MXPA00005348A - Transdermal delivery of particulate vaccine compositions - Google Patents

Abstract

A method for enhancing the immune response to a selected antigen is disclosed. The method entails delivering a particulate adjuvant composition transdermally, preferably using a needleless syringe system. Also described are methods for forming crystalline particles from pharmaceutical compositions and then delivering the same to a subject. The crystallized compositions are particularly suitable for transdermal vaccine delivery using a needleless syringe system.

Description

TRANSDERMAL ADMINISTRATION OF PARTICULATE COMPOSITIONS FOR VACCINES FIELD OF THE INVENTION The present invention relates to particulate compositions. More particularly, the invention relates to methods for administering particulate formulations, as well as methods for forming crystalline particles from pharmaceutical compositions and then administering them to a subject. The particulate compositions are particularly suitable for the administration of transdermal vaccines using a syringe system without needle.

BACKGROUND OF THE INVENTION The ability to administer agents on and across skin surfaces (transdermal administration) provides many advantages over parenteral administration techniques. In particular, transdermal administration REF .: 120612 ya ^. provides a safe, convenient and invasive alternative for traditional administration systems, conveniently avoiding the main problems associated with parenteral administration, for example, needle pain, the risk of introducing infection to treated individuals, the risk of contamination or infection of workers to health care caused by needle sticks, accidental, and the disposal of used needles. In addition, such administration produces a high degree of control over the blood concentrations of drugs administered. Recently, a new transdermal drug delivery system has been described that allows the use of a needleless syringe to discharge particles containing the solid drug in controlled doses in and through the intact skin. In particular, commonly acknowledged US Patent No. 5,630,796 to Bellhouse et al. Discloses a needleless syringe that delivers pharmaceutical particles entrained in a supersonic gas flow. The needleless syringe (also referred to as "the PowderJect needleless syringe device") is used for the transdermal administration of powder compositions and drug compositions, for the delivery of genetic material into living cells (eg, gene therapy) and for the administration of biopharmaceutical products to the skin, muscle, blood or lymph. The needleless syringe can also be used in conjunction with surgery to deliver drugs and biological substances to organ surfaces, solid tumors and / or surgical cavities (e.g., tumor beds or cavities after tumor resection). Pharmaceutical agents that can be suitably prepared in the form of substantially solid particulate material can be administered safely and easily using a device. A syringe without a particular needle generally comprises an elongated tubular nozzle having a rupturable membrane that initially closes the passage through the nozzle and is arranged substantially adjacent to the upstream end of the nozzle. Particles of a therapeutic agent that are administered are disposed adjacent to the breakable membrane and are administered using an activation medium that applies a gaseous pressure to the lateral updraft of the membrane sufficient to burst the membrane and produce a supersonic gas flow ( containing the pharmaceutical particles) through the nozzle for the administration of the downstream end of the same. The particles can thus be administered from the needleless syringe at administration rates of between Mach 1 and Mach 8 which are easily obtainable in the rupture of the breakable membrane. Another needleless syringe configuration generally includes the same elements as described above, except that instead of having the pharmaceutical particles entrained within a supersonic gas flow, the downstream end of the nozzle is provided with a bistable diaphragm which it moves between a remaining "inverted" position (in which the diaphragm has a concavity on the downstream running surface to contain the pharmaceutical particles) and an "always" active position (in which the diaphragm is convex outwardly on the surface running downward as a result of a supersonic shock wave that has been applied to the upstream running surface of the diaphragm). In this way, the pharmaceutical particles contained within the concavity of the diaphragm are expelled at an initial supersonic velocity from the device for transdermal administration thereof to a target skin or mucosal surface. Transdermal administration using the needleless syringe configurations described above, is performed with particles having an approximate dimension that generally varies between 0.1 and 250 μm. Particles larger than approximately 250 μm can also be administered from the device, with the upper limitation being the point at which the dimension of the particles could cause unfavorable damage to the skin cells. The actual distance at which the administered particles will penetrate depends on the particle size (for example, the nominal particle diameter assumed by an approximately spherical particle geometry), particle density, the initial velocity at which the particle hits the surface of the skin, and the density and kinematic viscosity of the skin. White particle densities for use in needleless injection generally vary between about 0.1 and 25 g / cm, and injection rates generally vary between about 200 and 3,000 m / sec. A particularly unique feature of the needleless syringe is the ability to closely control the depth of penetration of the delivered particles, thereby allowing the administration of target of the pharmaceutical products to various sites. For example, the characteristics of the particles and / or the parameters that operate the device can be selected to provide penetration depths that vary for, for example, intradermal or subcutaneous administration. An approach results in the selection of particle size, particle density and initial velocity to provide a moment density (eg, moment divided by the frontal area of particles) of between about 2 and 10 kg / sec / m, and more preferred between about 4 and 7 kg / sec / m. Such control over the density of the moment allows selective administration of the precisely controlled tissue of the pharmaceutical particles. The systems described above provide a unique means for the administration of antigens for vaccine in or through the skin or • - _..-. tissue. However, many antigens require the use of immunological adjuvants to increase the antigenic potency. Immune adjuvants act to increase humoral and cell-mediated immune responses. Such adjuvants include depot adjuvants, compounds that adsorb and / or precipitate antigens administered and which serve to retain the antigen at the site of injection. Typical deposit adjuvants include aluminum compounds and water-in-oil emulsions. Deposit adjuvants, although they increase antigenicity, frequently cause persistent, severe local reactions, such as granulomas, abscesses and scarring, when injected subcutaneously or intramuscularly. Other adjuvants, such as lipopolysaccharides and muramyl dipeptides, can produce pyrogenic responses in the injection and / or symptoms of Reiter (flu-like symptoms, generalized malaise of the joints and sometimes anterior uveitis, arthritis and urethritis). Therefore, there is a continuing need for effective and safe administration methods of adjuvants to improve immune responses to a given antigen. ^ - ^ ^? f ^ rZ ^^^^^^^^ ^^^ - ^^^^^^^^^ Z¡? fir ^ í ^^ DESCRIPTION OF THE INVENTION The present invention provides compositions for vaccines and unique adjuvants as well as a unique system for delivering pharmaceutical compositions in particulate form1, including vaccines or other therapeutic agents. New methods for producing pharmaceutical compositions in particulate form are also provided. In one embodiment, then, a method is provided for improving the immunogenicity of a selected antigen. The method comprises: (a) administering an effective amount of the antigen to a vertebrate subject; and (b) administering an amount of a particulate adjuvant composition sufficient to improve the immunogenicity of the antigen, wherein the adjuvant is administered in or through the skin or tissue of the vertebrate subject and in addition where the administration is performed using a delivery technique. transdermal The antigen and adjuvant can be present in the same or different compositions and can be administered to the same or different sites in the vertebrate subject. In addition, the antigen may be administered prior to or subsequent to, or concurrently with, the adjuvant composition. In particularly preferred embodiments, the adjuvant and / or antigen are administered using a syringe-free administration device. In another embodiment, the subject of the invention is directed to a method for producing an immune response in a vertebrate subject. The method comprises the transdermal administration of a particulate composition for vaccines in or through the skin or tissue of the vertebrate subject. The particulate composition for vaccines comprises: (a) an effective amount of a selected antigen; and (b) an amount of an adjuvant sufficient to improve the immunogenicity of the antigen. In yet another embodiment, the invention is directed to a particulate adjuvant composition suitable for delivery to or through the skin or tissue of a vertebrate subject using a transdermal delivery technique. The particulate adjuvant composition can be used to produce a physiological effect in a subject Go.*".* -..- -. ..J ... 1 vertebrate by administering a quantity of the particulate adjuvant composition in or through the skin or tissue of the vertebrate subject sufficient to arrive at the physiological effect. In another embodiment, a method is provided to convert conventional pharmaceutical formulations into crystallized particles that are optimally suitable for transdermal administration using a syringe without a needle. Thus, in one aspect of the invention, a liquid pharmaceutical formulation (e.g., in the aqueous form, or a reconstituted lyophilized product), it is combined with a suitable excipient, for example a sugar, and then dried to provide a crystalline composition. The excipient is selected to provide sufficient rigidity, structure, and density in the resulting crystalline product. The crystalline composition, which now has a sufficient density, can be used directly in a needleless syringe delivery technique, or it can be further processed to provide a more finely divided and / or uniform crystal composition. In a further embodiment of the invention, a crystalline pharmaceutical composition is administered to a subject to cause a desired treatment. In a particular aspect, a crystalline composition for vaccines is administered to a subject via needleless injection to provide a biological response in the subject. In a preferred embodiment, the crystalline composition for vaccines is administered to the subject to produce an antigen-specific immune response in the subject. In still another embodiment of the invention, a crystalline pharmaceutical composition is provided. The crystalline pharmaceutical composition has sufficient particle structure, stiffness and / or density characteristics that make it suitable for administration in and / or through the skin or mucosal tissue using a needleless syringe system. The crystalline pharmaceutical composition of the present invention can be made using the methods of the invention, and thus includes compositions for vaccines. These and other embodiments of the invention will readily occur to those of ordinary skill in the art in view of what is described above. xr i / ... "« S & - - - t - == aÁ_-aaHs ... lMa.x y-g-ÍoAt., ***? - Zy, iá.n BRIEF DESCRIPTION OF THE DRAWINGS Figures IA and IB show the results of Example 1 wherein the effect of the particle size on the IgG antibody response was verified in particulate formulations for vaccines. Figures 2-4 shows the ELISA results of the serum obtained from mice immunized with a crystalline composition for Hib conjugate vaccines administered using a syringe without needle. In Figure 2, the PRP-CRM197 conjugate was used as the capture phase, in Figure 3, the diphtheria toxoid was used as the capture phase, and in Figure 4, a PRP-HSA conjugate was used as the capture phase. Figure 5 shows the IgG antibody response in subjects receiving the descending doses of compositions for Hib conjugate vaccines in the liquid or particulate form. Figures 6A and 6B show the duration of enhanced immunity for compositions for Hib conjugate vaccines in either the liquid or the particulate form. Figure 7 shows the antibody responses for an inactivated influenza virus vaccine composition, administered in either the liquid form or in the particulate form. The data represent geometric average IgG titers from combined serum. Figures 8A and 8B show the results of a study of stimulation of the influenza virus in subjects immunized with a vaccine composition with the inactivated influenza virus, administered in either the liquid or particulate form. The subjects in Figure 8A receive 25 μg of inactive virus, while the subjects in Figure 8B receive 5 μg of inactive virus. The data represent weight loss as an average percentage of initial body weight. Figure 9 shows the results of a study of stimulation of the influenza virus in subjects immunized with an inactivated influenza virus vaccine composition adjuvanted with Alum and administered either in the particulate or liquid form. The data represent the weight loss as the average percentage of initial body weight from eight animals. Figure 10 shows the results of a study of stimulation of the influenza virus in subjects immunized with a composition for influenza virus vaccine aided with a PCPP adjuvant and administered in either the liquid or particulate form. The data represent the weight loss as the average percentage of the initial body weight of eight animals. Figures 11A and 11B show the results of stimulation studies of the influenza virus in subjects immunized with an inactivated influenza virus vaccine composition adjuvanted with CpG and administered in any liquid form (Figure 11B) or in particles (Figure HA). ). The data represent the weight loss as the average percentage of the initial body weight of eight animals. Figure 12 shows the results of a study of influenza virus stimulation in subjects immunized with an inactivated influenza virus vaccine composition adjuvanted with an MPL adjuvant and administered in either the liquid or particulate form. The data represent the weight loss as the average percentage of the initial body weight of eight animals.

DETAILED DESCRIPTION OF THE PREFERRED MODALITIES Before describing the present invention in detail, it is understood that this invention is not limited to particular process parameters or pharmaceutical formulations as such, they can, of course, vary. It is also understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limited. It should be noted that, as used in this specification and the appended claims, the singular forms "a", "an" and "the" include particular references unless the content clearly dictates another form. Thus, for example, with reference to "a pharmaceutical agent" includes a mixture of two or more pharmaceutical agents, the reference to "an antigen" includes a mixture of two or more antigens, the reference to "an excipient" includes mixtures of two or more excipients, and similar before Definitions Unless defined otherwise, all technical and scientific terms used here have the same meaning as they are understood ~ Xj *? *? É ** .. r. "* --.-. - - --- ^ - j ^ Q-Sd Éfe ^ ¡¡y tiS »¿r ^ rtí ^^. ^ ^^^ ^ rr ^^ _ ^^ r ^^? ^ y: __ ^^^^ ^^^ r_ commonly by one of ordinary skill in the art to which the invention pertains. Although a number of similar or equivalent methods and materials for those described herein can be used in the practice of the present invention, preferred materials and methods are described herein. In the description of the present invention, the following terms will be employed, and will be proposed to be defined as indicated below. By "transdermal administration" is meant the administration of particles to target tissues to provide a local, regional or systemic response. This contrast with the direct introduction of substances through cell membranes in living cells and tissue which is designated to operate at an intracellular level. Preferably, the particle size of the substance administered is larger than the cells present in the target tissue. Generally, for mammalian cells, particles larger than 10 μM will achieve this desired effect. The ranges of suitable dimensions for particles are described in additional form later. Thus, the term "transdermal" administration implies the administration ^ & ^. & i? r? ^? tiUa ^ Ut & ^ ??? ¡¡Sñ? SS £ ^^^^ ?. -i ^^ -a ^ .- ,. > - «^^ takj-i-! I.-a. '' A intradermal (eg, in the dermis or epidermis), transdermal (eg," percutaneous ") and transmucosal, ie, administration by the passage of an agent in or through the skin or mucous tissue. See, for example, Transdermal Drug Delivery: Developmental Issues and Research Initiatives, Hadgraft and Guy (eds.), Marcel Dekker, Inc., (1989); Controlled Drug Delivery: Fundamentals and Applictions, Robinson and Lee (eds.), Marcel Dekker Inc., (1987); and T ansdermal Delivery or f D u s, Vols. 1-3, Kydonieus and Berner (eds.), CRC Press, (1987). By "needleless syringe" is meant an instrument which administers a particulate composition t s s rmically, without a conventional needle that punches the skin. The erin as n needle for its use with the present invention is -scri L > e n t o n t o c t o n t o c. As used herein, the term "pharmaceutical agent" is intended to mean any compound or composition of material which, when administered to a human or mammalian (huma nooani ma 1) in effect or physiological or macological fa desired po loc and / or systemic action. Thus, the term refers to those compounds or chemistries traditionally seen as drugs and vaccines, as well as biopharmaceutical products that include molecules such as peptides, hormones, nucleic acids, gene constructs and the like. By "antigen" is meant a molecule which contains one or more epitopes that will stimulate a host immune system to produce a specific immune response to the cellular antigen, or a humoral antibody response. Thus, the antigens include proteins, polypeptides, antigen protein proteins, oligosaccharides, polysaccharides, and the like. In addition, the antigen can be derived from any known viruses, bacteria, parasites, plants, prot ozoa, or fungi, and can be a complete organism. The term also includes 5 tumor antigens. Similarly, an oligonucleotide or polynucleotide which expresses an antigen, such as in DNA immunization applications, is also included in the definition of the antigen. Also included are synthetic antigens, eg, polypeptides, flanking epitopes, and other recombinant or non-derived antigens (Bergmann et al. (1993) Eur. J. Immunol., 23: 2777-2781; Bergmann et al. al. (1996) J. Immunol., 157: 3242-3249; Suhrbier, A. (1997) Immunol. - * J auu ^ -t L)? ? ? . / _J. *-you . I U U,? a i U p e r c a. \ ± 3 3 u) i _. d < üSrSá ^ -ñ ^ y., World AIDS Conference, Genova, Switzerland, June 28-July 3, 1998). The term "vaccine composition" is intended to mean any pharmaceutical composition containing an antigen, this composition can be used to prevent or treat a disease or condition in a subject. The term thus includes both subunit vaccines, ie compositions for vaccines containing antigens which are separate and discrete from a whole organism with which the antigen is associated in nature, as well as compositions containing bacteria, viruses, parasites or other inactive or attenuated microbes, completely dead. Compositions for viral vaccines used herein include, but are not limited to, those which contain, or derivative thereof, elements of the Picornaviridae families (e.g., poliovirus, etc.); Caliciviridae; Togaviridae (eg, rubella virus, dengue virus, etc.); Fiaviviridae; Coronaviridae; Rt-oviiidae; Birnavi r idae; Rhabodoviridae (for example, rabies virus, etc.); Filoviridae; Paramyxoviridae (for example, mumps virus, measles virus, respiratory syncytial virus, etc.); Orthomixoviridae (eg, influenza viruses types A, B and C, etc.); Bunyaviridae; Arenaviridae; Retroviradae (e.g., HTLV-I; HTLV-II; HIV-1; and HIV-2); simian immunodeficiency virus (SIV) among others. Additionally, viral antigens can be derived from the papilloma virus (e.g., HPV); a herpes virus; a hepatitis virus, for example, hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV) ), hepatitis delta virus (HDV), hepatitis E virus (HEV) and hepatitis G virus (HGV); and the encephalitis viruses of the newborn transmitted by the fly. See, for example, Virology, 3rd Edition (W.K. Joklik ed., 1988); Fundamental Virology, 2nd Edition (B.N. Fields and D.M. Knipe, eds., 1991), for a description of these and other viruses. Compositions for bacterial vaccines used herein include, but are not limited to, those containing or derived from organisms that cause diphtheria, cholera, tuberculosis, tetanus, whooping cough, meningitis, and other conditions. aslkis ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~. , and Helicobacter pylori. Examples of compositions for antiparasitic vaccine include those derived from organisms that cause malaria and Lyme disease. A composition which contains a selected antigen together with an adjuvant, or a vaccine composition which is coadministered with the subject adjuvant, exhibits "enhanced immunogenicity" when it possesses a greater ability to produce an immune response than the immune response produced by an amount equivalent of the antigen administered without the adjuvant. Thus, a vaccine composition may exhibit "enhanced immunogenicity" because the antigen is more strongly immunogenic or because a lower dose or lower dose of antigen is necessary to achieve an immune response in the subject to which the antigen is administered. Such improved immunogenicity can be determined by the administration of the adjuvant composition and antigen controls for animals and by comparing antibody titers and / or cell-mediated immunity against the two standard assays used such as radioimmunoassay, ELISAs, CTL assays, and the like, well known in the art.

For the purposes of the present invention, an "effective amount" of an adjuvant will be that amount that enhances an immune response to a co-administered antigen such that the antigen exhibits enhanced immunogenicity as described above. In a similar way, an "effective amount" of an antigen is an amount which will stimulate an immune response in the subject to which the antigen is administered. The immune response can be a humoral, cell-mediated and / or protective immune response. As used herein, the term "co-administered" such as when an adjuvant is co-administered with a vaccine antigen, is intended to mean either the simultaneous or concurrent administration of adjuvant and antigen, for example, when both are present in the same composition or they are administered in separate compositions at almost the same time but at different sites, as well as the administration of adjuvant and antigen in separate compositions at different periods. For example, the adjuvant composition can be administered prior to or subsequent to the administration of the antigen in the same site or »3« ?. «< -K-g3-fe .. • JdSk £ g &s * ts. a different site The distribution between administrations of adjuvant and antigen can vary from about several minutes away, to several hours apart, to several days of separation. In addition, although the adjuvant composition is administered to the skin using transdermal administration methods such as needleless syringe, the vaccine composition can be administered using conventional administration techniques, such as conventional syringes and conventional vaccine spray guns. As used herein, the term "treatment" includes any of the following: prevention of infection or reinfection; l, to reduction or elimination of symptoms; and the reduction or complete elimination of a pathogen. The treatment can be carried out prophylactically (prior to infection) or therapeutically (followed by infection). By "vertebrate subject" is meant any element of the subfilum cordata, particularly mammals, including, without limitation, humans and other primates. The term does not denote a particular age. So, both adults and ^ j ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ j ^ g ^^^^^^^^^^^^? ^^^^ g ^^^^^ sl ^^^^^^^^ & ^? totag ^ * newborn individuals are proposed to be covered. The pharmaceutical agents, alone or in combination with other drugs or agents, are typically prepared as pharmaceutical compositions which may contain one or more aggregated materials such as carriers, carriers, and / or excipients. "Carriers", "carriers" and "excipients" generally refer to substantially inert materials which are non-toxic and do not interact with other components of the composition in a detrimental manner. These materials can be used to increase the amount of solids in particulate pharmaceutical compositions, such as those prepared using dispersion or lyophilization drying techniques. Examples of "excipients" or "carriers1" normally employed include pharmaceutical grades of dextrose, sucrose, lactose, trehalose, mannitol, sorbitol, inositol, dextran, starch, cellulose, sodium or calcium phosphates, calcium sulfate, citric or tartaric acids (and pharmaceutically acceptable salts thereof), glycine, high molecular weight polyethylene glycols (PEG), and combinations thereof. Exemplary excipients that serve as stabilizers include commonly available antioxidants and cryoprotectants.

B. General Methods The invention provides for the administration of particulate pharmaceutical compositions, particularly compositions for vaccines. These particulate compositions can be administered to a subject using a transdermal, syringeless needle delivery device. The ability to transdermally deliver compositions for vaccines in particulate (powder) forms to tissue such as the skin provides a significant improvement over prior vaccination methods that generally rely on conventional syringe and needle injection techniques. In this regard, almost all current vaccines are administered by intramuscular injection. However, injected vaccines need to achieve local draining lymph nodes to initiate an immune response. A large portion of a composition for intramuscularly injected vaccine will rapidly spread into surrounding tissue and the .. «? J ^^ i ^ ^ B_Í ^ -, ^^ -,. ^ A ^ -í ^^ - ^ - ti ^^ - ^ r *? tf - ^ ---. ^ - -;. ^ - * - »» ^: ^. *. ^ »- circulation, so it will get lost or diluted. In contrast, when vaccine compositions are administered transdermally, for example, to the skin, such losses will not occur. This is because the upper layers of the skin have the ability to retain the antigen, stronger, due to poor vascularity. Compositions for particulate vaccines are also better retained in the skin because of a slower dissolving process. The cellular component in the skin can also contribute to the improved functioning of the vaccine followed by transdermal administration. This is because there is a dense network of Langerhans cells in the epidermal layer and dendritic cells in the skin layer of the skin. These cells are important in the initiation and maintenance of an immune response. Administering the compositions for vaccines in the proximity of these immune cells, it is feasible to achieve a larger immune response than by conventional intramuscular injection. These immune cells can also be recovered from the vaccine and migrated to the local draining lymph node, thereby initiating an immune response. 3? & amp; & amp; s, i i i i i ^ i ^ Transdermal administration of particulate compositions to the skin or mucosal tissue also improves the safety and efficiency of commonly used immunomodulators such as adjuvants. Immunomodulators are frequently important components of vaccines and immune therapeutics. Immunomodulators have many functions including, for example, increased immunity, immunosuppression, and modulation of immunity. The increase in immunity improves the efficiency of a vaccine or immunotherapeutics. The increased immunity also allows the immune system to respond to smaller doses of vaccine compositions. For example, the aluminum adjuvant immunomodulator (Alum) is used to formulate diphtheria and tetanus toxoid vaccines to improve their immunogenicity. Some immunomodulators that have immunosuppressive properties are also useful in the treatment of certain diseases, such as autoimmune diseases and organ transplantation. Immunomodulators can also be directed to immune systems to generate a Th1 or Th2 type response, or to switch an established type of response to another type. This immunity modulating property is very important in immunotherapy. For example, subjects who have a deviated immune system to a Th2 type response tend to have allergies. Immunomodulators that can help promote a Thl-type response are useful in immunity therapy to desensitize these individuals. As with compositions for conventional vaccines, immunomodulators are typically administered by intramuscular injection. One of the problems with this method of injection is the toxicity of immunomodulators after they reach the systemic circulation. It is for this reason that many immunomodulators can not be used in humans. Intramuscular injection also requires a high dose of immunomodulators (relative to immunomodulators transdermally administered) to be effective since a large portion of injected material will spread rapidly from the injection site, usually entering the circulation. In this regard, an adjuvant may need to perform its activities at the injection site or in the drained lymph node (s).

M ^^^^ - ^^^ • -f'1 premises to increase the functioning of vaccines. The transdermal administration of immunomodulators to the skin or mucosal tissue according to the present invention is advantageous for the following reasons. First, the skin and mucosa are very powerful parts of the immune system. As described above, there is a dense network of immune cells in the various layers of skin (e.g., Langerhans cells in the epidermal layer or dendritic cells in the skin layer). The epithelial cells of mucous membranes contain a large number of intraepithelial dendritic cells. These cells are important in the initiation and maintenance of an immune response, making them essential targets for immunomodulation. Administering the immunomodulators in close proximity to those cells, and avoiding rapid loss by diffusion. It is feasible to achieve a very strong immunomodulation effect that by intramuscular injection. The effective dose of immunomodulators can also be significantly reduced. A lower dose helps reduce the toxicity associated with many immunomodulators.

Accordingly, in one embodiment, the invention makes possible a process for the formation of crystalline particles (suitable for transdermal administration) from conventional pharmaceutical preparations. Although the methods of the invention are broadly applicable to any pharmaceutical composition, the invention is exemplified herein with particular reference for methods using reconstituted or liquid (aqueous) dry vaccine compositions as starting materials. A common method for preparing and storing pharmaceutical products for vaccines involves lyophilization (freeze dehydration). Lyophilization refers to a technique to remove moisture from a material and involves rapid freezing at a very low temperature, followed by rapid dehydration by sublimation in a high vacuum. This technique typically produces low density porous particles having an open matrix structure. Such particles are chemically stable, but are rapidly reconstituted (disintegrated and / or carried in solution) when introduced into an aqueous environment.

Another method for preparing and storing vaccine compositions from heat sensitive or delicate biomolecules is spray dried. Spray drying refers to the atomization of a solution of one or more solids using a nozzle, spinning disc or other device, followed by evaporation of the solvent from droplets. More particularly, spray drying involves the combination of a liquid, highly dispersed pharmaceutical preparation (eg, a solution, slurry, emulsion or the like) with an adequate volume of hot air to produce evaporation and dryness of the liquid drops . Spray-dried pharmaceutical compositions are generally characterized as homogeneous spherical particles that are often hollow. Such particles have low density and exhibit a rapid solution speed. In a method of the invention, a liquid composition, (an aqueous composition or a reconstituted spray-dried or lyophilized composition) is converted to a dry crystalline powder, suitable for administration to and / or through the skin or mucosal tissues. The liquid composition is ? it can be combined with a suitable carrier or excipient which provides for increased crystal formation, particle structure, stiffness and / or density characteristics. Preferred carriers or excipients include pharmaceutical grade sugars and the like, including, for example, trehalose. The composition is allowed to dry under suitable evaporation conditions, resulting in a crystallized composition. The crystals can then be removed from the drying surface or container, and slightly fractured, for example, using mortar and mortar. The resulting crystalline powder can then be loaded into suitable administration cassettes for administration to a subject using a syringe without a needle. Although not limiting the present invention, the method described above can be used to obtain crystalline particles having a size ranging from about 0.1 to about 250 μm, preferably about 10 to about 250 μm, and a varying particle density. from about 0.1 to about 25 g / cm. These crystalline particles can be used in the treatment or prevention of a variety of diseases.

In another embodiment, the invention pertains to the administration of particulate compositions, particularly compositions for vaccines and adjuvants. Compositions for vaccines and adjuvants may be in the crystalline form, as described above, or may be administered in a particulate, non-crystallized state. Antigens for use with the present invention can be produced using a variety of methods known to those skilled in the art. In particular, the antigens can be isolated directly from natural sources, using standard purification techniques. Alternatively, the antigens can be produced by recombination using known techniques. See, for example, Sambrook, Fritsch & Maniatis, Molecular Clg: A Laboratory Manual, Vols. I, II and III, Second Edition (1989); DNA Clg, Vols. I and II (D.N. Glover ed., 1985). Antigens for use herein can also be synthesized, based on the amino acid sequences described, via synthesis of chemical polymers such as solid phase peptide synthesis. Such methods are known to those skilled in the art. See, for example, J. M. Stewart and J. D. Young, Solid Phase Peptide ^ - > - ^ ¿- ^^ ~ ^ * ^ Wfe ^ -fe _- ^^^^ .- ^ t -_ ^ 3Sf ^ - ^ S ^ x. _ * "X- -. - * t_ --- ft - 3-aj" .- & * .- ".

Synthesis, 2nd Ed., Pierce Chemical Co., Rockford, IL (1984) and G. Barany and RB Merrifield, The Peptides: Analysis, Synthesis, Biology, editors E. Gross and J. Meienhofer, Vol. 2, Academic Press, New York, (1980), pp. 3-254, for solid phase peptide synthesis techniques; and M. Bodansky, Principle of Peptide Synthesis, Springer-Verlag, Berlin (1984) and E. Gross and J. Meienhofer, Eds., The Peptides: Analysis, Synthesis, Biology, supra, Vol. 1, for classical solution synthesis . Once obtained, the antigen of interest is formed in a particulate composition for vaccines as described herein and administered to a subject, generally together with an immunological adjuvant which serves to enhance the immune response to the antigen. As explained above, the adjuvant can be present in the same composition or a separate composition and can be administered simultaneously with the vaccine composition, or prior or subsequent to administering the antigen. Additionally, adjuvant administration may be in the same or different site. Unfortunately, the best known adjuvants are highly toxic. Thus, the only ..-. fc - ^ - - a < Adjuvant commonly approved for human use is alum, an aluminum salt composition. However, a number of adjuvants are used in animal studies and several adjuvants for human use are subjected to preclinical or clinical studies. Surprisingly, adjuvants that are generally considered too toxic for human use can be administered with the present methods. Without being bound by a particular theory, it appears that the administration of adjuvants to the skin, using methods of transdermal administration, allows interaction with Langerhans cells in the epidermal layer and dendritic cells in the skin layer of the skin. These cells are important in the initiation and maintenance of an immune response. Thus, an improved adjuvant effect can be obtained by rendering administration to or near such cells white. Additionally, because the upper layers of the skin are poorly vascularized, the amount of adjuvant that enters the systemic circulation is reduced, whereby the toxic effect is reduced. In addition, because the skin cells are constantly being abandoned, the adjuvant "**! £ ** ». residual is eliminated before being absorbed. However, fewer adjuvants can be administered than those administered using conventional techniques such as intramuscular injection. Therefore, the present invention can be effectively used with a wide variety of adjuvants without concomitant toxicity. Such adjuvants include, without limitation, adjuvants formed from aluminum (alum) salts, such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc; oil-in-water and water-in-oil emulsion formulations, such as Complete Freunds Adjuvant (CFA) and Incomplete Freunds Adjuvant (IFA); adjuvants formed from bacterial cell wall components such as adjuvants including monophosphoryl lipid A (MPL) (Imoto et al. (1985) Tet. Lett 26: 1545-1548), trehalose dimycolate (for its acronym in English , TDM), and the cell wall skeleton (for its acronym in English, CWS); adjuvants derived from ribosilant bacteria toxins with ADP, a group of potent toxins for humans, including diphtheria toxin, whooping cough toxin (PT), cholera toxin (CT, for its acronym in English, CT), the -...-- ^ ^ heat-labile toxins from E. coli (LT1 and LT2), endotoxin A from Pseudomonas, toxins from C. botulinum C2 and C3, as well as toxins from C. perfringens, C. spiriforma and C. difficile, particularly toxin mutants of ADP ribosylating bacteria such as CRM197, a non-toxic diphtheria toxin mutant (see, for example, Bixler et al (1989) Adv. Exp. Med. Biol. 251: 175 and Constantino et al. (1992) Vaccine); saponin adjuvants such as Quil A (U.S. Patent No. 5,057,540) or particles generated from saponins such as ISCOMs (immunostimulation complexes); cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e.g., interferon gamma) , macrophage colony stimulation factor (M-CSF), tumor necrosis factor (TNF), etc; muramyl peptides such as N-acetyl-murami 1-L-threonyl-Di so-glutamine (thr-MDP), N-acet-il-normurami-1-alanyl-isoglutamine (nor-MDP), N-acet-lmuram? L-alan? lD-? soglutaminyl-L-alanin-2- (1'-2'-dipalmito? l-sn-glycero-3-hydroxyphosphoryloxy) -ethylamine (MTP-PE), etc .; adjuvants derived from the CpG family of molecules, the CpG dinucleotides and synthetic oligonucleotides comprising CpG motifs (see, for example, Krieg et al., Nature (1995) 374: 546 and Davis et al., J. Immunil. (1998) 160 : 870- 876) such as TCCATGACGTTCCTGATGCT (SEQ ID NO: 1) and ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 2); and synthetic adjuvants such as PCPP (Poly [di (carboxylatophenoxy) phosphazene) (Payne et al. Vaccines (1998) ^ 6: 92-98). Such adjuvants are commercially available from a number of distributors such as Accurate Chemicals; Ribi Immunechemicals, Hamilton, MT; GIBCO; Sigma, St. Loui s, MO. Once obtained, the adjuvant, with or without the antigen of interest, is formed into a particle suitable for transdermal administration using any suitable particle formation technique, such as air drying (crystallization) freeze drying (lyophilization), spray coating or supercritical fluid techniques. The compositions can also be prepared as crystalline compositions, as described above. Following its formation, the object particles are transdermally administered to the mammalian tissue using an administration technique. adequate transdermal. Various particle acceleration devices, suitable for the transdermal administration of the substance of interest are known in the art, and will find use in the practice of the invention. A particularly preferred transdermal delivery system employs a needleless syringe for discharging particles containing the solid drug in controlled doses in and through the intact tissue and skin. See, for example, U.S. Patent No. 5,630,796 to Bellhouse et al. describing a needleless syringe (also known as "the PowderJect® needleless syringe device"). Other needleless syringe configurations are known in the art and are described herein. The particles are administered to the subject in a manner compatible with the dosage formulation, and in an amount that will be effective to achieve the desired physiological response. Generally, the response generated will be prophylactically and / or therapeutically effective. Thus, for example, if an antigen or composition for vaccine is administered, the amount administered will be sufficient to generate an immune response. If an adjuvant is co-administered with the antigen, will be administered in an amount sufficient to improve the immune response to the co-administered antigen. It is readily apparent that the amount of the composition to be administered depends on the particular substance administered, the subject to be treated and the disease to be prevented or treated. Generally, about 0.5 μg to 1000 μg of adjuvant, more generally 1 μg to about 500 μg of adjuvant and most preferably about 5 μg to about 300 μg of adjuvant will be effective in improving an immune response of the adjuvant. a given antigen. Thus, for example, for CpG, doses in the range of about 0.5 to 50 μg, most preferably 1 to about 25 μg, preferably 5 to about 20 μg, will find use with the present methods. Similarly, for alum or PCPP, a dose of about 25 μg to about 500 μg, preferably about 50 to about 250 μg, and most preferably about 75 to about 150 μg form, will find use here. For MPL, a dose in the range of approximately 10 to 250 μg, preferably approximately 20 to 150 μg, and in more preferred about 40 to about 75 μg, will find use with the present methods. Doses for other adjuvants can be easily determined by one skilled in the art using routine methods. The amount to be administered will depend on the number of factors including the co-administered antigen, as well as the ability of the adjuvant to act as an immunity stimulator. Similarly, if an antigen is administered transdermally, either in the same composition or a different composition, generally 50 ng to 1 mg and more preferably 1 μg to approximately 50 μg of antigen, it will be useful in generating a response immune. The exact amount needed will vary depending on the age and general condition of the subject to be treated, the severity of the condition being treated and the particular antigen or antigens selected, the site of administration, as well as other factors. An appropriate effective amount can be readily determined by a person skilled in the art in reading the instant specification and through routine testing.

The dosing treatment can be a single dose schedule or a multiple dose schedule. For compositions for vaccines, a multiple dose schedule is one in which a primary course of vaccination can be with 1-10 separate doses, followed by other doses given in subsequent time intervals, chosen to maintain and / or reinforce the immune response , for example, in 1-4 months for a secondary dose, and if necessary, a subsequent dose after several months. The dosage regimen will be determined, at least in part, by the need of the subject and will be dependent on the judgment of the medical specialist. In addition, if prevention of the disease is desired, the compositions will generally be administered prior to primary infection with the pathogen of interest. If the treatment is desired, for example, the reduction of symptoms or recurrences, the compositions are generally administered subsequent to the primary infection.

Experimental V? Jr sC- The following are examples of specific modalities for carrying out the present invention. The examples are offered for purposes of illustration only, and are not intended to limit the scope of the present invention in any way. Efforts have been made to ensure accuracy with respect to numbers used (eg, quantities, temperatures, etc.), but, of course, some experimental error and deviation could be allowed.

C .1 Particle and Technique Formulations Particle Formation Example 1 Particulate Compositions for Vaccines The following study was conducted to assess the effect that various processes of particle and excipient formation have on the physical properties of the resulting particulate compositions, and the immunogenicity of such reformulated vaccines. Diphtheria toxoid (dT), a purified subunit protein antigen, was selected for the formulation with different excipients including mannitol (plus polyvinylpyrrolidone (PVP)), sucrose, and trehalose. Two techniques of powder processing, freeze drying and air drying (evaporative drying), were also compared. For each formulation tested, the resulting particulate composition was classified into the following particle fractions: < 20 μm, 20-38 μm, 38-53 μm, and 53-75 μm using 3"diameter stainless steel sieves The physical characterization of particulate vaccine compositions includes an assessment of size distribution, energy penetration, optical microscopy, scanning electron microscopy, absolute density, pore size distribution, surface area analysis, and powder diffraction by X-rays. To determine the immunogenicity of the reformulated vaccine administered with a needleless syringe device (for example, a needleless syringe device PowderJect) or by injection with conventional needle / eringa, Balb / C mice (female, 6-8 weeks of age) were vaccinated at weeks 0 and 4. The mice vaccinated with The PowderJect® needleless syringe device receives 5 μg of vaccine formulated with 1 mg of excipients. The control mice were injected intraperitoneally with a conventional syringe and needle. Two weeks post magnification, the serum was collected and co-assembled from 8 mice, and the antibodies to dT were determined by ELISA. The result of the physical characterization of the particulate compositions was as follows: (1) the air drying process produced high density glass particles, while the freeze drying produced amorphous powders of relatively low density; and (2) the particle size distribution appears to be independent of excipients and the particle formation process used. The particles were fractionated by sieving in 5 dimensions (<20 μm, 20-38 μm, 38-53 μm, 53-75 μm, and> 75 μm, and the mass distribution for each fraction is approximately equivalent. of the immunogenicity assessment are shown in Tables 1 and 2 below, and in Figure 1. As can be seen, the immunogenicity among the various particulate compositions for vaccines was very similar (among all the formulations and fractions of different sizes for the same formulation).

All particulate compositions administered by syringe without needle produce higher antibody titers than the control group (administration with conventional syringe and needle). The trehalose excipient seems to work slightly better than the other formulations, and the 20-53 μm fractions appear to be more immunogenic (see Figure 1). However, both the particle fractions of < 20 μm as of > 75 μm were more immunogenic than the control (administration by needle and syringe of aqueous compositions). It can also be seen that administration with a needleless syringe (PowderJect) of the particles of the crystalline composition for vaccine results in a higher rate or rate of seroconversion than the control injection method (conventional syringe and needle) (see Table 2). In this regard, 97% (157 out of 162) of the animals developed serum antibodies after a single vaccination with PowderJect®, while the rate or proportion of seroconversion was 37.5% (3 out of 8) for the group of control. 4 PJ = PowderJect Note: In week 0 the serum had a titer < 200. The dose of dT for all vaccines is 5 μg.

C.2 Formation Assessment of Compositions Crystalline for Vaccine Example 2 Formulation of Crystalline Compositions for Vaccine A number of conventional vaccine compositions were crystallized using the following methods. Capsular polysaccharide Pneumococcus # 14 (CP14) was obtained as a lyophilized powder from the ATCC. A volume of 1 ml of Water for Injection was dispersed in a 2 mg vial of CP14, and the resulting suspension was mixed continuously at 4 ° C overnight as specified by the manufacturer's instructions. 100 μl of aliquots of the mixture were made and frozen until necessary. An amount of trehalose powder of 99.5 mg (Sigma) was weighed and mixed with thawed aliquots of the CP14 slurry to provide a total of 500 μg of CP14. Approximately 1200 μl of Water for Injection was used to dissolve the CPl 4 / trehalose mixture, and the solution was thoroughly mixed. 100 μl of aliquots of the solution were then dispersed on the surface of weighing troughs, and placed in the constant air flow provided by -... ^^ í - / ^^ If & ri &a ^ ~ r ^ iu &? j? ^. '^. ..... i - »'---. *.» ..- JftU.-a smoking cover or hood. The droplets were then d by evaporation over the following 1-2 days to form a crystalline product. The crystals were then removed from weighing troughs and lightly ground using mortar and pestle. A standard adult Engerix-B vial (Smith Kline Beecham), containing 20 μg of the surface antigen of HepB adsorbed on 0.5 mg of aluminum hydroxide (alum) was combined with 10 mg of trehalose, and the resulting solution was mixed thoroughly. 100 μl of droplets were dispersed on weighing troughs, and d as described here above. After approximately 36 hours of evaporative drying, the crystalline vaccine residues were carefully removed from the troughs to be weighed using a spatula. The crystalline composition was then milled slightly using mortar and pestle until the larger crystals had visibly reduced in size. 1.25 ± 0.25 mg of aliquots were dispersed in drug cassettes, providing a nominal dose of 2.5 μg of the antigen on the surface of Hepatitis B.

An amount of antigen was obtained from the surface of Hepatitis B (for its acronym in English, HbsAg), purified from human plasma, (Biodesign International). HbsAg was combined with di and trehalose water solution. The resulting solution was mixed gently, poured into a glass petp box and allowed to air dry for 2 days under a smoking layer or cover. Additional drying was performed for an additional day in a desiccator (Nalgene Plástic desiccator) that was purged with N2 gas. The dry solid composition was collected by scraping and then pulverized using a mortar and pestle. The resulting dry powder was weighed, and the amount of dry material for each dose was determined by dividing the total weight by the number of formulated doses. The particle size distribution of the formulated HbsAg vaccine composition varies over a wide range (1-100 μm). Typically, each dose requires approximately 1-2 mg of dry mass, with a weight variation of about 10% or less. An amount of HibTITER® (Wyeth Lederle) was obtained, which is comprised of a PRP-CRM197 conjugate vaccine composition. The composition contains polyribosyl ribose phosphate (polysaccharide from Haemophilus influenzae type b) conjugated to the mutant diphtheria toxin carrier CRM197, and is referred to herein as the "composition for Hib conjugate vaccine." The composition for Hib conjugate vaccine was combined with trehalose, and the resulting solution was mixed thoroughly. The solution was then dispersed over the weighing troughs, and dried out as previously described. After drying by evaporation, the crystalline residues for vaccine were obtained from the troughs for weighing, and the crystalline composition was milled lightly using a mortar and pestle, and the appropriate dosages thereof were measured in cassettes for administration from of a syringe without a needle. An amount of influenza virus, strain PR8, was obtained from Spafas (Storrs, CT). In addition, an amount of the influenza virus, strain Aichi, was obtained from Dr. Yoshihero Kawaoka, Veterinary School, University of Wisconsin (Madison, Wisconsin). Each virus was inactive by standard formalin treatment (1: 4,000, 48 hours at 4 ° C). The inactive virus (either PR8 or Aichi) was then combined with water solution of di and trehalose. The resulting solution was mixed ^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ a glass petri dish and allowed to air dry for 2 days under a smoking layer. Additional drying was performed for an additional day in a desiccator (Nalgene Plástic desiccator) which was purged with N2 gas. The dry solid composition was collected by scraping and then pulverized using a mortar and pestle. The resulting dry powder was weighed, and the amount of dry material for each dose was determined by dividing the total weight by the number of formulated doses. The particle size size distribution of the inactivated, fully formulated vaccine composition varies over a wide range (1-100 μm). Typically, each dose required approximately 1-2 mg of dry mass, with a variation in weight of about 10% or less. An amount of Diphtheria toxoid was obtained (Accurate Chemical &Scientific Corp., produced by Statems Serum Institute, Denmark). The toxoid was combined with di and trehalose water solution. The resulting solution was mixed gently, poured into a glass petri dish and allowed to air dry for 2 days under a smoking layer. Additional drying was performed for an additional day in a desiccator (Nalgene Plástic desiccator) which was purged with N2 gas. The dry solid composition was collected by scraping and then pulverized using a mortar and pestle. The resulting dry powder was weighed, and the amount of dry material for each dose was determined by dividing the total weight by the number of formulated doses. The particle size distribution of the composition formulated for Diphtheria toxoid vaccine varies over a wide range (1-100 μm). Typically, each dose requires approximately 1-2 mg of dry mass, with a weight variation of about 10% or less.

Example 3 Vaccination with Crystalline Vaccine Compositions Devices: Unless otherwise noted, needleless syringe delivery devices used in skin administration studies (either the PowderJect® ND series device or the PowderJect® Oral device series) were obtained from from PowderJect Technologies, Ltd., Oxford, UK The PowderJect ND device it is generally described in commonly acknowledged US Patent No. 5,630,796. The PowderJect® Oral device is generally described in commonly recognized International Publication No. WO 96/20022. The gas cylinders in the devices used here were typically presented with helium gas between 40 and 60 bar pressure, although anywhere from 30 to 80 bar pressure can also be used. In the operation, the helium compressed in the gas cylinder was released during the actuation of the device, breaking the membranes of the payload cassette containing particles. A supersonic condition is created, and the resulting high velocity gas flow drives the particles as projectiles on the target tissue surface. By varying the pressure of the helium gas in the gas cylinder, the depth of penetration can be controlled. For administration with conventional needle and syringe, the disposable syringes were fitted with 26.5 gauge needles. Mice and vaccination: Female Balb / c mice or Swiss Webster mice, 7 weeks of age were purchased from an authorized vendor (eg, HSD) and acclimated for 1 week in a mouse medium prior to vaccination. The mice were anesthetized by an intraperitoneal (IP) injection of lOOmg / kg of ketamine mixed with 10 mg / kg of xylazine, and the abdominal skin in the target site was shaved by shaving. The needleless syringe device was gently pressed against the vaccination site and supported. A typical immunization regimen consists of two vaccinations, four weeks later, with blood collection via retro-orbital blood flow or drainage under anesthesia prior to each vaccination and two weeks post-magnification. ELISA: In general, the response of the antibody to the reformulated vaccines was determined by an ELISA. A 96-well plate was coated with 0.1 μg of the detection antigen in PBS per well overnight at 4 ° C. Plates were washed 3 times with TBS containing 0.1% Brij-35, and incubated with test serum diluted in PBS containing 1% BSA for 1.5 hours. A standard serum, which contains a high level of antibodies for the specific antigen, was added to each plate and was used to standardize the titer in the analysis of final data. Plates were then washed and incubated with goat or biotin labeled antibodies, specific for immunoglobulin of mouse IgG or subclasses of IgG (1: 8,000 in PBS, Southern Biotechnology) for 1 hr at room temperature. After three additional washes, the plates were incubated with conjugates of horseradish peroxidase-it is trepavidin (1: 8,000 in PBS, Southern Biotechnology) for 1 hr at room temperature. Finally, the plates were washed and developed with a TMB substrate set. { obtained from Bio-Rad, Richmond, CA). Titrators of the endpoint of the test serum were determined using the Softmax Pro 4: 1 program (Molecular Devices) as the highest dilution calibrated with an A4so that exceeds the previous medium by 0.1. The previous absorbance of the medium was determined by cavities that receive all the reagents plus the test serum. 1. Vaccination with crystalline capsular polysaccharide of pneumococcus # 14 (CP14). Experimental groups of Balb / c mice were randomized based on the route of administration (intraperitoneal (IP) or intradermal (ID)), and formulation, as shown in the test matrix of Table 3. The mice were provided an original or primary and a magnified, four weeks after the original using the composition for Crystalline CP14 vaccine described above, and then bleed 10 days after magnification. For magnification, the mice were anesthetized with an injection of a mouse anesthetic to allow retro-orbital blood flow prior to the administration of higher magnification. For the administration of needleless syringe, the hair was removed by shaving, and administration was performed using 60 bar gaseous pressure from the PowderJect® needleless syringe delivery device. The serum samples were then analyzed to determine antibody titers for pneumococcus. - .. i. 2. Vaccination with the crystalline composition for the surface antigen vaccine against Hepatitis B (HepB). The crystal composition for HepB vaccine (as described above) was administered (in 2.5 μg carbohydrate dose) to mice as follows. The eight Balb / c mice were divided into two groups based on the vaccine composition and the administration technique used: (1) intraperitoneal using a needle for administration of the (liquid) composition for Engerix-B® vaccine conventional (n = 2); and (2) intradermal using a PowderJect needleless syringe to administer the crystalline composition for vaccine (n = 6). The pressure delivered from the PowderJect® device varies from 40 to 60 bar. All the animals were magnified three weeks after the fattening, and they were bled for 10 days followed by magnification. Antibody titers for the Hepatitis B surface antigen were then determined by ELISA using the blood samples obtained 10 days after administration of the magnification. The results are shown later in Table 4. Titrators greater than about 10 mlU / mL are considered seroprotectors. As can be seen, out of 6 of the animals receiving the crystalline composition via the syringe without a needle, they were protected by the composition for the crystalline vaccine.

A subsequent magnification using the same composition for HepB surface antigen, crystalline, was sufficient to significantly raise all antibody titers in the animals receiving the injection ..-.faith.. without needle (via the PowderJect device), such that all 6 animals were protected by the crystalline composition for vaccine. 3. Vaccination with the crystalline composition for the vaccine of the polyribosyl ribose phosphate conjugate of Haemophilus influenzae (Hib conjugate). The crystalline vaccine composition of the Hib conjugate described above, was administered to mice as follows. Swiss Webster mice were divided into experimental groups based on the technique of administration, dosage, and formulation: (Group 1, 2 μg (PRP carbohydrate) of a liquid composition for Hib conjugate vaccine administered IP using the conventional needle and syringe, n = 3); (Group 2, 2.5 μg (PRP carbohydrate) of the vaccine composition of the crystalline Hib conjugate, administered to the skin using the PowderJect® needleless syringe, n = 6); and (Group 3, control (native or natural), n = 3). All vaccinated animals receive a bait, followed by a magnification in 4 weeks after bait. Serum samples were collected 2 weeks after magnification, pooled and antibody titers for immobilized PRP-CRM197 were determined using ELISA. Due to the differences observed in the binding of mouse and human anti-Haemophilus polysaccharide (HbPs) antibodies, the HbO-HA ELISA described by Phipps et al. (1990) J. Immunol. Methods 135: 121-128, was adapted for use in the serum of the tested mouse. The assay conditions adapted for the measurement of mouse anti-HbPs antibodies are reported in Table 5 below. All the different test conditions are as described by Phipps et al.

* The evaluation has shown that the quantitative antibody values in the measured mouse serum using this ELISA are higher than those measured using a proportion-antigen binding (RABA) assay especially for serum with titrators less than 10 μg / mL in the RABA.

The results of the ELISA are shown below in Table 6. As can be seen, the crystalline composition for vaccine gives comparable results with the composition for conventional vaccine.

To further characterize the immune response in the animals receiving the composition for Hib conjugate vaccine, the following study was performed. Three experimental groups of 6 mice each were assembled as follows: (Group 1, 2 μg dose (PRP carbohydrate) of the vaccine composition of the crystalline Hib conjugate, administered intradermally using the PowderJect needleless syringe device); (Group 2, 2 μg dose (PRP carbohydrate) of a conventional liquid Hib conjugate vaccine composition administered intraperitoneally (IP) using needle and syringe); and (Group 3, control). The animals were primed, and then magnified four weeks later. The serum was collected two weeks after the magnification was conjugate, and the serial dilutions were tested using the ELISA techniques described above. In a first ELISA test, the PRP-CRM197 conjugate was used as the capture phase. The results of this first ELISA test were subsequently reported in Table 7, and is shown in Figure 2. As can be seen, the crystal composition provides a substantially identical response in relation to conventional vaccine administration.

(IP) = Intraperitoneal administration with needle and syringe, (PJ) = administration with syringe without needle PowderJect To verify the specificity of the immune response, a second ELISA was performed using diphtheria toxoid as the capture phase. In this respect, CRM197 is a mutant form of diphtheria toxoid, but CRM197 is highly reverse reactive. The binding of antiserum to diphtheria toxin was used to verify the response to the carrier protein of CRM197. The results are reported later in Table 8, and are shown in Figure 3. Again, the composition for crystalline vaccines provides results comparable to the crystalline composition for vaccines.

(IP) = intraperitoneal administration with needle and syringe, (PJ) = administration with syringe without needle PowderJect.

To detect the PRP-specific antibody response, a third ELISA test was performed using a human serum albumin conjugate for PRP (PRP-HSA) as the solid phase (capture). Since the mice have not been immunized with the PRP-HSA conjugate, they have not been exposed to HSA in other contexts, the binding of the antibody is due to the presence of anti-PRP antibodies. The results of this ELISA test are reported in Table 9 below, and are shown in Figure 4. As can be seen, compositions for conventional Hib (liquid) conjugate vaccines provide comparable results. ^ '^? ^ r (IP) = intraperitoneal administration with needle and syringe, (PJ) = administration with PowderJect® needleless syringe.

To determine the antibody responses to descending doses of the Hib conjugate vaccine followed by administration of PowderJect® or injection with conventional syringe and needle, the following study was performed. Swiss Webster mice (females, 6-8 weeks of age) were vaccinated twice (primed or initial and magnified) with either a liquid Hib conjugate vaccine composition, or a Hib, crystalline conjugate vaccine composition. at intervals of and 4 weeks. Four doses (1 μg, 0.2 μg, 0.04 μg, and 0.01 μg per dose) of the Hib conjugate composition were tested. For vaccination with a syringe without a needle, each dose for vaccine was formulated with 1 mg of trehalose. The control mice were injected intraperitoneally (IP) with a conventional needle and syringe. Blood samples were collected prior to each vaccination, and 2 weeks post-magnification. The antibodies for PRP and CRM197 were tested by ELISA as described above. The serum collected 2 weeks post-magnification was pooled, and the pooled serum was tested using the ELISA techniques described above. The results are shown in Figure 5. As can be seen, at the 1 μg dose, the IgG titrators appear to be comparable between the mice immunized by the PowderJect needleless syringe and the immunized mice using the syringe and needle. conventional In the dose range of 0.01-0.2 μg, the antibody levels in the mice immunized using the PowderJect® device appear to be higher than the mice in the corresponding syringe and needle administration groups. In addition, antibody responses to CRM197 were also measured in the immunized animals. Dose-dependent responses were observed in the groups immunized with the PowderJect device (see Figure 5). Control mice (those animals that were immunized by conventional syringe and needle injection) respond to vaccinations at higher doses (1 μg and 0.2 μg), but not at lower doses. These data indicate that transdermal immunization of particulate vaccine compositions using the PowderJect needleless syringe device is more effective than administration of liquid vaccine compositions using conventional syringe and needle injection techniques, especially for the administration of antigens at doses low. To verify the duration of the immunity provided by the conjugate vaccine composition with Hib, crystalline, the following study was performed. Swiss Webster mice (female, 6-8 weeks old) were vaccinated with two doses (primed and magnified) of the vaccine composition, crystalline, of Hib conjugate, at 4 week intervals. For vaccinations with PowderJect needleless syringe, 1 μg of vaccine was formulated with 1 mg of the trehalose excipient. As controls, mice were injected IP with 5 μg of a liquid Hib conjugate vaccine composition, using conventional syringe and needle administration techniques. Blood samples were collected from each vaccination, 2 weeks post-magnification, and monthly thereafter. Antibodies specific for PRP and CRM197 were tested using the ELISA techniques described above. The results of the ELISA assays are shown in Figures 6a and 6B. As can be seen, the administration by PowderJect of 1 μg of the composition for Hib, crystalline conjugate vaccines, generates levels of serum antibodies for PRP and CRM197 equivalent to that produced by 5 μg of conjugate administered by injection with conventional needle and syringe. . Antibodies at maximum levels two weeks after magnification and later for 8 weeks without significant reduction. The results indicate that transdermal administration of the composition for particulate vaccine with the PowderJect® device produces a longer antibody response of the serum ie comparable with conventional syringe and needle administration of a composition for liquid vaccine. 4. Vaccination with the inactivated influenza virus vaccine composition. To determine the antibody responses for descending doses of the influenza vaccine followed by administration with PowderJect® of a composition for a crystalline vaccine or conventional syringe and needle injection of a liquid vaccine composition, the following study was performed. Five experimental groups of Balb / c mice (female, 6-8 weeks of age) were stabilized to verify the five different doses of the crystalline composition of the inactive influenza virus (Aichi strain). The five groups receive vaccinations at weeks 0, 4 and 10.5 with 25 μg, 5 μg, 1 μg, 0.2 μg, or 0.04 μg, respectively, of the inactivated influenza virus. For transdermal administration by PowderJect ®, each dose of the vaccine was formulated with 1 mg of trehalose. Five groups of control mice were also established. These control mice receive vaccinations at weeks 0, 4 and 10.5 with 25 μg, 5 μg 1 μg, 0.2 μg, or 0.04 μg, respectively, of the inactivated influenza virus in a liquid vaccine composition (administered IP by conventional injection with needle and syringe). Two weeks after the third vaccination, serum from 8 mice was collected and pooled, and antibodies were determined by ELISA for the influenza virus. Two weeks post-magnification, the antibody titers in the pooled sera were determined against the Aichi virus using the ELISA techniques described above. The results of the ELISA are shown in Figure 7. As can be seen, these were a response to the antibody depending on the dose, hence the transdermal administration PowderJect < R) of the crystalline composition as the conventional injection with needle and syringe of the liquid composition. However, in the same similar doses of vaccine, vaccination by PowderJect < R > produces elevated antibody titers than injection with needle and syringe, indicating that administration by PowderJect í R) of a crystalline vaccine to the skin improves the functioning of the vaccine. The pooled sera were also tested for hemoglutination inhibition activity (Hl). The results of the Hl activity assay are shown below in Table 10. As can be seen, these were Hl titrators that depend on the dose in the sera of the vaccinated animals. The titers Hl of the administration by PowderJect í R) The animals received and conventional injection with needle and syringe are similar to high doses of vaccine (25μg, 5μg and lμg). However, at low doses of vaccine (0.2μg and 0.04μg) the Hl titers were produced only in the animals that received the crystalline composition of the PowderJect (R) system.

To assess the protection against a subsequent stimulus of the influenza virus, the vaccinated animals were stimulated at week 12 by the intranasal instillation of I X 106 PFU (100X LD50) of an Aichi influenza virus adapted to a mouse. More particularly, ten days after the final immunization, the mice were anesthetized by an intraperitoneal injection of 100 mg / kg of ketamine mixed with 10 mg / kg of xylazine. 1 X 106 units * ú. »- Á * Q > • » ^^ ^ k ^ ^^^^ xj ^^^^ - ^ particle formers (PFUs) of the influenza virus in 50 μl of saline were instilled slowly into the opening of the nasal cavity. The mice naturally inhaled the liquid. Then the animals were allowed to recover. The body weight of the animals was taken before the stimulation and daily after the stimulation for 14 days. The animals were checked daily for symptoms and survival. The animals that lost 25% of the body weight in the pre-shake and became moribund were euthanized by C02. Survival and body weight loss were recorded daily for 14 days after stimulation. All animals lost weight during days 3-7 after stimulation. The survivors gained their weight again by day 14. The results of the protection study are shown below in Table 11. Survival statistics for the animals that received the vaccine compositions containing 25μg and 5μg of the inactivated virus are shown in Figures 8A and 8B, respectively. As can be seen, in the dose of 25μg, the administration by PowderJect (R) of the crystalline composition gives a better protection against mortality than the liquid composition when the administration is by means of conventional injection with needle and syringe. A correlation between the antibody response and survival was observed in that the animals that died had low antibody titers. With the dose of 5μg, administration by PowderJect ÍR >; of the crystalline composition provides partial protection against mortality, compared with no protection in animals that received the same dose by conventional injection with needle and syringe. Therefore, transdermal administration of the crystalline (R) composition by means of the PowderJect device provides better protection than conventional injection with needle and syringe. . * --_, * '> »-. ^? .. ^ I - «- Ífe- &- Note: Mice that received 3 vaccinations at weeks 0, 4 and 10, were stimulated with 100X LD50 of an influenza virus adapted to a homologous mouse in week 12 The data represent protection for 2 weeks post-stimulation.

. Vaccination with the composition for crystalline diphtheria toxoid vaccine. To determine the antibody responses to descending doses of the dT vaccine following administration by PowderJect R 'of the crystal composition, and to compare these antibody responses with those achieved from the conventional injection with needle and syringe, the following study was accomplished. Two experimental groups of Balb / c mice (females, 6-8 weeks of age) were established. The animals received the vaccinations at weeks 0 and 4 with a composition for liquid dT vaccine (administered by injection with needle and syringe) or with a composition for crystalline vaccine (administered by the PowderJect (R) syringe device without needle). Two doses of vaccine were tested, ie the vaccine compositions containing 5μg and 1μg of the toxoid dT. For vaccination by PowderJect (R>, each dose of vaccine was formulated with 1 mg of trehalose.The control mice were injected IP with a conventional needle and syringe.Two weeks after the final vaccinations, the sera were collected and matched of 8 mice, and the antibodies to dT were determined by the ELISA techniques described above The results of the ELISA are shown below in Table 12. As can be seen, the transdermal administration of the crystalline composition containing 1 μg of dT resulted in a serum antibody response that was 15 times higher than in animals that received the same dose of a liquid vaccine composition by conventional injection with needle and syringe.This indicates that administration to the skin by particles is a effective to administer the vaccine for dT At the dose of 5μg, serum antibody levels in animals that received the crystalline composition by the PowderJect device < R) were similar to those seen in the animals that received the liquid composition by conventional injection with needle and syringe.

Tow & v? ßYes »ußltñ ?? sSl? X ..» < -. -á-ii? - .-. , -. &? I,. rt- x < x -. S Ajj > -jfe »Mt« -Ía £ i3¡ £ ÍVttAfi ig »«.

C.3 Training and Evaluation of Particulate Adjuvant Compositions Example 4 Formulation of Particulate Adjuvant Compositions A number of conventional adjuvant compositions were formulated into particles (powder) according to the methods of the invention. These and other adjuvants can be easily reformulated as powders using any number of particle-forming processes. Suitable excipients for the adjuvant compositions include trehalose, sucrose, agarose, mannitol, or a mixture of these and / or other sugars. The techniques of training * ^ ^ * i ^ * & ^? < S- < - * * _ > The particles may include air drying, freeze drying, spray coating, and supercritical fluid methods. However, all formulations of adjuvants used in the following experiments were prepared using the crystallization methods of the present invention (particularly as described above in Sections C.l and C.2) unless expressly stated otherwise. The particulate adjuvant compositions were produced as follows. An amount of aluminum hydroxide and aluminum phosphate adjuvant ("Alum Adjuvant") was obtained (produced by Superfow Biosector a / s, obtained from Accurate Chemical and Scientific Corp.). Adjuvant Alum was combined with trehalose and a solution of di water. The resulting solution was mixed gently, poured into a glass petri dish and allowed to air dry for 2 days under a smoking cover. Additionally the drying was done for an additional day in a desiccator (Nalgene Plástic desiccator) which was purged with N2 gas. The dried solid composition was collected by scraping and then pulverized using a mortar and pestle. The resulting dry powder was heavy, and the amount of dry material for each dose was determined by dividing the total weight by the number of doses formulated. The particle size distribution of the formulated Alum Adjuvant composition varied over a wide range (1-100 μm). Typically, each dose required about 1-2 mg of dry mass, with a weight variation of about 10% or less. An amount of the adjuvant MPL (monophosphoryl lipid A purified from S. minneso ta R595) was obtained (RIBI ImmunoChem Research, Inc.). The MPL adjuvant was combined with trehalose and di water solution. The resulting solution was mixed gently, poured into a glass petri dish and allowed to air dry for 2 days under a smoking cover. Additionally the drying was done for an additional day in a desiccator (Nalgene Plástic desiccator) which was purged with N2 gas. The dried solid composition was collected by scraping and then pulverized using a mortar and pestle. The resulting dry powder was weighed, and the amount of dry material for each dose was determined by dividing the total weight by the number of formulated doses. The particle size distribution of the composition of the MPL Adjuvant formulated varied over a wide range (1-100 μm). Typically, each dose required about 1-2 mg of dry mass, with a weight variation of about 10% or less. An amount of the adjuvant (20mer synthetic oligonucleotides, CpG-1: ATCGACTCTCGAGCGTTCTC, SEQ ID NO: 1 and CpG-2: TCCATGACGTTCCTGATGCT, SEQ ID NO: 2) was obtained. The CpG adjuvant was combined with trehalose and di water solution. The resulting solution was mixed gently, poured into a glass petri dish and allowed to air dry for 2 days under a smoking cover. Additionally the drying was done for an additional day in a desiccator (Nalgene Plástic desiccator) which was purged with N2 gas. The dried solid composition was collected by scraping and then pulverized using a mortar and pestle. The resulting dry powder was weighed, and the amount of dry material for each dose was determined by dividing the total weight by the number of formulated doses. The particle size distribution of the composition of the formulated CpG Adjuvant varied over a wide range (1-100 μm). Typically, each dose required about 1-2 mg of dry mass, with a weight variation of about 10% or less.

An amount of the PCPP adjuvant (a polymer-poly [di (carboxylatophenoxy) phosphazene] synthetic) was obtained (Virus Research Institute). The PCPP adjuvant was combined with trehalose and di water solution. The resulting solution was mixed gently, poured into a glass petri dish and allowed to air dry for 2 days under a smoking cover. Additionally the drying was done for an additional day in a desiccator (Nalgene Plástic desiccator) which was purged with N2 gas. The dried solid composition was collected by scraping and then pulverized using a mortar and pestle. The resulting dry powder was weighed, and the amount of dry material for each dose was determined by dividing the total weight by the number of formulated doses. The particle size distribution of the composition of the PCPP Adjuvant formulated varied over a wide range (1-100 μ). Typically, each dose required about 1-2 mg of dry mass, with a weight variation of about 10% or less.

E xemplo 5 Vaccination with the Adjuvant Compositions The devices used to administer the particulate compositions (ie, the PowderJect needleless syringe devices) and the control compositions (liquid) (ie, conventional needle and syringe) are as described above in Example 3. The experimental animals (Female Balb / c mice) were manipulated as above, compositions for vaccine were also administered as described above, and the same ELISA techniques as described above were used in the following studies. The crystalline and control (liquid) vaccine compositions which were used in the following studies were the completely inactivated influenza virus compositions (Aichi strain) and the Diphtheria toxoid compositions described above in Example 2. Stimulation studies viral (in the influenza studies) with the Aichi influenza strain adapted to a mouse were performed as described above in Example 3.

* * X & SklS ~ i & Ls, ißs¡í ^? ' - .- «< -faith. -ji-Ji - »* - t'- X.X-. - »* '. í »•.? &Jk, «1. Vaccination studies with the particulate Alum adjuvant composition. The particulate Alum adjuvant composition was used as an adjuvant with the crystalline composition for inactivated influenza vaccine and administered via the PowderJect R needleless syringe delivery system. Mice were vaccinated with 5μg or 1μg of the crystalline composition for inactivated influenza vaccine either with or without 100 μg of the Alum particulate adjuvant composition. The control animals were vaccinated subcutaneously ("S / C") with aqueous formulations of the same vaccine / adjuvant compositions using a conventional needle and syringe. Three vaccinations were then performed (at weeks 0, 4, and 10.5), at week 12 the sera were matched from 8 mice, and the antibodies for the influenza virus were determined by the ELISA techniques described above. The results of the ELISA study are reported in Table 13 below. Following administration to the skin of the influenza vaccine with the Alum adjuvant, the response of the antibody was significantly high compared to the animals that received the same dose of vaccine without the adjuvant.

The levels of serum antibodies in the animals that received the particulate compositions by means of the PowderJect device (R> were similar to those of the animals that were vaccinated with the same vaccine / adjuvant composition using conventional techniques. Alum can be administered to the skin as a powder to improve the immunogenicity of the influenza vaccine.

To assess protection against a subsequent stimulus of the influenza virus, the vaccinated animals were stimulated in week 12 by the intranasal instillation of I X 106 PFU (100X LD50) of an Aichi influenza virus adapted to a mouse. More par- ticularly, ten days after the final immunization, the mice were anesthetized by an intraperitoneal injection of 100 mg / kg of ketamine mixed with 10 mg / kg of xylazine. 1 X 10 particle forming units (PFUs) of the influenza virus in 50 μl of saline were instilled slowly into the opening of the nasal cavity. The mice naturally inhaled the liquid. Then the animals were allowed to recover. The body weight of the animals was taken prior to the stimulation and daily to the post stimulation. The animals were checked daily for symptoms and survival. The animals that lost 25% of the body weight in the pre-stimulation and became dying were euthanized by C02. Survival and body weight loss were recorded daily for 14 days after stimulation. These results are reported later in Table 14 and shown in Figure 9. As can be seen, the survival rate in the mice that received the vaccine with the Alum adjuvant was much higher than that of the mice that received the vaccine alone. Administration by PowderJect R of the particulate composition for influenza vaccine with Alum adjuvant offers better protection against weight loss than injection with syringe and needle (see Figure 9). Initially both groups of mice lost 18% of their body weight, but the animals that received the particulate compositions by means of the PowderJect (R) device regained their body weight at a faster rate than the subcutaneously vaccinated mice, indicating that the transdermal administration of the particulate immunomodulators to the skin is superior to conventional syringe and needle administration methodologies.

Note: The data is the number of animals that survived for 14 days against the total number of animals stimulated.

The particulate Alum adjuvant composition was also used as an adjuvant with the crystalline composition for diphtheria toxoid (dT) vaccine and administered by means of the PowderJect "" needleless syringe administration system. Mice were vaccinated with 5μg or 1μg of the crystalline composition for dT vaccine either with or without 100μg of Alum particulate adjuvant by transdermal administration with the PowderJect R device). The control animals were vaccinated subcutaneously with aqueous formulations of the same vaccine / adjuvant composition using a conventional administration system with needle and syringe. Vaccinations were carried out at weeks 0 and 4. In week 6 the sera were collected and matched from 8 mice, and the antibodies for the dT were determined by the ELISA techniques described above. The results of the ELISA study are reported in Table 15 below. As can be seen, the serum antibody responses in the animals that received the particulate composition for dT vaccine with the Alum adjuvant via the PowderJect delivery device < R > were significantly high compared to the control animals that received the same dose of vaccine without the adjuvant. These levels of serum antibodies were similar to those seen in the animals that received the liquid vaccine / adjuvant composition by conventional means.

The titrators of the IgG subclass for dT were also determined by ELISA, the results of which are reported in Table 16 below. As can be seen, transdermal administration of the particulate composition for dT vaccine with the Alum adjuvant by means of the PowderJect device (R> initially produces an IgGl response.) A similar distribution of the IgG subclass was seen following conventional injection. With needle and syringe, this indicates that Alum adjuvant promotes a Th2-type immune response to the vaccine during administration to the skin.Therefore, Alum particulate adjuvant can be administered to the skin following the methods of the invention and used for control the type of immune response to co-administered vaccines. 2. Vaccination studies with the composition of particulate PCPP adjuvant. The particulate PCPP adjuvant composition was used as an adjuvant with the crystalline composition for inactivated influenza vaccine and administered by means of the PowderJect 'needleless syringe delivery system. Mice were vaccinated with 5μg or 1μg of the crystalline composition for inactivated influenza vaccine either with or without 100μg of the particulate PCPP adjuvant composition. The control animals were vaccinated S / C with aqueous formulations of the same vaccine / adjuvant compositions using a conventional needle and syringe. Three vaccinations were then performed (at weeks 0, 4, and 10.5), at week 12 the sera were matched from 8 mice, and the antibodies for the influenza virus were determined by the ELISA techniques described above. The injection sites were also assessed visually and manually for signs of toxicity (eg, granuloma formation). Granulomas are a common form of the local toxic effect seen with the administration of any adjuvant. Subcutaneous injection of the liquid composition for influenza vaccine with the PCPP adjuvant results in the formation of a granuloma in the subcutaneous tissue at the site of injection. In contrast, no granuloma was detected following administration by PowderJect (R >; of the particulate composition based on general manual and visual examination. These data suggest that transdermal administration of the particulate PCPP adjuvant reduces or also avoids the toxicity commonly associated with PCPP. To assess the protection against a subsequent stimulus of the influenza virus, the vaccinated animals were stimulated at week 12 by the intranasal instillation of I X 106 PFU (100X LD50) of an Aichi influenza virus adapted to a mouse. The stimulation was performed as described above. Survival and body weight loss were recorded daily for 14 days. Survival rates are shown in Table 17 below, and body weights are shown in Figure 10. As can be seen, in Table 17, the administration of the particulate PCPP adjuvant with the crystalline influenza vaccine (at the dose of 5 μg) significantly increases the survival rate compared with the vaccine without adjuvant. Similar protection was seen with the control animals (liquid) at the same dose of vaccine. However, as seen in Figure 10, administration by PowderJect (R1 of the flu vaccine with the adjuvant PCPP offers better protection against weight loss than subcutaneous injection using a conventional syringe and needle system. In consideration, both groups of mice initially lose 15% of their body weight, but mice vaccinated by PowderJect í R) regained their body weight at a faster rate than mice vaccinated subcutaneously. The non-significant protection is seen in the animals that received the dose of l | μg of the influenza vaccine (with or without adjuvant), when administered either in the particulate or liquid form. The particulate PCPP adjuvant composition was also used as an adjuvant with the crystalline composition for the Diphtheria toxoid (dT) vaccine and administered by means of the PowderJect needleless syringe delivery system (R. The mice were vaccinated with 5μg or 1μg of the crystalline composition for dT vaccine either with or without 100 μg of the particulate PCPP adjuvant by transdermal administration with the PowderJect R device.The control animals were subcutaneously vaccinated with aqueous formulations of the same vaccine / adjuvant composition using a of conventional administration with needle and syringe Vaccinations were performed at weeks 0 and 4. In week 6, the sera were collected and matched from 8 mice, and the antibodies for dT were determined by the ELISA techniques described above. The results of the ELISA study are reported in Table 18 below. -, -. and & see, serum antibody responses in the animals that received the particulate composition for dT vaccine with the PCPP adjuvant via the PowderJect (R) delivery device were significantly high compared to the control animals that received the same dose of vaccine without the adjuvant. These levels of serum antibodies were similar to those seen in the animals that received the liquid vaccine / adjuvant composition by conventional means.

Note: The data is the number of surviving animals for 14 days against the total number of stimulated animals.

The titrators of the IgG subclass for dT were also determined by ELISA, the results of which are reported in Table 19 below. As can be seen, the transdermal administration of the particulate composition for dT vaccine with the PCPP adjuvant by means of the PowderJect device < R) initially produces an IgG1 response. A similar distribution of the IgG subclass was seen following conventional injection with needle and syringe. This indicates that the PCPP adjuvant promotes a Th2-type immune response to the vaccine during administration to the skin. Accordingly, the particulate Alum adjuvant can be administered to the skin following the methods of the invention and used to control the type of immune response to co-administered vaccines. 3. Vaccination studies with the particulate CpG adjuvant composition. The particulate CpG adjuvant composition was used as an adjuvant with the crystalline composition for inactivated influenza vaccine and administered by means of the needleless syringe administration system PowderJect í R). Mice were vaccinated with 5μg or 1μg of the crystalline composition for inactivated influenza vaccine either with or without 100 μg of the particulate CpG adjuvant composition. The control animals were vaccinated S / C with aqueous formulations of the same vaccine / adjuvant compositions using a conventional needle and syringe. Three vaccinations were then performed (at weeks 0, 4, and 10.5), at week 12 the sera were matched from 8 mice, and the antibodies for the influenza virus were determined by the ELISA techniques described above. The results of the ELISA study are reported in Table 20 below. Following the administration of the particulate vaccine for influenza with the CpG adjuvant by means of the PowderJect device, the response of the serum antibody was significantly high compared with the animals that received the same dose of vaccine without the adjuvant. further, serum antibody levels in the animals receiving the particulate compositions by means of the PowderJect R device were significantly higher than serum antibody levels in the animals vaccinated with the same vaccine / adjuvant composition (in liquid form) using conventional techniques. Accordingly, the CpG adjuvant can be administered to the skin in powder form to improve the immunogenicity of an influenza vaccine. Administration in this manner significantly improves the enhanced immune effect provided by the CpG adjuvant. 2 * ^ ¡? ^^ ¿i | ^^ £ ^ Titers of the IgG subclass for influenza were also determined by ELISA. The results are reported in Table 21 below. As can be seen, administration by PowderJect (R > of the particulate composition for influenza vaccine without the adjuvant initially produces an IgGl response.) A similar distribution of the IgG subclass was seen following conventional injection with needle and syringe. the composition for liquid vaccine, except that the titrant was very low by this route.This data indicates that the influenza vaccine alone produces a Th2 type immunity.The administration by PowderJect (R) of the particulate composition for influenza vaccine with the CpG adjuvant it initially produces the IgG2a antibodies, indicating that the CpG promotes the Thl response. Therefore, the skin is a superior site for administering the CpG adjuvant or the CpG adjuvant vaccines.

To assess the protection against a subsequent stimulus of the influenza virus, the vaccinated animals were stimulated at week 12 by the intranasal instillation of I X 106 PFU (100X LD50) of an Aichi influenza virus adapted to a mouse. Viral stimulation was performed as described above. Survival and body weight loss were recorded daily for 14 days. Survival ratios are reported in Table 22. Body weights data are shown in Figures HA and 11B. As can be seen, from Table 22, a survival rate of 100% was seen with the animals that received the particulate vaccine compositions (both lμg and 5μg dose) when the CpG adjuvant was used and were administered transdermally by means of the powderJect (R) device In contrast, subcutaneous injection with the liquid composition did not result in any protection with a dose of lμg. therefore, administration by PowderJect < R > of the particulate vaccine for influenza with the CpG adjuvant to the skin is more effective than the subcutaneous injection.

Note: The data are the numbers of surviving animals for 14 days against the total number of animals stimulated.

Referring now to Figures HA and 11B, administration by PowderJect R) of the particulate composition for influenza vaccine with the CpG adjuvant also offers significantly better protection against weight loss than subcutaneous injection of the same vaccine composition using a conventional administration with needle and syringe. In this regard, it was less than an initial weight loss of 10% seen in mice vaccinated with either lμg or 5μg of the CpG adjuvant crystalline influenza vaccine, and these mice regained their body weight rapidly. In contrast, subcutaneous injection offered much less protection. Specifically, this was about 20% of initial weight loss in the mice injected subcutaneously with the liquid vaccine having the CpG adjuvant (at the 5μg dose), and the weight recovery was significantly higher. Subcutaneous injection of the liquid vaccine having the CpG adjuvant (at a dose of 1 μg) did not offer any protection. All animals in this control group lost approximately 25% of their body weight on day 5 and died on day 7. These data suggest that CpG is a much more effective and potent immunomodulator when administered to the skin using the PowderJect system. (R) The particulate CpG adjuvant composition was also used as an adjuvant with the crystalline composition for Diphtheria toxoid (dT) vaccine and administered by means of the PowderJect needleless syringe delivery system. Mice were vaccinated with 5μg or 1μg of the crystalline composition for dT vaccine either with or without 100 μg of the particulate CpG adjuvant by transdermal administration with the PowderJect device. The control animals were vaccinated subcutaneously with aqueous formulations of the same vaccine / adjuvant composition using a conventional administration system with needle and syringe. The vaccinations were carried out in weeks 0 and 4. In week 6 the sera were collected and combined from 8 mice, and the antibodies for dT were determined by the ELISA techniques described above. The results of the ELISA study are reported in Table 23 below. As can be seen, the serum antibody responses in the animals receiving the particulate composition for dT vaccine with the CpG adjuvant via the PowderJect (R) delivery device were significantly high compared to the control animals that received the same dose of vaccine without the adjuvant. The levels of serum antibodies in the animals that received the particulate compositions by means of the PowderJect delivery device <; R > were more than 10 times greater than the titrators in the animals vaccinated with the same vaccine / adjuvant composition (in liquid form) by means of conventional needle and syringe. Thus, the administration of CpG in particulate form improves the immunogenicity of the co-administered dT vaccine composition.

The titrators of the IgG subclass for the dT antigen were also determined by ELISA. The results are reported in Table 24 below.

As can be seen, administration by PowderJect of the particulate composition for influenza vaccine without the adjuvant initially produces an IgG1 response. A similar distribution of the IgG subclass was seen following the conventional needle and syringe injection of the liquid vaccine composition, except that the titrant was very low by this route. These data indicate that the influenza vaccine alone produces a Th2-type immunity. Administration by PowderJect (R> of the particulate composition for influenza vaccine with the CpG adjuvant initially produces IgG2a antibodies, indicating that CpG promotes the Thl response.) A similar distribution of the IgG subclass was seen following conventional injection With needle and syringe of the same vaccine composition (but in liquid form), except that the titrant was 10 times lower in this route, therefore, the skin is a superior site for administering the CpG adjuvant or CpG adjuvanted vaccines .

SC = subcutaneous injection, PJ = PowderJect device (R>.) Vaccinations were given at weeks 0 and 4. 4. Vaccination studies with the liquid and particulate compositions of MPL adjuvant. In a first study, a liquid MPL adjuvant composition was used as an adjuvant in combination with the crystalline composition for inactivated influenza vaccine (administered by means of the PowderJect needleless syringe delivery device). Mice were vaccinated with either 5μg or 1μg of the crystalline composition for inactivated influenza vaccine either- with or without 50μg of the liquid MPL adjuvant composition. When the MPL adjuvant was used, the liquid composition of MPL was injected intradermally using a 27 gauge needle, and the crystalline vaccine was administered 5 minutes later to the same site using the PowderJect! R) device. The control animals were vaccinated S / C with aqueous formulations of the same vaccine / adjuvant compositions using a conventional needle and syringe. Three vaccinations were then performed (at weeks 0, 4, and 10.5), at week 12 the sera were matched from 8 mice, and the antibodies for the influenza virus were determined by the ELISA techniques described above. The results of the ELISA study are reported in Table 25 below. Following administration to the skin of the influenza vaccine with the adjuvant MPL, the response of the serum antibody was significantly high compared to the animals that received the same dose of vaccine without the adjuvant. The levels of serum antibodies in the animals that received the particulate compositions by means of the PowderJect (R) device were similar to those of the animals that were . «Jja-a-t-, -. , ^ SS ^^^? & ^^ t¿tm ^^^^ B ^,! Ur ^ ié ». vaccinated with the same vaccine / adjuvant composition using conventional techniques. Accordingly, the MPL adjuvant can be administered to the skin in powder form to improve the immunogenicity of an influenza vaccine.

Note: Vaccinations were given in weeks 0, 4 and 10.5. He MPL was injected intradermally using a 27 gauge needle, 5 minutes later the powder vaccine was administered to the same site using a PowderJect (R) device Titers of the IgG subclass for the influenza virus were also determined by ELISA. The results are reported in Table 26 below. As you can see, the administration by PowderJect ÍR > of the particulate composition for influenza vaccine without the adjuvant initially produces an IgG1 response. A similar distribution of the IgG subclass was seen following the conventional needle and syringe injection of the composition for liquid vaccine. The combination of the intradermal MPL adjuvant and the administration by PowderJect (R) of the crystalline composition for the influenza vaccine produces both IgG1 and IgG2a antibodies., indicating that administration to the skin of MPL induces a balanced Thl / Th2 response for the influenza vaccine. A similar distribution of the IgG subclass was seen following the conventional needle and syringe injection of the composition for liquid vaccine.

To assess the protection against a subsequent stimulus of the influenza virus, the animals vaccinated were stimulated at week 12 by the intranasal instillation of I X 106 PFU (100X LD50) of an Aichi influenza virus adapted to a mouse. The stimulation was performed as described above. Survival and body weight loss were recorded daily for 14 days. Survival rates are shown in Table 27 below, and body weight data are shown in Figure 12. As can be seen from Table 27, 100% survival was seen in the animals vaccinated with 5 μg. of the composition for crystalline vaccine (administered by means of the powderJect (R) device) aided with 50 μg of the MPL (administered by conventional intradermal injection with needle and syringe), while only 4 of the 6 surviving animals in the group of control (administered by means of a needle and conventional syringe) received the same dose of vaccine and adjuvant. Partial protection was seen in the animals that received 1 μg of the vaccine composition with 50 μg of the MPL both by Powderj ect (R) and conventional administration with needle and syringe.

Note: The data are the numbers of surviving animals for 14 days against the total number of animals stimulated afterwards with 106 PFU of the virus.

Referring now to Figure 12, administration by PowderJect lR) of the crystalline composition for influenza vaccine (at the 5 μg dose) coupled with the MPL adjuvant offers significantly better protection against weight loss than subcutaneous injection of the same vaccine / adjuvant combination using conventional administration with needle and syringe. There was a maximum weight loss of 10% in the animals that received the 5μg vaccine dose (by means of transdermal administration by PowderJect R >) with 50 μg of the MPL adjuvant, however, these animals quickly regained their weight. In contrast, animals vaccinated with the liquid composition (S / C) lost approximately 20% of their body weight, and their weight was progressively recovered in a lower proportion. In a second study, a particulate composition of MPL was used as an adjuvant with the crystalline composition for diphtheria toxoid (dT) vaccine and administered via the needleless syringe delivery system PowderJect < R > . Mice were vaccinated with 5μg or 1μg of the crystalline composition for dT vaccine with or without 50 μg of the particulate MPL adjuvant composition by transdermal administration with the PowderJect device (R > The control animals were vaccinated subcutaneously with aqueous formulations of the same vaccine / adjuvant composition using a conventional administration system with needle and syringe Vaccinations were performed at weeks 0 and 4. In week 6 the sera were collected and matched from 8 mice, and antibodies for dT were determined by the ELISA techniques described above.

Following transdermal administration of the particulate composition for dT vaccine with MPL adjuvant, serum antibody responses were marginally high compared to control animals that received the same dose of vaccine without MPL. The level of the serum antibodies in the vaccinated animals by means of the tandermic administration PowderJect (R> was similar for the titrators of the animals vaccinated with the same composition of vaccine / adjuvant by conventional needle and syringe. IgG for dT were determined by ELISA The results are reported in Table 28. As can be seen, administration by PowderJect (R) of the dT vaccine without the adjuvant initially produces an IgGl response. the IgG subclass was seen following injection with needle and syringe The vaccine composition for dT having the MPL adjuvant produces both IgG1 and IgG2a antibody antibodies when administered in particulate form from the PowderJect device <; R). A similar distribution of the IgG subclass was seen following injection with needle and syringe, indicating that administration by PowderJect (R) of the MPL to the skin can be used to induce a Thl / Th2 type immunity.

Mouse strain = Balb / C, SC subcutaneous injection, PJ = PowderJect device (R) Vaccinations were given at weeks 0 and 4.

Accordingly, new methods for the administration of the transdermal compositions for vaccine and adjuvants are described. Additionally, new processes for pharmaceutical compositions (crsitalin), and methods for the production and use thereof are described. Although the preferred embodiments of the subject of the invention have been described in detail, it is understood that obvious variations can be made without departing from the spirit and scope of the invention • as defined by the appended claims.

It is noted that in relation to this date the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention. Having described the invention as above, the content of the following is claimed as property m-gg ^ jg ^

Claims (70)

1. A method for improving or enhancing the immunogenicity of a selected antigen, the method is characterized in that it comprises: (a) administering an effective amount of the antigen to a vertebrate subject; and (b) administering an amount of a particulate adjuvant composition sufficient to improve the immunogenicity of the antigen, wherein the adjuvant is administered in or through the skin or tissue of the vertebrate subject and in addition where the administration is performed using a delivery technique. transdermal

2. The method according to claim 1, characterized in that the antigen is in the form of particles and is administered in or through the skin or tissue of the vertebrate subject using a transdermal administration technique.

3. The method according to claim 1, characterized in that the composition Has-? ~ £ g | ¡& -fe ^ ~ < . ~. Particulate adjuvant is administered using a needleless syringe delivery device.

4. The method according to claim 1, characterized in that the antigen and the adjuvant are present in separate compositions.

5. The method according to claim 1, characterized in that the antigen and the adjuvant are present in the same composition.

6. The method according to claim 1, characterized in that the antigen and the adjuvant are administered to different sites in the vertebrate subject.

7. The method according to claim 1, characterized in that the antigen and the adjuvant are administered to the same site in the vertebrate subject.

8. The method according to claim 1, characterized in that the antigen is administered prior to the adjuvant composition.

9. The method according to claim 1, characterized in that the antigen is administered subsequent to the adjuvant composition.

10. The method according to claim 1, characterized in that the antigen is administered concurrently with the adjuvant composition.

11. The method according to claim 1, characterized in that the antigen is a viral antigen.

12. The method according to claim 11, characterized in that the viral antigen is a viral protein.

13. The method according to claim 11, characterized in that the viral antigen is a viral particle.

14. The method according to claim 1, characterized in that the antigen is in a composition for subunit vaccine.

15. The method according to claim 1, characterized in that the antigen is a bacterial antigen.

16. The method according to claim 15, characterized in that the bacterial antigen is a bacterial or polysaccharide protein.

17. The method according to claim 1, characterized in that the antigen is a live attenuated organism.

18. The method according to claim 17, characterized in that the attenuated organism is a virus.

19. The method according to claim 17, characterized in that the attenuated organism is a bacterium.

20. The method according to claim 1, characterized in that the particulate adjuvant composition is provided in a crystalline form suitable for transdermal administration.

21. The method according to claim 1, characterized in that the adjuvant is a CpG oligonucleotide.

22. The method according to claim 21, characterized in that the CpG oligonucleotide comprises the sequence TCCATGACGTTCCTGATGCT (SEQ ID NO: 1).

23. The method according to claim 21, characterized in that the CpG oligonucleotide comprises the sequence ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 2).

24. A method for producing an immune response in a vertebrate subject, the method is characterized in that it comprises the transdermal administration of a composition for a particulate vaccine in or through the skin or tissue of the vertebrate subject, wherein the composition for the particulate vaccine comprises: (a) ) an effective amount of a selected antigen; and (b) an amount of an adjuvant sufficient to improve the immunogenicity of the antigen.

25. The method according to claim 24, characterized in that the composition for a particulate vaccine is administered using a needleless syringe delivery device.

26. The method according to claim 24, characterized in that the antigen is a viral antigen.

27. The method according to claim 26, characterized in that the viral antigen is a viral protein.

28. The method according to claim 26, characterized in that the viral antigen is a viral particle.

29. The method according to claim 24, characterized in that the composition for vaccine is a composition for subunit vaccine.

30. The method according to claim 24, characterized in that the antigen is a bacterial antigen.

31. The method according to claim 30, characterized in that the bacterial antigen is a bacterial protein or polysaccharide.

32. The method according to claim 24, characterized in that the antigen is a live attenuated organism.

33. The method according to claim 32, characterized in that the attenuated organism is a virus.

34. The method according to claim 32, characterized in that the attenuated organism is a bacterium.

35. The method according to claim 24, characterized in that the composition for the particulate vaccine is provided in a crystalline form suitable for transdermal administration.

36. The method according to claim 24, characterized in that the adjuvant is a CpG oligonucleotide.

37. The method according to claim 36, characterized in that the CpG oligonucleotide comprises the sequence TCCATGACGTTCCTGATGCT (SEQ ID NO: 1).

38. The method according to claim 36, characterized in that the CpG oligonucleotide comprises the sequence ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 2).

A- 39. A particulate adjuvant composition suitable for administration in or through the skin or tissue of a vertebrate subject using a transdermal administration technique.

40. The use of an adjuvant in the production of a particulate composition for transdermal administration in or through the skin or tissue of a vertebrate subject.

41. The use according to claim 40, wherein the particulate composition comprises a selected antigen and the adjuvant improves the immunogenicity of the antigen.

42. The use according to claim 40, wherein the particulate composition is administered in or through the skin or tissue of the vertebrate subject using a needleless syringe delivery device. * 23 & # y2? _ - -. ,, «*? ¡* * &M '? L« ^ ¡¿. - * • «

43. The use according to claim 40, wherein the antigen is a viral antigen.

44. The use according to claim 43, wherein the viral antigen is a viral protein.

45. The use according to claim 43, wherein the viral antigen is a viral particle.

46. The use according to claim 40, wherein the antigen is in a composition for subunit vaccine.

47. The use according to claim 40, wherein the antigen is a bacterial antigen.

H ^ .- 48. The use according to claim 47, wherein the bacterial antigen is a bacterial protein or polysaccharide.

49. The use according to claim 40, wherein the antigen is an attenuated, living organism.

50. The use according to claim 49, wherein the attenuated organism is a virus.

51. The use according to claim 49, wherein the attenuated organism is a bacterium.

52. The use according to claim 40, wherein the particulate composition is provided in a crystalline form suitable for transdermal administration.

53. The use according to claim 40, wherein the adjuvant is a CpG oligonucleotide.

54. The use according to claim 53, wherein the CpG oligonucleotide comprises the sequence TCCATGACGTTCCTGATGCT (SEQ ID NO: 1).

55. The use according to claim 53, wherein the CpG oligonucleotide comprises the sequence ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 2).

56. A method for producing a physiological effect in a vertebrate subject characterized in that it comprises administering an amount of the particulate adjuvant composition according to claim 39, in or through the skin or tissue of the vertebrate subject sufficient to cause the physiological effect.

57. A method for forming a crystalline pharmaceutical composition, the method is characterized in that it comprises: (a) combining a liquid pharmaceutical formulation with a sugar of suitable pharmaceutical grade to provide a composition; (b) allowing the composition to dry under suitable evaporation conditions which favor crystal formation, whereby a crystalline composition having improved density characteristics is obtained; and (c) collecting the crystalline composition.

58. The method according to claim 57, characterized in that the pharmaceutical composition is a composition for vaccine.

59. A crystalline pharmaceutical composition suitable for administration in or through the skin or tissue of a vertebrate subject.

60. The composition according to claim 59, characterized in that the composition is a vaccine composition.

61. The composition according to claim 60, characterized in that the composition comprises an antigen and an excipient in an amount sufficient to improve the density of the crystalline pharmaceutical composition.

62. The composition according to claim 61, characterized in that the antigen is a viral antigen.

63. The composition according to claim 61, characterized in that the antigen is a bacterial antigen.

64. A method for treating a subject, the method is characterized in that it comprises the administration of the pharmaceutical composition crystalline according to claim 59, e'n or through the skin or tissue of the subject, wherein the crystalline composition is administered in an amount sufficient to cause a prophylactic or therapeutic effect in the subject.

65. The method according to claim 64, characterized in that the pharmaceutical composition is a vaccine composition comprising an antigen of interest.

66. The method according to claim 65, characterized in that the composition for vaccine is a composition for subunit vaccine.

67. The method according to claim 65, characterized in that the vaccine composition comprises a viral antigen.

68. The method according to claim 65, characterized in that the vaccine composition comprises a bacterial antigen.

69. The method according to claim 64, characterized in that the crystalline composition is administered to the subject using a syringe without a needle.

70. The use of a pharmaceutical agent in the production of a crystalline composition for transdermal administration in or through the skin or tissue of a vertebrate subject.