NZ518765A

NZ518765A - Induction of mucosal immunity by vaccination via the skin route

Info

Publication number: NZ518765A
Application number: NZ518765A
Authority: NZ
Inventors: Dexiang Chen; Sangeeta Bhargava; Deborah Fuller
Original assignee: Powderject Vaccines Inc
Priority date: 1999-11-10
Filing date: 2000-11-09
Publication date: 2005-07-29
Also published as: AU1481401A; JP2003528818A; AU784781B2; IL149458A; EP1229932A2; WO2001034185A3; WO2001034185A2; IL149458A0; CN1414861A; CN100340290C; CA2390999A1

Abstract

Described is a vaccine composition suitable for delivery into or across the skin of a vertebrate subject. This composition comprises an antigen or a nuclei acid encoding antigen; an ADP-ribosylating toxin as an adjuvant; and an oligonucleotide containing a CpG motif. The vaccine composition is disclosed to be used in generating an immune response at a mucosal surface, and for the treatment or preclusion of a disease caused by a pathogen that enters the body or a vertebrate subject via a mucosal surface. A dosage container comprising the vaccine composition for use in a needleless syringe powder injection device is also described.

Description

<div class="application article clearfix" id="description"> -1" ENDUCTION OF MUCOSAL IMMUNITY BY VACCINATION VIA THE SKIN ROUTE 14 APR 2005 _B £ C F I \/ p [y Technical Field 5 The invention relates to compositions suitable for transdermal vaccine delivery using a powder injection delivery system. More particularly the invention relates to methods of treatment or vaccination using particulate vaccine compositions. Background to the Invention ^ 10 Mucosa is the portal entry for variety of pathogens such as bacteria, virus, and parasites. Therefore, vaccines or vaccination methods that induce protective immunity (both antibody and cellular immunity) at the mucosal surface are needed for adequate protection against many diseases such as AIDS, pneumococcal diseases, and influenza. It is commonly thought that vaccination by parenteral injection using a syringe and needle 15 does not lead to a mucosal immune response and that mucosal immunity can only be generated by direct application of vaccines to the mucosal tissue. Topical application of non-replicating vaccines to the mucosal surface has not met with much success yet because of the low delivery efficiency. Immunization via the skin route leads to serum antibody responses. Methods that 20 deliver vaccines via the skin routes include intradermal injection using a liquid injector, transcutaneous immunization (TCI), patch delivery, and our recently described epidermal powder injection technology. Compared to other skin immunization methods, powder injection uses smaller vaccine doses and elicits higher serum antibody titers. Veiy importantly, a variety of adjuvants can be co-formulated and delivered with a vaccine to 25 enhance and modulate the immune response with the powder injection method. Skin is not a mucosal tissue; therefore, vaccination via the skin is not expected to cause a mucosal response. However, Glenn G. M. et a!, have recently reported IgA antibody response to cholera toxin, but not to a co-administered diphtheria toxoid, after transcutaneous immunization (Glenn et al. (1998) J. Immunol. 161:3211-3214: Glenn et 30 al. (1999) Infect. Immun. 67:1100-1106). In these studies, the authors stated that, as -2- expected, no mucosal IgA antibodies to co-administered diphtheria toxoid were found. The dose of cholera toxin used in these studies was lOOmg. TCI is a technique that utilizes ADP-ribosylating exotoxins (e.g. cholera toxin etc) to deliver liquid vaccines through a non-perforated intact skin. 5 Summary of the Invention The present invention concerns eliciting mucosal immunity to antigens that are co-formulated with an adjuvant combination and delivered using a powder injection technique. This invention differs from TCI methodology in at least four aspects: 1) Powder injection 10 delivers particulate vaccine compositions by perforating the stratum corneum, TCI delivers liquid vaccine compositions by coating them onto intact non-perforated skin; 2) Powder injection elicits mucosal immune responses to vaccine antigens, while TCI only elicits mucosal IgA to cholera toxin delivery vehicle/adjuvant, but not to co-administered antigen; 3) In addition to ADP-ribosylating exotoxins, other adjuvants such as CpG can be 15 used to induce and enhance a mucosal response in the powder injection method, while TCI is dependent on ADP-ribosylating exotoxins for delivery; and 4) Powder injection uses smaller doses of vaccine and adjuvants than TCI. We have conducted studies to demonstrate that TCI could not elicit a detectable mucosal antibody response to either cholera toxin or co-administered vaccine with the adjuvant and vaccine doses that were 20 used in the powder injection system. The invention also provides a vaccine composition for use in eliciting mucosal immunity. Accordingly, the invention provides a particulate vaccine composition suitable for delivery into or across the skin of a vertebrate subject using a transdermal delivery technique, the said composition comprising an antigen, or a nucleic acid encoding said 25 antigen, an ADP-ribosylating toxin as an adjuvant, and an oligonucleotide containing a CpG motif. In a preferred embodiment, the ADP-ribosylating toxin is a cholera toxin. These compositions find particular use as therapeutics or vaccines that can be administered to the skin yet provide mucosal immunity against a pathogen that enters the body via a mucosal surface. Preferably, the particulate vaccine composition is delivered using a 30 needleless syringe powder injection device. INTELLECTUAL mPERTY OFRcT of (ml 1 4 APR 2005 -3- Also provided herein are needleless syringe powder injection devices loaded (e.g., containing) one of the vaccine compositions of the present invention In addition, a dosage container comprising one of the particulate vaccine compositions of the present invention for use in a needleless syringe powder injection device is provided. 5 The invention also provides for the use of an antigen derived from or obtained from a pathogen that enters the body of a vertebrate subject via a mucosal surface, or of a nucleic acid encoding a said antigen, in the manufacture of a particulate vaccine composition for treating or preventing a disease caused by a said pathogen, wherein said composition is intended for administration to a said subject in need of treatment or 10 vaccination in an amount sufficient to bring about an IgA antibody response specific for the antigen at a mucosal surface of the subject and wherein said composition further comprises an ADP-ribosylating toxin as an adjuvant and an oligonucleotide containing a CpG motif. These and other embodiments of the invention will readily occur to those of oidinaiy skill in the art in view of the disclosure herein. 15 Brief Description of the Drawings Figures 1 A-ID compare the levels of IgA antibodies to influenza vaccine (in mucosal secretions) following powder injection of an influenza vaccine (a) without adjuvant, (b) with cholera toxin adjuvant, (c) with a CpG motif-containing oligonucleotide 20 adjuvant, or (d) with a combination of the two adjuvants. Mice were vaccinated with two 5 |jg doses of influenza vaccine on weeks 0 and 4. Mucosal secretions were collected on week 6 and assayed in an ELISA. Figure 1A shows Mean IgA titers in nasal secretions from 8 animals. Figure IB shows Mean IgA titers in the saliva from 8 animals. Figure 1C shows IgA titers in vaginal washes pooled from 8 animals. Figure ID shows Mean IgA 25 titers in fecal extract from 8 animals. Abbreviations: Flu: (influenza vaccine); PR8: (influenza vaccine); CT: (cholera toxin); CpG: (oligonucleotide containing CpG motif); PJ: (transdermal powder injection). Figure 2 compares the levels of IgA antibodies to the influenza vaccine (from different in vitro cultured mucosal tissues) following powder injection of an influenza 30 vaccine composition (a) without adjuvant, (b) with cholera toxin adjuvant, (cj^rth auiipuj property office I 4 APR 2005 —ftECEfVEn -4- motif-containing oligonucleotide adjuvant, (d) or with a combination of the two adjuvants. Mice were vaccinated with two 5 |_ig doses of influenza vaccine on weeks 0 and 4. Mucosal tissues were collected on week 6, cultured in vitro for 7 days, and assayed in an ELISA. Mean IgA titers from 8 mice are shown. Abbreviations: PP: (Peyer's patch); SI: 5 (small intestine); PR8: (the PR8 influenza vaccine); CT: (cholera toxin); CpG: (CpG motif-containing oligonucleotide); PJ: (transdermal powder injection). Figures 3A-3C compare the levels of IgG antibodies to the influenza vaccine (in mucosal secretions and in vitro cultured mucosal tissues) following powder injection of an influenza vaccine composition (a) without adjuvant, (b) with cholera toxin adjuvant, (c) with 10 a CpG motif-containing oligonucleotide adjuvant, or (d) with a combination of the two adjuvants. Mice were vaccinated with two 5 jj.g doses of influenza vaccine on weeks 0 and 4. Mucosal secretions were collected on week 6 and assayed in an ELISA. Mucosal tissues collected on week 6 were cultured in vitro for 7 days, and the culture supernatant was assayed for influenza-specific antibodies in an ELISA. Figure 3A shows mean IgG 15 titers in the culture supernatant of various mucosal tissues from 8 animals. Figure 3B shows mean IgG titers in the fecal extract from 8 animals. Figure 3C shows IgG titers in the saliva pooled from 8 animals. Abbreviations: PP: (Peyer's patch); SI: (small intestine); MLN: (Mesenteric lymph node); Flu: (influenza vaccine); CT: (cholera toxin); CpG: (oligonucleotide containing CpG motif); PJ: (transdermal powder injection). 20 Figure 4 shows the levels of IgG antibodies to the influenza antigen following powder injection of a commercial influenza vaccine (a) without adjuvant, (b) with cholera toxin adjuvant, or (c) a combination of the cholera toxin adjuvant with a CpG motif-containing oligonucleotide adjuvant. 8 mice/group received the various vaccine compositions, and sera samples were collected 4 weeks after immunization. The data are 25 IgG titer of the individual animals (") and the mean titer of the 8 mice in the group (—). Abbreviations: no adj. (without adjuvant); CT: (cholera toxin); CpG: (oligonucleotide containing CpG motif). Figure 5 shows the protection against mortality in vaccinated mice following challenge with a heterologous influenza strain Mice were vaccinated via powder injection 30 of a commercial influenza vaccine (a) without adjuvant, (b) with cholera toxin adjuvant, or intellectual property office; of sm.z i 1 h APR 2005 r f= n p i v f n -5- % 10 15 £ 20 25 (c) a combination of the cholera toxin adjuvant with a CpG motif-containing oligonucleotide adjuvant 8 mice/group received the various vaccine compositions, and challenged with 10X the LD50 of a mouse-adapted influenza (Aichi/68 (H3N2)) virus administered intranasally. All animals receiving powder injection of vaccine composition with either the cholera toxin adjuvant alone (• ), or the cholera toxin adjuvant with a CpG motif-containing oligonucleotide adjuvant (•) survived the entire 21 day monitoring period as contrasted with 0% of the non-vaccinated control animals (•) surviving past 8 days post challenge, and only 40% of the animals vaccinated with vaccine composition alone (• ) surviving past 10 days post challenge. Abbreviations: no adj.: (without adjuvant); CT: (cholera toxin); CpG: (oligonucleotide containing CpG motif). Figure 6 shows influenza antigen-specific IgA secreting cells present in mucosal tissue samples obtained from mice vaccinated via powder injection of a commercial influenza vaccine adjuvanted with a combination of cholera toxin adjuvant and a CpG motif-containing oligonucleotide adjuvant Control animals were vaccinated with the same adjuvanted influenza vaccine composition (in phosphate buffered saline) via either intranasal administration or subcutaneous injection with a conventional needle and syringe. 8 mice/group received a prime (day 0) and boost (day 28) immunization with the various vaccine compositions, and mucosal tissue samples were collected two weeks after the boost immunization. Cell suspensions were prepared from pooled samples, and influenza virus antigen-specific IgA secreting cells were enumerated using an ELISPOT assay. The data shown in the figure are average IgA spot-forming cell (SPC) frequency in pooled mucosal tissue from eight mice. Abbreviations: IN (intranasal); EI (transdermal powder injection); SC (subcutaneous); PP (Peyer's patch). Detailed Description of the Preferred Embodiments Before describing the present invention in detail, it is to be understood that this invention is not limited to particular pharmaceutical formulations or process parameters as such may, of course, vaiy. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting. 1« APR 2005 RECEIVED It must be noted that, as used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a particle" includes two or more particles, reference to "an antigen" or "an adjuvant" includes a mixture or a combination of two or more such agents, reference to "an excipient" includes mixtures of two or more excipients, and the like. A. Definitions Unless defined otherwise, all technical and scientific terms used herein have the 10 same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although a number of methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the preferred materials and methods are described herein. In describing the present invention, the following terms will be employed, and are 15 intended to be defined as indicated below. As used herein, the term "transdermal delivery" includes intradermal (e.g., into the dermis or epidermis) and transdermal (e.g. "percutaneous") i.e., delivery by passage of an agent into or through at least a top layer of skin. See, e.g., Transdermal Drug Delivery: Developmental Issues and Research Initiatives, Hadgraft and Guy (eds.), Marcel 20 Dekker, Inc., (1989); Controlled Drug Delivery: Fundamentals and Applications, Robinson and Lee (eds.), Marcel Dekker Inc., (1987); and Transdermal Delivery of Drugs, Vols. 1-3, Kydonieus and Berner (eds.), CRC Press, (1987). The term expressly encompasses delivery of a particulate agent to target tissue to provide a mucosal immune response, and particularly includes delivery of the agent via a powder injection technique. 25 By "needleless syringe" is meant an instrument which can be used to carry out a powder injection technique, and is used herein to deliver a particulate composition transdermally, without a conventional needle that pierces the skin. Suitable needleless syringes for use with the present invention are discussed throughout this document. An "antigen" refers to any immunogeneic moiety or agent, generally a 30 macromolecule, which can elicit an immunological response in an individual. The term may intellectual property office of 1m.z 1 h APR 2005 rphfivpd -7- be used to refer to an individual macromolecule or to a homogeneous or heterogeneous population of antigenic macromolecules. As used herein, the term "antigen" includes allergens. Thus, antigens include proteins, polypeptides, antigenic protein fragments, oligosaccharides, polysaccharides, and the like. Furthermore, the antigen can be derived 5 from any virus, bacterium, parasite, protozoan, or fungus, and can be a whole organism. The antigen will be derived from a pathogen that enters the body via a mucosal surface. Similarly, an oligonucleotide or polynucleotide which expresses an antigen, such as in DNA immunization applications, is also included in the definition of antigen. Synthetic antigens are also included, for example, polyepitopes, flanking epitopes, and other recombinant or 10 synthetically derived antigens (Bergmann et al. (1993) Eur. J. Immunol. 22:2777-2781; Bergmann et al. (1996) J. Immunol. 157:3242-3249: Suhrbier, A. (1997) Immunol, and Cell Biol. 75:402-408: Gardner et al. (1998) 12th World AIDS Conference, Geneva, Switzerland, June 28-July 3,1998). The term "vaccine composition" intends any pharmaceutical composition containing 15 an antigen, which composition can be used to prevent or treat a disease or condition in a subject. The term thus encompasses both subunit vaccines, i.e., vaccine compositions containing antigens which are separate and discrete from a whole organism with which the antigen is associated in nature, as well as compositions containing whole killed, attenuated or inactivated pathogens including bacteria, viruses, parasites and other microbes. Vaccine 20 compositions according to the invention also contain adjuvants as described herein. Typically the vaccine composition is used for the prophylaxis of a disease caused by a pathogen that enters the body via a mucosal surface. The term "mucosal surface" includes all external surfaces of the body which are protected by the secretion of mucus. Such mucosal surfaces include those of the 25 gastrointestinal tract, the respiratory tract and the reproductive tract Also included in this definition is the eye and urinary tract The skin is not a mucosal surface. An "immunological response" or "immune response" against a selected agent, antigen or a composition of interest is the development in an individual of a humoral and/or a cellular immune response to molecules (e.g., antigen) present in the agent or composition 30 of interest. For purposes of the present invention, a "humoral immune response" refers tn li|\ITC| iECTllAL prqpfrtv office. j "" nr *y,7 j 1APR 2005 i R E C EIVED -8- an immune response mediated by antibody molecules, while a "cellular immune response" is one mediated by T-lymphocytes and/or other white blood cells. By "IgA antibody response" is meant the generation of IgA antibodies against an antigen or infectious agent at a mucosal surface. The generation of an IgA antibody 5 response at the mucosal surface involves the secretion of antibodies into the mucus. Antibodies of the IgG subclass may be present in the mucus. However, the hallmark of a mucosal immune response is the generation of IgA antibodies. IgA is the major antibody subclass in mucosal secretions where it functions to block the entiy of microorganisms from the external surfaces to the tissues below. By "antigen-specific IgA response" is meant the 10 production of IgA antibodies directed against a specific antigen Hie generation of an antigen-specific IgA antibody response is an important part of the generation of a mucosal immune response. The term "adjuvant" intends any material or composition capable of specifically or non-specifically altering, enhancing, directing, potentiating or initiating an antigen-specific 15 IgA antibody response. Thus, coadministration of an adjuvant and an antigen (e.g., as a vaccine composition) may result in a lower dose or fewer doses of antigen being necessaiy to achieve an IgA antibody response in the subject to which the antigen is administered. The effectiveness of an adjuvant can be determined by administering the adjuvant with a vaccine composition and vaccine composition controls to animals and comparing antibody 20 titers and/or cellular-mediated immunity against the two using standard assays such as radioimmunoassay, ELISAs, CTL assays, and the like, well known in the art Typically, in a vaccine composition, the adjuvant is a separate moiety from the antigen, although a single molecule can have both adjuvant and antigen properties (e.g., cholera toxin). For the purposes of the present invention, an adjuvant is used to either enhance the IgA antibody 25 response to a specific antigen, e.g., when an adjuvant is coadministered with a vaccine composition, the mucosal IgA antibody response is greater than the immune response elicited by an equivalent amount of the vaccine composition administered without the adjuvant, or the adjuvant is used to direct a mucosal IgA antibody response against an antigen administered to the skin. In addition, for the purposes of the present invention, an 30 "effective amount" of an adjuvant will be that amount which enhances an immunological intellectual property office op i\!.z 1« APR 2005 RECEIVED / response to a coadministered antigen in a vaccine composition such that lower or fewer doses of the antigen are required to generate an efficient mucosal IgA antibody response. Similarly, an "effective amount" of a vaccine composition is an amount which will stimulate an antigen-specific mucosal IgA antibody response in the subject to which the 5 vaccine composition is administered. As used herein, the term "coadministered," such as when an adjuvant is "coadministered" with an antigen (e.g., a vaccine composition), intends the simultaneous or concurrent administration of adjuvant and antigen, in the same composition. Particles which comprise an antigen and adjuvant are typically prepared as 10 pharmaceutical compositions which can contain one or more added materials such as carriers, vehicles, and/or excipients. "Carriers," "vehicles" and "excipients" generally refer to substantially inert materials which are nontoxic and do not interact with other components of the composition in a deleterious manner. These materials can be used to increase the amount of solids in particulate compositions. Examples of suitable carriers 15 include water, silicone, gelatin, waxes, and like materials. Examples of normally employed "excipients" include pharmaceutical grades of dextrose, sucrose, lactose, trehalose, mannitol, sorbitol, inositol, dextran, starch, cellulose, sodium or calcium phosphates, calcium carbonate, calcium sulfate, sodium citrate, citric acid, tartaric acid, glycine, high molecular weight polyethylene glycols (PEG), and combinations thereof. 20 As used herein, the term "treatment" includes any of following: the prevention of infection or reinfection; the reduction or elimination of symptoms; and the reduction or complete elimination of a pathogen Treatment may be effected prophylactically (prior to infection). The terms "individual" and "subject" are used interchangeably herein to refer to any 25 member of the subphylum cordata, including, without limitation, humans and other primates (including non-human primates such as chimpanzees and other apes and monkey species); farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs; birds (including domestic, wild and game birds such as chickens, turkeys and other gallinaceous 30 birds, ducks, geese); fish; and the like. The terms do not denote a particular age. Thus, intellectual property office of m.z 1 "I APR 2005 Rpnpivpn -10- both adult and newborn individuals are intended to be covered. The methods described herein are intended for use in any of the above vertebrate species, since the immune systems of all of these vertebrates operate similarly. B. General Methods Antigens for use with the present invention are preferably derived or obtained from pathogens that enter the tissues of a vertebrate via a mucosal surface. Alternatively the antigens may be synthetic antigens that induce IgA antibodies that are directed to, or are specific for a pathogen that enters the body via a mucosal surface. Adjuvants combinations for use with the present invention contain or are derived from a bacterial exotoxin from the family of bacterial ADP-ribosylating exotoxins ('bAREs"), and more preferably contain or are derived from a cholera toxin (CT). The antigens are administered to a target skin site and are delivered in a particulate form, preferably via a powder injection technique. The adjuvants are likewise administered to the skin, in a particulate form and preferably by a powder injection technique. Antigens Suitable viral antigens include, but are not limited to, antigens or polynucleotide 20 sequences encoding antigens from the hepatitis family of viruses, including hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), the delta hepatitis virus (HDV), hepatitis E virus (HEV) and hepatitis G virus (HGV). By way of example, the viral genomic sequence of HCV is known, as are methods for obtaining the sequence. See, e.g., International Publication Nos. WO 89/04669; WO 90/11089; and WO 90/14436. 25 The HCV genome encodes several viral proteins, including El and E2. See, e.g., Houghton et al. (1991) Hepatology 14:381-388. The sequences encoding each of these proteins, as well as antigenic fragments thereof, will find use in the present methods. Similarly, the coding sequence for the d-antigen from HDV is known (see, e.g., U.S. Patent No. 5,378,814). Peptide/protein antigens encoded by these sequences are either 30 known or readily obtainable. inteilectijal property office of aj.z 1 4 APR 2005 10 15 -11- In like manner, a wide variety of proteins from the herpesvirus family can be used as antigens in the present invention, including proteins derived from herpes simplex virus (HSV) types 1 and 2, such as HSV-1 and HSV-2 glycoproteins gB, gD and gH; antigens from varicella zoster virus (VZV), Epstein-Barr virus (EBV) and cytomegalovirus (CMV) 5 including CMV gB and gH; and antigens from other human herpesviruses such as HHV6 and HHV7. (See, e.g. Chee et al. (1990) Cytomegaloviruses (J.K. McDougall, ed., Springer-Verlag, pp. 125-169; McGeochetal. (1988) J. Gen. Virol. 69:1531-1574: U.S. Patent No. 5,171,568; Baer et al. (1984) Nature 310:207-211; and Davison et al. (1986) J. Gen. Virol. 67:1759-1816.) 10 Human immunodeficiency virus (HIV) antigens, such as gpl20 molecules for a multitude of HTV-l and HIV-2 isolates, including members of the various genetic subtypes of HIV, are known and reported (see, e.g., Myers et al., Los Alamos Database, Los Alamos National Laboratory, Los Alamos, New Mexico (1992); and Modrow et al. (1987) J. Virol. 61:570-5781 and antigens derived from any of these isolates will find use 15 in the present methods. Furthermore, the invention is equally applicable to other immunogenic proteins derived from any of the various HIV isolates, including any of the various envelope proteins such as gpl60 and gp41, gag antigens such as p24gag and p55gag, as well as proteins derived from the pol, env, tat, vif, rev, nef, vpr, vpu and LTR regions of HIV. 20 Antigens derived or obtained from other viruses will also find use in the claimed methods, such as without limitation, proteins from members of the families Picornaviridae (e.g., polioviruses, rhinoviruses, etc.); Caliciviridae; Togaviridae (e.g., rubella virus, etc.); Flaviviridae; Coronaviridae; Reoviridae (e.g., rotavirus, etc.); Birnaviridae; Rhabodoviridae (e.g., rabies virus, etc.); Orthomyxoviridae (e.g., influenza virus types A, B and C, etc.); 25 Filoviridae; Paramyxoviridae (e.g., mumps virus, measles virus, respiratory syncytial virus, parainfluenza virus, etc.); Bunyaviridae; Arenaviridae; Retroviradae (e.g., HTLV-I; HTLV-II; HIV-1 (also known as HTLV-III, LAV, ARV, hTLR, etc.)), including but not limited to antigens from the isolates HIV^, HIVSF2, HIVlav, HTVLAI, HIVmn); HIV-1CM235, HIV-1US4; HIV-2, among others; simian immunodeficiency virus (SIV); Papillomavirus; and the 30 like. See, e.g. Virology, 3rd Edition (W.K. Joklik ed. 1988); Fundamental Virology, intciiectual property office OF M.7. 1 h APR 2005 -12- 2nd Edition (B.N. Fields and D.M. Knipe, eds. 1991), for a description of these and other viruses. Preferably, viral antigens used in the present invention are obtained or derived from a viral pathogen that typically enters the body via a mucosal surface and is known to cause 5 or is associated with human disease, such as, but not limited to, HIV (AIDS), influenza viruses (Flu), herpes simplex viruses (genital infection, cold sores, STDs), rotaviruses (diarrhea), parainfluenza viruses (respiratory infections), poliovirus (poliomyelitis), respiratory syncytial virus (respiratory infections), measles and mumps viruses (measles, mumps), rubella virus (rubella), and rhinoviruses (common cold). 10 Suitable bacterial and parasitic antigens are obtained or derived from known causative agents responsible for diseases including, but not limited to, Diptheria, Pertussis, Tuberculosis, Bacterial or Fungal Pneumonia, Otitis Media, Gonnorhea, Cholera, Typhoid, Meningitis, Mononucleosis, Plague, Shigellosis or Salmonellosis, Legionaire's Disease, Leprosy, Hookworm, Onchocerciasis, Schistosomiasis, Trypamasomialsis, Lesmaniasis, 15 Giardia, Amoebiasis, Borelia, and Trichinosis. Still further antigens can be obtained or derived from unconventional viruses such as the causative agents ofkuru, Creutzfeldt-Jakob disease (CJD), scrapie, transmissible mink encephalopathy, and chronic wasting diseases, or from proteinaceous infectious particles such as prions that are associated with mad cow disease. 20 Preferably, bacterial antigens used in the present invention are obtained or derived from a bacterial pathogen that typically enters the body via a mucosal surface and causes or is associated with human disease, such as, but not limited to, Streptococcus (pneumonia, throat infection, otitis media), Haemophilus influenza (otitis media), Moraxella cartarrhalis (otitis media), Neisseria gonnorhoeae (gonnorhea), Vibrio 25 cholerae (cholera, diarrhea), Salmonella (enteric infections, diarrhea), Escherichia coli (enteric infections, genital infections), Shigella (shigellosis), Mycobacterium tuberculosis (tuberculosis), Neisseria meningitidis (meningitis), Mycoplasma pneumoniae (respiratory infections), and Chlamydia (pneumonia, genital infections). A mucosal IgA antibody response may also be important for vaccines or 3 0 compositions for use in treating or preventing allergic conditions or disorders resulting from intellectual property office of N.Z 14 APR 2005 __ RECEIVFn -13- inhaled or orally encountered allergens. In this regard, mucosal IgA antibodies can bind and clear such antigens before they can bring about an allergic condition. Classes of suitable allergens for use in the present invention thus include, but are not limited to, pollens, animal dander, grasses, molds, dusts, antibiotics, stinging insect venoms, and a variety of environmental (including chemicals and metals), drug and food allergens. Common tree allergens include pollens from cottonwood, popular, ash, birch, maple, oak, elm, hickory, and pecan trees; common plant allergens include those from rye, ragweed, English plantain, sorrel-dock and pigweed; plant contact allergens include those from poison oak, poison ivy and nettles; common grass allergens include Timothy, Johnson, Bermuda, fescue and bluegrass allergens; common allergens can also be obtained from molds or fungi such as Alternaria, Fusarium, Hormodendrum, Aspergillus, Micropolyspora, Mucor and thermophilic actinomycetes; penicillin and tetracycline are common antibiotic allergens; epidermal allergens can be obtained from house or organic dusts (typically fungal in origin), from insects such as house mites (dermatphagoides pterosinyssis), or from animal sources such as feathers, and cat and dog dander; common food allergens include milk and cheese (diary), egg, wheat, nut (e.g., peanut), seafood (e.g., shellfish), pea, bean and gluten allergens; common environmental allergens include metals (nickel and gold), chemicals (formaldehyde, trinitrophenol and turpentine), Latex, rubber, fiber (cotton or wool), burlap, hair dye, cosmetic, detergent and perfume allergens; common drug allergens include local anesthetic and salicylate allergens; antibiotic allergens include penicillin and sulfonamide allergens; and common insect allergens include bee, wasp and ant venom, and cockroach calyx allergens. Particularly well characterized allergens include, but are not limited to, the major and cryptic epitopes of the Der p I allergen (Hoyne et al. (1994) Immunology £1:190-195), bee venom phospholipase A2 (PLA) (Akdis et al. (1996) J. Clin. Invest. 98:1676-1683), birch pollen allergen Bet v 1 (Bauer et al. (1997) Clin. Exp. Immunol. 102:536-541), and the multi-epitopic recombinant grass allergen rKBG8.3 (Cao et al. (1997) Immunology 90:46-51). These and other suitable allergens are commercially available and/or can be readily prepared as extracts following known techniques. Antigens for use with the present invention can be obtained or produced using a variety of methods known to those of skill in the art In particular, the antigens can be i intellectual property office of >m.z 1 4 APR 2005 RECEIVED -14- isolated directly from native sources, using standard purification techniques. Alternatively, the antigens can be produced recombinantly using known techniques. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Vols. I, II and III, Second Edition (1989); DNA Cloning, Vols. I and II (D.N. Glover ed. 1985). Antigens for use herein may also be synthesized, based on described amino acid sequences, via chemical polymer syntheses such as solid phase peptide synthesis. Such methods are known to those of skill in the art. See, e.g., J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, 2nd Ed., Pierce Chemical Co., Rockford, IL (1984) and G. Barany and R. B. Merrifield, The Peptides: Analysis, Synthesis, Biology, editors E. Gross and J. Meienhofer, Vol. 2, Academic Press, New York, (1980), pp. 3-254, for solid phase peptide synthesis techniques; and M. Bodansky, Principles of Peptide Synthesis, Springer-Verlag, Berlin (1984) and E. Gross and J. Meienhofer, Eds., The Peptides: Analysis, Synthesis, Biology, supra, Vol. 1, for classical solution synthesis. If desired, polynucleotide sequences coding for the above-described antigens, can be obtained using recombinant methods, such as by screening cDNA and genomic libraries from cells expressing the gene, or by deriving the gene from a vector known to include the same. Furthermore, the desired gene can be isolated directly from cells and tissues containing the same, using standard techniques, such as phenol extraction and PCR of cDNA or genomic DNA. See, e.g., Sambrook et al., supra, for a description of techniques used to obtain and isolate DNA. Polynucleotide sequences can also be produced synthetically, rather than cloned. Yet another convenient method for isolating specific nucleic acid molecules is by the polymerase chain reaction (PCR). Mullis et al. (1987) Methods Enzymol. 155:335-350. This technique uses DNA polymerase, usually a thermostable DNA polymerase, to replicate a desired region of DNA. The region of DNA to be replicated is identified by oligonucleotides of specified sequence complementary to opposite ends and opposite strands of the desired DNA to prime the replication reaction. The product of the first round of replication is itself a template for subsequent replication, thus repeated successive cycles of replication result in geometric amplification of the DNA fragment delimited by the primer pair used. (intellectual property office i OF N.Z 14 APR 2005 I RECEIVED ' • 10 15 Q 20 25 -15- Once obtained, the polynucleotide sequences can be expressed in mammalian, bacterial, yeast, or insect expression systems to provide suitable antigen preparations, or used per se as a nucleic acid antigen composition (e.g., for nucleic acid immunization techniques). In whatever form the antigen is to be used (peptide, whole organism, nucleic acid), the antigen of interest is formed into a particulate composition as described herein and administered to a subject along with an adjuvant which either serves to enhance the mucosal IgA antibody response to the antigen, or directs a mucosal IgA antibody response against the antigen Thus, the particulate composition will be delivered to the skin but, surprisingly, will elicit the generation of a mucosal IgA antibody response at one or more mucosal surfaces. It is preferred that the particular transdermal delivery system used perforates the stratum corneum, such as a powder injection system. It is also preferred that the adjuvant is delivered to the skin, typically by a transdermal delivery method that also perforates the stratum corneum. As explained above, the adjuvant is present in the same composition as the antigen, and is delivered simultaneously with the antigen or vaccine composition. Adjuvants The present invention uses adjuvants derived from ADP-ribosylating bacterial toxins, including diphtheria toxin (DT), pertussis toxin (PT), cholera toxin (CT), the E. coli heat-labile toxins (LTl and LT2), Pseudomonas endotoxin A, Pseudomonas exotoxin S, B. cereus exoenzyme, B. sphaericus toxin, C. botulinum C2 and C3 toxins, C. limosum exoenzyme, as well as toxins from C. perfringens, C. spiriforma and C. difficile, Staphylococcus aureus EDIN, and ADP-ribosylating bacterial toxin mutants such as CRM197, a non-toxic diphtheria toxin mutant (see, e.g., Bixler et al. (1989) Adv. Exp. Med. Biol. 251:175; and Constantino et al. (1992) Vaccine), with cholera toxin and heat labile toxins being most preferred. The invention also uses adjuvants derived from the CpG family of molecules, CpG dinucleotides and synthetic oligonucleotides which comprise CpG motifs (see, e.g., Krieg et al. Nature (1995) 224:546, Medzhitov et al. (1997) Curr. Opin. Immunol. 9:4-9, and Davis et al .J. Immunol. (1998) 1,60:870-8761 nmrP v j ^ v intellectual property office, OF f\i.Z t \ APR 2005 RECEIVED -16- such as TCCATGACGTTCCTGATGCT (SEQ ID NO: 1) and ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 2). Oligonucleotides containing a CpG motif are also preferred. The adjuvants are delivered in a combination of two adjuvants. In this regard, 5 combined adjuvants may have an additive or a synergistic effect in promoting a mucosal IgA antibody response. A synergistic effect is one where the result achieved by combining two or more adjuvants is greater than one would expect than by merely adding the result achieved with each adjuvant when administered individually. The adjuvant combination is an adjuvant derived from an ADP-ribosylating bacterial toxin and a synthetic 10 oligonucleotide comprising a CpG motif. A particularly preferred combination comprises cholera toxin and the oligonucleotide ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 2). Unfortunately, the above-referenced adjuvants are known to be highly toxic, and are thus generally considered too toxic for human use. It is for this reason that the only adjuvant currently approved for human usage is alum, an aluminum salt composition. 15 Nevertheless, the above adjuvants are commonly used in animals and thus suitable for numerous intended subjects. However, as discussed herein above, the adjuvants are rendered into particulate form for transdermal delivery using a powder injection method. Surprisingly, it has been found that adjuvants which are generally considered too toxic for human use may be rendered into particulate form and administered with a powder injection 20 technique without concomitant toxicity problems. Without being bound by a particular theory, it appears that delivery of adjuvants to the skin, using transdermal deliveiy methods (powder injection), allows interaction with Langerhans cells in the epidermal layer and dendritic cells in the cutaneous layer of the skin. These cells are important in initiation and maintenance of an immune response. Thus, an enhanced adjuvant effect can be obtained 25 by targeting delivery to or near such cells. Moreover, transdermal delivery of adjuvants in the practice of the invention may avoid toxicity problems because (1) the top layers of the skin are poorly vascularized, thus the amount of adjuvant entering the systemic circulation is reduced which reduces the toxic effect; (2) skin cells are constantly being sloughed, therefore residual adjuvant is eliminated rather than absorbed; and (3) substantially less 30 adjuvant can be administered to produce a suitable adjuvant effect (as compared with jtei.lectual property office, of m.z | 1 h APR 2005 | RECPIVPn I -17- adjuvant that is delivered using conventional techniques such as intramuscular injection). Once selected, the adjuvant can be rendered into particulate form as described in detail below. The adjuvants) will be present in the particulate form in an amount sufficient to bring about the desired effect, that is, either to enhance the mucosal response against the 5 coadministered antigen of interest, and/or to direct a mucosal IgA antibody response against the antigen of interest. Generally about 0.1 \xg to 1000 (j.g of adjuvant, more preferably about 1 (j.g to 500 |j.g of adjuvant, and more preferably about 5 |_tg to 300 |_ig of adjuvant will be effective to enhance an IgA antibody response of a given antigen. Thus, for example, for CpG, doses in the range of about 0.5 to 50 (ig, preferably about 1 to 25 10 |ig, and more preferably about 5 to 20 jj.g, will find use with the present methods. For cholera toxin, a dose in the range of about 0.1 |jg to 50 |ug, preferably about 1 |xg to 25 |ig, and more preferably about 5 (igto 15 jig will find use herein Doses for adjuvants can readily be determined by one of skill in the art using routine methods. The amount to administer will depend on a number of factors including 15 the coadministered antigen, as well as the ability of the adjuvant to act as stimulator of a mucosal IgA antibody response. Particulate Compositions Once obtained, the antigen of interest (as well as the selected adjuvant) can be 20 formulated as a particulate composition. More particularly, formulation of particles comprising the antigen and adjuvant of interest can be carried out using standard pharmaceutical formulation chemistries and methodologies all of which are readily available to the reasonably skilled artisan. For example, one or more antigen and adjuvant can be combined with one or more pharmaceutically acceptable excipient or vehicle to provide a 25 vaccine composition. Auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in the excipient or vehicle. These excipients, vehicles and auxiliary substances are generally pharmaceutical agents that do not themselves induce an immune response in the individual receiving the composition, and which may be administered without undue toxicity. Pharmaceutically acceptable excipients 30 include, but are not limited to, liquids such as water, saline, polyethyleneglycol, hyaluronic intellectual property office* of n.z \ 1 4 APR 2005 RFHFIX/Fn -18- acid, glycerol and ethanol. Pharmaceutically acceptable salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. It is also preferred, although not required, that an antigen 5 composition will contain a pharmaceutically acceptable carrier that serves as a stabilizer, particularly for peptide, protein or other like antigens. Examples of suitable carriers that also act as stabilizers for peptides include, without limitation, pharmaceutical grades of dextrose, sucrose, lactose, trehalose, mannitol, sorbitol, inositol, dextran, and the like. Other suitable carriers include, again without limitation, starch, cellulose, sodium or calcium 10 phosphates, citric acid, tartaric acid, glycine, high molecular weight polyethylene glycols (PEGs), and combination thereof. A thorough discussion of pharmaceutically acceptable excipients, carriers, stabilizers and other auxiliary substances is available in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co., N.J. 1991), incorporated herein by reference. 15 The formulated compositions will include an amount of the antigen of interest which is sufficient to mount an IgA antibody response, as defined above. An appropriate effective amount can be readily determined by one of skill in the art. Such an amount will fall in a relatively broad range, generally within the range of about 0.1 |agto 25 mg or more of the antigen of interest, and specific suitable amounts can be determined through routine 20 trials. The compositions may contain from about 0.1% to about 99.9% of the antigen. The adjuvant will be present in a suitable amount as described above. The compositions are then prepared as particles using standard techniques, such as by simple evaporation (air drying), vacuum drying, spray drying, freeze drying (lyophilization), spray-freeze drying, spray coating, precipitation, supercritical fluid particle formation, and the like. If 25 desired, the resultant particles can be densified using the techniques described in commonly owned International Publication No. WO 97/48485, incorporated herein by reference. Single unit dosages or multidose containers, in which the particles may be packaged prior to use, can comprise a hermetically sealed container enclosing a suitable amount of the particles comprising the antigen of interest and/or the selected adjuvant (e.g., 30 the vaccine composition). The particulate compositions can be packaged as a sterile intellectual property office i of l\i.z 14 APR 2005 PCPCH/l-r^ -19- formulation, and the hermetically sealed container can thus be designed to preserve sterility of the formulation until use in the methods of the invention. If desired, the containers can be adapted for direct use in the a needleless syringe system. The container in which the particles are packaged can further be labelled to identify 5 the composition and provide relevant dosage information. In addition, the container can be labelled with a notice in the form prescribed by a governmental agency, for example the Food and Drug Administration, wherein the notice indicates approval by the agency under Federal law of the manufacture, use or sale of the antigen, adjuvant (or vaccine composition) contained therein for human administration. 10 The particulate compositions (comprising the antigen of interest and the adjuvant combination) can then be administered using a transdermal delivery technique. Preferably, the particulate compositions will be delivered via a powder injection method, e.g., delivered from a needleless syringe system such as those described in commonly owned International Publication Nos. WO 94/24263, WO 96/04947, WO 96/12513, and WO 15 96/20022, all of which are incorporated herein by reference. Delivery of particles from such needleless syringe systems is practiced with particles having an approximate size generally ranging from 0.1 to 250 |_im, preferably ranging from about 10-70 |_im. Particles larger than about 250 |am can also be delivered from the devices, with the upper limitation being the point at which the size of the particles would cause untoward damage to the skin 20 cells. The actual distance which the delivered particles will penetrate a target surface depends upon particle size (e.g., the nominal particle diameter assuming a roughly spherical particle geometry), particle density, the initial velocity at which the particle impacts the surface, and the density and kinematic viscosity of the targeted skin tissue. In this regard, optimal particle densities for use in needleless injection generally range between about 0.1 25 and 25 g/cm3, preferably between about 0.9 and 1.5 g/cm3, and injection velocities generally range between about 100 and 3,000 m/sec, or greater. With appropriate gas pressure, particles having an average diameter of 10-70 (im can be accelerated through the nozzle at velocities approaching the supersonic speeds of a driving gas flow. If desired, these needleless syringe systems can be provided in a preloaded 30 condition containing a suitable dosage of the particles comprising the antig^rtnsfftosjest ^property office 1 h APR 2005 RECEIVED -20- and/or the selected adjuvant. The loaded syringe can be packaged in a hermetically sealed container, which may further be labeled as described above. Coated Particles 5 Alternatively, if intracellular delivery is desired, the antigens and adjuvants can be coated onto suitable carrier particles, e.g., gold or tungsten. If the antigen is to be provided in nucleic acid form, intracellular delivery is preferred. Accordingly, in one embodiment of the invention, the antigens, polynucleotides encoding antigens (e.g., DNA vaccines) and/or adjuvants are delivered using carrier particles. Particle-mediated methods 10 for delivering such vaccine preparations are known in the art. More particularly, once prepared and suitably purified, antigens, nucleic acid molecules encoding antigens and/or adjuvants can be coated onto carrier particles (e.g., ballistic core carriers) using a variety of techniques known in the art. Carrier particles are selected from materials which have a suitable density in the range of particle sizes typically used for intracellular delivery from a 15 gene gun device. The optimum carrier particle size will, of course, depend on the diameter of the target cells. Any suitable carrier particle can be used, for example, particles formed from polymers or metals (e.g., tungsten, gold, platinum and iridium); however, tungsten and gold carrier particles are preferred. Tungsten particles are readily available in average sized of 20 0.5 to 2.0 (jm in diameter. Although such particles have optimal density for use in particle-mediated delivery methods, and allow highly efficient coating with DNA, tungsten may potentially be toxic to certain cell types. Gold particles or microcrystalline gold (e.g., gold powder A1570, available from Engelhard Corp., East Newark, NJ) will also find use with the present methods. Gold particles provide uniformity in size (available from Alpha 25 Chemicals in particle sizes of 1-3 (am, or available from Degussa, South Plainfield, NJ in a range of particle sizes including 0.95 jim) and reduced toxicity. Microcrystalline gold provides a diverse particle size distribution, typically in the range of 0.5-5 |jun. However, the irregular surface area of microcrystalline gold provides for highly efficient coating with nucleic acids, antigens and adjuvants. 30 A number of methods are known and have been described for coatinpar intellectual property office -of n.z i 1 APR 2005 RECEIVED intellectual property office of n.z 1 k APR 2005 -21- received precipitating DNA or RNA onto gold or tungsten particles. Such methods generally combine a predetermined amount of gold or tungsten with plasmid DNA, CaCl2 and spermidine. The resulting solution is vortexed continually during the coating procedure to ensure uniformity of the reaction mixture. After precipitation of the nucleic acid, the coated 5 particles can be transferred to suitable membranes and allowed to dry prior to use, coated onto surfaces of a sample module or cassette, or loaded into a delivery cassette for use in particular gene gun instruments. Peptide antigens and adjuvants can be attached to carrier particle by simply mixing the two components in an empirically determined ratio, by ammonium sulfate precipitation 10 or other solvent precipitation methods familiar to those skilled in the art, or by chemical coupling of the peptide to the carrier particle. The coupling of L-cysteine residues to gold has been previously described (Brown et al. (1980) Chemical Society Reviews 9:271-311). Other methods include, for example, dissolving the peptide antigen in absolute ethanol, water, or an alcohol/water mixture, adding the solution to a quantity of carrier 15 particles, and then drying the mixture under a stream of air or nitrogen gas while vortexing. Alternatively, the peptide antigens can be dried onto carrier particles by centrifugation undo- vacuum. Once dried, the coated particles can be resuspended in a suitable solvent (e.g., ethyl acetate or acetone), and triturated (e.g., by sonication) to provide a substantially uniform suspension. 20 Following their formation, carrier particles coated with antigen and adjuvant preparations are delivered to the target skin site using a particle-mediated delivery technique. Various particle acceleration devices suitable for particle-mediated delivery are known in the art, and are all suited for use in the practice of the invention. Current device designs employ an explosive, electric or gaseous discharge to propel the coated carrier 25 particles toward target cells. The coated carrier particles can themselves be releaseably attached to a movable carrier sheet, or removably attached to a surface along which a gas stream passes, lifting the particles from the surface and accelerating them toward the target An example of a gaseous discharge device is described in U.S. Patent No. 5,204,253. An explosive-type device is described in U.S. Patent No. 4,945,050. One example of a 30 helium discharge-type particle acceleration apparatus is the PowderJect® XR instrument • 10 15 • 20 25 tellectual property office of n.z 1 h apr 2005 -22- received (PowderJect Vaccines, Inc., Madison), WI, which instrument is described in U.S. Patent No. 5,120,657. An electric discharge apparatus suitable for use herein is described in U.S. Patent No. 5,149,655. The disclosure of all of these patents is incorporated herein by reference. Single dosages of the coated carrier particles can be provided in a suitable container, for example, provided in a length of tubing which contains a dose of the particles coated on an inner surface thereof. Methods for preparing such containers are described in commonly owned U.S. Patent Nos. 5,733,600 and 5,780,100, the disclosures of which are incorporated herein by reference. The particle compositions or coated particles are administered to the individual in a manner compatible with the dosage formulation, and in an amount that will be effective for the purposes of the invention. The amount of the composition to be delivered (e.g., about 0.1 |ig to 1 mg, more preferably 1 to 50 |ag of the antigen or allergen, depends upon the individual to be tested and the particular antigen(s) or allergen(s) being administered. The exact amount necessaiy will vary depending on the age and general condition of the individual to be treated, and an appropriate effective amount can be readily determined by one of skill in the art upon reading the instant specification. Administration and Dosage Schedules Vaccine compositions containing antigen and adjuvant are administered to the subject in a manner compatible with the dosage formulation, and in amounts effective to bring about a desired mucosal IgA antibody response. The amount of the antigen to be delivered per administration is, in the case of nucleic acid molecules encoding an antigen, generally in the range of from about 0.001 |ag to 10 mg, and preferably about 0.01 to 5000 |ig of nucleic acid molecule per dose (generally in the range of from 0.5 |ig/kg to 100 Hg/kg of nucleic acid molecule per dose), and in the case of an antigen molecule (e.g., a peptide, carbohydrate or whole organism) is about 1 \ig to 20 mg, and preferably about 1 Mg to 5 mg, and more preferably about 10 ^g to 3 mg. The exact amount will, of course, depend upon both the subject and the condition to be treated or prevented. More particularly, the exact amount necessaiy will vary depending on the age and general condition of the -23- iintellectual property office of n.z 1 h APR 2005 received individual, and the particular antigen(s) and/or adjuvants) selected, as well as other factors. An appropriate effective amount can be readily determined by one of skill in the art upon reading the instant specification and/or can be determined through routine trials. For powder injection, transdermal delivery is carried out with particles having an 5 approximate size that generally ranges between 0.1 and 250 |im. However, the optimal particle size is usually at least about 10 to 15 |im (the size of a typical cell). Particles larger than about 250 |im can also be delivered from the device, with the upper limitation being the point at which the size of the particles would cause untoward damage to the skin. Other particulate biopharmaceuticals, such as peptide and protein preparations, will 10 generally have an approximate size of 0.1 to about 250 |xm, preferably about 0.1 to about 150 (im, and most preferably about 20 to about 60 |im. The actual distance which the delivered particles will penetrate depends upon particle size (e.g., the nominal particle diameter assuming a roughly spherical particle geometiy), particle density, the initial velocity at which the particle impacts the skin surface, 15 and the density and kinematic viscosity of the skin. In this regard, optimal particle densities for use in needleless injection generally range between about 0.1 and 25 g/cm3, and optimal bulk densities range from about 0.5 and 3.0 g/cm?. Injection velocities generally range between about 100 and 3,000 m/sec. Dosage treatment may be a single dose schedule or a multiple dose schedule. For 20 vaccine compositions, a multiple dose schedule is one in which a primary course of vaccination may be with 1-10 separate doses, followed by other doses given at subsequent time intervals, chosen to maintain and/or reinforce the IgA antibody response, for example at 1-4 months for a second dose, and if needed, a subsequent dose (s) after several months. The dosage regimen will also, at least in part, be determined by the need of the 25 subject and be dependant on the judgment of the practitioner. Furthermore, if prevention of disease is desired, the compositions are generally administered prior to primary infection with the pathogen of interest. If treatment is desired, e.g., the reduction of symptoms or recurrences, the compositions are generally administered subsequent to primary infection. 30 C. Examples intellectual property office of n.z 1 k APR 2005 ~24~ received Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., 5 amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for. General Materials and Methods Vaccine formulation: Vaccines can be formulated in powder form using a number 10 of particle formation processes. Excipients, such as trehalose, sucrose, agarose, mannitol, or a mixture of sugar excipients are preferably used in the formulations to provide for stabilization (of the antigen(s) and/or adjuvant(s)) and enhanced particle characteristics (e.g., enhanced hardness, density). Standard particle preparation processes include air-drying, freeze-drying, spray-coating, spray-drying, spray-freeze drying, and supercritical 15 fluid technology. The following is an example of air-drying a vaccine compositioa First, the antigen (such as diphtheria toxoid, influenza vaccine, etc.) was combined with adjuvant (e.g. cholera toxin, synthetic oligonucleotide containing CpG motif, etc.), then mixed with a trehalose/water solution. The solution was gently mixed, poured into glass petri dishes and 20 allowed to air-dry for two days under a fume hood, after which it was further dried in a desiccator (Nalgene™ Plastic desiccator) then purged with N2 gas for another day. The dried solid was collected by scraping and was ground with mortar and pestle. Finally, dry powder was weighed and the amount of dry material for each dose was determined by dividing the total weight by the number of doses formulated. Particle size distribution of the 25 reformulated vaccine composition was measured, and a broad size range of particles was used (e.g., 1-100 mm). An appropriate amount of the powdered vaccine composition was measured using a balance and loaded into a particle cassette. Typically, each dose required about 1-2 mg of dry mass. The variation in weighing was 10% or less. Device: The powder injection technology employs a helium-powered PowderJect® 30 ND powder injection device (needleless syringe) as previously described (see, e.g., US -25- iintellectual property office of w.z 1 4 APR 2005 RECEIV E D Patent No. 5,899,880 to Bellhouse, et al.). The powder injection device that was used to conduct the present studies is a reusable research model obtained from PowderJect Vaccines, Inc. (Madison, WI). The instrument is approximately 15 cm in length and comprises an actuation button, a helium gas chamber, a vaccine cassette (containing the 5 particulate vaccine composition), a nozzle, and a silencer. In use, the stainless steel gas chamber is filled with approximately 5 ml of medical grade helium gas to 50 bar pressure. Upon actuation, the released helium gas ruptures the membranes of the trilaminate cassette and accelerates the vaccine particles to sufficiently high velocity such that the particles perforate the stratum corneum and are delivered into the epidermis. The helium gas is 10 reflected off the skin and exhausted through the vented silencer. The depth of particle penetration depends upon the powder formulation, the particle size, the gas pressure, and the mechanics of the device. All of these parameters can be experimentally optimized to deliver powders through the stratum corneum of different thickness. Mice and vaccination: Female Balb/C mice or Swiss Webster mice, 7 weeks of 15 age were purchased from HSD and acclimatised for 1 week at a mouse facility before vaccination. Mice were anesthetized by an intraperitoneal injection of 100 mg/kg ketamine mixed withlO mg/kg xylazine, and the abdominal skin was depiliated by shaving. The powder injection device was gently pressed against the vaccination site and actuated. A typical immunization regime consisted of two vaccinations four weeks apart, with blood 20 collection via retro-orbital bleeding under anesthesia prior to each vaccination and two weeks post boost. For transcutaneous immunization (TCI) procedures, the abdominal skin of the anesthetized mice was shaved, and the liquid vaccine compositions were applied to the shaved area and left for 1 hour before being washed off with warm tap water. ELISA Antibody response to the various vaccine compositions was determined 25 by a standard ELISA procedure. More particularly, a 96-well plate was coated with 0.1 (j.g (diphtheria toxoid) or 1 |_ig (influenza) of detecting antigen in PBS (per well) and maintained overnight at 4* C. Plates were washed 3 times with TBS containing 0.1% Brij-35, and incubated with test sera diluted in PBS containing 1% BSA (diphtheria toxoid) or 5% dry milk (influenza) for 1.5 hr. A serum standard containing a high level of antibodies to 30 specific antigen, was added to each plate and used to standardize the titer in the final data • 10 15 0 20 25 intellectual property office of n.z 14 APR 2005 -26- RECEIVFn analysis. The plates were then washed and incubated with biotin-labelled goat antibodies specific for mouse immunoglobulin IgG or specific IgG subclasses (1:8,000 in PBS, Southern Biotechnology) for 1 hr at room temperature. Following three additional washes, the ELISA plates were incubated with strepavidin-horseradish peroxidase conjugates (1:8,000 in PBS, Southern Biotechnology) for 1 hr at room temperature. Finally, plates were washed and developed with TMB substrate (kit from Bio-Rad, Richmond, CA). Endpoint titers of the test sera were determined using the Softmax Pro 4.1 program (Molecular Devices) as the calibrated highest dilution with an A450 that exceeded the mean background by 0.1. Mean background absorbance was determined by wells that received all reagents except for test sera. Example 1 Induction of Mucosal Immune Response to Influenza Virus bv Skin Tmrmini7ntion The following study was performed in order to determine whether adjuvants other than the cholera toxin (CT) adjuvant can be used to induce a mucosal immune response when delivered to the skin via a powder injection technique. A secondary purpose of this study was to find out if a combination of the CpG and CT adjuvants would act in synergistic or additive fashion to induce a mucosal response when administered to the skin via powder injection. The PR8 strain of inactivated influenza virus was used as the antigen of interest in this study. 5 fag of inactivated influenza virus (strain PR8/38, H1N1) was combined with 5 Mg of the CT adjuvant (either with or without 10 jug of CpG DNA) or with 10 (ag of CpG DNA (CpG sequence: ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 2)) and formulated as particulate (powder) compositions. The vaccine compositions were administered to Balb/C mice using a powder injection device. Immunizations were carried out on weeks 0 and 4 of the study. Mucosal secretions and sera samples were collected on week 6, and then used for antibody analysis. The mucosal tissue fragments were ikueubtiliai property office nr ,1.7 1 h APR 2005 -27- received collected on week 6 for in vitro culture and antibody analysis. The results of the study are depicted in Figures 1-3. Referring now to Figures 1A-1D, the influenza vaccine composition formulated with the CT adjuvant provided for a secretory IgA antibody response in nasal wash (Figure 1 A), saliva (Figure IB), vaginal wash (Figure 1C), and fecal extract (Figure ID) following powder injection to the skin. Furthermore, the vaccine composition containing the CpG adjuvant also elicited a mucosal response to the influenza vaccine (Figures 1A-1D). However, strikingly, the data demonstrate that the combination of the CpG and CT adjuvants provided for a synergistic effect, that is, the combination was more potent than either adjuvant alone in inducing secretory IgA responses (Figures 1A-1D). The combination of the CT and CpG adjuvants provided consistently higher levels of IgA titers in all the mucosal secretions measured (nasal, saliva, vaginal and fecal). As can be seen in Figure 2, IgA antibodies were also detected in the supernatants from the in vitro cultured mucosal tissue samples (trachea, vagina, lung, Peyer's patch, and small intestines) obtained from mice receiving vaccine compositions containing either CT or CpG adjuvant. However, the combination of the CT and CpG adjuvants elicited higher IgA production than either adjuvant alone, as well as higher IgA production than one would expect by merely adding the intensities of the adjuvant effect when those adjuvants were administered individually. These data show that powder injection of the particulate influenza vaccine compositions to skin elicited a disseminated mucosal immune response, and further that the CpG/CT adjuvant combination acts in a synergistic fashion in promoting a mucosal immune response. Finally, the IgG titers from fecal extract, saliva, and mucosal tissue cultures were also determined (see the results reported in Figures 3A-3C). Elevated IgG titers were noted in these mucosal samples when CT or CpG adjuvant was used, and the combination of adjuvants was again more potent then either one alone in promoting the mucosal IgG response against the flu vaccine. intellectual property office of n.z 1 4 APR 2005 -28- RECEIVED Example 2 Induction of Mucosal Immune Response to Influenza Antigen bv Skin Immunization 5 The following study was performed to assess a number of issues. Initially, the study was carried out to establish that the ability to elicit anti-influenza mucosal immunity via skin administration (as shown in the Examples above) was not strain-specific. In addition, the effect of combining the CpG and CT adjuvants on the ability to induce a 10 mucosal response when administered to the skin via powder injection was revisited. An influenza vaccine product was obtained from a commercial source (the Strain A/Sydney/5197 (H3N2) influenza subunit vaccine product obtained from Swiss Serum Institute, Switzerland). A l/10th dose of the human influenza vaccine product (corresponding to 1.5 |ig of HA antigen) was combined with a trehalose excipient and 15 formulated as a particulate either per se, in combination with 10 |ag of the CT adjuvant, or in combination with 5 ng of the CT adjuvant and 10 |_ig of CpG DNA (CpG sequence: ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 2)). The particulate vaccine compositions were administered to Balb/C mice (8 mice/group) using a powder injection device. Immunization was carried out on week 0, and blood serum samples were collect 20 on week 4 of the study just prior to a week 4 challenge with a mouse-adapted Aichi/68 (H3N2) influenza virus at 10X the LD50 by intranasal delivery. Control mice did not receive any vaccine composition. Influenza-specific IgG titers were then determined in the above-described ELISA procedure. The results of the study are depicted in Figures 4-5. With respect to Figure 4, 25 antibody (IgG) responses were measured by ELISA using the four week post-vaccination serum samples. As can be seen, immunization with the composition containing both CT and CpG adjuvant provided a higher IgG titer. Referring now to Figure 5, the ability of the various vaccine composition to protect the immunized mice against challenge with a heterologous influenza virus are graphically illustrated. As can be seen, the vaccine 30 compositions containing the l/10th dose of A/Sydney Strain human vaccine with either the -29- iintellectual property office of n.z 1 h APR 2005 received CT adjuvant or the combined CT and CpG adjuvant provided complete protection (100% survival) over the 21 day monitoring period of the challenge study. These results are contrasted with the 100% mortality seen in the naive control group, and the 60% mortality rate seen in the mice receiving the 1/10th dose of A/Sydney Strain human vaccine without adjuvant. The vaccine compositions of the present invention provided protection against mucosal exposure to the challenge virus after having been administered to the skin via needleless powder injection. 10 Example 3 Detection of Influenza-Specific IgA Secreting Cells in Mucosal Tissue After Skin Immunization In order to quantify the number of antigen-specific IgA secreting cells present in 15 mucosal tissue of mice immunized via powder injection to skin, the following study was carried out The PR8 strain of inactivated influenza virus was used as the antigen of interest in this study. 5 fig of inactivated influenza virus (strain PR8/38, H1N1) was combined with 10 |xg of the CT adjuvant and 10 |ig of CpG DNA (CpG sequence: ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 2)) and formulated as a particulate 20 (powder) composition. The powdered vaccine composition was administered to an experimental group of 8 Balb/C mice using a powder injection device. Immunizations were carried out on days 0 and 28 of the study. Two control groups were also established. For the control vaccines, 5 jug of inactivated influenza virus (strain PR8/38, H1N1) was combined with 10 ng of the CT 25 adjuvant and 10 ^g of CpG DNA (CpG sequence: ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 2)) and then mixed with phosphate buffered saline (PBS) to provide a liquid composition. The liquid vaccine composition was administered to a first control group of 8 Balb/C mice using a conventional needle and syringe to deliver the vaccine subcutaneously (SC). The liquid vaccine composition was also administered to a second control group of -30- 8 Balb/C mice intranasaly. As with the experimental group, immunizations were carried out on days 0 and 28 of the study. Two weeks after the second immunizations (i.e., day 42 of the study), mucosal tissue samples (trachea, small intestine, lung tissue and Peyer's patch) were collected from 5 the mice in each group, and the samples were pooled separately for use in either a fragment culture assay to assess mucosal antibody production or in an ELISPOT assay to assess influenza-specific IgA secreting cells. More particularly, small pieces of trachea and small intestines were collected and washed extensively with calcium- and magnesium-free Hank's balanced salt solution ("HBSS," GIBCO-BRL, Grand Island, NY) containing 10 0.1% gentamicin. The tissue fragments were finally washed with complete RPMI media and cultured in 24-well flat-bottomed tissue culture plates (COSTAR) for 7 days under 90% 02 and 10% C02 at 37* C. The culture media was Kennett's H-Y medium (JRH Biosciences, Zlenexa, KS) containing 10% fetal calf serum, 1% L-glutamin, 0.01% gentamicin, and 1% antibiotic-antimycotic solution. Influenza-specific antibodies in the 15 tissue culture supernatant were assayed using an ELISA (data not shown). In the IgA ELISPOT, the assays were performed using single cell suspensions prepared from the lungs and Peyer's patches of the immunized mice. To prepare the single cell suspensions, lungs were collected and digested with a Dipase solution (1.5 mg/ml in HBSS, Boehringer Mannheim Biochemicals, Indianapolis, IN) for 2 hours with continuous 20 stirring. Peyer's patches were collected and teased apart using fine forceps. The fractionated mixtures were then passed through a 70 |j.m sterile cell strainer (Fisher Scientific, Pittsburgh, PA) to obtain single cell suspensions. The cells were then washed extensively with calcium- and magnesiom-free HBSS and then resuspended in a RPMI medium containing 10% fetal calf serum, 1% L-glutamine, and 1% antibiotic-antimycotic 25 solutioa The ELISPOT assays were carried out in 96-well nitrocellulose plates (Milliscreen, Millipore). The plates were coated with 10 |ig/ml of formalin-inactivated PR8 influenza virus in 0.1M bicarbonate buffer (pH 9.5). Plates were blocked with 10% RPMI for one hour at room temperature. After washing, 100 (al of lymphocyte suspensions from the 30 mucosal tissues at varying concentrations were placed in each well, and the plated intellectual property qfrf of n.z 14 APR 2005 RECEIVED -31- incubated overnight at 37* C in 5% C02. The plates were then washed five times with PBS, and 100 jj.1 of appropriately diluted goat anti-mouse IgA-alkaline phosphatase conjugate (Southern Biotechnologies) in PBS was added to each well, after which the plates were incubated at room temperature for 4 hours. The plates were then washed five 5 times with PBS (0.05% Tween-80). The plates were then developed using an alkaline phosphatase substrate kit (Bio-Rad Laboratories, Melville, NY). Spots were quantified by counting spots under an Olympus® dissecting microscope (Leeds Precision Instruments, Inc., Minneapolis, MN). The results of the ELISPOT assay are depicted in Figure 6. As can be seen, 10 transdermal powder injection of mice using the PR8 vaccine composition adjuvanted with CT and CpG induced ftequencies of IgA forming spots from Peyer's patch and lung mucosal tissue of200 and 542 per million cells, respectively. The mice receiving the same vaccine composition directly to mucosal tissue (intranasal delivery) displayed only marginally higher frequencies, that is, 266 and 783 per million cells from the Peyer's patch 15 and lung tissues samples, respectively. These results were in contrast to those seen with the mice receiving the same vaccine composition via subcutaneous injection, wherein influenza-specific IgA secreting cells were not detectable in the assay. These data convincingly demonstrate that administration of the powdered compositions of the present invention to skin induce a robust mucosal immune response substantially equivalent to that 20 obtained with direct mucosal immunization techniques (intranasal). Accordingly, novel vaccine compositions and methods of inducing a mucosal immune response are disclosed. Although preferred embodiments of the subject invention have been described in some detail, it is understood that obvious variations can be made without departing from the spirit and the scope of the invention as defined by the appended 25 claims. intellectual prgperty office of n.z 1 h APR 2005 REC EIVED </div>

Claims

<div class="application article clearfix printTableText" id="claims"> -32-CLAIMS

1. A particulate vaccine composition suitable for delivery into or across skin of a vertebrate subject, said composition comprising: 5 (a) an antigen or a nucleic acid encoding said antigen; (b) an ADP-ribosylating toxin as an adjuvant; and (c) an oligonucleotide containing a CpG motif.

2. A vaccine composition according to claim 1 wherein the ADP-ribosylating 10 toxin is a cholera toxin.

3. A vaccine composition according to claim 1 or 2 wherein the antigen is derived or obtained from a pathogen that enters a subject's body via a mucosal surface. 15

4. A vaccine composition according to any one of claims 1 to 3 wherein die antigen is a viral antigen or a bacterial antigen.

5. A vaccine composition according to any one of the claims 1 to 3 wherein the antigen is a live, attenuated organism. £ 20

6. A dosage container comprising a vaccine composition as defined in any one of claims 1 to 5 for use in a needleless syringe powder injection device.

7. A needleless syringe powder injection device loaded with a vaccine - 25 composition as defined in any one of claims 1 to 5.

8. Use of an antigen derived from or obtained from a pathogen that enters the body of a vertebrate subject via a mucosal surface, or of a nucleic acid encoding a said antigen, in the manufacture of a particulate vaccine composition for treating or preventing a 30 disease caused by a said pathogen, wherein said composition is intended for administration intellectual property 0-of n.z 1 k APR 2005 RPHPix/cn -33- to a said subject in need of treatment or vaccination in an amount sufficient to bring about an IgA antibody response specific for the antigen at a mucosal surface of the subject and wherein said composition further comprises an ADP-ribosylating toxin as an adjuvant and an oligonucleotide containing a CpG motif. 5

9. Use according to claim 8 wherein the vaccine composition is intended for administration into or across the skin of the subject using a transdermal delivery technique.

10. Use according to claim 9 wherein the vaccine composition is intended for ^ administration to the subject from a needleless syringe powder injection device.

11. A particulate vaccine composition according to claim 1 substantially as hereinbefore described in Example 1,2 or 3. 15

12. A needleless syringe powder injection device according to claim 7 substantially as hereinbefore described in Example 1,2 or 3. INTELLECTUAL PROPERTY OFFICE OF l\|.Z 1 h APR 2005 RECEIVED </div>