JP2003528818A - Induction of mucosal immunity by vaccination via the skin route - Google Patents

Abstract

(57) SUMMARY A method for generating a mucosal immune response is described. Compositions suitable for use in a method for generating an immune response at a mucosal surface are also described. Furthermore, there is provided a method for treating or preventing a disease caused by invasion of a pathogen into a subject through a mucosal surface. In one aspect, the present invention relates to the use of an antigen or a nucleic acid encoding an antigen in the manufacture of a particulate vaccine composition for generating a mucosal immune response on a mucosal surface of a vertebrate subject, the method comprising: A mucosal immune response provides for use by delivering the particulate vaccine composition into or across the subject's skin using a transdermal delivery technique.

Description

Detailed Description of the Invention

TECHNICAL FIELD The present invention relates to compositions suitable for transdermal vaccine delivery using a powder injection delivery system. More particularly, the invention relates to methods of eliciting a mucosal immune response, and methods of treatment or vaccination with particulate vaccine compositions.

BACKGROUND OF THE INVENTION The mucosa is a portal entry site for various pathogens such as bacteria, viruses and parasites. Therefore, a vaccine or vaccination method that induces protective immunity (both antibody and cell-mediated immunity) at the mucosal surface is described by AIDS, pne.
It is necessary for proper protection against many diseases such as umococcus disease and influenza. It is generally believed that vaccination by parenteral injection with a syringe and needle does not produce a mucosal immune response, and mucosal immunity can only be generated by direct application of the vaccine to mucosal tissues. Topical application of non-replicating vaccines to mucosal surfaces has remained largely unsuccessful due to low delivery efficiency.

Immunization via the dermal route results in a serum antibody response. Methods of delivering the vaccine via the cutaneous route include intradermal injection using a liquid injector, transcutaneous immunization (TCI).
), Patch delivery and the epithelial powder injection technique that we have recently described. Compared to other skin immunization methods, powder injection uses smaller vaccine doses and elicits higher serum antibody titers. Very importantly, various adjuvants can be co-formulated and delivered with vaccines to enhance and modulate the immune response using powder injection methods.

The skin is not mucosal tissue, so vaccination via the skin is not expected to produce a mucosal response. However, Glenn G. M. et al.
Recently reported that after transcutaneous immunization, there is an IgA antibody response to cholera toxin but no co-administered diphtheria toxoid (Glenn et al. (1998) J. Immunol. 16
1: 3211-3214; Glenn et al. (1999) Inf
ect. Immun. 67: 1100-1106). In these studies, the authors noted that, as expected, no immune IgA antibody against co-administered diphtheria toxoid was found. The dose of cholera toxin used in these studies was 100 mg. TCI is a technique that utilizes ADP-ribosylated exotoxins (such as cholera toxin) to deliver liquid vaccines through intact skin without pores.

SUMMARY OF THE INVENTION The present invention provides a novel method of eliciting mucosal immunity to an antigen, preferably formulated with or in combination with an adjuvant and delivered using powder injection technology. provide. The present invention differs from TCI methodologies in at least the following four aspects: 1) powder injection delivers a particulate vaccine composition by piercing the degrading layer and TCI does not leave a liquid vaccine composition intact. Deliver liquid vaccine compositions by coating in non-perforated skin; 2) powder injection elicits a mucosal immune response to vaccine antigens, while TCI is mucosal to cholera toxin delivery vehicle / adjuvant. I
Only induces gA, but not co-administered antigens; 3) In addition to ADP-ribosylated exotoxin, other adjuvants (eg CpG) are used to induce mucosal response in powder injection method And TCI, on the other hand, depends on the ADP-ribosylated exotoxin for delivery; and 4) powder injection uses smaller doses of vaccine and adjuvant than TCI. We have conducted studies to show that TCI elicits a detectable mucosal antibody response against either cholera toxin or co-administered vaccine with the dose of adjuvant and vaccine used in powder injection systems. It proved impossible. The present invention also provides vaccine compositions for use in such methods.
Methods for treating diseases caused by pathogens that enter the body through mucosal surfaces are also provided.

[0006] Accordingly, the present invention involves the use of transdermal delivery techniques to deliver a particulate vaccine composition into or across the skin of a vertebrate subject to generate an immune response at a mucosal surface. Provide a way to do. Here, the vaccine composition comprises an antigen or a nucleic acid encoding the antigen. Preferably, the particulate vaccine composition is delivered using a needleless syringe powder injection device.

The present invention also provides the use of an antigen or a nucleic acid encoding an antigen in the manufacture of a particulate vaccine composition for generating a mucosal immune response at the mucosal surface of a vertebrate subject. Here, the particulate vaccine composition is delivered using transdermal delivery techniques, and preferably using a needleless syringe powder injection device, into or across the skin of the subject.

Further, the adjuvant composition can be delivered to a vertebrate. The adjuvant composition may be administered at the same or different site as the vaccine composition. The adjuvant composition may also be delivered before, after or simultaneously with the vaccine composition.
The adjuvant and vaccine composition can be administered either as a single composition or separate compositions. In one particular embodiment, the adjuvant composition is in particulate form and is delivered using a transdermal delivery technique, preferably a needleless Schilling powder injection device.

Accordingly, the present invention provides the use of an antigen or nucleic acid encoding an antigen in the manufacture of a particulate vaccine composition for generating a mucosal immune response at the mucosal surface of a vertebrate subject. Here, the adjuvant composition is co-administered to the subject,
The particulate vaccine composition is then delivered into or across the skin of the subject using transdermal delivery techniques and preferably a needleless syringe powder injection device.

In a preferred embodiment, the adjuvant composition comprises a combination of two or more adjuvants. In a particularly preferred embodiment, the adjuvant composition comprises
It contains an oligonucleotide containing cholera toxin and a CpG motif.

In another embodiment, the invention provides a particulate vaccine composition suitable for delivery into or across the skin of a vertebrate subject using transdermal delivery techniques. The composition comprises an antigen or a nucleic acid encoding the antigen, an ADP-ribosylating toxin as an adjuvant, and an oligonucleotide containing a CpG motif. In a preferred embodiment, the ADP ribosylating toxin is cholera toxin. These compositions find particular use as therapeutic agents or vaccines that can be administered to the skin but still provide mucosal immunity to pathogens that enter the body via mucosal surfaces. Preferably, the particulate vaccine composition is delivered using a needleless syringe powder injection device.

The present invention further includes a product as a combined preparation for simultaneous, sequential or separate use for generating a mucosal immune response at the mucosal surface of a vertebrate subject, which product Comprises: (i) an antigen, or a particulate vaccine composition comprising a nucleic acid encoding the antigen; and (ii) an adjuvant composition. Here, these compositions are delivered into or across the skin of a subject using transdermal delivery techniques.

Also provided herein is a needleless syringe powder injection device loaded (eg, containing) one of the vaccine compositions and / or adjuvant compositions of the present invention. Additionally, a suitable dosing container is provided for use in a needleless syringe powder injection device. This container contains one of the particulate vaccine compositions and / or adjuvant compositions of the present invention.

In yet another embodiment, the invention provides a method for treating or preventing a disease caused by the entry of a pathogen into a vertebrate subject's body via a mucosal surface. The method comprises delivering a particulate vaccine composition into or across the skin of a vertebrate subject in need of treatment or vaccination using transdermal delivery techniques, the vaccine composition comprising: Including an antigen, or a nucleic acid encoding an antigen, and then co-administering the adjuvant composition to the subject. The adjuvant composition comprises the ADP-ribosylating toxin, and co-administration of the vaccine and adjuvant composition is sufficient to result in a mucosal immune response specific for that antigen. The ADP ribosylating toxin is preferably cholera toxin.

The present invention also treats a disease caused by an antigen derived from or obtained from a pathogen that invades the body of a vertebrate via a mucosal surface, or a nucleic acid encoding the antigen, caused by the pathogen. Use in the manufacture of a particulate vaccine composition for prophylaxis. This treatment or prevention is by administering the vaccine composition to the subject in need of treatment or vaccination in an amount sufficient to effect a mucosal immune response at the subject's mucosal surface. In certain aspects,
The vaccine composition further comprises an oligonucleotide containing ADP-ribosylating toxin as an adjuvant and a CpG motif. In another aspect, the adjuvant composition is co-administered with a vaccine composition, wherein the adjuvant composition comprises ADP-ribosylating toxin, and the co-administration of the vaccine and adjuvant composition is administered to the subject. Sufficient at the mucosal surface to elicit a specific mucosal response for the antigen.

These and other embodiments of the present invention will be readily apparent to those of ordinary skill in the art in view of the disclosure herein.

Detailed Description of the Preferred Embodiments Before describing the invention in detail, the invention is not limited to the parameters of any particular pharmaceutical formulation or process, which, of course, will vary. It should be understood that you get. It should also be understood that the terminology used herein is for the purpose of describing only particular embodiments of the invention and is not intended to be limiting.

As used in this specification and the appended claims, the singular form “a”
It should be noted that ",""an" and "the" also include plural references unless the context clearly dictates otherwise. So, for example,
Reference to "a particle" also includes two or more particles and includes "an antigen" or "an adjuvant".
) ”Includes a mixture or combination of two or more such factors,
Reference to "an excipient" includes a mixture of two or more excipients, and so on.

A. Definitions Unless defined otherwise, all technical and scientific terms used herein are understood to be commonly understood by one of skill in the art to which this invention pertains. Have the same meaning. Although many methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the preferred materials and methods are described herein.

In describing the present invention, the following terms are used and are intended to be defined as indicated below.

As used herein, the term “transdermal delivery” includes intradermal (eg, into the dermis or epithelium) and transdermal (eg, “pecutaneous (pe)
rcutaneous) "(i.e., delivery by passage of factors through or through at least the upper layers of the skin). For example, see: Trans
normal Drug Delivery. Developmental
Issues and Research Initiatives, Had
Graft and Guy (eds.), Marcel Dekker,
Inc. , (1989); Controlled Drug Deliver.
ry: Fundamentals and Applications, R
Obinson and Lee (eds.), Marcel Dekke
r Inc. , (1987); and Transdermal Delive.
ry of Drugs, Vols. 1-3, Kydonieus an
d Berner (eds.), CRC Press, (1987). The term explicitly includes delivery of a particulate drug to a target tissue that provides a mucosal immune response, and specifically the delivery of that drug via powder injection techniques.

By “needleless syringe” is meant a device that can be used to perform powder injection techniques, and as used herein, via a particulate composition that does not use a conventional needle to pierce the skin. Used for dermal delivery. Such needleless syringes for use in the present invention are discussed in this document.

“Antigen” refers to any immunogenic portion or factor, generally a macromolecule, capable of eliciting an immunologically adapted sugar in an individual. The term refers to an individual macromolecule or a homogenous or heterogeneous population of antigenic macromolecules. The term "antigen" as used herein includes allergens. Thus, antigens include proteins, polypeptides, antigenic protein fragments, oligosaccharides, polysaccharides and the like. Furthermore, the antigen may be from any virus, bacterium, parasite, protozoan or fungus, and may be whole organism. Typically, antigens are derived from pathogens that enter the body via mucosal surfaces. The term also includes tumor antigens derived from tumors of mucosal tissues (eg, tumors of the esophagus, lungs, stomach, neck, etc.). Similarly, an oligonucleotide or polynucleotide which comprises an antigen (eg, DNA
Those that express (in immune applications) also fall within the definition of antigen. Synthetic antigens are also included (eg, polyepitopes, flanking epitopes, and other recombinantly or synthetically derived antigens; Bergmann et al. (1993) Eur.
． J. Immunol. 23: 2777-2781; Bergmann.
et al. (1996) J. Immunol. 157: 3242-3
249; Suhrbier, A .; (1997) Immunol. an
d Cell Biol. 75: 402-408; Gardner et a.
l. (1998) 12th World AIDS Conference
, Geneva, Switzerland, June 28-July 3, 1998).

The term “vaccine composition” intends any pharmaceutical composition containing an antigen. The composition can be used to prevent or treat a disease or condition in a subject. Thus, the term includes subunit vaccines (ie, vaccine compositions that include an antigen that is distinct and distinct from the whole organism with which it is naturally associated), as well as bacteria, viruses, parasites and other microorganisms. Both compositions comprising the entire killed attenuated or inactivated pathogen are included. The vaccine composition also comprises
It may include one or more adjuvants described herein. Vaccine compositions are typically used for the prevention of diseases caused by pathogens that enter the body via mucosal surfaces.

The term “mucosal surface” includes all external surfaces of the body that are protected by the secretion of mucus. Such mucosal surfaces include the gastrointestinal, respiratory and reproductive tract mucosa. Also included in this definition are the eye and the ureter. The skin is not a mucosal surface.

An “immunological response” or “immune response” to a selected factor, antigen or composition of interest is the humoral and / or humoral response to a molecule (eg, antigen) present in the factor or composition of interest. Or the development of a cellular immune response in the individual. For the purposes of the present invention, a "humoral immune response" refers to an immune response mediated by small polymorphic molecules, while a "cellular immune response" is mediated by T lymphocytes and / or other leukocytes. Immune response.

By “mucosal immune response” is meant the generation of immunity on the mucosal surface against an antigenic or infectious agent, either in the humoral or cellular context.
The generation of humoral immunity at the mucosal surface involves the secretion of antibodies into the mucus. Antibodies of the IgG subclass may be present in mucus. However, a sign of a mucosal immune response is the production of IgA antibodies. IgA is the major antibody subclass in mucosal secretions, where IgA functions to block microbial invasion from the external surface to the following tissues. By "antigen-specific IgA response" is meant the production of IgA antibodies directed against a specific antigen. Generating an antigen-specific immune response is an important part of generating a mucosal immune response.

The term “adjuvant” intends any material or composition capable of specifically or non-specifically altering, enhancing, directing, enhancing or initiating an antigen-specific immune response.
Thus, co-administration of an adjuvant and an antigen (eg, as a vaccine composition) may result in lower or lower doses of the antigen required to achieve mucosal immunity in the subject to which the antigen is administered. Adjuvant efficacy is determined by administration of the vaccine composition and adjuvant with the vaccine composition control to animals, as well as standard assays well known in the art (eg, radioimmunoassay, E.
Antibody titers to these two using LISA, CTL assay etc. and /
Alternatively, it can be determined by comparing cell-mediated immunity. Typically, in a vaccine composition, the adjuvant is a separate part of the antigen, but a single molecule may have both adjuvant and antigenic properties (eg, cholera toxin). For purposes of this invention, an adjuvant is used to enhance the immune response to a particular antigen (eg, when the adjuvant is co-administered with a vaccine composition, the mucosal immune response is administered without adjuvant. Or stronger than the immune response elicited by an equivalent amount of the vaccine composition), or the adjuvant is used to direct a mucosal immune response to an antigen administered to the skin. . Furthermore, for the purposes of the present invention, the adjuvant "
An "effective amount" enhances the immunological response to the co-administered antigen in the vaccine composition, so that lower or lower doses of that antigen are required to produce an efficient mucosal immune response. Is the amount.

By “adjuvant composition” is intended any pharmaceutical composition that includes an adjuvant. The adjuvant composition may be delivered in the present invention, but may also be delivered in any suitable pharmaceutical form such as a liquid, powder, cream, lotion, emulsion, gel, etc. However, a preferred adjuvant composition. The object is in a particulate form.

Similarly, an “effective amount” of an antigen or vaccine composition is an amount that stimulates an antigen-specific mucosal immune response in the subject to which the vaccine composition is administered. The immune response can be a humoral, cell-mediated and / or protective mucosal immune response. The mucosal immune response is preferably or includes an IgA response at the mucosal surface.

The term “co-administered” as used herein means, for example, when an adjuvant is “co-administered” with an antigen (eg, a vaccine composition), the adjuvant and antigen are co-administered or together. (Eg, the two are present in the same composition or are administered at about the same time but at different sites in separate compositions), as well as separate compositions at different times. It is intended to either deliver the adjuvant and the antigen therein. For example, the adjuvant composition may be delivered before or after delivery of the antigen at the same or different sites. The timing between the delivery of the adjuvant and the delivery of the antigen may range from minutes to hours, hours, days.

Particles containing an antigen or adjuvant are typically prepared as pharmaceutical compositions that may include one or more additional materials such as carriers, vehicles and / or excipients. "Carrier", "vehicle" and "excipient" generally refer to non-toxic and substantially inert materials that do not interact in a deleterious fashion with the other ingredients of the composition. These materials can be used to increase the amount of solids in the particulate composition. Examples of suitable carriers are water, silicone, gelatin,
Waxes and similar materials are included. Examples of commonly used "excipients" include pharmaceutical grade dextroses, sucrose, lactose, trehaloses, mannitol, sorbitol, inositol, dextran, starch,
Cellulose, sodium phosphate, calcium phosphate, calcium carpet carpet, calcium sulfate, sodium citrate, citric acid, tartaric acid, glycine, high molecular weight polyethylene glycol (PEG), and combinations thereof.

As used herein, the term “treatment” includes any of the following: prevention of infection or reinfection; reduction or elimination of symptoms; and reduction or complete elimination of pathogens. Treatment can be performed prophylactically (prior to infection).

The terms “individual” and “subject” are used interchangeably herein to refer to any member of the subphylum Vertebrate, including, without limitation, humans and other primates. (Non-human primates (eg, chimpanzees and other apes and monkey species);
Livestock animals (eg, cows, sheep, pigs, goats, and horses), domestic mammals (eg, dogs and cats); laboratory animals (rodents (eg, including mice, rats and guinea pigs)); birds ( Livestock, wild and sport birds (including, for example, chickens, turkeys and other pheasants, ducks, geese);
Includes fish. This term does not specify a particular age. Thus, both living and newborn individuals are intended to be covered. The methods described herein are intended for use in any of the above vertebrate species. This is because the immune system of all these vertebrates functions similarly.

General Method The antigens used in the present invention are derived from or obtained from a pathogen that preferably enters the vertebrate tissues through the surface of the mucosa. Alternatively, the antigen may be a synthetic antigen directed against a pathogen that enters the body through the surface of the mucosa or induces antibodies (particularly IgA antibodies) that are specific for this pathogen. The adjuvant or combination of adjuvants used in the invention preferably comprises or is derived from a bacterial exotoxin from the family of bacterial ADP-ribosylating exotoxins ("bARE"); and more preferably cholera. Contains or is derived from a toxin (CT). The antigen is administered to the target skin site and delivered in the form of particles (preferably through powder injection techniques). Similarly, the adjuvant (eg, in the form of particles, and preferably by powder injection techniques) is administered to the skin.

(Antigen) As a suitable viral antigen, an antigen derived from hepatitis virus or a polynucleotide sequence encoding this antigen (hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV) ), Hepatitis delta virus (HDV),
(Including, but not limited to, hepatitis E virus (HEV) and hepatitis G virus (HGV)). By way of example, the viral genome sequence of HCV is known and the method of obtaining this sequence is also known. For example, International Publication No. WO89 /
No. 04669; No. WO90 / 11089; and No. WO90 / 14436.
See issue. The HCV genome encodes a wide variety of viral proteins, including E1 and E2. For example, Houghton et al. (1991) Hepat.
Seeology 14: 381-388. The sequences encoding each of these proteins and their antigenic fragments find use in this method. Similarly, the coding sequence for the delta antigen from HDV is known (see, eg, US Pat. No. 5,378,814). Peptide / protein antigens encoded by these sequences are either known or readily obtainable.

Similarly, a wide variety of proteins from the herpesvirus family can be used as antigens in the present invention. Examples of these include herpes simplex virus (H
SV) type 1 and type 2 derived proteins (eg HSV-1 and HSV-2
Glycoproteins gB, gD and gH); Varicella zoster virus (VZV), Epstein-Barr virus (EBV) and cytomegalovirus (CMV) (CM
Antigens from VgB and gH); and antigens from other human herpesviruses such as HHV6 and HHV7 (eg, Chee et al. (19).
90) Cytomegalovirus (JK McDogal, edited, S.
pringer-Verlag, pages 125-169; McGeoch et al. (199).
8) J. Gen. Virol. 69: 1531-1574; U.S. Pat. No. 5,17.
1,568; Baer et al. (1984) Nature 310: 207-21.
1; and Davison et al. (1986) J. Am. Gen. Virol. 67:17
59-1816).

The human immunodeficiency virus (HIV) antigen (eg, gp12 of many HIV-1 and HIV-2 isolates, including members of various genetic subtypes of HIV).
0 molecules are known and reported (eg Myers et al., Los.
Alamos Database, Los Alamos National
Laboratory, Los Alamos, New Mexico (199
2); and Modrow et al., (1987) J. Am. Virol. 61: 570-5
78). And antigens derived from any of these isolates find use in the present invention. Furthermore, the present invention relates to other immunogenic proteins derived from any of various HIV isolates (such as any of various envelope proteins such as gp160 and gp41, ga 24 such as p24gag and p55gag).
g antigen and HIV pol, env, tat, vif, rev, nef, v
(including proteins derived from the pr, vpu, and LTR regions) as well.

Antigens derived from or obtained from other viruses will also find use in the claimed methods, examples of which are Picomaviridae (eg, poliovirus, rhinovirus, etc.); Caliciviridae; To.
gaviridae (eg, rubella virus, dengue virus, etc.); Fla
viviridae; Coronaviridae; Reoviridae (eg, rotavirus); Bimaviridae; Rhabodoviri
dae (for example, rabies virus); Orthomyxoviridae (
For example, influenza virus types A, B and C); Filovir
paramyxoviridae (eg, mumps virus, respiratory syncytial virus, parainfluenza virus, etc.); Bunyavirida
e; Arenaviridae; Retroviridae _{(e.g., HIV II Ib, HIV SF2,} HIV LAV, HIV LAI, including antigens derived from isolates of HIV _MN, but not limited to HTLV-I; HTLV-II; HIV-1 (HTLV −
III, LAV, ARV, hTLR, also known as _{such); HIV-1 CM23 S,} HIV-1 US4; HIV-2, in particular; simian immunodeficiency virus (STV);
Papilloma virus, tick-borne encephalitis virus; and the like, without limitation. For a description of these and other viruses, see, eg, Viro.
3rd edition (edited by W. K. Joklik, 1998); Fundamental
al Virology, 2nd edition (BN Fields and DM Kni.
pe, eds., 1991).

Preferably, the viral antigen used in the present invention typically enters the body through the mucosal surface, and the HIV (AIDS), influenza virus (Flu).
), Herpes simplex virus (genital infection, cold soar, STD), rotavirus (
Diarrhea), parainfluenza virus (respiratory infection), poliovirus (pancreatitis), RS virus (respiratory infection), measles virus and mumps virus (measles, mumps), Derived from viral pathogens known to cause or be associated with human disease, such as, but not limited to, rubella virus (rubella), as well as rhinovirus (common cold), or It derives from this.

Suitable bacterial and parasite antigens include (but are not limited to):
Obtained from or derived from known causative agents of the disease: diphtheria, pertussis, tetanus, tuberculosis, bacterial and fungal pneumonia, otitis media, gonorrhea, cholera, typhoid fever, meningitis, mononucleosis. , Pest, shigellosis or salmonellosis, legionella disease, Lyme disease, leprosy, malaria, hookworm, onchocerciasis, schistosomiasis,
Trypanosomiasis, Trypanosomiasis, Lemania
smaniasis), giardia, amebiasis, filariasis, borreliosis and trichinosis. Furthermore, the antigen is Kuru, Creutzfeldt-Jakob disease (
CJD), scrapie, mink infectious encephalopathy, and proteins derived from or derived from non-conventional viruses such as the causative agent of chronic wasting disease, or prions associated with mad cow disease. It may be obtained from or derived from infectious particles.

Preferably, the bacterial antigens used in the present invention are from, but are not limited to, the following: Obtained or derived from: Str
eptococcus (pneumonia, throat infection, otitis media), Haemophilus
influenza (otitis media), Moraxella cartarrhali
s (otitis media), Neisseria gonnorhoeae (gonorrhea), Vib
rio cholerae (cholera, diarrhea), Salmonella (enteric infection,
Diarrhea), Escherichia coli (enteric infection, genital infection), Shige
lla (bacterial dysentery), Mycobacterium tuberculosi
s (tuberculosis), Neisseria meningitidis (meningitis), My
coplasma pneumoniae (respiratory infection), and Chlamy
dia (pneumonia, genital infection).

Mucosal immunity is also important for vaccines or compositions for use in treating or preventing allergic conditions or disorders resulting from allergens inhaled or orally. In this regard, mucosal antibodies (IgA and / or IgG antibodies) may bind to and eliminate such allergens before they trigger an allergic condition. Accordingly, classes of allergens suitable for use in the present invention include, but are not limited to: pollen, animal dander, grass, mold, dust, antibiotics, harsh insect venom, and various environments. Allergens for chemicals (including chemicals and metals), drugs and foods. Common tree allergens include poplar, poplar, ash, birch, maple, oak, elm, hickory, and pecan pollen; common plant allergens include rye, ragweed, and plantain. , Pollen from sorrel and pigweed; allergens from contact with plants include oak venom, venom venom, and allergens from nettle; common herbal allergens Substances include timothy, johnson, bermuda, boletus and bluegrass allergens; common allergens also include alternaria, fusarium, hormondrum.
, Aspergillus, Micropolyspora, Mucor and fungi such as hyperthermophilic actinomycetes; penicillin and tetracycline are common antibiotic allergens; epidermal allergens are house dust or From organic dust (typically native to fungi), house dust mites (dermatphagoides pterosinyss)
can be obtained from insects such as is) or from animal sources such as feathers, cats and dander; milk and cheese, eggs, wheat, nuts as common food allergens (Eg peanuts), seafood (eg shellfish), peas, beans and gluten allergens; common environmental allergens include metals (nickel and gold), chemicals (formaldehyde, tritium). Nitrophenol and terpentine), latex, rubber, fiber (cotton or feather), burlap, hair dye, cosmetics, detergents and perfume allergens; common drug allergens induce local anesthesia Substances and salicylic acid allergens; Allergens of substances include penicillin and sulfonamide allergens; and common insect allergens include bee, wasp and ant venom, and cockroach calyx allergens. .. Particularly well-characterized allergens include, but are not limited to: the major and potential epitopes of Der p 1 allergens (Hoyne et al., (1
994) Immunology 83: 190-195, bee venom phospholipase A2 (PLA) (Akdis et al. (1996), J. Clin. Invest.
． 98: 1676-1683, Bet v, an allergen of birch pollen.
1 (Bauer et al., (1997) Clin. Exp. Immunol. 107.
: 536-541) and a multiple epitope recombinant grass allergy inducer KBG 8.3 (Cao et al., (1997) Immunology 90: 46-.
51). These and other suitable allergens are commercially available and / or can be readily prepared as extracts using known techniques below.

The antigen used in the present invention can be obtained or produced using various methods known to those skilled in the art. In particular, the antigen can be isolated directly from its natural source using standard purification techniques. Alternatively, the antigen may be produced recombinantly using known techniques. For example, Sambrook, Fritsch & Maniatis, Mo
regular Cloning: A Laboratory Manual,
See Volumes I, II, III, Second Edition (1989); DNA Cloning, Volumes I and II (Edited by DN Glover, 1985). The antigens used in the present invention can also be synthesized based on the amino acid sequences described, via chemical polymer synthesis, such as solid phase peptide synthesis. Such methods are known to those of skill in the art. For example, regarding solid phase peptide synthesis technology, see J. M. Stewar
t and J. D. Young, Solid Phase Peptide Sy
nthesis, 2nd edition, Pierce Chemical Co. , Rock
ford, IL (1984) and G.L. Barany and R.M. B. Merr
ifield, The Peptides: Analysis, Synthes
is, Biology, (editor) E. Gross and J.M. Meienhof
er, Volume 2, Academic Press, New York, (1980
), 3-254; and for classical solution synthesis, see M. et al. Bodansky
, Principles of Peptide Synthesis, Spr
inger-Verlag, Berlin (1984) and E. Gross
And J. Meienhofer, edited by The Peptides: Analy
See sis, Synthesis, Biology, supra, Volume 1.

If desired, the polynucleotide sequence encoding the above-mentioned antigen may be by recombinant methods (eg by screening cDNA and genomic libraries from cells expressing this gene or containing the same gene). By inducing this gene from a known vector). further,
This desired gene can be cloned using standard techniques such as phenol extraction and cDNA.
A or PCR of genomic DNA) can be used to directly isolate from cells and tissues containing the same gene. See, eg, Sambrook et al., Supra, for a description of the techniques used to obtain and isolate DNA as described above. Polynucleotide sequences may also be produced synthetically rather than cloned.

Another convenient method for isolating specific nucleic acid molecules also follows the polymerase chain reaction (PCR) (Mullis et al., (1987) Methods Enzy.
mol. 155: 335-350). This technique uses a DNA polymerase, usually a thermostable DNA polymerase, to replicate the desired region of DNA. The region of DNA to be replicated is determined by oligonucleotides of specific sequence complementary to the opposite ends and opposite strands of the desired DNA to prepare for the replication reaction.
The product of this first round of replication is itself the template for subsequent replication, and therefore repeated successive replication cycles, resulting in the geometry of the DNA fragment defined by the primer pair used. Cause a general amplification.

Once obtained, the polynucleotide sequence may be expressed in a mammalian, bacterial, yeast, or insect expression system to provide a suitable antigenic preparation, or itself as an antigenic nucleic acid composition. Can be used (eg, nucleic acid immunization techniques).

Whatever form the antigen is used (peptide, whole organism, nucleic acid), the antigen of interest will be formed in the composition on the particles as described herein. , And is generally administered to a subject with an adjuvant that either acts to enhance the mucosal immune response to the antigen or is directed to the mucosal immune response to the antigen. Thus, this particulate composition, delivered to the skin, surprisingly induces the development of a mucosal immune response at one or more mucosal surfaces. It is preferred that the particular transdermal delivery system used penetrate the stratum corneum, such as a powder injection system. The adjuvant is also preferably delivered to the skin by typical transdermal delivery methods that penetrate the stratum corneum. As mentioned above, the adjuvant is present in the same or separate composition as the antigen and can be delivered simultaneously with the antigen or vaccine composition, prior to antigen delivery, or after antigen delivery. Further, the adjuvant can be administered at the same or different sites.

Adjuvant The present invention can be effectively used with any adjuvant or combination of adjuvants. For example, suitable adjuvants include (without limitation) the following: an adjuvant formed with an aluminum salt (eg, aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc.). Oil-in-water and water-in-oil emulsion formulations such as complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA); lipopolysaccharides (eg Lipid A or monophosphoryl lipid A (MPL);
(Imoto et al., (1985) Tet. Lett. 26: 1545-1548).
), Trehalose dimycolate (TDM), and adjuvants formed from bacterial cell wall components such as those containing cell wall skeletons (CWS); heat shock proteins or their derivatives; ADP-ribosylating bacterial toxins (diphtheria toxin (
DT), pertussis toxin (PT), cholera toxin (CT), E. E. coli heat labile toxins (LT1 and LT2)), Pseudomonas endotoxin A, Ps
eudomonas endotoxin B, B. Cereus extra-enzyme, B. spha
ericus toxin, C.I. botulinum C2 and C3 toxins, C. lim
exosum enzyme, and C.I. perfringens, C.I. spirifor
ma, and C.I. difficile, Staphylococcus aur
eus EDIN-derived toxins, and ADP-ribosylating bacterial toxin variants such as CRM ₁₉₇ , adjuvants derived from non-diphtheria toxin variants (eg, Bix
Ler et al., (1989) Adv. Exp. Med. Biol. 251: 175;
And Constantino et al. (1992) Vaccine);
Saponin adjuvants such as Quil A (US Pat. No. 5,057,540) or particles produced from saponins such as TSCOM (immunostimulatory complex); interleukins (eg IL-1, IL-2, IL-4, IL-
5, IL-6, IL-7, IL-8, IL-12, etc.), interferon (eg, γ interferon), macrophage colony stimulating factor (M-CSF).
, Tumor necrosis factor (TNF), defensin 1 or 2, PANTES, MIP1
And chemokines and cytokines such as MIP-2; N-acetyl-muramyl-L-threonyl-isoglutamine (thr-MDP), N-acetyl-normuramyl- ^L -alanyl- ^D -isoglutamine (nor-). MDP),
N-acetylmuramyl- ^L -alanyl- ^D- isoglutamyl- ^L -alanine-2-
Muramyl peptides such as (1'-2'-dipalmitoyl-sn-glycero-3hydroxyphosphoryloxy) -ethylamine (MTP-PE); CpG family molecules, CpG dinucleotides and CpG motifs including:

[0050]

[Chemical 1] From the synthetic oligonucleotides of (eg, Krieg et al., N.
ature (1995) 374: 546, Medzitov et al. (1997) C.
urr. Opin. Immunol 9: 4-9, and David et al., J. Am. I
mmunol. (1998) 160: 870-876); PCPP (poly [di (
Carboxylatophenoxy) phosphazene] (Poly [di (carboxy
latophenoxy) phosphazene] (Payne et al., Vacc
ines (1998) 16: 92-98). Such an adjuvant is Acc
Urate Chemicals; Ribi Immunochemicals
, Hamilton, MT; GIBCO; Sigma, St. Louis, MO
Is commercially available from many agencies such as. Preferred adjuvants are those derived from ADP-ribosylated bacterial toxins, with cholera toxin and heat labile toxins being most preferred. Oligonucleotides containing a CpG motif are also preferred.

The adjuvants may be delivered individually or in a combination of two or more adjuvants. In this regard, the combined adjuvant may have an additional or synergistic effect in promoting a mucosal immune response. The synergistic effect is 2
One effect is that the results achieved by combining the above adjuvants are higher than would be expected by simply summing the results achieved with each adjuvant when administered individually. A preferred adjuvant combination is an adjuvant derived from an ADP-ribosylated bacterial toxin and a synthetic oligonucleotide containing a CpG motif. A particularly preferred combination is the cholera toxin and the oligonucleotide ATCGACTCTCGAGGCGTTCTC (SEQ ID NO: 2
)including.

Unfortunately, most of the above mentioned adjuvants are known to be very toxic, and are therefore generally considered too toxic for human use. It is for this reason that the only adjuvant currently approved for human use is alum (aluminum salt composition). Nevertheless, many of the above adjuvants are commonly used in animals and are therefore suitable for many intended subjects, and some have undergone preclinical and clinical studies for human use. ing. However, as discussed herein above, the adjuvant is preferably in particulate form for transdermal delivery using the powder injection method. Surprisingly, adjuvants, which are generally considered too toxic for use in humans, can be made into particulate form and can be administered using powder injection techniques without the attendant toxicity problems. Have been found. Without being bound by a particular theory, delivery of adjuvants to the skin using the transdermal delivery method (powder injection) results in the Langerhans cells in the epidermal layer and the skin (ski).
It is clear that n) allows interaction with dendritic cells in the cutaneous layer. These cells are important in initiating and maintaining the immune response. Thus, an enhanced adjuvant effect may be obtained by targeting delivery to or near such cells. further,
Transdermal delivery of adjuvants in the practice of the present invention may avoid toxicity problems for the following reasons: (1) The surface of the skin is less vaccinated, thus reducing the amount of adjuvant entering the systemic circulation, This reduces toxic effects; (2)
The skin cells are constantly exfoliated, so that the remaining adjuvant is not absorbed and removed; and (3) substantially less adjuvant can be administered to produce a suitable adjuvant effect (like intramuscular injection). Compared to adjuvants delivered using various conventional techniques).

Once selected, the one or more adjuvants may be provided in a pharmaceutical form suitable for parenteral delivery, the preparation of this form being well within the skill of the art. For example, Remington's Pharmaceutical Sciences
(1990) Mack Publishing Company, Easton
, Penn. , 18th Edition. Alternatively, the adjuvant is in particulate form, as described in detail below. The adjuvant produces the desired effect (ie, either to enhance the mucosal response to the co-administered antigen of interest and / or to direct the mucosal immune response to the antigen of interest).
In a pharmaceutical form in an amount sufficient to Generally, about 0.1 μg to 1000 μg of adjuvant, more preferably about 1 μg to 500 μg of adjuvant, and more preferably about 5 μg to 300 μg of adjuvant is effective to increase the immune response of a given antigen. Thus, for example, for CpG, about 0.5-50
Doses in the range of μg, preferably about 1-25 μg, and more preferably about 5-20 μg find use in the present methods. For cholera toxin, about 0.1 μg-5
0 μg, preferably about 1 μg to 25 μg, and more preferably about 5 μg to 1
Doses in the range of 5 μg find use herein. Similarly, for alum or PCPP, about 2.5 μg to 500 μg, preferably about 25 μg to about 25 μg.
Doses in the range of 250 μg, and more preferably in the range of about 50-150 μg find use herein. For MPL, doses in the range of about 1-250 μg, preferably about 20-150 μg, and more preferably about 40-75 μg find use in the present methods.

Doses for other adjuvants can be readily determined by one of ordinary skill in the art using conventional methods. The quantity to be administered depends on a number of factors, including the co-administered antigen and the ability of the adjuvant to act as a stimulator of the mucosal immune response.

Particulate Composition Once obtained, the antigen of interest (and one or more selected adjuvants) is
It can be formulated as a particulate composition. More specifically, the formulation of particles containing the antigen and / or adjuvant of interest can be carried out using standard pharmaceutical formulation chemistry or methodologies, all readily available to one of skill in the art. is there. For example, one or more antigens and / or adjuvants can be mixed with one or more pharmaceutically acceptable excipients or vehicles to provide an antigen, adjuvant, or vaccine composition. Auxiliary substances such as wetting or emulsifying agents, pH buffering substances and the like can be present in the vehicle or vehicle. These excipients, vehicles and auxiliary substances are usually pharmaceutical agents which themselves do not provoke an immune response in the individual receiving the composition and which can be administered without undue toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, polyethylene glycol, hyaluronic acid, glycerol and ethanol. Pharmaceutically acceptable salts include, for example, inorganic acid salts (eg, hydrochlorides, hydrobromides, phosphates, sulfates, etc.); and organic acid salts (eg, acetates). , Propionate, malonate, benzoate, etc.). Although not required, it is also preferred that the antigen composition also include a pharmaceutically acceptable carrier that acts as a stabilizer, particularly for peptides, proteins or other similar antigens. Examples of suitable carriers that also act as stabilizers for peptides include, without limitation, the following: pharmaceutical grade glucose, sucrose, lactose, trehalose, mannitol, sorbitol, inositol, dextran, and the like. Other suitable carriers also include, without limitation, starch, cellulose, sodium or calcium phosphate, citric acid, tartaric acid, glycine, high molecular weight polyethylene glycol (PEG), and combinations thereof. For a thorough discussion of pharmaceutically acceptable excipients, carriers, stabilizers and other adjunct materials, see REMINGT.
ON'S PHARMACEUTICAL SCIENCES (Mac Pu
b. Co. , N .; J. 1991), which is incorporated herein by reference.

The formulated composition comprises an amount of the antigen of interest sufficient to elicit an immune response as described above. An appropriate effective amount can be readily determined by one of ordinary skill in the art. Such an amount is usually in a relatively broad range of about 0.1 μg to 25 mg or more of the antigen of interest, and the particular appropriate amount can be determined by routine trials. The composition can include about 0.1% to about 99.9% antigen. If an adjuvant is included in the composition, or if the method for providing a particulate adjuvant composition is used, the adjuvant is present in a suitable amount as described above. The composition is then subjected to standard techniques, such as simple evaporation (air drying), vacuum drying, spray drying, freeze drying (lyophilization.
Lization)), spray lyophilization, spray coating, precipitation, supercritical fluid particle formation, etc.). If desired, the resulting particles can be densified using the techniques described in commonly owned International Publication No. WO 97/48485, which is incorporated herein by reference.

Single-dose or multi-dose containers, into which the particles prior to use may be packaged, containing a suitable antigen and / or a selected adjuvant (eg, vaccine composition) Mention may be made of hermetically sealed containers enclosing a quantity of particles. The particulate composition can be packaged as a sterile formulation, and hermetically sealed containers can then be designed to store the formulation sterilely until use in the methods of the invention. If desired, the container can be adapted for direct use in a needleless syringe system.

The container in which the particles are packaged can be further labeled to identify the composition and provide clear dosage information. In addition, the container may be labeled with a warning in the form prescribed by a government agency (eg, the Food and Drug Administration), where the warning may include the antigen, adjuvant (or adjuvant) contained within the container for human administration. Approval by this agency under federal law for the manufacture, use or sale of vaccine compositions).

The particulate composition (including the antigen of interest and / or the selected adjuvant) can then be administered using transdermal delivery techniques. Preferably, the particulate composition is prepared using a powder infusion method, for example, shared International Publication No. WO 94/24.
263, WO96 / 04974, WO96 / 12513 and WO96 / 200.
22 (all of which are incorporated herein by reference) delivered from a needleless syringe system. Delivery of particles from such needleless syringe systems is usually carried out with particles having an approximate size in the range of 0.1 to 250 μm, preferably in the range of about 10 to 70 μm. About 250
Particles larger than μm can also be delivered from the device, which has an upper limit at which the size of the particles causes annoying damage to skin cells. The actual distance that a delivered particle penetrates the target surface is determined by the particle size (eg, the nominal particle diameter that exhibits a roughly spherical particle geometry), the particle density, the initial velocity at which the particle impacts the surface, and the targeted size. It depends on the density and mechanical viscosity of the skin tissue.
In this regard, optimum particle densities for use in needleless injections are generally between about 0.1 g / cm ³ and 25 g / cm ³ , preferably about 0.9 g / cm ³ and 1.5.
The range is between g / cm ³ and the injection speed is generally about 100 m / sec and 3
In the range of between 1,000 m / s or more. With a suitable gas pressure, particles with an average diameter of 10-70 μm can be accelerated through the nozzle at a velocity approaching the supersonic velocity of the driving gas stream.

If desired, these needleless syringe systems may be provided pre-filled with an appropriate dose of particles containing the antigen of interest and / or the adjuvant of choice. The filled syringe can be packaged in a hermetically sealed container, which can be further labeled as described above.

Coated Particles Alternatively, if intracellular delivery is desired, the antigen and / or adjuvant may be coated onto suitable carrier particles such as gold or tungsten. Intracellular delivery is preferred when the antigen is provided in the form of nucleic acid.
Thus, in one embodiment of the invention, the antigen, polynucleotide encoding the antigen (eg, DNA vaccine) and / or adjuvant is delivered using carrier particles. Particle-mediated methods for delivering such vaccine preparations are known in the art. More particularly, once prepared and appropriately purified, the antigen, the nucleic acid molecule encoding the antigen and / or the adjuvant is
It can be coated onto carrier particles (eg, ballistic core carriers) using various techniques known in the art. Carrier particles are selected from materials that have suitable densities in the range of particle sizes typically used for intracellular delivery from gene gun devices. Of course, the optimum carrier particle size depends on the diameter of the target cells.

Any suitable carrier particles may be used, such as particles formed of polymers or metals such as tungsten, gold, platinum and iridium; however, tungsten and gold carrier particles are preferred. Tungsten particles are 0
． It is readily available in average sizes with diameters of 5-2.0 μm. Such particles have optimal densities for use in particle-mediated delivery methods, and DN
While allowing very effective coating with A, tungsten can be potentially toxic to certain cell types. Gold particles or microcrystalline gold (eg, gold powder A1570 (Engelhard Corp., East Newark,
(Available from NJ)) also finds use in this method. Gold particles provide uniform size (available from Alpha Chemicals in particle sizes of 1-3 μm, or 0 from Degussa, South Plainfield, NJ.
． Available in a particle size range including 95 μm) and reduce toxicity. Microcrystalline gold provides a variety of particle size distributions, typically in the 0.5-5 μm range. However, the irregular surface area of microcrystalline gold provides a highly efficient coating with nucleic acids, antibodies and adjuvants.

Many methods are known and have been described for coating or depositing DNA or RNA on gold or tungsten particles. Such a method generally involves adding a predetermined amount of gold or tungsten to plasmid DNA, Ca
Combine with Cl ₂ and spermidine. The resulting solution is vortexed continuously during the coating procedure to ensure homogeneity of the reaction mixture. After precipitation of the nucleic acids, the coated particles can be transferred to a suitable membrane and dried before use, coated on the surface of a sample module or cassette, or a delivery cassette for use in a particular gene gun device. Can be loaded into.

The peptide antigen and / or the adjuvant may be by simply mixing the two components in empirically determined ratios, by ammonium sulphate precipitation or other solvent precipitation methods familiar to those skilled in the art, or onto carrier particles. Can be attached to carrier particles by chemical bonding of the peptides of The attachment of L-cysteine residues to gold has been previously described (Brown et al. (1980) Chemical Society.
Reviews 9: 271-311). Other methods include, for example, dissolving the peptide antigen in absolute ethanol, water, or an alcohol / water mixture, adding this solution to large numbers of carrier particles, and then vortexing.
ng) while drying the mixture under a stream of air or nitrogen gas.
Alternatively, the peptide antigen can be dried on the carrier particles by centrifugation under reduced pressure. Once dried, the coated particles can be resuspended in a suitable solvent (eg, ethyl acetate or acetone) and ground (eg, by sonication) to yield a substantially uniform suspension. Provide liquid.

Following their formation, the carrier particles coated with the antigen and / or adjuvant preparation are delivered to the target skin site using particle-mediated delivery techniques. Various particle acceleration devices suitable for particle-mediated delivery are known in the art,
And all of these are suitable for use in the practice of the invention. Current device designs use explosive, electrical, or outgassing to propel coated carrier particles toward target cells. The coated carrier particles can themselves be releasably attached to a moveable carrier sheet, or can be removed to a surface along which a gas stream is lifted that lifts the particles from the surface or accelerates them towards a target. Can be attached. An example of a gas release device is
Described in US Pat. No. 5,204,253. Explosive devices are described in US Pat. No. 4,945,050. Helium emission type particle accelerator 1
One example is the PowderJect® XR instrument (PowderJect).
Vaccines, Inc. , Madison), WI,
It is described in US Pat. No. 5,120,657. Electroemissive devices suitable for use herein are described in US Pat. No. 5,149,655.
The disclosures of all these patents are incorporated herein by reference.

A single dose of coated carrier particles may be provided in a suitable container (eg provided in a single tubing containing the dose of particles coated on its inner surface). Methods for preparing such containers are described in commonly owned US Pat. Nos. 5,733,600 and 5,780,100 (
These disclosures are incorporated herein by reference).

The particle composition or coated particles are administered to an individual in a manner compatible with the dosage formulation and in an amount effective for the purposes of the invention. The amount of composition delivered (eg, about 0.1 μg to 1 mg, more preferably 1 to 50 μg of antigen or allergen) depends on the individual being tested and the particular antigen or allergen administered. The exact required amount will vary depending on the age and general condition of the individual being treated, and the appropriate effective amount can be readily determined by one of ordinary skill in the art upon reading the specification.

Administration and Dosing Schedules Antigens, adjuvants, or compositions containing antigens and / or adjuvants are administered to a subject in a manner compatible with the dosage formulation and in an amount effective to elicit the desired mucosal immune response. Is administered to. The amount of antigen delivered per dose is generally about 0.001 μg to 10 per dose for nucleic acid molecules encoding the antigen.
mg, and preferably in the range of about 0.01-5000 μg of a nucleic acid molecule (generally
0.5 μg / kg to 100 μg / kg of nucleic acid molecule per dose), and about 1 μg for an antigen molecule (eg, peptide, carbohydrate, or whole organism).
g to 20 mg, and preferably about 1 μg to 5 mg, and more preferably about 10 μg to 3 mg. The precise amount will, of course, depend both on the subject and the condition being treated or prevented. More specifically, the exact required amount may vary depending on the age and general condition of the individual, and the particular antigen and adjuvant selected and other factors. An appropriate effective amount can be readily determined by one of ordinary skill in the art upon reading the specification and / or can be determined by routine trial.

For powder injection, transdermal delivery was performed with particles having an approximate size in the range of approximately 0.1-250 μm. However, the optimum particle size is usually at least about 10-15 μm (typical cell size). Particles larger than about 250 μm, with an upper limit where the size of the particles is a value that causes harmful damage to the skin, can also be delivered from the device. Other particulate biopharmaceuticals (eg, peptide and protein preparations) generally have an approximate size of 0.1 to about 250 μm, preferably about 0.1 to about 150 μm, and most preferably about 20 to about 60 μm. Have. The actual distance that a delivered particle penetrates is determined by the particle size (eg, the nominal particle diameter considered as a roughly spherical particle outline), particle density, initial velocity at which the particle strikes the surface, and the targeted skin tissue's Depends on density and kinematic viscosity. In this regard, the optimum particle density for use in needleless injections is generally between about 0.1 g / cm ³ and 25 g / cm ³ , and the optimum bulk density is about 0.5-3.0 g / cm ^3. It is in the range of cm ³ . Injection speeds generally range between about 100 m / sec and 3,000 m / sec.

If desired, an adjuvant or composition comprising an adjuvant is typically an injectable substance, either a liquid solution or suspension, or a solution or suspension in a liquid vehicle prior to injection. Can be prepared as a solid form suitable for. Adjuvants can also be emulsified, or even encapsulated, for example, in liposomal vehicles. Adjuvant compositions suitable for topical administration may also be prepared in the form of, for example, pharmaceutically acceptable topical vehicles such as ointments, emulsions, gels and creams or lotions. Other suitable pharmaceutical forms and modes of administration will be readily apparent to those of skill in the art upon reading this specification.

Dosing treatment can be a single dose schedule or a multiple dose schedule. For vaccine compositions, a multi-dose schedule is one where the initial course of vaccination is 1-
There may be 10 separate doses, then the other dose is followed by a time interval (selected to maintain and enhance the immune response, eg 1 to 4 months for the second dose, and if necessary). , Subsequent doses will be given several months later). This dosing regimen will also be determined, at least in part, by the subject's needs and will depend on the judgment of the practitioner. Moreover, if prevention of disease is desired, the composition is generally administered prior to primary infection with the pathogen of interest. If treatment (eg, reduction of symptoms or recurrence) is desired, the composition will generally be administered following primary infection.

C. Examples The following are examples of specific embodiments for carrying out the present invention. These examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any manner.

Efforts have been made to ensure accuracy with respect to numbers used (eg amounts, temperature, etc.) but some experimental errors and deviations should, of course, be allowed for.

General Materials and Methods Vaccine Formulation: The vaccine may be formulated in powder form using a number of particle forming processes. The excipient (eg, trehalose, sucrose, agarose, mannitol, or a mixture of sugar excipients) preferably has stabilized (for antigen and / or adjuvant) and enhanced particle properties (eg, enhanced hardness). , Density). Standard particle preparation processes include air drying, freeze drying, spray coating, spray drying, spray freeze drying, and supercritical fluid technology.

The following is an example of air drying a vaccine composition. First, an antigen (eg, diphtheria toxoid, influenza vaccine, etc.) is combined with an adjuvant (eg, cholera toxin, synthetic oligonucleotide containing a CpG motif, etc.) and then mixed with trehalose / water solution. The solution was mixed gently, poured into a glass Petri dish and air dried under a fume hood for 2 days, after which it was further dried in a desiccator (Nalgene® plastic dessicator),
Then the day was again purged with N ₂ gas. Dried solids were collected by scraping and ground with a mortar and pestle. Finally, the dry powder was weighed and the amount of dry material for each dose was determined by dividing the total weight by the number of doses prescribed. The particle size distribution of the re-formulated vaccine composition was measured and particles in a wide size range (eg 1-100 mm) were used. The appropriate amount of powdered vaccine composition was measured using a balance and loaded into the particle cassette. Each dose typically required about 1-2 mg dry weight. The variation in weighing was 10% or less.

Devices: Powder injection technology has been previously described (eg, Bellhouse).
(See US Pat. No. 5,899,880 to et al.), Using a helium powered PowderJect® ND powder injection device (needleless syringe). The powder injection device used to perform this study was Powder
erJect Vaccines, Inc (Madison, WI), a reusable research model. The device is about 15 cm long and comprises an actuation button, a helium gas chamber, a vaccine cassette (containing the particular vaccine composition), a nozzle, and a silencer. In use, the stainless steel gas chamber is filled with about 5 ml of medical helium gas to a pressure of 50 bar. Upon actuation, the released helium gas ruptures the membrane of the trilaminate cassette and accelerates the vaccine particles to a sufficiently fast rate to cause the particles to pierce the stratum corneum and deliver to the epidermis. This helium gas reflects on the skin and is exhausted through a vented silencer. The depth of particle penetration depends on the powder formulation, particle size, gas pressure, and device mechanics. All of these parameters are different thickness strat
It can be experimentally optimized to deliver the powder via the um corneum.

Mice and Vaccines: Female Balb / C mice or Swiss Webs
Ter mice (7 weeks old) were purchased from HSD and acclimated for 1 week at the mouse facility prior to vaccination. Mice were mixed with 10 mg / kg xylazine 1
Anesthesia was performed by intraperitoneal injection of 00 mg / kg of ketamine, and abdominal skin was shaved. The powder injection device was gently pressed onto the vaccination site and activated. A typical immunization regimen consisted of two vaccinations, 4 weeks apart, with blood collection by orbital bleeding under anesthesia before each vaccination and 2 weeks after the booster immunization. For the transdermal immunization (TCI) procedure, the abdominal skin of anesthetized mice is shaved and the liquid vaccine composition is applied to the shaved area,
Then, it was left for 1 hour before being rinsed with warm tap water.

ELISA: antibody response to various vaccine compositions, standard ELISA
Determined by the procedure. More specifically, 96-well plates were coated with 0.1 μg (diphtheria toxoid) or 1 μg (influenza) of the antigen to be detected in PBS and kept overnight at 4 ° C. Plate with 0.1% Brij-35
Was washed 3 times with TBS containing 1% BSA (diphtheria toxoid) or 5% nonfat dry milk (influenza) and incubated with test serum diluted in PBS for 1.5 hours. Standard sera containing high levels of antibodies to specific antigens were added to each plate and used to normalize titers in the final data analysis. The plate is then washed and mouse immunoglobulin I
Biotin-labeled goat antibody specific to gG or IgG subclass (1: 8 in PBS)
, 000, Southern Biotechnology) at room temperature for 1
Incubated for hours. After three additional washes, the ELISA plate was washed with streptavidin-horseradish peroxidase conjugate (1: 8,000 in PBS).
, Southern Biotechnology) at room temperature for 1 hour. Finally, the plate is washed and the TMB substrate kit (Bio-R
color was developed using a kit manufactured by Ad, Richmond, CA. The endpoint titer of the test sera was defined as the highest dilution corrected with A ₄₅₀ above 0.1 mean background,
Softmax Pro 4.1 Program (Molecular Device)
es). Mean background absorbance was determined in wells containing all reagents except test serum.

Example 1 Induction of Immune Response to Diphtheria Toxoid by Cutaneous Immunization To determine whether powder injection delivery of a vaccine composition to the skin induces a mucosal antibody response, the following study was conducted. It was 5 μg diphtheria toxoid and 10 μg cholera toxin were combined with trehalose excipients and formulated into a powdered vaccine composition as described above. The powdered vaccine composition was then delivered via powder injection to immunize Balb / C mice. Immunizations were performed on study days 0 and 28. Serum and saliva were collected on day 42. The titer of diphtheria toxoid-specific antibody was then determined in an ELISA procedure.

In addition to the induction of antigen-specific serum IgG titers (data not shown), powder injection of diphtheria toxoid into the skin resulted in Ig to diphtheria toxoid in saliva.
G (FIG. 1A) and IgA (FIG. 1B) antibodies were induced. Conventional needle and syringe injections into deeper tissues (e.g. muscle) usually elicit IgA in saliva, in contrast to epidermal powder injection immunizations of the invention, which may elicit a mucosal (IgA antibody) response.
It is known not to induce antibodies.

Example 2 Comparison of Mucosal Antibody Responses Obtained by either Powder Injection or TCI Administration Procedures Mucosal Antibody Responses of Vaccine Compositions When Delivered to the Skin by either Powder Injection or TCI Administration The following studies were performed to compare the ability to provoke. Vaccine composition in either particle (for powder injection) or liquid form (TC
5) in combination with 5 μg of cholera toxin.
Included μg diphtheria toxoid. This composition was used to immunize Balb / C mice by either method. Here, immunizations were performed at 0 and 4 weeks of the study. Serum and mucosal tissue samples were collected at 6 weeks. Mucosal tissue samples (trachea, lungs, vagina, small intestine, Peyer's patches, and mesenteric lymph nodes) were cultured in vitro for 7 days. EL the tissue culture supernatant and serum for antigen-specific response
Assayed by ISA.

The results of the study are shown in Figures 2-4. First, as can be seen in FIG. 2, powder injection elicited high levels of serum IgG antibodies against both diphtheria toxoid and cholera toxin, whereas TCI administration of the same vaccine composition resulted in cholera toxin only. Elicited only moderate levels of serum IgG against and no detectable IgG antibody against co-administered diphtheria toxoid (FIG. 2).

Furthermore, as shown in FIG. 3, high levels of IgG antibody were consistently found in mucosal tissue culture supernatants isolated from mice immunized via powder injection. These antibodies appear to have been produced by antibody-secreting cells present in mucosal tissue samples during 7 days of in vitro culture (all serum antibodies were incubated in large amounts with buffer and culture medium prior to initiation of culture). Removed by washing). In contrast, TCI immunization of mice with the same vaccine composition did not induce detectable antibody in cultured mucosal tissues (Figure 3). These data demonstrate that powder injection of the vaccine composition into the skin successfully produces the key steps of producing antigen-specific antibody-secreting cells present in disseminated mucosal tissues and generating a mucosal immune response to the antigen of interest. Suggest that. These data also suggest that powder injection may be used to provide a successful immune status in a subject with doses of antigen and adjuvant that do not work with TCI.

Finally, the successful induction of mucosal immunity by powder injection into the skin is also shown by examining antibodies in mucosal secretions. Here, referring to FIG. 4, powder injection (not TCI administration) was found to induce high levels of IgG response in nasal endocrine of immunized mice (FIG. 4). It is well tolerated here that parenteral injections (eg, intraperitoneal injection (IP) control in this study) do not generate antibody responses in the nasal mucosa. Presence of elevated IgG in nasal secretion (
Found only on powder injections) is an indicator of a successful mucosal immune response. In addition, high levels of IgG antibodies were also found in vaginal secretion samples, lung lavage samples, and fecal samples of mice immunized via powder injection into the skin.

Example 3 Induction of Mucosal Immune Response to Influenza Virus by Cutaneous Immunization In order to establish that powder injection of the vaccine composition to the skin can elicit a mucosal immune response to other antigens, Researched. Inactivated influenza vaccine was obtained from a commercial supplier. Inactivated influenza vaccine is 8
Since it is a particle of 0-120 nm, TCI is a stratum corneum.
Due to their relative impermeability, such vaccines are unlikely to be delivered to intact skin.

More specifically, 5 μg of inactivated influenza virus (strain Aichi / 68
, H3N2) was formulated as either a powder or liquid vaccine (each composition additionally containing 5 μg of cholera toxin adjuvant). This vaccine composition was administered to Balb / C mice by either powder injection or TCI administration. Immunizations were performed at 0 and 4 weeks of the study. Mucosal secretions were collected at 6 weeks of antibody analysis. Mucosal tissue fragment samples were collected at 6 weeks for in vitro culture and antibody analysis.

The results of the study are shown in Figures 5-7. First, we found that powder injection delivery of a vaccine composition (cholera toxin (CT) formulated with influenza virus) elicited an influenza-specific IgA response in the trachea based on an in vitro tissue culture assay (Figure 5). Moreover, cholera toxin adjuvant enhances mucosal IgA responses in mice immunized by powder injection (see Figure 5 for comparison between powder injection of influenza alone and influenza formulated with CT). . TCI administration with influenza alone or in combination with cholera toxin adjuvant failed to induce a detectable IgA response to influenza in this assay.

Referring to FIG. 7, when nasal secretions were tested, EL was raised in mice vaccinated with elevated IgG antibodies against influenza virus via powder injection.
It was detected by ISA. Here again, the cholera toxin adjuvant appears to have enhanced the antibody response (see Figure 6 for a comparison between powder injections of influenza alone and influenza formulated with CT). TCI administration of influenza alone or in combination with CT adjuvant
It failed to elicit a detectable antibody response (Figure 7).

Finally, referring to FIG. 6, it was also found that powder injection of the particulate vaccine composition elicits an influenza-specific IgG antibody response in a variety of different mucosal tissues based on a tissue fragment culture assay. This mucosal immune response was enhanced by formulating an influenza vaccine with a cholera toxin adjuvant (see Figure 7 for a comparison between powder injections of influenza alone and influenza formulated with CT). thing).

Example 4 Induction of Mucosal Immune Response to Influenza Virus by Skin Immunization Mucosal immunization using an adjuvant other than CT adjuvant when delivered to the skin via powder injection technology. The following studies were conducted to determine if a response could be induced. The second objective of this study was whether the combination of CpG and CT adjuvants acted in a synergistic or additive manner to induce mucosal responses when administered to the skin via powder injection techniques. Was to find out.

The PR8 strain of inactivated influenza virus was used as the antigen of interest in this study. 5 μg of inactivated influenza virus (strain PR8 / 38, H1
N1) with 5 μg CT adjuvant (with or without 10 μg CpG DNA) or 10 μg CpG DNA (CpG sequence: ATCGAC
TCTCGAGCGTTCTC (SEQ ID NO: 2)) and was formulated as a particulate (powder) composition. These vaccine compositions were administered to Balb / C mice using a powder injection device. Immunizations were performed at 0 and 4 weeks of this study. Mucosal secretions and serum samples were collected at 6 weeks and then used for antibody analysis. Mucosal tissue fragments for in vitro culture and antibody analysis 6
Collected in the week.

The results of this study are shown in FIGS. Referring now to Figures 8A-8D, CT
The influenza vaccine composition formulated with an adjuvant showed secretory IgA antibody response in nasal wash (FIG. 8A), saliva (FIG. 8B), vaginal wash (FIG. 8C) and fecal extract (FIG. 8D) after powder injection into the skin. Provided. This is consistent with the results obtained in Example 3 above. In addition, a vaccine composition containing a CpG adjuvant also elicited a mucosal response to this influenza vaccine (Fig. 8A-).
8D). However, clearly these data show that the combination of CpG and CT adjuvant provides a synergistic effect, ie this combination produces secreted Ig.
We demonstrate that it is more potent in inducing an A response than either adjuvant alone (FIGS. 8A-8D). The combination of CT and CpG adjuvant is
Consistently high levels of IgA titers were provided in all mucosal secretions measured (nasal, saliva, vaginal and fecal).

As can be seen in FIG. 9, IgA antibodies were also tested for in vitro cultured mucosal tissue samples (trachea, vagina, lung) obtained from mice that received vaccine compositions containing either CT or CpG adjuvant. , Peyer's patches and small intestine). However, consistent with the results reported above, the combination of CT and CpG adjuvants gave higher I than either of these adjuvants alone.
Inducing gA production and higher than expected IgA production by simply adding the strengths of the adjuvant effects when these adjuvants were administered individually. These data indicate that powder injection of the particulate influenza vaccine composition into the skin elicits a disseminated mucosal immune response, and further that the CpG / CT adjuvant combination synergizes in promoting a mucosal immune response. To act in a physical manner.

Finally, IgG titers from fecal extracts, saliva and mucosal tissue cultures were also measured (see results reported in Figures 10A-10C). Elevated IgG titers were seen in these mucosal samples when using CT or CpG adjuvant, and the combination of the adjuvants was also more potent than either alone in promoting the mucosal IgG response to the influenza vaccine. It was powerful.

Example 5 Induction of Mucosal Immune Response to Influenza Antigen by Cutaneous Immunization The following studies were conducted to evaluate many problems. First, the ability to induce anti-influenza mucosal immunity via dermal administration (as shown in the examples above)
This study was performed to confirm that it was not strain-specific. In addition, the effect of the combination of CpG and Ct adjuvant on the ability to induce a mucosal response when administered to the skin via powder injection was reassessed.

Influenza vaccine products were obtained from commercial sources (Swiss Se).
strain A / Syd from the Rum Institute, Switzerland
ney / 5197 (H3N2) influenza subunit vaccine product).
A 1/10 dose of the human influenza vaccine product (corresponding to 1.5 μg HA antigen) was combined with trehalose vehicle and as such or 10 μg C
In combination with T adjuvant or 5 μg CT adjuvant and 10
μg of CpG DNA (CpG sequence; ATCGACTCTCGAGCGTTCT
C (SEQ ID NO: 2)) or either, and was formulated as particles. These particulate vaccine compositions were administered to Balb / C mice (8 mice / group) using a powder injection device. Immunizations were performed at week 0, and blood serum samples were collected at week 4 of the study, immediately after which mouse adaptation A was administered by intranasal delivery.
The ichi / 68 (H3N2) influenza virus was challenged at 4 weeks with 10 × LD ₅₀ . Control mice received no vaccine composition. Influenza-specific IgG titers were then measured in the ELISA procedure described above.

The results of this study are shown in Figures 11-12. With respect to FIG. 11, antibody (IgG) response was measured by ELISA using serum samples 4 weeks post vaccination. As can be seen, immunization with a composition containing both CT and CpG adjuvant provided higher IgG titers. Referring now to FIG. 12, the ability of various vaccine compositions to protect these immunized mice against challenge with a heterologous influenza virus is graphically displayed. As you can see,
Vaccine compositions containing a 1/10 dose of the A / Sydney strain human vaccine with either CT adjuvant or a combination of CT and CpG adjuvants had full protection (100% survival) over the 21 day monitoring period of this challenge study. ) Provided. These studies show that 100% mortality seen in the untreated control group and 1/10 dose of adjuvant-free A / S
This was in contrast to the 60% mortality seen in mice receiving the ydney strain human vaccine. The vaccine composition of the invention provided protection against mucosal exposure to this challenge virus after administration to the skin via a needleless powder injection.

Example 6 Comparison of Cholera Toxin Toxicity When Administered by Different Routes Cholera toxin (CT) is one of the most potent immunogens identified to date, which is Induces a strong mucosal response when used in the method of the invention.
A range of doses when administered directly to mucosal tissues (intranasal application of liquid CT) or to the skin in particulate form via needle-free powder injection (via PowderJect® ND powder injection device) The following studies were performed to assess the relative toxicity of C.T. More specifically, the following doses of CT were administered to a group of 8 Balb / c mice by powder injection or intranasal application: 1 μ
g, 5 μg, 10 μg, 20 μg and 50 μg. The results of this study are shown in Table 1 below.
Shown in. As can be seen, for powder injection into the skin, the highest dose (50 μg
CT) did not show any signs of toxicity, but when administered directly to the nasal mucosa, 10 μg CT resulted in 100% mortality. These results demonstrate that adjuvant toxicity can be avoided by administering the vaccine composition to the skin by needle-free powder injection.

[0099]

[Table 1] (Example 7) (Detection of influenza-specific IgA-secreting cells in mucosal tissue after skin immunization) Antigen-specific I present in mucosal tissue of mice immunized via powder injection into skin
The following studies were performed to quantify the number of gA secreting cells. The PR8 strain of inactivated influenza virus was used as the antigen for the purpose of this study. 5 μg of inactivated influenza virus (strain PR8 / 38, H1N1) was added to 10 μg of CT adjuvant and 10 μg of CpG DNA (CpG sequence: ATCGACTCTC).
GAGCGTTCTC (SEQ ID NO: 2)) and was formulated as a particulate (powder) composition. This powdered vaccine composition was administered to an experimental group of 8 Balb / C mice using a powder injection device. Immunizations were performed on days 0 and 28 of this study.

Two control groups were also established. 5μ for control vaccine
g of inactivated influenza virus (strain PR8 / 38, H1N1)
CT adjuvant and 10 μg of CpG DNA (CpG sequence: ATCGA
CTCTCGAGCGTTCTC (SEQ ID NO: 2)) and then mixed with phosphate buffered saline (PBS) to provide a liquid composition. The liquid vaccine composition was administered to a first control group of 8 Balb / C mice using a conventional needle and syringe to deliver the vaccine subcutaneously (SC). This liquid vaccine composition was also administered intranasally to a second control group of 8 Balb / C mice. Immunizations were performed on days 0 and 28 of the study, similar to the experimental group.

Two weeks after the second immunization (ie day 42 of the study), mucosal tissue samples (trachea, small intestine, lung tissue and Peyer's patches) were collected from each group of mice and samples were collected. , Pooled separately for use in either a fragment culture assay to assess mucosal antibody production or an ELISPOT assay to assess influenza-specific IgA secreting cells. More specifically, small pieces of trachea and small intestine are collected and calcium and magnesium free Hanks balanced salt solution ("HBSS", GIBCO-BRL) containing 0.1% gelatin.
, Grand Island, NY). Finally, these tissue fragments were washed with complete RPMI medium and 90% O ₂ and 10%
24-well flat bottom tissue culture plates (COST, 37 ° C, CO _{2 for} 7 days).
AR). This culture medium contains 10% fetal bovine serum, 1% L-glutamine, 0.01% gelatin and 1% antibiotic-antimycotic solution, Kennett HY medium (JRH BioSciences,
Zlenexa, KS). Influenza-specific antibodies in tissue culture supernatants were assayed using an ELISA (data not shown).

In the IgA ELISPOT, this assay was performed using single cell suspensions prepared from lungs and Peyer's patches of immunized mice. To prepare these single cell suspensions, lungs were collected and Dipase solution (1.
5 mg / ml, Boehringer Mannheim Biochemical
als, Indianapolis, IN) for 2 hours with continuous stirring. Peyer's patches were collected and separated using fine forceps (tease).
d apart). These fractionated mixtures were then passed through a 70 μm sterile cell strainer (Fisher Scientific, Pittsburgh, P.
Single cell suspension was obtained by passage through A). These cells were then washed extensively with HBSS without calcium and magnesium, then in RPMI medium containing 10% fetal bovine serum, 1% L-glutamine and 1% antibiotic-antimycotic solution. Resuspended.

This ELISPOT assay was performed on 96-well nitrocellulose plates (Mi
Lilisscreen, Millipore). These plates,
10 μg / ml formalin in 0.1 M bicarbonate buffer (pH 9.5)
Coated with inactivated PR8 influenza virus. Plates were blocked with 10% RPMI for 1 hour at room temperature. After washing, 100 μl of various concentrations of lymphocyte suspensions from mucosal tissue were placed in each well and the plates were placed in 5% C
Incubated overnight at 37 ° C. under O ₂ . The plates were then washed 5 times with PBS and 100 μl of goat anti-mouse IgA alkaline phosphatase conjugate (Southern Biotehcnologi) diluted appropriately in PBS.
es) was added to each well, then the plates were incubated for 4 hours at room temperature. The plate was then washed 5 times with PBS (0.05% Tween-80). The plate is then placed in an alkaline phosphatase substrate kit (Bio-
Color was developed using Rad Laboratories, Melville, NY). Spots were placed on an Olympus® dissecting microscope (Leeds P).
resolution Instruments, Inc. , Minneapolis
s, MN) and quantified by counting spots.

The results of the ELISPOT assay are shown in FIG. As you can see, CT
Percutaneous powder injection of mice using the PR8 vaccine composition adjuvanted with CpG and CpG resulted in frequencies of 200 and 542 Peyer's patches and IgA-forming spots from lung mucosal tissue per million cells, respectively. Induced. Mice that received the same vaccine composition directly on mucosal tissue (intranasal delivery) had only a slightly higher frequency (ie, 100 from Peyer's patches and lung tissue samples, respectively).
266 and 783 per million cells). These results are in contrast to the results seen in mice that received the same vaccine via subcutaneous injection, in which influenza-specific IgA secreting cells were not detectable in this assay. The data show that administration of the powdered composition of the invention to the skin induces a strong mucosal immune response, which is substantially equivalent to the immune response obtained with the direct mucosal immunization technique (intranasal). , Prove corroboratively.

Accordingly, novel vaccine compositions and methods for inducing a mucosal immune response are disclosed.
While the preferred embodiments of the invention have been described in some detail, obvious changes are
It is understood that modifications can be made without departing from the spirit and scope of the invention as defined by the appended claims.

[Brief description of drawings]

1A and 1B illustrate the mucosal antibody response produced by the diphtheria toxoid vaccine composition delivered by the powder injection technique. Mice were formulated with 5 μg of cholera toxin and were dosed with two 5 μg doses of diphtheria toxoid.
Vaccinations were carried out on weeks 1 and 4. FIG. 1A shows E from individual mice at 6 weeks.
The IgG titers in saliva as determined by LISA are shown, and FIG. 1B shows the IgA titers.

FIG. 2 compares serum antibody responses elicited by diphtheria toxoid vaccine compositions delivered via either the powder injection technique or the TCI delivery technique. Mice were vaccinated at 0 and 4 weeks with two 5 μg doses of diphtheria toxoid formulated with 5 μg cholera toxin. Serum IgG titers determined by ELISA in sera pooled from 8 mice at 6 weeks are shown. Abbreviations DT (diphtheria toxoid); CT (cholera toxin); TCI (transdermal immunity); PowerJect: (transdermal powder injection).

FIG. 3 compares mucosal responses elicited by diphtheria toxoid vaccine compositions via either powder injection or TCI delivery techniques. Mouse 5μ
Vaccinated at 0 and 4 weeks with two 5 μg doses of diphtheria toxoid formulated with g cholera toxin. Tissue fragments were harvested at 6 weeks and cultured in vitro for 7 days. Tissue culture supernatants were assayed by ELISA for antibodies to diphtheria toxoid. Mean IgG levels from 8 mice are shown. Abbreviations: PP (Peyer's patch); MLN (mesenteric lymph node)
CT; cholera toxin; DT (diphtheria toxoid); PJ (transdermal powder injection)
TCI (transdermal immunity).

FIG. 4 compares levels of IgG antibody in nasal secretions produced in response to diphtheria toxoid vaccine compositions delivered via: (1) powder injection technique, (2) By TCI delivery technique or intraperitoneal injection via conventional needle and syringe. Two 5 μg mice were formulated with 5 μg cholera toxin
Vaccination with diphtheria toxoid at doses of 0 and 4 weeks. Nasal secretions were collected at 6 weeks and assayed by ELISA for antibodies to diphtheria toxoid. IgG titers in 4 individual animals are shown. Abbreviations:
IP (intraperitoneal injection with needle); TCI (transdermal immunity) PowderJect (transdermal powder injection).

FIG. 5 is produced after delivery of an influenza vaccine composition, either with or without cholera toxin adjuvant, delivered via powder injection or TCI of influenza vaccine (tracheal). Compare the levels of IgA antibodies against influenza vaccine (present in the culture supernatant). Mice were vaccinated at weeks 0 and 4 with a dose of 5 μg influenza vaccine. Trachea were harvested at 6 weeks and cultured in vitro for 7 days. Culture supernatant IgA
Antibodies were measured by ELISA. IgA titers from 6 individual animals for each immunization schedule are shown. Abbreviation: Flu (influenza vaccine); CT
(Cholera toxin); PJ (transdermal powder injection); TCI (transdermal immunity).

FIG. 6 is an IgG antibody to influenza vaccine produced after administration of an influenza vaccine composition (either with or without cholera toxin adjuvant) delivered via powder injection or TCI. Compare levels (in nasal secretions). Mice were vaccinated at weeks 0 and 4 with a dose of 5 μg influenza vaccine. Nasal secretions were collected at 6 weeks for antibody assay in ELISA. Mean IgG antibody titers from 6 animals are shown. Abbreviation:
Flu (influenza vaccine); CT (cholera toxin); PJ (transdermal powder injection); TCI (transdermal immunity); SI (small intestine); PP (Peyer's patch); MLN (mesenteric lymph node).

FIG. 7: IgG antibody to influenza vaccine produced after administration of influenza vaccine composition (with or without cholera toxin adjuvant) delivered by powder injection or TCI (on mucosal tissue culture). Kiyonaka) levels. Mice were vaccinated at weeks 0 and 4 with a dose of 5 μg influenza vaccine. Mucosal tissues were harvested at 6 weeks and cultured in vitro for 7 days. The IgG antibody in the culture supernatant was measured by ELISA. IgG titers from 6 individual animals are shown. Abbreviations: Flu (influenza vaccine); CT (cholera toxin); PJ (transdermal powder injection); TCI (transdermal immunity).

8A-8D show (a) no adjuvant, (b) cholera toxin adjuvant, (c) CpG motif-containing oligonucleotide adjuvant, or (d).
) Compare levels of IgA antibody (in mucosal secretions) to influenza vaccine after powder injection of influenza vaccine with a composition of two adjuvants. Mice were vaccinated with two 5 μg doses of influenza vaccine at weeks 0 and 4. Mucosal secretions were collected at 6 weeks and ELISA
Was assayed at. FIG. 8A shows mean IgA titers in nasal secretions from 8 animals. FIG. 8B shows the average IgA titers in saliva from 8 animals. Figure 8
C shows IgA titers in pooled vaginal lavages from 8 animals. Figure 8D
Shows mean IgA titers in fecal extracts from 8 animals. Abbreviation: Flu
(Influenza vaccine); PR8 (Influenza vaccine); CT (Cholera toxin); CpG (oligonucleotide containing CpG motif); PJ (transdermal powder injection).

FIG. 9 shows (a) no adjuvant, (b) cholera toxin adjuvant, (c).
Compare levels of IgA antibody (from different in vitro-cultured mucosal tissues) against influenza vaccine after powder injection of influenza vaccine with CpG motif-containing oligonucleotide adjuvant or (d) composition of two adjuvants. To do. Mice were vaccinated with two 5 μg doses of influenza vaccine at weeks 0 and 4. Mucosal tissue was collected at 6 weeks,
Cultured in vitro for 7 days and assayed by ELISA. Mean IgA titers from 8 mice are shown. Abbreviations: PP (Peyer's board); SI (small intestine);
PR8 (influenza vaccine); CT (cholera toxin); CpG (oligonucleotide containing CpG motif); PJ (transdermal powder injection).

10A-10C show (a) without adjuvant, (b) with cholera toxin adjuvant, (c) with CpG motif-containing oligonucleotide adjuvant, or (d) with a composition of two adjuvants. The levels of IgG antibodies to influenza vaccine (in mucosal secretions and in vitro cultured mucosal tissues) after powder injection of influenza vaccine are compared. Mice were vaccinated with two 5 μg doses of influenza vaccine at weeks 0 and 4. Mucosal secretions were collected at 6 weeks and assayed by ELISA. Mucosal tissues collected at 6 weeks were cultured in vitro for 7 days, and the culture supernatants were assayed by ELISA for influenza-specific antibodies. FIG. 10A shows the average IgG titers in culture supernatants of various mucosal tissues from 8 animals. FIG. 10B shows 8
Shown are the average IgG titers in fecal extracts from one animal. FIG. 10C shows the average IgG titers in pooled saliva from 8 animals. Abbreviations: PP (Peyer's patch); SI (small intestine); MLN (mesenteric lymphocytes); Flu (influenza vaccine); CT (cholera toxin); CpG (oligonucleotide containing CpG motif); PJ (transdermal powder) injection).

FIG. 11: After powder injection of a commercial influenza vaccine with (a) no adjuvant, (b) with cholera toxin adjuvant, or (c) a CpG motif-containing oligonucleotide adjuvant in combination with cholera toxin. Of IgG antibody levels against influenza vaccine. Eight mice / group were given various vaccine compositions and serum samples were collected 4 weeks post immunization. The data is
IgG titers of individual animals (O) and mean titers of 8 mice in this group (-). Abbreviations: no adj. (No adjuvant); CT: (cholera toxin); CpG: (oligonucleotide containing CpG motif).

FIG. 12 shows protection against death in vaccinated mice after challenge with a heterologous influenza strain. Mice were vaccinated via powder injection of a commercial influenza vaccine with (a) no adjuvant, (b) with cholera toxin adjuvant, or (c) a CpG motif-containing oligonucleotide adjuvant and cholera toxin. . Eight mice / group were given different vaccine compositions and mouse-matched influenza (Aichi / 68 (H3N2)
) Challenged with 10 × LD _{50 of} virus administered intranasally. Cholera toxin adjuvant alone (□) or cholera toxin and CpG motif-containing oligonucleotide (*)
All animals that received a powder injection of the vaccine composition with any of 1) survived the entire 21-day monitor-period. This means that unvaccinated control animals (O) survived 8 days post challenge, and only 40% of the animals vaccinated with the composition alone (⋄) survived 10 days post challenge. Abbreviation: no a
dj. : (No adjuvant); CT: (cholera toxin); CpG: (oligonucleotide containing CpG motif).

FIG. 13 is present in mucosal tissue samples obtained from mice vaccinated via powder injection of a commercial influenza vaccine adjuvanted with a combination of cholera toxin adjuvant and CpG motif-containing oligonucleotide adjuvant. 2 shows the IgA-secreting cells specific for influenza antigen. Control
Animals were vaccinated with the same adjuvanted influenza vaccine composition (phosphate buffered saline) either via intranasal or subcutaneous injection using conventional needles and syringes. Eight mice / group were immunized with different vaccine compositions, prime (day 0) and boost (day 28), and mucosal tissue samples were collected 2 weeks after boost. Cell suspensions were prepared from the pooled samples and influenza virus antigen-specific IgA secreting cells were prepared with E.
Counts were made using the LISPOT assay. The data shown in the figure are the average IgA spot forming cell (SPC) frequencies in mucosal tissue pooled from 8 mice. Abbreviations: IN (intranasal); EI (transdermal powder injection); SC (subcutaneous); PP (Peyer's patch).

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61K 39/12 A61K 39/12 39/145 39/145 39/39 39/39 47/30 47/30 48 / 00 48/00 A61P 31/04 A61P 31/04 31/12 31/12 31/16 31/16 (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ , TM), AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN , IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, T J, TM, TR, TT, UA, UG, UZ, VN, YU, ZW (72) Inventor Bhagava, Sanguita USA Wisconsin 53711, Madison, Science Drive 585 (72) Inventor Fuller, Devolar United States Wisconsin 53711, Madison, Science Drive 585 F Term (reference) 4C076 AA29 BB31 CC06 EE41 EE60 FF68 4C084 AA13 CA01 CA04 MA01 MA43 MA 63 NA10 NA11 ZB331 ZB351 4C085 AA03 BA07 BA10 BA20 BA51 BA55 CC07 CC08 DD86 EE01 EE06 FF13 FF19 GG04 GG05

Claims (39)

[Claims] 1. Use of an antigen or nucleic acid encoding an antigen in the manufacture of a particulate vaccine composition for producing a mucosal immune response on a mucosal surface of a vertebrate subject, said mucosal immune response comprising: , By delivering the particulate vaccine composition into or across the skin of the subject using transdermal delivery techniques. 2. The use according to claim 1, wherein the particulate vaccine composition is delivered using a needleless syringe powder injection device. 3. Use according to claim 1 or 2, wherein the mucosal immune response is specific for the antigen. 4. The use according to claim 3, wherein the mucosal immune response is characterized by an IgA antibody response specific for the antigen. 5. The use according to any one of claims 1 to 4, wherein the antigen is derived from or obtained from a pathogen that enters the body of a subject through a mucosal surface. 6. The antigen according to claim 1, which is a viral antigen or a bacterial antigen.
Use according to any one of 5 to 5. 7. Use according to any one of claims 1 to 5, wherein the antigen is a live attenuated organism. 8. The use of any one of claims 1-7, wherein an adjuvant composition is co-administered to the vertebrate subject. 9. Use according to claim 8, wherein the adjuvant composition is in particulate form. 10. The use according to claim 9, wherein the particulate adjuvant composition is delivered into or across the skin of the subject using transdermal delivery techniques. 11. The use according to any one of claims 8-10, wherein the vaccine composition and the adjuvant composition are administered to the same site in the subject. 12. The use according to any one of claims 8 to 11, wherein the vaccine composition and the adjuvant composition are administered simultaneously. 13. The use of claim 12, wherein the vaccine composition and the adjuvant composition are combined to provide a single composition. 14. The use according to any one of claims 8 to 13, wherein the adjuvant composition comprises more than one adjuvant. 15. The use according to any one of claims 8-14, wherein the adjuvant composition comprises an oligonucleotide containing a CpG motif. 16. The use according to any one of claims 8-15, wherein the adjuvant composition comprises an ADP ribosylating toxin. 17. The adjuvant composition comprises cholera toxin.
Use according to 6. 18. A particulate vaccine composition suitable for delivery into or across the skin of a vertebrate subject, the composition comprising: (a) an antigen or co-the antigen. A vaccine composition comprising: (b) an ADP-ribosylating toxin as an adjuvant; and (c) an oligonucleotide containing a CpG motif. 19. The vaccine composition of claim 18, wherein the ADP ribosylating toxin is cholera toxin. 20. The vaccine composition according to claim 18 or 19, wherein the antigen is derived from or obtained from a pathogen that enters the body of a subject through a mucosal surface. 21. The vaccine composition according to any one of claims 18 to 20, wherein the antigen is a viral antigen or a bacterial antigen. 22. The method of claim 18, wherein the antigen is a live, attenuated organism.
The vaccine composition according to any one of 1. 23. A dosing container suitable for use in a needleless syringe powder injection device, said dosing container comprising a vaccine composition according to any one of claims 18-22. . 24. A needleless syringe powder injection device filled with the vaccine composition according to any one of claims 18 to 22. 25. A product as a combined preparation for simultaneous, sequential or separate use for generating a mucosal immune response at the mucosal surface of a vertebrate subject, comprising: (i) an antigen or A particulate vaccine composition comprising a nucleic acid encoding an antigen, and (ii) an adjuvant composition, wherein the generation of the mucosal immune response is carried out into the skin of the subject using transdermal delivery techniques or A product by delivering the composition across the skin. 26. Treatment of diseases caused by a pathogen of an antigen derived from or obtained from the pathogen, or a nucleic acid encoding the antigen, which invades the body of a vertebrate subject through a mucosal surface. Or the use in the manufacture of a particulate vaccine composition for prophylaxis, wherein the treatment or prophylaxis requires treatment or vaccination in an amount sufficient to result in a mucosal immune response at the mucosal surface of the subject. The administration of the vaccine composition to the subject, wherein the vaccine composition further comprises an ADP-ribosylating toxin as an adjuvant and an oligonucleotide comprising a CpG motif. 27. The use according to claim 26, wherein the mucosal immune response is specific to the antigen. 28. The use according to claim 26 or 27, wherein the vaccine composition is administered into or across the skin of the subject using transdermal delivery techniques. 29. The use of claim 28, wherein the vaccine composition is administered to the subject from a needleless syringe powder injection device. 30. Treatment of a disease caused by a pathogen of an antigen derived from or obtained from the pathogen, which invades the body of a vertebrate subject via a mucosal surface, or a nucleic acid encoding the antigen. Or the use in the manufacture of a particulate vaccine composition for prophylaxis, said treatment or prophylaxis comprising administering said particulate vaccine composition into or across the skin of said subject, and said Use, wherein by co-administering to the subject an adjuvant composition comprising an ADP-ribosylating toxin, said co-administration of said vaccine and adjuvant composition is sufficient to result in a mucosal immune response specific for said antigen. 31. The use according to claim 30, wherein the ADP-ribosylating toxin is cholera toxin. 32. A method of generating a mucosal immune response at a mucosal surface, the method comprising:
The method comprises the step of delivering a particulate vaccine composition into or across the skin of a vertebrate subject using a transdermal delivery technique, the vaccine composition comprising: Comprising a nucleic acid to be read. 33. The method of claim 32, further comprising co-administering an adjuvant composition to the vertebrate subject. 34. A method for treating or preventing a disease caused by the entry of a pathogen into a vertebrate subject's body via a mucosal surface, the method comprising: providing a particulate vaccine composition to the subject. Administering to a subject in need of treatment or vaccination in an amount sufficient to elicit a mucosal immune response at the mucosal surface of An antigen derived from or obtained from a pathogen that invades the body of a subject; (b) an ADP-ribosylating toxin as an adjuvant; and (c) an oligonucleotide containing a CpG motif, Including the method. 35. The method of claim 34, wherein the vaccine composition is administered into or across the skin of the subject using transdermal delivery techniques. 36. A method for treating or preventing a disease caused by invasion of a pathogen into a vertebrate body through a mucosal surface, the method comprising the steps of: (a) a particulate vaccine composition. In the skin of the subject or across the skin, the vaccine composition comprising an antigen derived from or obtained from the pathogen, or a nucleic acid encoding the antigen. And (b) co-administering the adjuvant composition to the subject, wherein the adjuvant composition comprises an ADP-ribosylating toxin, and the co-administration of the vaccine and adjuvant composition further comprises: Sufficient to elicit a mucosal immune response specific for said antigen. 37. The method of claim 36, wherein the ADP ribosylating toxin is cholera toxin. 38. The method of any one of claims 32-37, wherein the vaccine composition is administered to the subject from a needleless syringe powder injection device. 39. A particulate vaccine composition for generating a mucosal immune response at a mucosal surface of a vertebrate subject, the mucosal immune response being in the skin of the subject using transdermal delivery techniques. A particulate vaccine composition, wherein the vaccine composition comprises an antigen or a nucleic acid encoding the antigen by delivering the vaccine composition to or across the skin.