glioblastoma, renal cancer, ovarian cancer, breast cancer, pancreatic cancer, gastric cancer and lung cancer, more specifically colorectal cancer, renal , breast cancer, pancreatic cancer and lung cancer, even more specifically colorectal cancer, renal cancer and lung cancer.

Also described herein is a method of reducing the risk of developing hypertension associated with a therapy by an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, said method comprising: (a) ining in a sample derived from a patient suffering from cancer the genotype at polymorphism rs2305949 (SEQ ID NO. 3); (b) identifying a patient as less susceptible to ping hypertensin associated with a therapy by an angiogenesis inhibitor sing bevacizumab or an antibody that binds ially the same epitope on VEGF as bevacizumab, wherein the presence of CT or TT genotype at polymorphism 949 (SEQ ID NO. 3) indicates that said patient is less susceptible to developing hypertension than a patient having a genotype of CC at polymorphism rs2305949 (SEQ ID NO. 3); and (c) administering said enesis inhibitor to a patient with the CT or TT genotype at polymorphism rs2305949 (SEQ ID NO. 3) identified as less susceptible to developing hypertension in accordance with (b). In an embodiment, cancer is selected from the group consisting of ctal cancer, glioblastoma, renal cancer, ovarian cancer, breast cancer, pancreatic cancer, gastric cancer and lung cancer, more specifically colorectal cancer, renal cancer, breast cancer, pancreatic cancer and lung cancer, even more specifically ctal cancer, renal cancer and lung cancer.

The present invention also provides an in vitro method of ining susceptibility of a t to developing hypertension associated with a therapy by an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, said method comprising: (a) determining in a sample derived from a patient suffering from cancer the genotype at polymorphism rs4444903 (SEQ ID NO. 4), and (b) fying a patient as more or less susceptible to developing hypertension associated with a therapy by an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of GA genotype at polymorphism rs4444903 (SEQ ID NO. 4) indicates that said patient is more susceptible to developing hypertension than a t having a genotype of GG or AA at polymorphism rs4444903 (SEQ ID NO. 4), or the presence of GG or AA genotype at polymorphism rs4444903 (SEQ ID NO. 4) indicates that said patient is less susceptible to developing hypertension than a patient having a genotype of GA at rphism rs4444903 (SEQ ID NO. 4). In an embodiment, cancer is selected from the group consisting of colorectal cancer, glioblastoma, renal cancer, ovarian , breast cancer, pancreatic cancer, c cancer and lung cancer, more specifically colorectal cancer, renal cancer, breast , pancreatic cancer and lung , even more specifically colorectal cancer, renal cancer and breast cancer.

The present invention further provides the use of an angiogenesis inhibitor that comprises zumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, for the manufacture of a medicament for the treatment of cancer in a t in need thereof, wherein said patient has been determined to be less susceptible to developing hypertension associated with a therapy by the enesis inhibitor by an in vitro method comprising: (a) determining in a sample derived from a patient suffering from cancer the genotype at polymorphism rs4444903 (SEQ ID NO. 4), and (b) identifying a patient as more or less susceptible to developing hypertension associated with a therapy by an angiogenesis inhibitor comprising bevacizumab or an dy that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of GA genotype at polymorphism rs4444903 (SEQ ID NO. 4) tes that said patient is more susceptible to developing hypertension than a patient having a genotype of GG or AA at polymorphism rs4444903 (SEQ ID NO. 4), or the ce of GG or AA genotype at polymorphism rs4444903 (SEQ ID NO. 4) tes that said patient is less susceptible to developing hypertension than a patient having a genotype of GA at polymorphism rs4444903 (SEQ ID NO. 4). In an embodiment, cancer is selected from the group consisting of colorectal cancer, glioblastoma, renal cancer, ovarian cancer, breast cancer, pancreatic cancer, gastric cancer and lung cancer, more specifically colorectal cancer, renal cancer, breast cancer, pancreatic cancer and lung cancer, even more specifically colorectal cancer, renal cancer and breast cancer.

Also bed herein is a method of ng the risk of ping hypertension associated with a therapy by an angiogenesis inhibitor comprising bevacizumab or an antibody that binds ially the same epitope on VEGF as bevacizumab, said method comprising: (a) determining in a sample derived from a patient suffering from cancer the genotype at polymorphism rs4444903 (SEQ ID NO. 4); (b) identifying a patient as less susceptible to developing hypertensin associated with a therapy by an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, wherein the ce of GG or AA genotype at rphism rs4444903 (SEQ ID NO. 4) indicates that said patient is less susceptible to developing hypertension than a patient having a genotype of GA at polymorphism rs4444903 (SEQ ID NO. 4); and (c) administering said angiogenesis inhibitor to a patient with the GG or AA genotype at polymorphism rs4444903 (SEQ ID NO. 4) identified as less susceptible to developing hypertension in accordance with (b). In an embodiment, cancer is selected from the group consisting of colorectal cancer, glioblastoma, renal cancer, ovarian cancer, breast , atic cancer, gastric cancer and lung cancer, more ically colorectal cancer, renal cancer, breast cancer, pancreatic cancer and lung cancer, even more ically colorectal cancer, renal cancer and lung cancer.

In an embodiment, the angiogenesis inhibitor is administered as a atment with a chemotherapeutic agent or chemotherapy regimen. In a further embodiment, the enesis inhibitor is administered with one or more agents selected from the group consisting of taxanes such as docetaxel and paclitaxel, interferon alpha, 5-fluorouracil, leucovorin, irinotecan, gemcitabine-erlotinib and um-based chemotherapeutic agents such as carboplatin, cisplatin and oxaliplatin. Further, the angiogenesis inhibitor may be stered as a co-treatment with radiotherapy.

In the context of the present invention, the sample is a biological sample and may be a blood and/or tissue sample. In an ment, the sample is a blood sample, more specifically a peripheral blood sample. In the context of the present invention, the sample is a DNA sample.

The DNA sample may be ne DNA or somatic DNA, more specifically germline DNA.

In one embodiment, the genotype is determined by means of MALDI-TOF mass spectrometry.

In addition to the detailed description of the detection of SNPs below, the ing reference es guidance for MALDI-TOF mass spectrometry-based SNP genotyping, e.g. Storm et al., Methods Mol. Biol. 212:241-62, 2003. 3. Detection of Nucleic Acid Polymorphisms Detection techniques for evaluating nucleic acids for the presence of a SNP involve procedures well known in the field of molecular genetics. Many, but not all, of the methods involve ication of nucleic acids. Ample ce for ming amplification is provided in the art. Exemplary references include manuals such as PCR Technology: Principles and ations for DNA Amplification (ed. H. A. Erlich, Freeman Press, NY, N.Y., 1992); PCR Protocols: A Guide to Methods and Applications (eds. Innis, et al., Academic Press, San Diego, Calif., 1990); Current Protocols in Molecular Biology, Ausubel, 1994-1999, including supplemental updates h April 2004; Sambrook & Russell, Molecular Cloning, A Laboratory Manual (3rd Ed, 2001). General methods for detection of single nucleotide polymorphisms are disclosed in Single Nucleotide Polymorphisms: Methods and Protocols, Pui- Yan Kwok, ed., 2003, Humana Press.

Although the s typically employ PCR steps, other amplification protocols may also be used. Suitable amplification methods include ligase chain reaction (see, e.g., Wu & Wallace, Genomics 4:560-569, 1988); strand displacement assay (see, e.g. Walker et al., Proc. Natl. Acad.

Sci. USA 89:392-396, 1992; U.S. Pat. No. 5,455,166); and several transcription-based amplification systems, including the methods described in U.S. Pat. Nos. 5,437,990; 5,409,818; and 5,399,491; the transcription amplification system (TAS) (Kwoh et al., Proc. Natl. Acad. Sci.

USA 86:1173-1177, 1989); and self-sustained sequence ation (3SR) (Guatelli et al., Proc.

Natl. Acad. Sci. USA 87:1874-1878, 1990; WO 92/08800). Alternatively, methods that amplify the probe to detectable levels can be used, such as licase amplification (Kramer & Lizardi, Nature 339:401-402, 1989; Lomeli et al., Clin. Chem. 35:1826-1831, 1989). A review of known amplification methods is provided, for e, by Abramson and Myers in Current n in Biotechnology 4:41-47, 1993. ion of the genotype, haplotype, SNP, microsatellite or other rphism of an individual can be performed using oligonucleotide primers and/or probes. Oligonucleotides can be prepared by any suitable method, usually chemical sis. Oligonucleotides can be synthesized using commercially available reagents and instruments. Alternatively, they can be purchased through commercial sources. Methods of synthesizing oligonucleotides are well known in the art (see, e.g, Narang et al., Meth. Enzymol. 68:90-99, 1979; Brown et al., Meth. l. 68:109-151, 1979; Beaucage et al., Tetrahedron Lett. 22:1859-1862, 1981; and the solid support method of U.S. Pat. No. 4,458,066). In addition, modifications to the above- described methods of synthesis may be used to desirably impact enzyme or with respect to the sized oligonucleotides. For example, incorporation of modified phosphodiester linkages (e.g., phosphorothioate, methylphosphonates, phosphoamidate, or boranophosphate) or linkages other than a phosphorous acid derivative into an oligonucleotide may be used to t cleavage at a selected site. In addition, the use of 2’-amino modified sugars tends to favor displacement over ion of the oligonucleotide when hybridized to a nucleic acid that is also the template for synthesis of a new nucleic acid strand.

The genotype of an individual can be determined using many detection methods that are well known in the art. Most assays entail one of several general protocols: hybridization using allele- ic oligonucleotides, primer extension, allele-specific ligation, sequencing, or electrophoretic separation techniques, e.g., single-stranded conformational polymorphism (SSCP) and heteroduplex analysis. ary assays include 5’-nuclease , template-directed dyeterminator incorporation, molecular beacon allele-specific oligonucleotide assays, single-base extension assays, and SNP scoring by real-time pyrophosphate sequences. Analysis of amplified ces can be performed using various technologies such as microchips, fluorescence polarization assays, and MALDI-TOF (matrix ed laser desorption tion-time of flight) mass spectrometry. Two methods that can also be used are assays based on invasive cleavage with Flap nucleases and methodologies employing k probes. ination of the presence or absence of a particular allele is generally performed by analyzing a nucleic acid sample that is ed from the individual to be analyzed. Often, the nucleic acid sample comprises genomic DNA. The genomic DNA is typically obtained from blood samples, but may also be obtained from other cells or tissues.

It is also possible to analyze RNA samples for the presence of polymorphic alleles. For example, mRNA can be used to determine the pe of an individual at one or more polymorphic sites.

In this case, the nucleic acid sample is obtained from cells in which the target nucleic acid is expressed, e.g., adipocytes. Such an analysis can be performed by first reverse-transcribing the target RNA using, for example, a viral reverse transcriptase, and then amplifying the resulting cDNA; or using a combined high-temperature reverse-transcription-polymerase chain reaction (RT-PCR), as described in U.S. Pat. Nos. 5,310,652; 5,322,770; 5,561,058; 5,641,864; and ,693,517.

Frequently used methodologies for analysis of c acid samples to detect SNPs are briefly described. However, any method known in the art can be used in the invention to detect the presence of single nucleotide substitutions. a. Allele-Specific Hybridization This technique, also commonly referred to as allele specific oligonucleotide ization (ASO) (e.g., Stoneking et al., Am. J. Hum. Genet. 48:70-382, 1991; Saiki et al., Nature 324, 163-166, 1986; EP 235,726; and WO 89/11548), relies on distinguishing between two DNA molecules differing by one base by hybridizing an oligonucleotide probe that is ic for one of the variants to an amplified product obtained from ying the nucleic acid sample. This method typically employs short oligonucleotides, e.g. 15-20 bases in length. The probes are designed to entially hybridize to one variant versus another. Principles and guidance for designing such probe is ble in the art, e.g. in the references cited herein. ization conditions should be sufficiently stringent that there is a significant difference in hybridization intensity between alleles, and producing an essentially binary response, whereby a probe hybridizes to only one of the alleles. Some probes are designed to ize to a segment of target DNA such that the rphic site aligns with a central position (e.g., in a 15-base ucleotide at the 7 on; in a 16-based ucleotide at either the 8 or 9 position) of the probe, but this design is not required.

The amount and/or presence of an allele is determined by measuring the amount of allelespecific oligonucleotide that is hybridized to the sample. Typically, the oligonucleotide is labeled with a label such as a fluorescent label. For example, an allele-specific oligonucleotide is applied to immobilized ucleotides representing SNP sequences. After ent hybridization and washing conditions, fluorescence intensity is measured for each SNP oligonucleotide.

In one embodiment, the nucleotide t at the polymorphic site is identified by hybridization under sequence-specific hybridization conditions with an oligonucleotide probe or primer exactly complementary to one of the polymorphic s in a region encompassing the polymorphic site. The probe or primer izing sequence and sequence-specific hybridization conditions are selected such that a single mismatch at the polymorphic site destabilizes the hybridization duplex sufficiently so that it is effectively not formed. Thus, under sequencespecific hybridization conditions, stable duplexes will form only between the probe or primer and the exactly complementary allelic ce. Thus, oligonucleotides from about 10 to about nucleotides in length, usually from about 15 to about 35 nucleotides in length, which are y mentary to an allele sequence in a region which encompasses the polymorphic site are within the scope of the invention.

In an alternative embodiment, the nucleotide present at the polymorphic site is identified by hybridization under sufficiently stringent hybridization conditions with an oligonucleotide substantially complementary to one of the SNP alleles in a region assing the polymorphic site, and exactly complementary to the allele at the polymorphic site. Because mismatches which occur at non-polymorphic sites are mismatches with both allele sequences, the difference in the number of mismatches in a duplex formed with the target allele sequence and in a duplex formed with the corresponding non-target allele sequence is the same as when an oligonucleotide exactly complementary to the target allele sequence is used. In this embodiment, the hybridization conditions are relaxed sufficiently to allow the formation of stable duplexes with the target sequence, while maintaining sufficient stringency to preclude the formation of stable duplexes with non-target sequences. Under such sufficiently stringent ization conditions, stable duplexes will form only between the probe or primer and the target allele. Thus, oligonucleotides from about 10 to about 35 nucleotides in length, usually from about 15 to about 35 nucleotides in length, which are substantially complementary to an allele sequence in a region which encompasses the polymorphic site, and are exactly complementary to the allele sequence at the polymorphic site, are within the scope of the invention.

The use of substantially, rather than exactly, complementary oligonucleotides may be desirable in assay s in which optimization of hybridization conditions is limited. For example, in a typical multi-target immobilized-oligonucleotide assay format, probes or primers for each target are immobilized on a single solid support. Hybridizations are d out simultaneously by contacting the solid support with a on containing target DNA. As all hybridizations are carried out under identical conditions, the hybridization conditions cannot be separately optimized for each probe or primer. The incorporation of ches into a probe or primer can be used to adjust duplex stability when the assay format precludes adjusting the hybridization conditions. The effect of a particular introduced mismatch on duplex ity is well known, and the duplex stability can be routinely both estimated and empirically determined, as described above. Suitable hybridization conditions, which depend on the exact size and sequence of the probe or primer, can be selected empirically using the guidance provided herein and well known in the art. The use of oligonucleotide probes or primers to detect single base pair ences in sequence is described in, for example, Conner et al., 1983, Proc. Natl. Acad. Sci. USA 80:278- 282, and U.S. Pat. Nos. 5,468,613 and 5,604,099, each incorporated herein by reference.

The proportional change in stability n a perfectly matched and a -base mismatched hybridization duplex s on the length of the hybridized oligonucleotides. Duplexes formed with shorter probe sequences are destabilized proportionally more by the presence of a mismatch.

Oligonucleotides between about 15 and about 35 nucleotides in length are often used for sequence-specific detection. Furthermore, because the ends of a hybridized oligonucleotide o continuous random dissociation and re-annealing due to thermal energy, a mismatch at either end destabilizes the hybridization duplex less than a mismatch occurring ally. For discrimination of a single base pair change in target sequence, the probe sequence is selected which hybridizes to the target sequence such that the polymorphic site occurs in the interior region of the probe.

The above criteria for ing a probe sequence that hybridizes to a specific allele apply to the hybridizing region of the probe, i.e., that part of the probe which is involved in hybridization with the target sequence. A probe may be bound to an additional nucleic acid sequence, such as a poly-T tail used to immobilize the probe, without significantly altering the hybridization characteristics of the probe. One of skill in the art will recognize that for use in the present methods, a probe bound to an additional nucleic acid sequence which is not complementary to the target sequence and, thus, is not involved in the hybridization, is essentially equivalent to the unbound probe.

Suitable assay formats for detecting hybrids formed between probes and target nucleic acid sequences in a sample are known in the art and include the immobilized target (dot-blot) format and immobilized probe (reverse dot-blot or line-blot) assay formats. Dot blot and reverse dot blot assay formats are bed in U.S. Pat. Nos. 5,310,893; 5,451,512; 5,468,613; and 5,604,099; each incorporated herein by nce.

In a dot-blot format, ied target DNA is immobilized on a solid support, such as a nylon membrane. The membrane-target x is incubated with labeled probe under suitable hybridization conditions, unhybridized probe is removed by washing under suitably stringent conditions, and the membrane is red for the presence of bound probe.

In the reverse dot-blot (or line-blot) , the probes are immobilized on a solid support, such as a nylon membrane or a microtiter plate. The target DNA is d, typically during amplification by the incorporation of labeled primers. One or both of the s can be labeled.

The membrane-probe x is incubated with the labeled amplified target DNA under suitable hybridization ions, unhybridized target DNA is removed by washing under suitably stringent conditions, and the membrane is monitored for the ce of bound target DNA. A reverse lot detection assay is described in the example.

An allele-specific probe that is specific for one of the polymorphism ts is often used in conjunction with the allele-specific probe for the other polymorphism variant. In some embodiments, the probes are immobilized on a solid support and the target sequence in an individual is analyzed using both probes simultaneously. Examples of nucleic acid arrays are described by WO 95/11995. The same array or a different array can be used for analysis of characterized polymorphisms. WO 95/11995 also describes subarrays that are optimized for detection of variant forms of a pre-characterized polymorphism. Such a subarray can be used in detecting the presence of the polymorphisms described . b. Allele-Specific Primers Polymorphisms are also commonly detected using allele-specific amplification or primer extension methods. These reactions typically involve use of primers that are ed to specifically target a polymorphism via a mismatch at the 3’-end of a primer. The presence of a mismatch effects the ability of a polymerase to extend a primer when the polymerase lacks error- correcting activity. For example, to detect an allele sequence using an allele-specific amplification- or ion-based method, a primer complementary to one allele of a polymorphism is ed such that the 3’-terminal nucleotide hybridizes at the polymorphic position. The ce of the particular allele can be determined by the ability of the primer to initiate extension. If the 3’-terminus is mismatched, the extension is impeded.

In some embodiments, the primer is used in conjunction with a second primer in an amplification reaction. The second primer hybridizes at a site unrelated to the polymorphic position.

Amplification proceeds from the two s leading to a detectable product signifying the particular allelic form is present. -specific amplification- or extension-based s are described in, for example, WO 93/22456; U.S. Pat. Nos. 806; 5,595,890; 5,639,611; and U.S. Pat. No. 4,851,331.

Using allele-specific amplification-based genotyping, identification of the alleles requires only ion of the presence or absence of amplified target sequences. Methods for the detection of amplified target sequences are well known in the art. For example, gel electrophoresis and probe hybridization assays described are often used to detect the presence of nucleic acids.

In an alternative probe-less method, the ied nucleic acid is detected by monitoring the increase in the total amount of double-stranded DNA in the reaction e, is described, e.g. in U.S. Pat. No. 5,994,056; and European Patent Publication Nos. 487,218 and 512,334. The detection of double-stranded target DNA relies on the increased fluorescence various DNA- binding dyes, e.g., SYBR Green, t when bound to double-stranded DNA.

As appreciated by one in the art, allele-specific amplification methods can be med in reaction that employ multiple allele-specific primers to target particular alleles. Primers for such multiplex applications are generally labeled with distinguishable labels or are selected such that the ication products produced from the alleles are distinguishable by size. Thus, for example, both alleles in a single sample can be identified using a single amplification by gel analysis of the amplification product.

As in the case of allele-specific probes, an allele-specific oligonucleotide primer may be y mentary to one of the rphic alleles in the hybridizing region or may have some mismatches at positions other than the 3’-terminus of the oligonucleotide, which mismatches occur at lymorphic sites in both allele sequences. c. Detectable Probes i) 5’-Nuclease Assay Probes Genotyping can also be performed using a “TaqMan®” or “5’-nuclease assay” , as described in U.S. Pat. Nos. 5,210,015; 5,487,972; and 5,804,375; and Holland et al., 1988, Proc.

Natl. Acad. Sci. USA 88:7276-7280. In the TaqMan® assay, labeled detection probes that hybridize within the amplified region are added during the amplification reaction. The probes are modified so as to prevent the probes from acting as primers for DNA synthesis. The amplification is performed using a DNA polymerase having 5’- to 3’-exonuclease activity.

During each synthesis step of the amplification, any probe which hybridizes to the target nucleic acid downstream from the primer being extended is degraded by the 5’- to 3’-exonuclease activity of the DNA polymerase. Thus, the synthesis of a new target strand also results in the degradation of a probe, and the accumulation of degradation product provides a measure of the synthesis of target sequences.

The hybridization probe can be an allele-specific probe that discriminates between the SNP alleles. Alternatively, the method can be performed using an allele-specific primer and a labeled probe that binds to amplified product.

Any method suitable for detecting degradation t can be used in a lease assay. Often, the detection probe is d with two scent dyes, one of which is e of quenching the fluorescence of the other dye. The dyes are attached to the probe, usually one ed to the ’-terminus and the other is attached to an internal site, such that quenching occurs when the probe is in an unhybridized state and such that ge of the probe by the 5’- to 3’-exonuclease activity of the DNA polymerase occurs in between the two dyes. Amplification results in cleavage of the probe between the dyes with a concomitant elimination of quenching and an increase in the fluorescence observable from the initially quenched dye. The accumulation of degradation t is monitored by measuring the increase in on fluorescence. U.S. Pat.

Nos. 5,491,063 and 5,571,673, both incorporated herein by reference, describe alternative methods for detecting the degradation of probe which occurs concomitant with amplification. ii) Secondary Structure Probes Probes detectable upon a secondary structural change are also suitable for detection of a polymorphism, including SNPs. Exemplified secondary structure or stem-loop structure probes include molecular beacons or Scorpion® primer/probes. Molecular beacon probes are singlestranded oligonucleic acid probes that can form a hairpin structure in which a fluorophore and a quencher are usually placed on the opposite ends of the oligonucleotide. At either end of the probe short complementary sequences allow for the formation of an intramolecular stem, which s the fluorophore and the quencher to come into close ity. The loop portion of the molecular beacon is mentary to a target nucleic acid of interest. Binding of this probe to its target nucleic acid of interest forms a hybrid that forces the stem apart. This causes a conformation change that moves the phore and the quencher away from each other and leads to a more intense fluorescent signal. lar beacon probes are, however, highly sensitive to small sequence ion in the probe target (Tyagi S. and Kramer F. R., Nature Biotechnology, Vol. 14, pages 303-308 (1996); Tyagi et al., Nature Biotechnology, Vol. 16, pages 49-53(1998); Piatek et al., Nature Biotechnology, Vol. 16, pages 359-363 (1998); Marras S. et al., Genetic is: Biomolecular Engineering, Vol. 14, pages 151-156 (1999); Tpp I. et al, BioTechniques, Vol 28, pages 8 (2000)). A Scorpion® primer/probe comprises a stemloop structure probe covalently linked to a primer. d. DNA Sequencing and Single Base Extensions SNPs can also be detected by direct sequencing. s include e.g. dideoxy sequencing-based methods and other methods such as Maxam and Gilbert ce (see, e.g. Sambrook and Russell, supra).

Other detection methods include Pyrosequencing™ of oligonucleotide-length products. Such methods often employ amplification techniques such as PCR. For example, in pyrosequencing, a sequencing primer is hybridized to a single stranded, PCR-amplified, DNA template; and incubated with the enzymes, DNA polymerase, ATP sulfurylase, luciferase and e, and the substrates, adenosine 5’ phosphosulfate (APS) and luciferin. The first of four deoxynucleotide triphosphates (dNTP) is added to the reaction. DNA polymerase catalyzes the incorporation of the deoxynucleotide sphate into the DNA , if it is complementary to the base in the template strand. Each incorporation event is accompanied by release of pyrophosphate (PPi) in a quantity equimolar to the amount of orated nucleotide. ATP sulfurylase quantitatively converts PPi to ATP in the presence of adenosine 5’ phosphosulfate. This ATP drives the luciferase-mediated conversion of luciferin to oxyluciferin that generates visible light in amounts that are proportional to the amount of ATP. The light ed in the luciferase-catalyzed reaction is detected by a charge coupled device (CCD) camera and seen as a peak in a Pyrogram™. Each light signal is proportional to the number of nucleotides incorporated. e, a nucleotide degrading enzyme, continuously es unincorporated dNTPs and excess ATP. When degradation is complete, another dNTP is added.

Another similar method for characterizing SNPs does not require use of a complete PCR, but typically uses only the extension of a primer by a single, fluorescence-labeled dideoxyribonucleic acid molecule (ddNTP) that is complementary to the nucleotide to be investigated. The nucleotide at the polymorphic site can be identified via detection of a primer that has been extended by one base and is fluorescently labeled (e.g., Kobayashi et al, Mol. Cell.

Probes, 9:175-182, 1995). e. Electrophoresis ication products generated using the polymerase chain reaction can be analyzed by the use of denaturing gradient gel electrophoresis. Different alleles can be identified based on the different sequence-dependent melting properties and electrophoretic migration of DNA in solution (see, e.g. Erlich, ed., PCR Technology, Principles and ations for DNA Amplification, W. H. Freeman and Co, New York, 1992, Chapter 7).

Distinguishing of atellite polymorphisms can be done using capillary electrophoresis.

Capillary electrophoresis conveniently allows identification of the number of s in a ular microsatellite allele. The application of capillary electrophoresis to the analysis of DNA polymorphisms is well known to those in the art (see, for example, Szantai, et al, J Chromatogr A. (2005) 1079(1-2):41-9; Bjorheim and Ekstrom, Electrophoresis (2005) 26(13):2520-30 and Mitchelson, Mol Biotechnol. (2003) 24(1):41-68). f. -Strand Conformation Polymorphism Analysis Alleles of target sequences can be differentiated using single-strand conformation polymorphism analysis, which identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described, e.g, in Orita et al., Proc. Nat. Acad. Sci. 86, 2766-2770 (1989). Amplified PCR products can be generated as described above, and heated or otherwise denatured, to form single stranded ication products. Single-stranded nucleic acids may refold or form secondary structures which are partially dependent on the base sequence. The different electrophoretic mobilities of single-stranded amplification ts can be d to base-sequence difference between alleles of target SNP detection s often employ labeled oligonucleotides. Oligonucleotides can be labeled by incorporating a label detectable by spectroscopic, hemical, biochemical, immunochemical, or chemical means. Useful labels include fluorescent dyes, radioactive labels, e.g. 32P, electron-dense reagents, enzyme, such as dase or alkaline phosphatase, biotin, or haptens and proteins for which antisera or onal antibodies are available. Labeling techniques are well known in the art (see, e.g. Current Protocols in Molecular Biology, supra; Sambrook & Russell, supra). 4. Methods of Treatment Dosages of with bevacizumab (Avastin®) for treatments of specific cancers, according to the EMEA, are as follows. For metastatic carcinoma of the colon or rectum (mCRC) recommended dosages are 5 mg/kg or 10 mg/kg of body weight given once every 2 weeks or 7.5 mg/kg or 15 mg/kg of body weight given once every 3 weeks, for metastatic breast cancer (mBC) recommended dosages are 10 mg/kg of body weight given once every 2 weeks or 15 mg/kg of body weight given once every 3 weeks as an intravenous infusion, and for non-small cell lung cancer (NSCLC) recommended dosages are 7.5 mg/kg or 15 mg/kg of body weight given once every 3 weeks as an intravenous infusion. Clinical benefit in NSCLC patients has been demonstrated with both 7.5 mg/kg and 15 mg/kg doses. For details refer to section 5.1 Pharmacodynamic ties, all cell lung cancer (NSCLC). For ed and/or metastatic Renal Cell Cancer (mRCC) preferred dosages are 10 mg/kg of body weight given once every 2 weeks as an intravenous infusion(in addition to platinum-based chemotherapy for up to 6 cycles of treatment followed by zumab (Avastin®) as a single agent until disease progression). For gliablastoma a particular dosage is 10 mg/kg every 2 weeks.

In the context of the present invention, the angiogenesis inhibitor may be administered in addition to or as a co-therapy or a co-treatment with one or more chemotherapeutic agents administered as part of standard chemotherapy regimen as known in the art. Examples of agents included in such standard chemotherapy regimens include 5-fluorouracil, leucovorin, irinotecan, gemcitabine, erlotinib, capecitabine, taxanes, such as docetaxel and paclitaxel, interferon alpha, vinorelbine, and platinum-based chemotherapeutic agents, such as paclitaxel, latin, tin and oxaliplatin. Examples of co-treatments for metastatic pancreatic cancer include gemcitabine-erlotinib plus bevacizumab at a dosage of 5mg/kg or 10 mg/kg of body weight given once every two weeks or 7.5 mg/kg or 15 mg/kg of body weight given once every three weeks. Examples of co-treatments for renal cell cancer include interferon alpha plus bevacizumab at a dosage of or 10 mg/kg of body weight given once every two weeks. Further, a patient may be co-treated with a combination of ecan, 5-fluorouracil, orin, also referred to as IFL, as, for example, a bolus-IFL, with a combination of oxaliplatin, orin, and rouracil, also referred to a FOLFOX4 regimen, or with a ation of tabine and latin, also referred to as XELOX. Accordingly, in a further embodiment of the invention, the patient suffering from a ant disease or a disease involving physiological and ogical angiogenesis is being treated with one or more chemotherapeutic agents such as 5-fluorouracil, leucovorin, irinotecan, gemcitabine-erlotinib, capecitabine and/or platinum-based chemotherapeutic agents, such as paclitaxel, carboplatin and oxaliplatin. Examples of cotherapy or co-treatment include 5 mg/kg bevacizumab (Avastin®) every two week with bolus- IFL or 10 mg/kg bevacizumab (Avastin®) every 2 weeks with FOLFOX4 for metastatic colorectal cancer, 15 mg/kg bevacizumab (Avastin®) every 3 weeks with caboplatis/paclitaxel for non-squamous non-small cell lung cancer, and 10 mg/kg bevacizumab (Avastin®) every 2 weeks with paclitaxel for atic breast cancer. Further, the angiogenesis inhibitor to be administered may be stered as a co-therapy or a co-treatment with radiotherapy. 5. Kit Also described herein is a diagnostic composition or kit sing any of the mentioned oligonucleotides and optionally suitable means for detection.

The kit may advantageously be used for carrying out a method of the invention and could be, inter alia, employed in a variety of applications, e.g., in the diagnostic field or as a research tool.

The parts of the kit of the invention can be packages individually in vials or in combination in containers or multicontainer units. Manufacture of the kit follows preferably standard procedures which are known to the person skilled in the art. The kit or diagnostic compositions may be used for detection of the one or more variant alleles in accordance with the herein-described methods of the invention, employing, for example, amplification techniques as described herein.

Accordingly, also described is a kit useful for carrying out the s herein described, comprising oligonucleotides or polynucleotides capable of determining the genotype of one or more SNPs. The ucleotides or cleotides may se primers and/or probes.

The present invention is r described by reference to the following non-limited figures and examples.

Examples Example 1: Genetic determination can influence sensitivity of the endothelium to VEGF. In accordance with this and in context of this invention, we explored genetic variability in underlying signaling pathways in order to discover predictive patterns for anti enic treatment and the development of hypertension under this therapy n. In this analysis, the correlation of genetic variability in the VEGF-A signaling pathway with clinical outcome of patients with different advanced primary cancers was assessed in 5 different trials. All five were randomised parallel trials to investigate the efficacy and safety of BEV (bevacizumab) in subjects with metastatic colorectal cancer (NO16966), metastatic pancreatic cancer (AVITA), ed or recurrent non-squamous non-small-cell lung cancer (AVAIL), metastatic renal cancer (AVOREN) and egative atic breast cancer (AVADO).

In all five trials, al DNA biomarker sampling was included for SNP analysis. In total, germline DNA was available from 1346 patients. Common single nucleotide polymorphisms (SNPs) located in the hypoxia-inducible factor-1α and -2α, VEGF-A, its receptors (VEGFR-1 and -2) and other relevant genes were selected based on literature and using a SNP tagging approach (f≥0.1 and r2 ≤ 0.8). 157 SNPs were sfully genotyped using MALDI-TOF mass spectrometry. Risk and survival estimates were ated using Cox sion analyses.

Two types of analyses were performed. 1. Correlation of genetic markers to PFS and OS. 2. Correlaton of genetic markers to hypertension, not fied as ated to study drug” The rs699946 (SEQ ID NO. 1) SNP, located in the VEGF-A promoter, was associated with improved PFS in bev-treated subjects with an allelic HR of 1.26 (95% CI 1.07–1.48, p=0.005).

No effect was seen in placebo subjects, suggesting that 46 (SEQ ID NO. 1) may be a predictive marker for favourable outcome with bevacizumab ent. Further, the rs11133360 (SEQ ID NO. 5) SNP, located in the VEGFR2, was associated with improved PFS in bevacizumab-treated subjects with an allelic HR of 1.15 (95% CI 1.02–1.30, p=0.02). In terms of OS, the rs12505758 (SEQ ID NO. 2) SNP in VEGFR2 was most significantly associated with improved OS in bev-treated pts (allelic HR 1.50, 95% CI 1.21–1.86, p=0.0002). No effects for rs12505758 (SEQ ID NO. 2) were seen in placebo pts.

Ten SNPs were associated with bevacizumab-induced hypertension (p<0.05), but none of these surpassed the threshold for multiple testing (p<0.0003). The two SNPs showing the strongest association (p<0.01) were: rs2305949 (SEQ ID NO. 3) in KDR (allelic OR 0.93, 95% CI 0.88– 0.98, p=0.0067), and rs4444903 (SEQ ID NO. 4) in EGF (allelic OR 1.06, 95% CI 1.02–1.11, p=0.0052). Interestingly, rs2305949 (SEQ ID NO. 3) and rs4444903 (SEQ ID NO. 4) were closely linked to amino acid s ing on position 273 and 708 of KDR and EGF, suggesting that these changes may functionally affect both genes and y contribute to hypertension. y, rs11064560 in WNK1 was also ated with bevacizumab-induced hypertension (allelic OR 1.06, 95% CI 1.01–1.10, p=0.02), thereby supporting previous observations in a limited number of patients [Frey et al. J Clin Oncol 26: 2008 (May 20 suppl; abstr 11003)].

PATIENTS AND METHODS Samples All 5 trial protocols were approved by the institutional review board at each site and were conducted in accordance with the Declaration of Helsinki, current US Food and Drug Administration Good Clinical ces, and local ethical and legal requirements. In total, 1346 subjects were genotyped. Among these subjects, 1225 were white and 121 were non-white. As non-white patients are genetically distinct from white patients and SNP frequencies may differ n both ethnic groups, non-white patients were omitted from further is. All patients provided separate written informed consent for genetic ker testing.

Assessments Patients were ed according to the study protocol as described in the following nces: - AVITA: Van Cutsem et al., J. Clinc. Oncol. 27, 2231-7 (2009) - AVAIL: Reck M, von Pawel J, Zatloukal P, et al. Phase III trial of cisplatin plus abine with either placebo or bevacizumab as first-line therapy for nonsquamous non-small-cell lung cancer: AVAiL. J Clin Oncol 2009;27(8):1227–34 - AVOREN: Escudier B, Pluzanska A, Koralewski P, Ravaud A, Bracarda S, Szczylik C, et al.

Bevacizumab plus interferon alfa-2a for treatment of metastatic renal cell carcinoma: a randomised, double-blind phase III trial. Lancet. 2007;370(9605):2103-2111 - AVADO: Miles DW, et al., J Clin Oncol 2010a;28(20):3239–47 - NO16966: Saltz LB, Clarke S, ubio E, et al. Bevacizumab in combination with oxaliplatin-based chemotherapy as first-line therapy in metastatic colorectal cancer: a randomized phase III study. J Clin Oncol 2008;26(12):2013-2019 Single Nucleotide Polymorphism Selection Two marker panels were considered for analysis: The Roche panel and Leuven panel. The Roche panel consists of 35 genetic polymorphisms selected by literature review for potential relevance to BEV treatment. The panel is made up of SNPs and repeat polymorphisms lying in the following genes: VEGFA, NOS3, FLT1 (VEGFR1), KDR 2), WNK1, IL8, IL8R and IFNAR2. The Leuven panel consists of 186 tag SNPs from the VEGF signalling cascade or from candidate genes for known side-effects, hypertension or thrombosis and includes the following genes: the VEGF ligand, the VEGF homologues (placental growth factor or PlGF, VEGF-B and -C, as well as VEGF-D or FlGF), the VEGF receptor-2 (KDR or VEGFR-2) and VEGF receptor- 1 (FLT1 or VEGFR-1). Genomic sequences 5 kb am of the translation start site up to 3’ poly-A adenylation site of each gene, were used to select SNPs from the HapMap database (HapMap Data Rel 24/phaseII Nov08, on NCBI B36 assembly, dbSNP b126). Tagging SNPs were selected using the Tagger , I., et al., Nat. Genet. 38, 663-7 ) as provided in the HAPLOVIEW software package (Barrett, J.C., et al., Bioinformatics. 21, 263-5 ). Only SNPs occurring commonly, i.e., with a minor allele ncy f≥0.1 and a minimum r2 threshold ≥0.8 were considered. In total, 167 tagging SNPs were selected following these criteria.

Additionally, 11 SNPs located in exonic ces and inducing non-synonymous amino-acid changes at a frequency f≥0.1 were selected from the dbSNP database, as well as 4 SNPs in VEGF (rs699947, 61, rs2010963 and rs3025039), 1 SNP in VEGFR-1 (rsTP53_R-1) and 1 SNP in 2 (rs2071559), which previously have been reported to affect function or expression of these genes.

There is some overlap between s in the two panels, and the size of the panels has increased slightly over the duration of the six trials, so fewer markers are available for earlier trials. The current meta-analysis is confined to markers for which genotyping was conducted in at least two trials under study.

Four marker sets were defined as follows: • ‘All s’ consists of all markers assayed for which at least one genotype was obtained.

• ‘Roche Markers’ consists of markers from the Roche panel, which passed quality checks (see below) and had frequency greater than 1% in white subjects.

• ‘Leuven Efficacy Markers’ consists of those markers from the Leuven panel, which lie in loci implicated in the VEGF pathway, which passed quality checks (see below) and which had frequency r than 1% in white subjects. • n Safety Markers’ consists of those s from the Leuven panel which lie in candidate genes for involvement in hypertension or thrombosis, which passed y checks (see below) and which had ncy greater than 1% in white subjects.

Genotyping Peripheral blood was sampled in K2EDTA plastic Vacutainer tubes. After centrifugation, germline DNA was extracted from the precipitated leucocyte cell fraction according to standard ures.

For SNPs of the Roche panel, Genotyping was carried out in a blinded manner at the Roche Translational Research Sciences Genetics laboratories (Basel, Switzerland) using Allele Specific PCR amplification, Sanger sequencing and Fragment Analysis platforms (AVAIL, AVITA, AVOREN, AVADO, NO16966).

For SNPs of the Leuven panel, ping was carried out in a blinded manner at the us Research Center (Leuven, Belgium) using the Sequenom iPLEX platform (Sequenom Inc, San Diego, CA, USA). Any SNP that failed to provide a robust genotype in the first genotyping round was redesigned using a different set of polymerase chain on primers and retested.

Overall, 157 ) were successfully genotyped with an overall success rate of 98.5%. The 27 SNPs that also failed the second design were considered failures.

The following amplification primers were designed for SNPs rs699946 (SEQ ID NO. 1), rs12505758 (SEQ ID NO. 2), rs2305949 (SEQ ID NO. 3), rs4444903 (SEQ ID NO. 4) and rs11133360 (SEQ ID NO. 5). For rs699946 (SEQ ID NO. 1), ACGTTGGATGCTACCACTAGTGTTGGCTTG (SEQ ID NO. 6) and ACGTTGGATGTGAGCTCCACACTGCCTTC (SEQ ID NO. 7) were used. For SNP rs12505758 (SEQ ID NO. 2), ACGTTGGATGCTTTACTCTGCCAAATCTATG (SEQ ID NO. 8) and ACGTTGGATGGCTAATAAGCTTATACATTTG (SEQ ID NO. 9) were used. For rs2305949 (SEQ ID NO. 3), ACGTTGGATGATCCTATACCCTAGAGCAAG (SEQ ID NO. ) and ACGTTGGATGATCTGTGCAAAGTTATAGGC (SEQ ID NO. 11) were used. For 903 (SEQ ID NO. 4), ACGTTGGATGTCTTCTTTCAGCCCCAATCC (SEQ ID NO. 12) and ACGTTGGATGAAGAAAGGAAGAACTGATGG (SEQ ID NO. 13) were used. For rs11133360 (SEQ ID NO. 5), ACGTTGGATGTTTCACATTGCTATGCCCAA (SEQ ID NO. 14) and ACGTTGGATGCTCTTTCTTCACTTTGACTG (SEQ ID NO. 15) were used.

The following unextended primers (probes) were designed for SNPs rs699946 (SEQ ID NO. 1), rs12505758 (SEQ ID NO. 2), rs2305949 (SEQ ID NO. 3), rs4444903 (SEQ ID NO. 4) and rs11133360 (SEQ ID NO. 5). For rs699946 (SEQ ID NO. 1), ATTAGTCAATTCTCTGACAGAGACA (SEQ ID NO. 16) was used. For rs12505758 (SEQ ID NO. 2), TTACTCTGCCAAATCTATGATGCCA (SEQ ID NO. 17) was used. For 949 (SEQ ID NO. 3), CTAGAGCAAGTAAATTGAAAAAA (SEQ ID NO. 18) was used. For rs4444903 (SEQ ID NO. 4), GCATCTCCAATCCAAGGGTTGT (SEQ ID NO. 19) was used.

For rs11133360 (SEQ ID NO. 5), CACATTGCTATGCCCAACACATC (SEQ ID NO. 20) was used.

Quality checking Data were checked for quality as follows: • Uniformity of assay strand was d • Levels of missing data were summarised • Markers with minor allele frequency (MAF<1%) were excluded • Markers failing a test of homogeneity of allele frequency were excluded • Tests of Hardy Weinberg Equilibrium (HWE) were conducted to assist interpretation After quality check, 25 Roche Markers, 133 Leuven Efficacy Markers and 22 Leuven Safety Markers were subjected to pooled association analysis.

Statistical analysis A pooled analysis of individual patient data, stratified by study was d to all markers with homogeneous ncy. Candidate markers for efficacy were tested for association to PFS and OS using Cox Proportional Hazards Regression. Candidate markers for safety were tested for association to Hypertension using logistic regression. The primary is involved white BEV-treated subjects from the ITT (for efficacy endpoints) and SP tension), as riate. ments were made in all association tests for the following covariates: Region, study and dose and background chemotherapy regimen. A subset of the following variables, selected by endpoint using rds stepwise regression, were adjusted for as well: ECOG performance status (0 vs. 1), gender (male vs. female), age, LDH, alkaline phosphatase level n normal range vs. above normal range), serum albumin (<2.9g/dL vs. >=2.9g/dL) and baseline number of atic sites (>2 vs. <=2). In order to investigate whether any ed associations reflected temporal rather than treatment effects, association testing was also conducted in white placebotreated subjects. In order to r characterise any detected associations, Genotype x Treatment interaction analysis was conducted in white subjects.

Data 26 Roche Markers, 136 Leuven Efficacy Markers and 22 Leuven Safety Markers passed quality checking and were ted to homogeneity analysis. Table 1 shows the number of ts to be incorporated into the meta-analysis. It is noted that 3 subjects in the ITT were not in the SP and 3 subjects had missing values for randomised weekly dose ).

Table 1: Subject sets and sizes for analysis Analysis Population Count PGx-ITT-All Arms-All Ethnicities 1346 PGx-ITT-All Arms-White 1225 PGx-ITT-BEV-All Ethnicities 668 PGx-ITT-BEV-White 629 PGx-ITT-PBO-White 593 PGx-SP-All Arms-White 1223 PGx- SP -BEV-All Ethnicities 667 PGx- SP -BEV-White 628 PGx- SP -PBO-White 592 Clinical Characteristics of genetic patient population Demographic and endpoint teristics are tabulated in Table 2 by clinical trial and overall for subjects in PGx-ITT-BEV-All Ethnicities. Endpoint distributions are portrayed graphically in Figure 1-4.

Table 2: Summary of demographic and endpoint data AVAIL AVOREN AVITA AVADO All BO17704 BO17705 BO17706 BO17708 NO16966 Cancer-type NSCLC Renal Pancreatic Breast Colorectal N 119 108 161 350 610 1348 BEV 83 59 79 238 210 669 PBO 36 49 81 110 400 676 Male 0.71 0.72 0.64 0 0.61 0.47 Age (yr) (SD) 57.39 59.7 61.7 54.73 59.56 58.38 (9.85) (10.57) (9.59) (10.84) (11.46) (11.13) White 0.92 0.99 0.95 0.96 0.85 0.91 OS (Median) 424 1011 213 873.5 636 614 Cens. (OS) 0.36 0.47 0.09 0.37 0.19 0.26 PFS (Median) 197 413 150 256 267.5 250 Cens. (PFS) 0.03 0.11 0.04 0.07 0.04 0.05 BOR (PR/CR) 0.42 0.37 0.14 0.49 0.51 0.44 Hypertension 0.21 0.2 0.14 0.15 0.08 0.13 Clinical data was available for 1348 subjects from 5 trials, with approximately equal numbers overall on d and placebo. In contrast to the other trials, no males participated in 8 (AVADO), which was a trial of ed breast cancer. The age distributions and the tions white were broadly homogeneous, except for a slightly lower proportion of white subjects in the largest trial, NO16966. The median lengths of OS and PFS varied widely as did the rates of censoring. As expected, censoring for OS was far r than for PFS and in statistical terms, the effect will be to reduce power to detect association to OS compared to PFS.

Rates of BOR were 49% in BEV-treated subjects and 46% in PBO-treated subjects. Rates of ension were 18% in BEV-treated subjects and 7% in PBO-treated subjects (Figure 4).

For PFS there were 592 events and for OS, there were 438 events out of 629 white BEV-treated subjects in the PGx-ITT. For Hypertension, there were 113 events out of a total of 628 white BEV-treated subjects in PGx-SP. Table 3 shows the number of white subjects to be incorporated into the meta-analysis.

Table 3: Subject counts for pharmacogenetic nalysis of white subjects Population Treatment Count ITT BEV 629 ITT PBO 593 SP BEV 628 SP PBO 592 ITT: intent-to-treat population SP: safety population s Efficay Progression Free Survival Analysis in the sub-group of patients treated with Bevacizumab The strongest ation in VEGF-A with PFS was for rs699946 (SEQ ID NO. 1) (p=0.005).

Although the result would not be significant after adjustment for multiple-testing, it provides consistent upstream signal with marker rs699947, published by Schneider et al. J Clin Oncol 2008 26:4672. A scatter plot of association across the whole gene is given in Figure 5.

Marker Chr BP MAF N HR 95% CI p-value Gene rs699946 Chr6 43732669 0.18 542 1.26 (1.07,1.48) 0.0047 VEGFA Relative to AA carriers, HR for rs699946 (SEQ ID NO. 1) AG carriers was 1.26 (95% CI 1.07– 1.48, p=0.005). This means that each additional G allele was associated with 27% increase in risk of ssion or death. No effect was seen in placebo subjects, ting that rs699946 (SEQ ID NO. 1) may be a predictive marker for able outcome with bevacizumab treatment.

As shown in Figure 6, consistent s for rs699946 (SEQ ID NO. 1) were seen for all studies except AVOREN/BO17705 (renal cancer), the smallest study under consideration.

Further, the rs11133360 (SEQ ID NO. 5) was weakly associated (p=0.02) to PFS (Figure 13).

Marker Chr BP MAF N HR 95% CI p-value Gene rs11133360 Chr4 55982752 0.45 579 1.15 (1.02,1.30) 0.02 KDR Relative to TT carriers, HR for rs11133360 (SEQ ID NO. 5) CT rs was 1.15 (95% CI 1.02– 1.30, p=0.02). This means that each additional C allele was associated with 15% increase in risk of progression or death. l Survival Analysis Analysis in the sub-group of patients treated with Bevacizumab In association analysis for OS, 6/133 markers had p<0.05 in white treated subjects. One of these, rs12505758 (SEQ ID NO. 2) is significant after roni adjustment for 158 tests. The marker is an intronic SNP in KDR (Kinase Insert Domain Receptor; VEGFR2; FLK1) and it is in LD 31) with another intronic SNP, rs1531289 in the gene (source: HapMap release 22; the marker not available in HapMap v3 release 2). The marker is not associated in white placebotreated subjects therefore it may be said to have predictive as opposed to prognostic qualities. An inspection of the forest plot e 7) shows that the effect is driven primarily by NO16966 (colorectal cancer) and BO17705 N; renal cancer). The effect is either weak or absent in the other three s.

Marker Chr BP MAF N HR 95% CI p-value Gene rs12505758 Chr4 55966898 0.12 581 1.50 (1.21, 1.86) 2.00E-04 KDR Relative to TT carriers, HR for rs12505758 (SEQ ID NO. 2) TC carrier was (allelic HR 1.50, 95% CI 1.21–1.86 (, p=0.0002). This means that each additional C allele was associated with 50% increase in risk of death. No effects for rs12505758 (SEQ ID NO. 2) were seen in placebo patients.

The Kaplan Meier plots show increasing estimated hazard ratio with increasing number of copies of the minor allele (Figure 8).

Additional information on SNPs Since the rs699946 (SEQ ID NO. 1) SNP is d in the VEGF promoter, we examined its effect on VEGF-A expression in human plasma samples. We found that GG carriers have a 27% increased median VEGF expression compared to AG and AA (wildtype) carriers. The minor allele of rs699946 (SEQ ID NO. 1) was in linkage with the minor allele of rs699947 (D’ 0.98; r2=0.23), which is r VEGF promoter SNP previously shown to ate with response to bevacizumab therapy [Schneider et al, J Clin Oncol 2008 26:4672]. Furthermore, rs699946 (SEQ ID NO. 1) is also in linkage with rs833058 (-6589 C>T), which emerged as the second hit in VEGF for PFS in the meta-analysis (D’=0.95, r2=0.35).

Conclusion of additional ch: We demonstrated that the G allele of rs699946 (SEQ ID NO. 1) in the VEGF-A promoter is associated with an increased plasma VEGF-A expression and that rs699946 (SEQ ID NO. 1) is in linkage with rs699947, another VEGF-A promoter SNP previously shown to ate with response to bevacizumab by Schneider et al.

The rs11133360 (SEQ ID NO. 5) in VEGFR-2 is an intronic SNP located between the exons that encode the extracellular domains of the VEGFR-2 protein. We found that HUVECs gous for the minor C allele have sed proliferation upon VEGF stimulation compared to CT and TT carriers. antly, rs11133360 is also in strong linkage with rs2305948 (D’= 1), a nonsynonymous SNP that induces the Val297Ile tution and which has been ed to affect the binding of VEGF to VEGFR-2.

Results Hypertension The two SNPs g the strongest association (p<0.01) were: rs2305949 (SEQ ID NO. 3) in KDR (allelic OR 0.93, 95% CI 0.88–0.98, p=0.0067), rs4444903 (SEQ ID NO. 4) in EGF (allelic OR 1.06, 95% CI 1.02–1.11, p=0.0052); see table 4, but none of these surpassed the threshold for multiple testing (p<0.0003). Interestingly, rs2305949 (SEQ ID NO. 3) and rs4444903 (SEQ ID NO. 4) were y linked to amino acid changes occurring on position 273 and 708 of KDR and EGF, suggesting that these changes may functionally affect both genes and thereby contribute to hypertension.

Table 4 Association results for SNP markers with Hypertension Marker Chr BP MAF N OR 95% CI p-value Gene rs2305949 4 55980456 0.22 578 0.93 (0.88,0.98) 0.0067 KDR rs4444903 4 111053559 0.43 609 1.06 (1.02,1.11) 0.005 EGF Chr = chromosome; MAF: Minor Allele Freqeuncy; OR = Odds ratio rs2305949 (SEQ ID NO. 3) (KDR) As shown in Figure 9, higher frequency of hypertension was seen for the CC carrier. Figure 10 shows that three studies, (NO16966, AVAIL/BO17704 and AVOREN/BO17705) drive the association. The forest plot for white o-treated subjects (not shown) shows the mean effect across studies is weakly in the opposite direction, so the marker may be concluded to have predictive characteristics. rs4444903 (SEQ ID NO. 4) (EGF) As shown in Figure 11, higher frequency of hypertension was seen for the GA carrier, with lowest frequency for the AA carriers, while the frequency of the GG carrier was in between. For marker rs4444903 (SEQ ID NO. 4) in EGF, examination of the forest plot (Figure 12) shows reasonable consistency across studies, with t effect observed inBO17708/ AVADO t cancer). The forest plot for subjects in the placebo arm (not shown) shows that the marker has tive as opposed to prognostic characteristics.

Claims (15)

Claims

1. An in vitro method of ining susceptibility of a patient to developing hypertension associated with a therapy comprising an angiogenesis inhibitor comprising 5 bevacizumab or an antibody that binds ially the same epitope on VEGF as bevacizumab, said method sing: (a) determining in a sample derived from a patient suffering from cancer the genotype at polymorphism rs4444903 (SEQ ID NO. 4), and (b) identifying a patient as more or less susceptible to developing hypertension associated 10 with a therapy by an angiogenesis tor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab based on said genotype, wherein the presence of GA genotype at rphism rs rs4444903 (SEQ ID NO. 4) indicates that said patient is more susceptible to developing ension than a patient having a genotype of GG or AA at polymorphism rs4444903 (SEQ ID NO. 4), or the presence of GG or AA genotype at 15 polymorphism rs4444903 (SEQ ID NO. 4) indicates that said patient is less susceptible to developing hypertension than a patient having a genotype of GA at polymorphism 903 (SEQ ID NO. 4).

2. The method of claim 1, wherein the therapy further comprises a chemotherapeutic 20 agent or chemotherapy regimen.

3. The method of claim 1 or claim 2, wherein the therapy comprises administration of the angiogenesis inhibitor with one or more agents selected from the group ting of taxanes, interferon alpha, 5-fluorouracil, leucovorin, irinotecan, gemcitabine-erlotinib and 25 platinum-based chemotherapeutic agents.

4. The method of any one of claims 1 to 3, n the cancer is atic cancer, renal cell cancer, colorectal cancer, breast cancer or lung cancer. 30

5. The method of any one of claims 1 to 4, wherein the sample is a blood sample.

6. The method of any one of claims 1 to 5 wherein the genotype is determined by means of MALDI-TOF mass spectrometry.

7. The use of an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, for the manufacture of a medicament for the treatment of cancer in a patient in need thereof, wherein said patient has been determined to be less tible to developing hypertension associated with a therapy by the 5 angiogenesis inhibitor in accordance with the method of any one of claims 1 to 6.

8. The use of an angiogenesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab in the manufacture of a medicament for the treatment of cancer in a patient in need thereof, wherein said patient has been 10 determined to be less susceptible to developing hypertension associated with a therapy by the enesis inhibitor by an in vitro method comprising: (a) determining in a sample d from a patient suffering from cancer the pe at polymorphism rs4444903 (SEQ ID NO. 4); and (b) fying a patient as less susceptible to developing hypertension associated with a 15 therapy by an enesis inhibitor comprising bevacizumab or an antibody that binds essentially the same epitope on VEGF as bevacizumab, wherein the presence of GG or AA genotype at polymorphism rs4444903 (SEQ ID NO. 4) indicates that said patient is less susceptible to developing hypertension than a patient having a pe of GA at polymorphism rs4444903 (SEQ ID NO. 4).

9. The use of claim 8, wherein the therapy further comprises a chemotherapeutic agent or chemotherapy regimen.

10. The use of any one of claims 8 to 9, wherein the therapy comprises administration 25 of the angiogenesis inhibitor with one or more agents selected from the group consisting of s, interferon alpha, 5-fluorouracil, leucovorin, irinotecan, abine-erlotinib and um-based herapeutic agents.

11. The use of any one of claims 8 to 10, wherein the cancer is pancreatic cancer, 30 renal cell cancer, colorectal cancer, breast cancer or lung cancer.

12. The use of any one of claims 8 to 11, wherein the sample is a blood sample.

13. The use of any one of claims 8 to 12, wherein the genotype is determined by means of MALDI-TOF mass spectrometry.

14. A method according to any one of claims 1 to 6 substantially as herein described 5 with reference to any example thereof.

15. A use according to any one of claims 7 to 13 ntially as herein described with reference to any example thereof.