NZ500530A

NZ500530A - Truncated VEGF-B, VEGF-C, VEGF-3, PlGF, VRF-2, poxvirus ORF-1 and ORF-2 proteins

Info

Publication number: NZ500530A
Application number: NZ500530A
Authority: NZ
Inventors: Peter Bohlen
Original assignee: Collateral Therapeutics
Priority date: 1997-04-25
Filing date: 1998-04-20
Publication date: 2001-12-21
Also published as: CN1260835A; KR20010020259A; NZ514872A; IL132537A0; WO1998049300A2; EA199900861A1; WO1998049300A3; AU7250298A; EP0977854A2; CA2287538A1; JP2001524828A; CN1680442A

Abstract

Provided are truncated forms of vascular endothelial growth factor-related proteins (VRPs) which are useful for stimulation of angiogenesis in vitro and in vivo. The truncated VRP subunits selected from VEGF-B, VRF-2, VEGF-C, PlGF, poxvirus ORF-1 and poxvirus ORF-2 have a deletion of at least one of the amino acid residues N-terminal to the first cysteine of the core sequence of the subunit. Gene therapy using the nucleic acids which code for the truncated VRPs may be useful for the treatment of heart disease and for wound healing.

Description

<div class="application article clearfix" id="description"> WO 98/49300 1 PCT/US98/07801 DESCRIPTION TRUNCATED VEGF-RELATED PROTEINS Field Of The Invention The present invention relates to novel truncated forms of vascular endothelial growth factor (VEGF)-related proteins. More particularly, the invention relates to N-terminally truncated VEGF-related proteins that are substantially free of other proteins. Such truncated VEGF-related proteins may be used to stimulate angiogenesis m vivo and in vitro. The invention als©-relates to nucleic acids encoding such novel truncated VEGF-related proteins* cells, tissues and animals containing stich nucleic acids; methods of treatment using such nucleic acids; and methods .rela&ipg to all of the foregoing. Background Vascular endothelial growth factors (VEGFs), also called vascular permeability factors (VPFs), are a family of proteins that are produced by many different cell types m many organs and act in a highly selective manner to stimulate endothelial cells almost exclusively (reviewed in Ferrara et al., Endocr. Rev. 13:18-32, (1992); Dvorak et al., Am. J. Pathol. 146:1029-39, 1995^. "Thomas, -~j~. " Biol. . Chem. 271:603-06, 1996). These publications, a,nd all othe£ publications referenced herein, are hereby incorporated by, reference in their entirety. When tested in cell -culture, VEGFs are potently mitogenic (Gospodarowicz et al., Proc. Natl. Acfad. Sci. USA 86:7311-15, 1989) and chemotactic (Favard et al., Biol. Cell 73:1-6, 1991). Additionally, VEGFs induce plasminogen activator, plasminogen activator inhibitor, and plasminogen activator receptor (Mandriota et al., J. Biol. Chem. 270:9709-16, 1995; Pepper et al., 181: 902-06, 1991), as well as collagenases (Unemori et al., J. Cell. Physiol. 153:557-62, 1992), enzyme systems that regulate invasion of growing capillaries into tissues. VEGFs Printed from Mimosa WO 98/49300 2 PCT/US98/07801 also stimulate the formation of tube-like structures by endothelial cells, an in vitro example of angiogenesis (Nicosia et al., Am. J. Pathol., 145:1023-29, 1994). In vivo, VEGFs induce angiogenesis (Leung et al., Science 246:1306-09, 1989) and increase vascular permeability (Senger et al., Science 219:983-85, 1983). VEGFs are now known as important physiological regulators of capillary blood vessel formation. They are involved in the normal formation of new capillaries during organ growth, including fetal growth (Peters et al., Proc. Natl. Acad. Sci. USA 90:8915-19, 1993), tissue repair (Brown et al., J. Exp. Med. 176:1375-79, 1992), the menstrual cycle, and pregnancy (Jackson et al., Placenta 15:341-53, 1994; Cullinan & Koos, Endocrinology 133:829-37, 1993; Kamat et al., Am. J. Pathol. 146:157-65, 1995). During fetal development, VEGFs appear to play an essential role in the de novo formation of blood vessels from blood islands (Risau & Flamme, Ann. Rev. Cell. Dev. Biol. 11:73-92, 1995), as evidenced by abnormal blood vessel development and lethality in embryos lacking a single VEGF allele (Carmeliet et al., Nature 380:435-38, 1996). Moreover, VEGFs are strongly implicated m the pathological blood vessel growth characteristic of many diseases, including solid tumors (Potgens et al., Biol. Chem. Hoppe-Seyler 376:57-70, 1995), retinopathies (Miller et al., Am. J. Pathol. 145:574-84, 1994; Aiello et al., N. Engl. J. Med. 331:1480-87, 1994; Adamis et al., Am. J. Ophthalmol. 118:445-50, 1994), psoriasis (Detmar et al., J. Exp. Med. 180:1141-46, 1994), and rheumatoid arthritis (Fava et al., J. Exp. Med. 180:341-46, 1994). VEGF expression is regulated by hormones (Schweiki et al., J. Clin. Invest. 91:2235-43, 1993) growth factors (Thomas, J. Biol. Chem. 271:603-06, 1996), and by hypoxia (Schweiki et al., Nature 359:843-45, 1992, Levy et al., J. Biol. Chem. 271:2746-53, 1996) . Upregulation of VEGFs by hypoxic conditions is of particular importance as a compensatory mechanism by which Printed from Mimosa WO 98/49300 3 PCT/US98/07801 tissues increase oxygenation through induction of additional capillary vessel formation and resulting increased blood flow. This mechanism is thought to contribute to pathological angiogenesis in tumors and in retinopathies. However, 5 upregulation of VEGF expression after hypoxia is also essential in tissue repair, e.g., in dermal wound healing (Frank et al., J. Biol. Chem. 270:12607-613, 1995), and in coronary ischemia (Banai et al., Cardiovasc. Res. 28:1176-79, 1994; Hashimoto et al., Am. J. Physiol. 267:H1948-H1954, 1994). 10 The potential of VEGF to pharmacologically induce angiogenesis in animal models of vascular ischemia has been shown in the rabbit chronic limb ischemia model by demonstrating that repeated intramuscular injection or a single intra-arterial bolus of VEGF can augment collateral blood 15 vessel formation as evidenced by blood flow measurement in the ischemic hindlimb (Pu, et al., Circulation 88:208-15, 1993; Bauters et al., Am. J. Physiol. 267:H1263-71, 1994; Takeshita et al., Circulation 90 [part 2], 11-228-34, 1994; Bauters et al., J. Vase. Surg. 21:314-25, 1995; Bauters et al., 20 Circulation 91:2802- 09, 1995; Takeshita et al., J. Clin. Invest. 93:662-70, 1994). In this model, VEGF has also been shown to act synergistically with basic FGF to ameliorate ischemia (Asahara et al., Circulation 92:[suppl 2], 11-365-71, 1995) . VEGF was also reported to accelerate the repair of 25 balloon-injured rat carotid artery endothelium thereby inhibiting pathological thickening of the underlying smooth muscle layers, and thus maintaining lumen diameter and blood flow (Asahara et al., Circulation 91:2793-2801, 1995). VEGF has also been shown to induce EDRF (Endothelium-Derived 30 Relaxing Factor (nitric oxide))-dependent relaxation in canine coronary arteries, thus potentially contributing to increased blood flow to ischemic areas via a secondary mechanism not related to angiogenesis (Ku et al., Am. J. Physiol. 265:H586-H592, 1993). Together, these data provide compelling evidence Printed from Mimosa WO 98/49300 4 PCT/US98/07801 for a potential therapeutic role of VEGFs in wound healing, ischemic diseases and restenosis. The VEGF family of proteins is comprised of at least 4 members VEGF-121, VEGF-165, VEGF-189, and VEGF-206. The originally characterized VEGF is a 34-45 kDa glycosylated protein which consists of 2 identical subunits of 165 amino acid residues (Tischer et al., Biochem. Biophys. Res. Commun. 165:1198-1206, 1989). The VEGF-165 cDNA encodes a 191-residue amino acid sequence consisting of a 26-residue secretory signal peptide sequence, which is cleaved upon secretion of the protein from cells, and the 165-residue mature protein subunit. VEGF-165 binds strongly to heparin for which the strongly basic sequence between residues 115-159 is thought to be responsible (Fig. 1) (Thomas, J. Biol. Chem., 271:603-06 (1996)). The other members of the VEGF family are homodimeric proteins with shorter or longer subunits of 121, 189 and 206 residues (VEGF-121, VEGF-189, and VEGF-206, respectively) (Tischer et al., J. Biol. Chem. 266:11947-54, 1991; Park et al., Mol Biol Cell 4:1317-26 (1993)). The 4 forms of VEGF arise from alternative splicing of up to 8 exons of the VEGF gene (VEGF-121, exons 1-5,8; VEGF-165, exons 1-5,7,8; VEGF-189, exons 1-5, 6a, 7, 8; VEGF-206, exons 1-5, 6b, 7, 8 (exon 6a and 6b refer to 2 alternatively spliced forms of the same exon)) (Houck et al., Mol. Endocr., 5:1806-14 (1991)). The VEGF sequences contain eight conserved disulfide-forming core cysteine residues. All VEGF genes encode signal peptides that direct the protein into the secretory pathway. However, only VEGF-121 and -165 are found to be readily secreted by cultured cells whereas VEGF-189 and -206 remain associated with the extracellular matrix. These VEGF forms possess an additional highly basic sequence, corresponding to residues 115-139 in VEGF-189 and -206 (matrix-targeting sequence), which confers high affinity to acidic components of the extracellular matrix (Thomas, J. Biol. Chem. 271:603-06 (1996)) . Printed from Mimosa WO 98/49300 5 PCT/US98/07801 Mitogenic activity of the various VEGF isoforms varies depending on each isoform. For example, VEGF-121 and VEGF-165 have very similar mitogenic activity for endothelial cells. However, VEGF-189 and VEGF-206 are only weakly mitogenic 5 (Ferrara et al., Endocr. Rev. 13:18-32, 1992). The reduced activity of these isoforms is attributed to their strong association with cells and matrix, as evidenced by the normal mitogenic activity of a mutant of VEGF-206 which lacks the 24-residue "matrix targeting" sequence common to VEGF-189 and 10 VEGF-206 (residues 115-139 in Fig. 1) (Ferrara et al., Endocr. Rev. 13:18-32, 1992). An N-terminal fragment of VEGF-165 generated by plasmin (VEGF (1-110)) bound with the same affinity to the KDR receptor as VEGF-165 and VEGF-121 whereas the C-terminal VEGF-fragment 15 (111-165) had no binding activity (Keyt et al., J. Biol. Chem. 271:7788-95, 1996). Interestingly, in this study the mitogenic activity of VEGF-121 and VEGF-110 was reduced by approximately 110-fold as compared to VEGF-165, suggesting a potential role of the C-terminal domain of VEGF-165 in the biological potency 20 of VEGF isoforms. The significance of this finding is somewhat unclear in view of earlier results showing the equivalent potency of VEGF-121 and VEGF-165 on endothelial cell growth. Furthermore, since functional interaction of VEGF with the KDR receptor is thought to be dependent at least in part on cell 25 surface heparin sulfate proteoglycan(s) (Cohen et al., J. Biol. Chem., 270:11322-26, 1995; Tessler et al., J. Biol. Chem. 269:12456-61; 1994) it is conceivable that differences in results arise from differences in various experimental systems. In this context it is unclear to what extent cell surface 30 heparin sulfates regulate the functional interaction of VEGF-121 (lacking a heparin-binding domain) and VEGF-165 (possessing a heparin-binding domain) (Tessler et al., J. Biol. Chem. 269:12456-61, 1994; Cohen et al., J. Biol. Chem. 270:11322-26, 1995; Gitay-Goren et al., J. Biol. Chem. 271:5519-23 (1996)). Printed from Mimosa WO 98/49300 PCT/US98/07801 VEGFs are related to platelet-derived growth factor (PDGF)(Andersson et al., Growth Factors 12:159-64, 1995). VEGFs are also related to the family of proteins derived from the Placenta Growth Factor (P1GF) gene, P1GF-129 and PlGF-150 5 (Maglione et al., Proc. Natl. Acad. Sci. USA 88:9267-71, 1991; Oncogene 8:925-31, 1993). More recently several additional VEGF-related genes have been identified and termed VEGF-B (also called VEGF-related factor VRF-1) (Grimmond et al., Genome Res. 6:122-29, 1996; Olofsson et al., Proc. Natl. Acad. Sci. U.S.A. 10 93:2567-81, 1996) VRF-2 (Grimmond et al., Genome Res. 6:122-29, 1996), and VEGF-C (Joukov et al., EMBO J. 15:290-98, 1996; Lee et al., Proc. Natl. Acad. Sci. USA 93:1988-92, 1996) and VEGF-3 (PCT Application No. PCT/US95/07283, published on December 12, 1996 as W096/39421). Finally, two virally encoded VEGF-related 15 sequences have been identified, poxvirus ORF-1 and ORF-2 (Lyttle et al., J. Virol. 68:84-92, 1994). With the exception of PDGF, these proteins are referred to as VEGF-related proteins [VRPs]. Sequences of examples of VRPs are depicted in Figure 1. 20 The VRPs, and the PDGFs known so far have 8 cysteines within their sequences that are relatively positionally conserved. The protein sequence spanning the conserved cysteines is therefore referred to herein as the core sequence, and the first N-terminal conserved cysteine of the sequence is 25 referred to herein as the "First cysteine of the core sequence" or "first core cysteine." Interestingly, members of the VEGF families can form heterodimers, such as heterodimers consisting of VEGF and P1GF subunits (DiSalvo et al., J. Biol. Chem. 270:7717-23, 1995; Cao 30 et al., J. Biol. Chem. 271: 3154-62, 1996). Whereas VEGFs are highly potent in stimulating angiogenesis and endothelial cell proliferation, VEGF/P1GF heterodimers are less potent mitogens, and P1GF homodimers have little or no mitogenic activity (DiSalvo et al., J. Biol. Chem. 270:7717-23, 1995; Cao et al., Printed from Mimosa WO 98/49300 7 PCT/US98/07801 J. Biol. Chem. 271: 3154-62, 1996). In other experiments, VEGF-165/VEGF-B heterodimers were found to form after transfection of cells with both genes (Olofsson et al., Proc. Natl. Acad. Sci. U.S.A. 93:2567-81, 1996). 5 VEGFs interact with two receptors present on endothelial cells, KDR/flk-1 (Terman et al., Biochem. Biophys. Res. Commun. 187:1579-86, 1992), and flt-1 (De Vries et al., Science 255:989-91, 1992). Systematic site-directed mutagenesis of VEGF-165 by alanine scanning of charged residues has shown that 10 residues D63, E64 and E67 are involved in binding of VEGF to flt-1 whereas the basic residues R82, KI84, and H86 contribute strongly to binding to KDR (Keyt et al., J. Biol. Chem. 271:5638-46, 1996). VRPs are known to bind to one or more of three different 15 endothelial cell receptors, each of which is a single transmembrane protein with a large extracellular portion comprised of 7 immunoglobulin-type domains and a cytoplasmic portion that functions as a tyrosine kinase. These receptors are KDR/flk-1 (Terman et al., Biochem. Biophys. Res. Commun. 20 187:1579-86, 1992), flt-1 (De Vries et al., Science 255:989-91, 1992), and flt-4 (Pajusola et al., Cancer Res. 52:5738-43, 1992). There are distinct selectivities between these receptors and the various VEGF ligands that have not been completely elucidated as yet. However, it is known that VEGF 25 binds to KDR and fltl (Terman et al., Growth Factors 11:187-95, 1994) but not flt4 (Joukov et al., EMBO J. 15:290-98, 1996), P1GF binds to fit 1 but not KDR (Terman et al. , Growth Factors 11:187-95, 1994) and flt4 (Joukov et al., EMBO J. 15:290-98, 1996), VEGF-C binds to flt-4 (Joukov et al., EMBO J. 15:290-98, 30 1996) but it is controversial whether it also binds to KDR (Joukov et al., EMBO J. 15:290-98, 1996; Lee et al., Proc. Natl. Acad. Sci. USA 93:1988-92, 1996). The receptor specificity for VEGF-B/VRF-1, VRF-2 and the virally encoded VRPs is not presently known. However, since VEGF-B stimulates Printed from Mimosa WO 98/49300 PCT/US98/07801 endothelial cell proliferation (Olofsson et al., Proc. Natl. Acad. Sci. U.S.A. 93:2567-81, 1996) it may be speculated that VEGF-B can bind to KDR because KDR is thought to be primarily responsible for the angiogenic response of endothelial cells to 5 VEGF-like growth factors (Gitay-Goren et al., J. Biol. Chem. 271:5519-23 (1996)). Most of the VRPs have been shown to activate the KDR receptor which is thought to make endothelial cells "angiogenesis-competent." Evidence for such activity has been 10 presented for VEGF-B which stimulates endothelial cell proliferation (Olofsson et al., Proc. Natl. Acad. Sci. U.S.A. 93:2567-81, 1996), VEGF-C which stimulates endothelial cell migration and proliferation (Joukov et al., EMBO J. 15:290-98, 1996; Lee et al., Proc. Natl. Acad. Sci. USA 93:1988-92, 1996), 15 and both known virally encoded VRPs which were reported to be angiogenic (Lyttle et al., J. Virol. 68:84-92, 1994). A notable exception are P1GF isoform homodimers which have negligible mitogenic activity for endothelial cells. However, P1GF/VEGF heterodimers still retain considerable mitogenic 20 activity (DiSalvo et al., J. Biol. Chem. 270:7717-23, 1995; Cao et al., J. Biol. Chem. 271: 3154-62, 1996). VEGFs are expressed in many different tissues. Similarly, VRP genes are also expressed in multiple tissues but it is of particular interest that VEGF-B and to a lesser extent VRF-2 25 are strongly expressed in human heart and skeletal muscle (Grimmond et al., Genome Res. 6:122-29, 1996; Olofsson et al., Proc. Natl. Acad. Sci. U.S.A. 93:2567-81, 1996). In fact, VEGF-B is expressed considerably more strongly in mouse heart tissue than VEGF (Olofsson et al., Proc. Natl. Acad. Sci. 30 U.S.A. 93:2567-81, 1996). VEGF-C is also strongly expressed in several human tissues, most notably in heart and skeletal muscle (Joukov et al., EMBO J. 15:290-98, 1996). This expression pattern, and the exquisite specificity of VRPs for endothelial cells, suggest that these factors play a Printed from Mimosa WO 98/49300 9 PCT/US98/07801 physiological role in angiogenesis in these tissues. This is thought to be relevant in pathological situations such as coronary ischemia where collateral angiogenesis is required to provide the heart muscle with an adequate capillary blood 5 vessel supply. It has been shown that transient ischemia induced by coronary artery ligation or hypoxia rapidly upregulates VEGF mRNA in the rat or pig heart in vivo and hypoxia induces VEGF mRNA in cardiac myocytes and smooth muscle cells in vitro (Hashimoto et al., Am. J. Physiol 267, H1948-10 H1954, 1994; Banai, et al., Cardiovac. Res. 28:1176-79, 1994; Circulation 90, 649-52, 1994). The strong expression of VEGF and VRPs in the heart may help to ensure a redundant and competent regulatory system capable of inducing new blood vessel formation when it is needed. Collateral blood vessel 15 formation is also required in peripheral (lower limb) vascular ischemias and in cerebral ischemias (stroke). Finally, new blood vessel formation is required in tissue repair after wounding. In this context, it is worth noting that VEGF is upregulated in epidermal keratmocytes during skin wound 20 healing (Brown et al., J. Exp. Med. 176:1375-79, 1992). Thus, therapy of various ischemic conditions such as cardiac infarction, chronic coronary ischemia, chronic lower limb ischemia, wound healing and stroke with VRPs may be potentially clinically beneficial. 25 Summary Of The Invention The present invention is directed to novel truncated forms of VEGF-related proteins (VRPs), preferably human VRPs. The preferred use of the truncated VRPs and nucleic acid molecule 30 compositions of the invention is to use such compositions to aid in the treatment of patients with heart disease, wounds, or other ischemic conditions by stimulating angiogenesis in such patients. The amino acid sequences of VRPs include eight disulfide-forming cysteine residues that are conserved between Printed from Mimosa WO 98/49300 PCT/US98/07801 10 VRPs and VEGF proteins (core cysteines). VRPs include, but are not limited to, VEGF-B, VEGF-C, VRF-2, ORF-1, ORF-2, and PIGFs. A first aspect of the invention provides for a truncated VRP having a deletion of at least one of the amino acid 5 residues N-terminal to the first cysteine of the core sequence of said subunit with the proviso that said truncated VRP is not a truncated VEGF-3 subunit. Such compositions would be substantially free of other proteins. Preferably, the truncations range from truncating minimally the N-terminal residue of the mature protein subunit only(not including the signal sequence) and 10 maximally all N-terminal amino acids of the mature protein up to and including the residue N-terminal to (prior to) the first core cysteine residue. In more preferred aspects, all of the amino acid residues N-terminal to the first cysteine of the core sequence, except the 1 to 5 amino acid residues 15 immediately N-terminal to said first cysteine, are deleted. Although the amino acid deletions may consist of deletions of non-adjacent amino acid residues in the N-terminal sequence, it is preferred that the deletions be of consecutive amino acid residues. Thus, in one preferred aspect, the invention 20 comprises human VRPs that have deletions of amino acid residue sequences of increasing lengths from the N-terminus of the N-terminal sequence up to the first cysteine of the core sequence of the VRP subunit sequence. In preferred aspects, the invention provides for truncated 25 versions of the VRPs VEGF-B, VRF-2, VEGF-C, P1GF, poxvirus ORF-1, and poxvirus ORF-2. In such truncated VRPs, each subunit may independently have a deletion of at least one of the amino acid residues N-terminal to the first cysteine of the core sequence of said subunit, or only one of the subunits 30 may have such a deletion. In particular embodiments, the truncated VRP subunit comprises a VRP subunit wherein various numbers of ammo acid residues N-terminal to the first cysteine of the core sequence are deleted. In one aspect, the remaining N-terminal residues intellectual property office of nz. 1 7 OCT 2001 WO 98/49300 11 PCT/US98/07801 consist of consecutive amino acid residues derived from the N-terminal sequence. These consecutive N-terminal residues may be derived from any location in the N-terminal sequence, however, a consecutive sequence starting from the N-terminus of 5 the N-terminal sequence is preferred, and 4a sequence consisting of consecutive amino acid residues immediately N-terminal to the first cysteine of the core sequence of the VRP subunit is most preferred. Examples of such most preferred embodiments are depicted in Figure 2. 10 In other embodiments, the amino acid residues N-termmal to the first cysteine of the core sequence of the truncated VRPs of the invention are a randomly selected amino acid sequence, in yet other embodiments, these amino acid residues are derived from the N-terminal sequence of the full length VRP 15 sequence, but are not necessarily consecutive amino acids from the full length VRP sequence. Thus, in one most preferred aspect, the invention provides a truncated VRP subunit wherein the amino acid residues N-terminal to the first cysteine of the core sequence of said 20 subunit are deleted. In other aspects, the invention provides a truncated VRP subunit wherein the amino acid sequence N-terminal to the core sequence comprises 11 to 20, more preferably 11 to 15, more preferably 6 to 10, and most preferably 2 to 5 amino acid 25 residues. Preferably, the amino acid sequence N-terminal to the core sequence comprises the consecutive amino acid residues immediately N-terminal to the first cysteine of the core sequence of said VRP subunit. Thus, in these preferred 30 embodiments, the truncated VRP comprises the core sequence, the necessary C-terminal sequence to the core sequence, and further comprises at the region N-terminal to the first cysteine of the core sequence, the 11 to 20, more preferably the 11 to 15, more preferably the 6 to 10, and most preferably the 2 to 5 Printed from Mimosa WO 98/49300 12 PCT/US98/07801 consecutive amino acid residues of the amino acid sequence that is immediately N-terminal to the first cysteine of the core sequence of the full length VRP sequence. Those skilled in the art will recognize that where a 5 truncated VRP subunit comprises, for example, (X) amino acids N-terminal to the first cysteine of the core sequence, that such a truncated VRP subunit is one where the corresponding full length VRP subunit comprises (X + 1) amino acids N-terminal to the first cysteine of the core sequence. 10 The truncated VRPs of the invention include truncated VRP homodimers comprising two truncated VRP subunits of the invention, wherein the two truncated VRP subunits have the same amino acid sequence, and also include truncated VRP heterodimers comprising two truncated VRP subunits of the 15 invention wherein the two subunits have different amino acid sequences from each other. For purposes of the present invention, the term "first N-NN" amino acids where N and NN each represent numbers of amino acids, for example, the first 10-15 amino acids, denotes the 20 first N-NN ammo acids (e.g., the first 10-15 amino acids) after the signal peptide sequence of the designated VRP. The term N-NN encompasses a deletion of anywhere from N to NN of the first amino acids after the signal sequence. Thus, in more preferred aspects, the truncated VRP subunit comprises a 25 truncated hVEGFB protein subunit wherein the first 10-15 amino acids are deleted; more preferably, the first 15-20 amino acids are deleted; more preferably, the first 20-25 amino acids are deleted; and most preferably, the first 23-24 amino acids are deleted. 30 In other more preferred aspects, the truncated VRP subunit comprises a truncated hVRF2 protein subunit wherein the first 10-15 amino acids are deleted; more preferably, the first 15-20 amino acids are deleted; more preferably, the first 20-25 amino Printed from Mimosa WO 98/49300 13 PCT/US98/07801 acids are deleted; and most preferably, the first 23-24 amino acids are deleted. In other more preferred aspects, the truncated VRP subunit comprises a truncated hVEGFC protein subunit wherein the first 5 95-100 amino acids are deleted; more preferably, the first 100-105 amino acids are deleted; more preferably, the first 105-110 amino acids are deleted; and most preferably, the first 108-109 amino acids are deleted. In other more preferred aspects, the truncated VRP subunit 10 comprises a truncated hPlGF protein subunit wherein the first 16-21 amino acids are deleted; more preferably, the first 21-26 amino acids are deleted; more preferably, the first 26-31 amino acids are deleted; and most preferably, the first 29-30 amino acids are deleted. 15 20 In other more preferred aspects, the truncated VRP subunit comprises a truncated pvORFl protein subunit wherein the first 20-25 amino acids are deleted; more preferably, the first 25-30 amino acids are deleted; more preferably, the first 30-35 amino 25 acids are deleted; and most preferably, the first 33-34 amino acids are deleted. In other more preferred aspects, the truncated VRP subunit comprises a truncated pvORF2 protein subunit wherein the first 30-35 amino acids are deleted; more preferably, the first 35-40 30 amino acids are deleted; more preferably, the first 40-45 amino acids are deleted; and most preferably, the first 43-44 amino acids are deleted. The sequences of some exemplary preferred truncated VRP subunits are set out in Figure 2. intellectual property office of nz. 1 7 OCT 2001 RECEIVED WO 98/49300 14 PCT/US98/07801 The invention also provides for nucleic acid molecules coding for the truncated VRP subunits described herein. The nucleic acid molecules may be, for example, DNA, cDNA or RNA. The invention also provides for recombinant DNA vectors 5 comprising the nucleic acid molecules encoding the truncated VRPs, and host cells transformed with such recombinant DNA vectors, wherein such vectors direct the synthesis of a truncated VRP subunit such as those described herein. The invention further provides for nucleic acid molecules 10 encoding biosynthetic precursor forms of N-terminally truncated subunits of VRPs for the purpose of facilitating the expression in suitable host systems. Such nucleic acid molecules are comprised of DNA encoding a signal peptide that precedes the truncated subunits at their N-termini. The signal sequences of 15 VEGF or VRPs would be used to construct appropriate signal peptide-containing truncated forms of VRPs. The human VEGF signal peptide is as follows: mnfllswvhwslalllylhhakwsqa (I) — [SEQ I.D. NO. 40] — Alternatively, the signal peptides shown in Figure 1 may be 20 used. Preferably, the signal peptide specific for the truncated VRP is used in the construct. In order to facilitate signal peptide cleavage in mammalian cells after fusion of the signal sequence to truncated forms of VRP, it may be necessary to include the 25 first or the first two residues of the mature VRP peptide sequence, e.g. proline (P), or proline-valine (PV) for hVEGFB. Thus, an appropriate nucleic acid molecule would be comprised of DNA encoding the signal sequence of VEGF-B, optionally followed by a codon for proline (the first residue of mature 30 VEGF-B), optionally followed by a codon for valine (the second residue of mature VEGF-B) , and followed by DNA encoding the N-terminally truncated VEGF-B. The invention also provides for other appropriate signal peptide fusion constructs, best suitable for non-mammalian hosts, as known by those skilled in Printed from Mimosa WO 98/49300 15 PCT/US98/07801 the art. Those skilled in the art will recognize that the signal peptides should optionally include residues needed for facilitation of signal peptide cleavage in mammalian cells for the various truncated VRP subunits of the present invention. 5 Thus, the present invention provides for recombinant DNA expression vectors wherein the 51 end of the nucleic acid molecule coding for the truncated VRP subunit is operably linked to a DNA sequence that codes for a signal peptide. The signal peptide may be a human VRP signal peptide. Moreover, 10 the DNA sequence coding for said signal peptide may be operably linked at the 3' end of said DNA sequence to DNA coding for the first amino acid residue of the mature non-truncated VRP subunit, and wherein the 3' end of said DNA coding for said residue is operably linked to the nucleic acid molecule coding 15 for said truncated VRP subunit. In other aspects, the DNA sequence coding for said signal peptide is operably linked at the 3' end of said DNA sequence to DNA coding for the first two amino acid residues of the mature non-truncated VRP subunits, and wherein the 3' end of said DNA coding for said two residues 20 is operably linked to said nucleic acid molecule coding for said truncated VRP subunit. Thus, in preferred aspects, the invention also provides a truncated VRP subunit of the invention as described above, further comprising at the N-terminus of said truncated VRP subunit, the first one or two 25 amino acid residues of the mature non-truncated VRP subunit. Those skilled in the art will recognize that such truncated VRP subunits of the invention include those wherein the final number of amino acids N-terminal to the first cysteine of the core sequence (including the additional one or two amino acids 30 that may facilitate signal peptide cleavage) is at least one less than the number of amino acids N-terminal to the first cysteine of the core sequence of the corresponding full length VRP. Printed from Mimosa WO 98/49300 16 PCT/US98/07801 In other preferred aspects, the invention provides truncated VRP homodimers or heterodimers comprising two truncated VRP subunits wherein said truncated VRP subunits comprise at the N-terminus of said truncated VRP subunits, the 5 first one or two amino acid residues of the mature non-truncated VRP subunit. In preferred aspects, the recombinant nucleic acid molecule coding for a truncated VRP subunit of the invention is operably linked to control sequences operable in a host cell 10 transformed with said vector. The present invention also provides for transformed or transfected host cells comprising the recombinant DNA vectors of the invention. The present invention also includes delivery vectors which comprise nucleic acid molecules coding for the truncated VRPs 15 of the invention. Such delivery vectors may be, for example, viral vectors. Such viral vectors may be, for example, adenovirus vectors or adenovirus-associated virus vectors. In other aspects of the invention are provided an adenovirus vector comprising a nucleic acid molecule coding for a 20 truncated VRP of the invention operably linked at the 5' end of the nucleic acid molecule to a DNA sequence that codes for a signal peptide. Preferably, the signal peptide is selected from the group consisting of VEGF signal peptide, VEGF-B signal peptide, VRF-2 signal peptide, VEGF-C signal peptide, P1GF 25 signal peptide, VEGF-3 signal peptide, poxvirus ORF-1 signal peptide, and poxvirus ORF-2 signal peptide. Preferably said signal peptide is VEGF-B signal peptide. In preferred aspects, the DNA sequence coding for the signal peptide is operably linked at the 3' end of the DNA sequence to DNA coding for the 30 first amino acid residue of the mature non-truncated VRP subunit, and wherein the 3' end of said DNA coding for said residue is operably linked to the nucleic acid molecule coding for said truncated VRPs. In most preferred aspects, the Printed from Mimosa WO 98/49300 17 PCT/US98/0780J adenovirus vector comprises a nucleic acid molecule which codes for a truncated VRP subunit of Figure 2. In further preferred aspects of the invention are provided a filtered-injectable adenovirus vector preparation comprising 5 a recombinant adenoviral vector, said vector containing no wild-type virus and comprising: a partial adenoviral sequence from which the E1A/E1B genes have been deleted, and a transgene coding for a truncated VRP subunit, driven by a promoter flanked by the partial adenovirus sequence; and a 10 pharmaceutically acceptable carrier. In preferred aspects, the preparation has been filtered through a 30 micron filter. In other preferred aspects the truncated VEGF subunit is a truncated VEGF subunit of Figure 2. In another preferred aspect, the injectable adenoviral vector preparation comprises 15 a promoter selected from the group consisting of a CMV promoter, a ventricular myocyte-specific promoter, and a myosin heavy chain promoter. In other aspects, the invention provides a method of producing a truncated VRP polypeptide comprising growing, under 20 suitable conditions, a host cell transformed or transfected with the recombinant DNA expression vector of the invention in a manner allowing expression of said polypeptide, and isolating said polypeptide from the host cell. Suitable conditions are then provided for the truncated VRP peptide to fold into a 25 truncated VRP subunit. In mammalian cells, such conditions should be naturally provided by the cell. In non-mammalian cells, appropriate pH, isotonicity, and reducing conditions must be provided, such as those described in, for example, Example 2. Most preferably, the invention provides a method of 30 producing a truncated VRP wherein suitable conditions are provided for said truncated VRP subunit to dimerize with a second VRP subunit selected from the group consisting of VRP subunits and truncated VRP subunits. In preferred aspects of the invention are provided methods of producing a truncated VRP Printed from Mimosa WO 98/49300 PCT/US98/07801 18 homodimer comprising two truncated VRP subunits having the same amino acid sequence. In other aspects of the invention are provided methods of producing truncated VRP heterodimers wherein the two VRP 5 subunits have different amino acid sequences. Such heterodimers may consist of one truncated VRP subunit and one non-truncated VRP subunit, or both VRP subunits may be truncated. The two subunits may be derived from different VRPs. For example, the heterodimer may consist of one VEGF-B 10 subunit and one truncated VEGF-C subunit, or both subunits may be truncated. In further preferred aspects, the present invention provides pharmaceutical compositions comprising a truncated VRP subunit of the present invention, in a suitable carrier. The 15 invention includes methods of stimulating blood vessel formation comprising administering to a patient such a pharmaceutical composition. Methods are provided using the compounds of the present invention to stimulate endothelial cell growth or endothelial 20 cell migration in vitro comprising treating said endothelial cells with truncated VRPs. Disclosed but not claimed are methods of treating a patient suffering from a heart disease comprising administering to said patient a nucleic acid molecule coding for at least one 25 truncated VRP subunit, said nucleic acid molecule capable of expressing the truncated VRP subunit in said patient. In an additional embodiment, methods are provided of stimulating angiogenesis in a patient comprising administering a therapeutic amount of a pharmaceutical composition comprising a 30 truncated VRP of the present invention. Preferably, the pharmaceutical composition is in a therapeutically suitable delivery system. In other preferred aspects, a potentiating agent is administered to potentiate the angiogenic effect of said truncated VRP. Such agents include, intellectual property office of nz. 1 7 OCT 2001 RECEIVED WO 98/49300 19 PCT/US98/07801 for example, basic Fibroblast Growth Factor (bFGF) (FGF-2), acidic FGF (aFGF) (FGF-1) , FGF-4, FGF-5, FGF-6, or any FGF or other angiogenic factor that stimulates endothelial cells. Thus, in one aspect of the invention is provided a 5 pharmaceutical composition comprising a truncated VRP and one or more potentiating agents. The pharmaceutical compositions may also be used to treat patients suffering from ischemic conditions such as cardiac infarction, chronic coronary ischemia, chronic lower limb ischemia, stroke, and peripheral 10 vascular disease. Methods are also provided using the pharmaceutical compositions of the present invention to treat wounds, such as dermal or intestinal wounds. Also disclosed are methods of stimulating angiogenesis in a patient comprising delivering a 15 delivery vector to the myocardium of the patient by intracoronary injection directly into one or both coronary arteries, said vector comprising a nucleic acid molecule coding for at least one truncated VRP subunit, wherein said vector is capable of expressing the truncated VRP subunit in the 20 myocardium. The disclosed method may be used for stimulating coronary collateral vessel development. Further disclosed is a method for stimulating vessel development in a patient having peripheral 25 vascular disease, comprising delivering a delivery vector to the peripheral vascular system of the patient by intra-femoral artery injection directly into one or both femoral arteries, said vector comprising a transgene coding for a truncated VRP subunit, and capable of expressing the truncated VRP subunit in 30 the peripheral vascular system, thereby promoting peripheral vascular development. Preferably the delivery vector used in the invention is a viral delivery vector. In one preferred aspect, the delivery vector is a replication-deficient adenovirus vector. In intellectual property OFFICE OF N.Z. 1 7 OCT 2001 ppnciucn WO 98/49300 20 PCT/US98/07801 another preferred aspect, the delivery vector is an adeno-associated virus vector. Brief Description Of The Drawings Figure 1 depicts the amino acid sequences of VEGF-B [SEQ I. D. NO. 1], VRF-2 [SEQ I.D. NO. 2], VEGF-C [SEQ I.D. NO. 3], P1GF (human P1GF-2) [SEQ I.D. NO. 4], VEGF-3 [SEQ I.D. NO. 5], poxvirus ORF-1 [SEQ I.D. NO. 6], and poxvirus ORF-2 [SEQ I.D. NO. 7] . Lower case letters signify signal peptides that are cleaved from the mature protein. The eight cysteines of the core sequence are underlined. Sequences are described in the following references: human VEGF-B: Grimmond et al., Genome Res. 6:122-29 (1996); Olofsson et al., Proc. Natl. Acad. Sci. U.S.A. 93:2567-81 (1996); mouse VEGF-B: Olofsson et al., Proc. Natl. Acad. Sci. U.S.A. 93:2567-81 (1996); human VRF-2: Grimmond et al., Genome Res. 6:122-29 (1996); human VEGF-C: Joukov et al., EMBO J. 15:290-98 (1996); Lee et al., Proc. Natl. Acad. Sci. USA 93:1988-92 (1996); P1GF: Maglione et al., Oncogene 8:925-31 (1993); Hauser & Weich, Growth Factors 9:259-68 (1993); human VEGF3: PCT Application Serial No. PCT/US95/07283, published on December 12,, 1996, as W096/39421; poxvirus ORF-1 and ORF-2: Lyttle et al., J. Virol. 68:84-92 (1994). Figure 2a-2f depicts examples of truncated VRP ammo acid sequences below the corresponding full length (F/L) VRP sequence. The amino acid sequences of each truncation are listed as follows: 2a (F/L) [SEQ I.D. NO. 34] (1) [SEQ I.D. NO. 8]; 2a(2) [SEQ I.D. NO. 9]; 2a (3) [SEQ I.D. NO. 10]; 2a(4) [SEQ I.D. NO. 11]; 2a(5) [SEQ I.D. NO. 12]; 2a(6) [SEQ I.D. NO. 13]; 2b (F/L) [SEQ I.D. NO. 35]; (1) [SEQ I.D. NO. 14]; 2b(2) [SEQ I.D. NO. 15]; 2b(3) [SEQ I.D. NO. 16]; 2b(4) [SEQ I.D. NO. 17]; 2c(F/L) [SEQ I.D. NO. 36]; (1) [SEQ I.D. NO. 18]; Printed from Mimosa WO 98/49300 21 PCT/US98/07801 2c (2) [SEQ I.D. NO. 19]; 2c(3) [SEQ I.D. NO. 20]; 2c(4) [SEQ I.D. NO. 21]; 2d(F/L) [SEQ I.D. NO. 37]; (1) [SEQ I.D. NO. 22]; 2d (2) [SEQ I.D. NO. 23]; 2d(3) [SEQ I.D. NO. 24]; 2d(4) [SEQ I.D. NO. 25]; 2e(F/L [SEQ I.D. NO. 38] (1) [SEQ I.D. NO. 5 26]; 2e (2) [SEQ I.D. NO. 27]; 2e(3) [SEQ I.D. NO. 28]; 2e(4) [SEQ I.D. NO. 29]; 2f(F/L) [SEQ I.D. NO. 39]; (1) [SEQ I.D. NO. 30]; 2f (2) [SEQ I.D. NO. 31]; 2f(3) [SEQ I.D. NO. 32]; and 2f(4) [SEQ I.D. NO. 33]. 10 Detailed Description Of The Invention Construction of Novel Truncated VRP Sequences In a first aspect the invention features a truncated VRP comprising at least one truncated VRP subunit. By "truncated VRP subunit" it is meant a VRP subunit having an amino acid 15 sequence substantially similar to one of the VRPs, for example, but not limited to, one of the sequences shown in Figure 1, or an analog or derivative thereof, wherein at least one of the N-terminal amino-acid residues N-terminal to the first cysteine of the core sequence of the mature subunit is deleted. A 20 sequence that is "substantially similar" to a VRP comprises an amino acid sequence that is at least 25% homologous to the 8 cysteine core sequence of VEGF-B, comprises all of the essential conserved cysteine residues of said core sequence, and retains VRP activity. By "truncated VRP subunit" is also 25 meant a VRP subunit wherein at least one of the N-terminal amino acid residues N-terminal to the first cysteine of the VEGF core sequence is deleted, and, at least one of the cysteines of the core sequence is deleted, wherein said cysteine is non-essential. A non-essential cysteine is one 30 that is not required to retain VRP activity. Such nonessential cysteines have been described in connection with PDGF. (Potgens, et al. J. Biol. Chem. 269:32879-85 (1994)). By "identity" is meant a property of sequences that measures their similarity or relationship. Identity is Printed from Mimosa WO 98/49300 22 PCT/US98/07801 measured by dividing the number of identical residues by the total number of residues and multiplying the product by 100. Thus, two copies of exactly the same sequence have 100% identity, but sequences that are less highly conserved and have 5 deletions, additions, or replacements may have a lower degree of identity. In calculating sequence identity, the two sequences are compared starting at the carboxy terminus of the N-terminal deletion. Those skilled in the art will recognize that several computer programs are available for determining 10 sequence identity. Analogs of a truncated VRP polypeptide or subunit are functional equivalents having similar amino acid sequence and retaining, to some extent, one or more activities of the related truncated VRP polypeptide or subunit. By "functional 15 equivalent" is meant the analog has an activity that can be substituted for one or more activities of a particular truncated VRP polypeptide or subunit. Preferred functional equivalents retain all of the activities of a particular truncated VRP polypeptide or subunit, however, the functional 20 equivalent may have an activity that, when measured quantitatively, is stronger or weaker, as measured in VRP functional assays, for example, such as those disclosed herein. In most cases, such truncated VRP polypeptides or subunits must be incorporated into a truncated VRP dimer in order to measure 25 functional activity. Preferred functional equivalents have activities that are within 1% to 10,000% of the activity of the related truncated VRP polypeptide or subunit, more preferably between 10% to 1000%, and more preferably within 50% to 200%. The ability of a derivative to retain some activity can be 30 measured using techniques described herein. Derivatives include modification occurring during or after translation, for example, by phosphorylation, glycosylation, crosslinking, acylation, proteolytic cleavage, linkage to an antibody Printed from Mimosa WO 98/49300 23 PCT/US98/07801 molecule, membrane molecule or other ligand (see Ferguson et al., 1988, Annu. Rev. Biochem. 57:285-320). Specific types of derivatives or analogs also include amino acid alterations such as deletions, substitutions, 5 additions, and amino acid modifications. A "deletion" refers to the absence of one or more amino acid residue(s) in the related polypeptide. An "addition" refers to the presence of one or more amino acid residue(s) in the related polypeptide. Additions and deletions to a polypeptide may be at the amino 10 terminus, the carboxy terminus, and/or internal. Amino acid "modification" refers to the alteration of a naturally occurring amino acid to produce a non-naturally occurring amino acid. A "substitution" refers to the replacement of one or more amino acid residue(s) by another amino acid residue(s) in 15 the polypeptide. Derivatives can contain different combinations of alterations including more than one alteration and different types of alterations. While the effect of an amino acid change on VRP activity varies depending upon factors such as phosphorylation, 20 glycosylation, intra-chain linkages, tertiary structure, and the role of the amino acid in the active site or a possible allosteric site, it is generally preferred that the substituted amino acid is from the same group as the amino acid being replaced. To some extent the following groups contain amino 25 acids which are interchangeable: the basic amino acids lysine, arginine, and histidine; the acidic amino acids aspartic and glutamic acids; the neutral polar amino acids serine, threonine, cysteine, glutamine, asparagine and, to a lesser extent, methionine; the nonpolar aliphatic amino acids glycine, 30 alanine, valine, isoleucine, and leucine (however, because of size, glycine and alanine are more closely related and valine, isoleucine and leucine are more closely related); and the aromatic amino acids phenylalanine, tryptophan, and tyrosine. In addition, although classified in different categories, Printed from Mimosa WO 98/49300 24 PCT/US98/07801 alanine, glycine, and serine seem to be interchangeable to some extent, and cysteine additionally fits into this group, or may be classified with the polar neutral amino acids. Preferred derivatives have one or more amino acid 5 alteration(s) which do not significantly affect the activity of the related truncated VRP polypeptide or subunit. In regions of the truncated VRP polypeptide or subunit not necessary for VRP activity, amino acids may be deleted, added or substituted with less risk of affecting activity. In 10 regions required for VRP activity, amino acid alterations are less preferred as there is a greater risk of affecting VRP activity. Such alterations should be conservative alterations. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar 15 polarity which acts as a functional equivalent. Conserved regions tend to be more important for protein activity than non-conserved regions. Standard procedures can be used to determine the conserved and non-conserved regions important for VRP activity using in vitro mutagenesis 20 techniques or deletion analyses and measuring VRP activity as described by the present disclosure. Derivatives can be produced using standard chemical techniques and recombinant nucleic acid molecule techniques. Modifications to a specific polypeptide may be deliberate, as 25 through site-directed mutagenesis and amino acid substitution during solid-phase synthesis, or may be accidental such as through mutations in hosts which produce the polypeptide. Polypeptides including derivatives can be obtained using standard techniques such as those described in Sambrook et al., 30 Molecular Cloning, Cold Spring Harbor Laboratory Press (1989). For example, Chapter 15 of Sambrook describes procedures for site-directed mutagenesis of cloned DNA. By a "truncated VRP polypeptide" is meant a polypeptide comprising the amino acid sequence of a truncated VRP subunit Printed from Mimosa WO 98/49300 25 PCT/US98/07801 of the invention, or a functional analog or derivative thereof as described herein. The term "truncated VRP polypeptide" also includes a truncated VRP subunit; the term subunit generally referring to a peptide that has been folded into an active 5 three-dimensional structure. By "truncated VRP" is meant a dimer of two VRP subunits. The two subunits may be derived from two different VRPs where both subunits are truncated VRP subunits. One or both of the subunits may be truncated; the two subunits may also have 10 different N-terminal deletions. It is advantageous that the truncated VRP, truncated VRP subunit, or truncated VRP polypeptide be enriched or purified. By the use of the term "enriched" in this context is meant that the specific amino acid sequence constitutes a significantly 15 higher fraction (2-5 fold) of the total of amino acid sequences present in the cells or solution of interest than in normal or diseased cells or in the cells from which the sequence was taken. This could be caused by a person by preferential reduction in the amount of other amino acid 20 sequences present, or by a preferential increase in the amount of the specific amino acid sequence of interest, or by a combination of the two. However, it should be noted that enriched does not imply that there are no other amino acid sequences present, just that the relative amount of the 25 sequence of interest has been significantly increased. The term "significant" here is used to indicate that the level of increase is useful to the person making such an increase, and generally means an increase relative to other amino acid sequences of about at least 2 fold, more preferably at least 5 30 to 10 fold or even more. The term also does not imply that there is no amino acid sequence from other sources. The other source amino acid sequence may, for example, comprise amino acid encoded by a yeast or bacterial genome, or a cloning vector such as pUC19. The term is meant to cover only those Printed from Mimosa WO 98/49300 26 PCT/US98/07801 situations in which man has intervened to elevate the proportion of the desired amino acid sequence. It is also advantageous for some purposes that an amino acid sequence be in purified form. The term "purified" in 5 reference to a polypeptide does not require absolute purity (such as a homogeneous preparation); instead, it represents an indication that the sequence is relatively purer than in the natural environment (compared to the natural level this level should be at least 10 fold greater, e.g., in terms of mg/ml) . 10 Purification of at least one order of magnitude, preferably two or three orders, and more preferably four or five orders of magnitude is expressly contemplated. The substance is preferably free of contamination at a functionally significant level, for example 90%, 95%, or 99% pure. 15 In another aspect the invention features a nucleic acid molecule encoding a truncated VRP polypeptide or subunit. In some situations it is desirable for such nucleic acid molecule to be enriched or purified. By the use of the term "enriched" in reference to nucleic acid molecule is meant that 20 the specific DNA or RNA sequence constitutes a significantly higher fraction (2-5 fold) of the total DNA or RNA present in the cells or solution of interest than in normal or diseased cells or in the cells from which the sequence was taken. This could be caused by a person by preferential reduction in the 25 amount of other DNA or RNA present, or by a preferential increase in the amount of the specific DNA or RNA sequence, or by a combination of the two. However, it should be noted that enriched does not imply that there are no other DNA or RNA sequences present, just that the relative amount of the 30 sequence of interest has been significantly increased. The term significant here is used to indicate that the level of increase is useful to the person making such an increase, and generally means an increase relative to other nucleic acids of about at least 2 fold, more preferably at least 5 to 10 fold or Printed from Mimosa WO 98/49300 27 PCT/US98/07801 even more. The term also does not imply that there is no DNA or RNA from other sources. The other source DNA may, for example, comprise DNA from a yeast or bacterial genome, or a cloning vector such as pUC19. This term distinguishes from 5 naturally occurring events, such as viral infection, or tumor type growths, in which the level of one mRNA may be naturally increased relative to other species of mRNA. That is, the term is meant to cover only those situations in which a person has intervened to elevate the proportion of the desired nucleic 10 acid. It is also advantageous for some purposes that a nucleotide sequence be in purified form. The term "purified" in reference to nucleic acid molecule does not require absolute purity (such as a homogeneous preparation); instead, it 15 represents an indication that the sequence is relatively purer than in the natural environment (compared to the natural level this level should be at least 2-5 fold greater, e.g., in terms of mg/ml). The nucleic acid molecule may be constructed from an 20 existing VRP nucleotide sequence by modification using, for example, oligonucleotide site-directed mutagenesis, or by deleting sequences using restriction enzymes, or as described herein. Standard recombinant techniques for mutagenesis such as m vitro site-directed mutagenesis (Hutchinson et al., 25 Biol. Chem. 253:6551, (1978), Sambrook et al., Chapter 15, supra), use of TAB® linkers (Pharmacia), and PCR-directed mutagenesis can be used to create such mutations. The nucleic acid molecule may also be synthesized by the triester method or by using an automated DNA synthesizer. 30 The invention also features recombinant DNA vectors and recombinant DNA expression vectors preferably in a cell or an organism. The recombinant DNA vectors may contain a sequence coding for a truncated VRP or a functional derivative thereof in a vector containing a promoter effective to initiate Printed from Mimosa WO 98/49300 28 PCT/US98/07801 transcription in a host cell. The recombinant DNA vector can contain a transcriptional initiation region functional in a cell and a transcriptional termination region functional in a cell. 5 The present invention also relates to a cell or organism that contains the above-described nucleic acid molecule or recombinant DNA vector and thereby is capable of expressing a truncated VRP peptide. The polypeptide may be purified from cells which have been altered to express the polypeptide. A 10 cell is said to be "altered to express a desired polypeptide" when the cell, through genetic manipulation, is made to produce a protein which it normally does not produce or which the cell normally produces at lower levels. One skilled in the art can readily adapt procedures for introducing and expressing either 15 genomic, cDNA, or synthetic sequences into either eukaryotic or prokaryotic cells. A nucleic acid molecule, such as DNA, is said to be "capable of expressing" a polypeptide if it contains nucleotide sequences which contain transcriptional and translational 20 regulatory information and such sequences are "operably linked" to nucleotide sequences which encode the polypeptide. The precise nature of the regulatory regions needed for gene sequence expression may vary from organism to organism, but shall in general include a promoter region which, in 25 prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation. Such regions will normally include those 5'-non-coding sequences involved with initiation of transcription and 30 translation, such as the TATA box, capping sequence, CAAT sequence, and the like. For example, the entire coding sequence of a truncated VRP subunit or a fragment thereof, may be combined with one or more of the following in an appropriate expression vector to allow Printed from Mimosa WO 98/49300 29 PCT/US98/07801 for such expression: (1) an exogenous promoter sequence (2) a ribosome binding site (3) a polyadenylation signal (4) a secretion signal. Modifications can be made in the 5'-untranslated and 31-untranslated sequences to improve expression in a prokaryotic or eukaryotic cell; or codons may be modified such that while they encode an identical amino acid, that codon may be a preferred codon in the chosen expression system. The use of such preferred codons is described in, for example, Grantham et al., Nuc. Acids Res., 9:43-74 (1981), and Lathe, J. Mol. Biol., 183:1-12 (1985) hereby incorporated by reference herein in their entirety. If desired, the non-coding region 3' to the genomic VRP sequence may be operably linked to the nucleic acid molecule encoding such VRP subunit. This region may be used in the recombinant DNA vector for its transcriptional termination regulatory sequences, such as termination and polyadenylation. Thus, by retaining the 31-region naturally contiguous to the DNA sequence encoding a VRP gene, the transcriptional termination signals may be provided. Alternatively, a 3' region functional in the host cell may be substituted. An operable linkage is a linkage in which the regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene sequence expression. Two DNA sequences (such as a promoter region sequence and a truncated VRP sequence) are said to be operably linked if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation in the coding sequence, (2) interfere with the ability of the promoter region sequence to direct the transcription of a truncated VRP gene sequence, or (3) interfere with the ability of the a truncated VRP gene sequence to be transcribed by the promoter region sequence. Thus, a promoter region would be operably linked to a DNA sequence if the promoter were capable of effecting transcription of that DNA sequence. Thus, to express Printed from Mimosa WO 98/49300 30 PCT/US98/07801 a truncated VRP gene, transcriptional and translational signals recognized by an appropriate host are necessary. Expression and Purification of Novel Truncated VRP Sequences Examples 2 and 3 describe the expression and purification 5 of novel truncated VRP sequences of the present invention as expressed in baculovirus systems. Those skilled in the art will recognize that the truncated VRPs of the present invention may also be expressed in other cell systems, both prokaryotic and eukaryotic, all of which are within the scope of the 10 present invention. Examples 4-6 provide examples of suitable assays for functional activity of the novel truncated VRPs. Although the truncated VRPs of the present invention may be expressed in prokaryotic cells, which are generally very efficient and convenient for the production of recombinant 15 proteins, the truncated VRPs produced by such cells will not be glycosylated and therefore may have a shorter half-life in vivo. Prokaryotes most frequently are represented by various strains of E. coli. However, other microbial strains may also be used, including other bacterial strains. Recognized 20 prokaryotic hosts include bacteria such as E. coli, Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, and the like. The prokaryotic host must be compatible with the replicon and control sequences in the expression plasmid. In prokaryotic systems, plasmid vectors that contain 25 replication sites and control sequences derived from a species compatible with the host may be used. Examples of suitable plasmid vectors may include pBR322, pUCll8, pUC119 and the like; suitable phage or bacteriophage vectors may include ygtlO, Ygtll and the like; and suitable virus vectors may include pMAM-30 neo, pKRC and the like. Preferably, the selected vector of the present invention has the capacity to replicate in the selected host cell. To express truncated VRP polypeptides or subunits (or a functional derivative thereof) in a prokaryotic cell, it is Printed from Mimosa WO 98/49300 31 PCT/US98/07801 necessary to operably link the truncated VRP sequence to a functional prokaryotic promoter. Such promoters may be either constitutive or, more preferably, regulatable (i.e., inducible or derepressible). Examples of constitutive promoters include 5 the int promoter of bacteriophage X, the bla promoter of the P-lactamase gene sequence of pBR322, and the CAT promoter of the chloramphenicol acetyl transferase gene sequence of pPR325, and the like. Examples of inducible prokaryotic promoters include the major right and left promoters of bacteriophage X 10 (PL and PR) , the trp, recA, XacZ, XacI, and gal promoters of E. coli, the a-amylase (Ulmanen et al., J. Bacteriol. 162:176-182(1985)) and the £-28-specific promoters of B. subtilis (Gilman et at., Gene sequence 32:11-20(1984)), the promoters of the bacteriophages of Bacillus (Gryczan, In: The Molecular 15 Biology of the Bacilli, Academic Press, Inc., NY (1982)), and Streptomyces promoters (Ward et at., Mol. Gen. Genet. 203:4 68-478(1986)). Prokaryotic promoters are reviewed by Glick (J. Ind. Microbiot. 2:277-282(1987)); Cenatiempo (Biochimie 68:505-516(1986)); and Gottesman (Ann. Rev. Genet. 28:415-442 (1984)). 20 Proper expression in a prokaryotic cell also requires the presence of a ribosome binding site upstream of the gene sequence-encoding sequence. Such ribosome binding sites are disclosed, for example, by Gold et at. (Ann. Rev. Microbiol. 35:365-404(1981)) . The ribosome binding site and other 25 sequences required for translation initiation are operably linked to the nucleic acid molecule coding for the truncated VRP by, for example, in frame ligation of synthetic oligonucleotides that contain such control sequences. For expression in prokaryotic cells, no signal peptide sequence is 30 required. The selection of control sequences, expression vectors, transformation methods, and the like, are dependent on the type of host cell used to express the gene. As used herein, "cell", "cell line", and "cell culture" may be used interchangeably and all such designations include Printed from Mimosa WO 98/49300 PCT/US98/07801 32 progeny. Thus, the words "transformants" or "transformed cells" include the primary subject cell and cultures derived therefrom, without regard to the number of transfers. Truncated VRP peptides expressed in prokaryotic cells are 5 expected to comprise a mixture of properly truncated VRP peptides with the N-terminal sequence predicted from the sequence of the expression vector, and truncated VRP peptides which have an N-terminal methionine resulting from inefficient cleaving of the initiation methionine during bacterial 10 expression. Both types of truncated VRP peptides are considered to be within the scope of the present invention as the presence of an N-terminal methionine is not expected to affect biological activity. It is also understood that all progeny may not be precisely identical in DNA content, due to 15 deliberate or inadvertent mutations. However, as defined, mutant progeny have the same functionality as that of the originally transformed cell. Preferred prokaryotic vectors include plasmids such as those capable of replication in E. coil (such as, for example, 20 pBR322, ColEl, pSClOl, pACYC 184, 7tVX. Such plasmids are, for example, disclosed by Sambrook (cf. "Molecular Cloning: A Laboratory Manual", second edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, (1989)). Bacillus plasmids include pC194, pC221, pT127, and the like. 25 Such plasmids are disclosed by Gryczan (In: The Molecular Biology of the Bacilli, Academic Press, NY (1982), pp. 307-329) . Suitable Streptomyces plasmids include plJlOl (Kendall et al., J. Bacteriol. 169:4177-4183 (1987)), and streptomyces bacteriophages such as <|)C31 (Chater et al., In: Sixth 30 International Symposium on Actinomycetales Biology, Akademiai Kaido, Budapest, Hungary (1986), pp. 45-54) . Pseudomonas plasmids are reviewed by John et al. (Rev. Infect. Pis. 8:693-704(1986)), and Izaki (Jpn. J. Bacteriol. 33:729-742(1978)). Printed from Mimosa WO 98/49300 33 PCT/US98/07801 Eukaryotic host cells which may be used in the expression systems of the present invention are not strictly limited, provided that they are suitable for use in the expression of the truncated VRP peptide. Preferred eukaryotic hosts include, 5 for example, yeast, fungi, insect cells, mammalian cells either in vivo, or in tissue culture. Mammalian cells which may be useful as hosts include HeLa cells, cells of fibroblast origin such as VERO or CHO-K1, or cells of lymphoid origin and their derivatives. 10 The truncated VRPs of the present invention may also be expressed in human cells such as human embryo kidney 293EBNA cells which express Epstein-Barr virus nuclear antigen 1, as described, for example, in Olofsson, B. et al., Proc. Natl. Acad. Sci. USA 93:2576-2581 (1996). The cells are transfected 15 with the expression vectors of Example 2 by using calcium phosphate precipitation, and the cells are then incubated for at least 48 hours. The truncated VRP peptides may then be purified from the supernatant as described in Example 3. In addition, plant cells are also available as hosts, and 20 control sequences compatible with plant cells are available, such as the cauliflower mosaic virus 35S and 19S, and nopaline synthase promoter and polyadenylation signal sequences. Another preferred host is an insect cell, for example the Drosophila larvae. Using insect cells as hosts, the Drosophila 25 alcohol dehydrogenase promoter can be used. Rubin, Science 240:1453-1459(1988). Any of a series of yeast gene sequence expression systems can be utilized which incorporate promoter and termination elements from the actively expressed gene sequences coding for 30 glycolytic enzymes are produced in large quantities when yeast are grown in mediums rich in glucose. Known glycolytic gene sequences can also provide very efficient transcriptional control signals. Yeast provides substantial advantages in that it can also carry out post-translational peptide modifications. Printed from Mimosa WO 98/49300 34 PCT/US98/07801 A number of recombinant DNA strategies exist which utilize strong promoter sequences and high copy number of plasmids which can be utilized for production of the desired proteins in yeast. Yeast recognizes leader sequences on cloned mammalian 5 gene sequence products and secretes peptides bearing leader sequences (i.e., pre-peptides). For a mammalian host, several possible vector systems are available for the expression of truncated VRP peptides. A wide variety of transcriptional and translational 10 regulatory sequences may be employed, depending upon the nature of the host. The transcriptional and translational regulatory signals may be derived from viral sources, such as adenovirus, bovine papilloma virus, cytomegalovirus, simian virus, or the like, where the regulatory signals are associated with a 15 particular gene sequence which has a high level of expression. Alternatively, promoters from mammalian expression products, such as actin, collagen, myosin, and the like, may be employed. Transcriptional initiation regulatory signals may be selected which allow for repression or activation, so that expression of 20 the gene sequences can be modulated. Of interest are regulatory signals which are temperature-sensitive so that by varying the temperature, expression can be repressed or initiated, or are subject to chemical (such as metabolite) regulation. 25 Expression of truncated VRPs in eukaryotic hosts requires the use of eukaryotic regulatory regions. Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis. Preferred eukaryotic promoters include, for example, the promoter of the mouse metallothionein 30 I gene sequence (Hamer et al., J. Mol. Appl. Gen. 2:273-288(1982)); the TK promoter of Herpes virus (McKnight, Cell 32:355-365 (1982)); the SV40 early promoter (Benoist et al., Nature (London) 290:304-310(1981)); the yeast gal4 gene sequence promoter (Johnston et al., Proc. Natl. Acad. Sci. Printed from Mimosa WO 98/49300 35 PCT/US98/07801 (USA) 75:6971-6975(1982); Silver et al., Proc. Natl. Acad. Sci. (USA) 81:5951-5955 (1984)). Translation of eukaryotic mRNA is initiated at the codon which encodes the first methionine. For this reason, it is 5 preferable to ensure that the linkage between a eukaryotic promoter and a DNA sequence which encodes a truncated VRP (or a functional derivative thereof) does not contain any intervening codons which are capable of encoding a methionine (i.e., AUG). The presence of such codons results either in a formation of a 10 fusion protein (if the AUG codon is in the same reading frame as the truncated VRP coding sequence) or a frame-shift mutation (if the AUG codon is not in the same reading frame as the truncated VRP coding sequence). A truncated VRP nucleic acid molecule and an operably 15 linked promoter may be introduced into a recipient prokaryotic or eukaryotic cell either as a nonreplicating DNA (or RNA) molecule, which may either be a linear molecule or, more preferably, a closed covalent circular molecule. Since such molecules are incapable of autonomous replication, the 20 expression of the gene may occur through the transient expression of the introduced sequence. Alternatively, permanent expression may occur through the integration of the introduced DNA sequence into the host chromosome. A vector may be employed which is capable of integrating 25 the desired gene sequences into the host cell chromosome. Cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or more markers which allow for selection of host cells which contain the expression vector. The marker may provide for prototrophy 30 to an auxotrophic host, biocide resistance, e.g., antibiotics, or heavy metals, such as copper, or the like. The selectable marker gene sequence can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection. Additional elements may also be Printed from Mimosa WO 98/49300 36 PCT/US98/07801 needed for optimal synthesis of single chain binding protein mRNA. These elements may include splice signals, as well as transcription promoters, enhancers, and termination signals. cDNA expression vectors incorporating such elements include 5 those described by Okayama, Molec. Cell. Biol. 3:280 (1983). The introduced nucleic acid molecule can be incorporated into a plasmid or viral vector capable of autonomous replication in the recipient host. Any of a wide variety of vectors may be employed for this purpose. Factors of 10 importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether 15 it is desirable to be able to "shuttle" the vector between host cells of different species. Preferred eukaryotic plasmids include, for example, BPV, vaccinia, SV40, 2-micron circle, and the like, or their derivatives. Such plasmids are well known in the art (Botstein 20 et al., Miami Wntr. Symp. 19:265-274(1982); Broach, In: "The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, p. 445-470 (1981); Broach, Cell 28:203-204 (1982); Bollon et al., J. Clin. Hematol. Oncol. 10:39-48 (1980); 25 Maniatis, In: Cell Biology: A Comprehensive Treatise, Vol. 3, Gene Sequence Expression, Academic Press, NY, pp. 563-608(1980). Once the vector or nucleic acid molecule containing the construct(s) has been prepared for expression, the DNA 30 construct(s) may be introduced into an appropriate host cell by any of a variety of suitable means, i.e., transformation, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, lipofection, calcium phosphate precipitation, direct microinjection, DEAE-dextran Printed from Mimosa WO 98/49300 37 PCT/US98/07801 transfection, and the like. The most effective method for transfection of eukaryotic cell lines with plasmid DNA varies with the given cell type. After the introduction of the vector, recipient cells are grown in a selective medium, which 5 selects for the growth of vector-containing cells. Expression of the cloned gene molecule(s) results in the production of truncated VRP or fragments thereof. This can take place in the transformed cells as such, or following the induction of these cells to differentiate (for example, by administration of 10 bromodeoxyuracil to neuroblastoma cells or the like). A variety of incubation conditions can be used to form the peptide of the present invention. The most preferred conditions are those which mimic physiological conditions. Production of the stable transfectants, may be 15 accomplished by, for example, transfection of an appropriate cell line with an eukaryotic expression vector, such as pCEP4, in which the coding sequence for the truncated VRP polypeptide or subunit has been cloned into the multiple cloning site. These expression vectors contain a promoter region, such as 20 the human cytomegalovirus promoter (CMV), that drive high-level transcription of desired DNA molecules in a variety of mammalian cells. In addition, these vectors contain genes for the selection of cells that stably express the DNA molecule of interest. The selectable marker in the pCEP4 vector encodes an 25 enzyme that confers resistance to hygromycin, a metabolic inhibitor that is added to the culture to kill the nontransfected cells. Cells that have stably incorporated the transfected DNA will be identified by their resistance to selection media, as 30 described above, and clonal cell lines will be produced by expansion of resistant colonies. The expression of the truncated VRPs DNA by these cell lines will be assessed by solution hybridization and Northern blot analysis. Printed from Mimosa WO 98/49300 38 PCT/US98/07801 Pharmaceutical Compositions and Therapeutic Uses One object of this invention is to provide truncated VRP in a pharmaceutical composition suitable for therapeutic use. Thus, in one aspect the invention provides a method for stimulating angiogenesis in a patient by administering a therapeutically effective amount of pharmaceutical composition comprising a truncated VRP. By "therapeutically effective amount" is meant an amount of a compound which produces the desired therapeutic effect in a patient. For example, in reference to a disease or disorder, it is the amount which reduces to some extent one or more symptoms of the disease or disorder, and returns to normal, either partially or completely, physiological or biochemical parameters associated or causative of the disease or disorder. When used to therapeutically treat a patient it is an amount expected to be between 0.1 mg/kg to 100 mg/kg, preferably less than 50 mg/kg, more preferably less than 10 mg/kg, more preferably less than 1 mg/kg. The amount of compound depends on the age, size, and disease associated with the patient. The optimal formulation and mode of administration of compounds of the present application to a patient depend on factors known in the art such as the particular disease or disorder, the desired effect, and the type of patient. While the compounds will typically be used to treat human patients, they may also be used to treat similar or identical diseases in other vertebrates such as other primates, farm animals such as swine, cattle and poultry, and sports animals and pets such as horses, dogs and cats. Preferably, the therapeutically effective amount is provided as a pharmaceutical composition. A pharmacological agent or composition refers to an agent or composition in a form suitable for administration into a multicellular organism such as a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, transdermal, or by Printed from Mimosa WO 98/49300 39 PCT/US98/07801 infection. Such forms should allow the agent or composition to reach a target cell whether the target cell is present in a multicellular host or in culture. For example, pharmacological agents or compositions injected into the blood stream should 5 be soluble. Other factors are known in the art, and include considerations such as toxicity and forms which prevent the agent or composition from exerting its effect. The claimed compositions can also be formulated as pharmaceutically acceptable salts (e.g., acid addition salts) 10 and/or complexes thereof. Pharmaceutically acceptable salts are non-toxic salts at the concentration at which they are administered. The preparation of such salts can facilitate the pharmacological use by altering the physical-chemical characteristics of the composition without preventing the 15 composition from exerting its physiological effect. Examples of useful alterations in physical properties include lowering the melting point to facilitate transmucosal administration and increasing the solubility to facilitate the administration of higher concentrations of the drug. 20 Pharmaceutically acceptable salts include acid addition salts such as those containing sulfate, hydrochloride, phosphate, sulfonate, sulfamate, sulfate, acetate, citrate, lactate, tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, cyclolexylsulfonate, 25 cyclohexylsulfamate and quinate. Pharmaceutically acceptable salts can be obtained from acids such as hydrochloric acid, sulfuric acid, phosphoric acid, sulfonic acid, sulfamic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic acid, 30 benzenesulfonic acid, p-toluenesulfonic acid, cyclcohexylsulfonic acid, cyclohexylsulfamic acid, and quinic acid. Such salts may be prepared by, for example, reacting the free acid or base forms of the product with one or more equivalents of the appropriate base or acid in a solvent or Printed from Mimosa WO 98/49300 40 PCT/US98/07801 medium in which the salt is insoluble, or in a solvent such as water which is then removed m vacuo or by freeze-drying or by exchanging the ions of an existing salt for another ion on a suitable ion exchange resin. 5 Carriers or excipients can also be used to facilitate administration of the compound. Examples of carriers and excipients include calcium carbonate, calcium phosphate, various sugars such as lactose, glucose, or sucrose, or types of starch, cellulose derivatives, gelatin, vegetable oils, 10 polyethylene glycols and physiologically compatible solvents. The compositions or pharmaceutical composition can be administered by different routes including intravenously, intraperitoneal, subcutaneous, and intramuscular, orally, topically, or transmucosally. 15 The desired isotonicity may be accomplished using sodium chloride or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol, polyols (such as mannitol and sorbitol), or other inorganic or organic solutes. Sodium chloride is preferred particularly for 20 buffers containing sodium ions. The compounds of the invention can be formulated for a variety of modes of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remington's 25 Pharmaceutical Sciences, 18th Edition, Mack Publishing Co., Easton, PA, 1990. See also Wang, Y.J. and Hanson, M.A. "Parenteral Formulations of Proteins and Peptides: Stability and Stabilizers," Journal of Parenteral Science and Technology, Technical Report No. 10, Supp. 42:2S (1988). A suitable 30 administration format may best be determined by a medical practitioner for each patient individually. For systemic administration, injection is preferred, e.g., intramuscular, intravenous, intraperitoneal, subcutaneous, intrathecal, or intracerebroventricular. For injection, the Printed from Mimosa WO 98/49300 41 PCT/US98/07801 compounds of the invention are formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution. Alternatively, the compounds of the invention are formulated in one or more excipients (e.g., 5 propylene glycol) that are generally accepted as safe as defined by USP standards. They can, for example, be suspended in an inert oil, suitably a vegetable oil such as sesame, peanut, olive oil, or other acceptable carrier. Preferably, they are suspended in an aqueous carrier, for example, in an 10 isotonic buffer solution at a pH of about 5.6 to 7.4. These compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH 15 buffering agents. Useful buffers include for example, sodium acetate/acetic acid buffers. A form of repository or "depot" slow release preparation may be used so that therapeutically effective amounts of the preparation are delivered into the bloodstream over many hours or days following transdermal 20 injection or delivery. In addition, the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included. Systemic administration can also be by transmucosal or transdermal means, or the molecules can be administered orally. 25 For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents 30 may be used to facilitate permeation. Transmucosal administration may be, for example, through nasal sprays or using suppositories. For oral administration, the molecules are formulated into conventional oral administration dosage forms such as capsules, tablets, and liquid preparations. Printed from Mimosa WO 98/49300 42 PCT/US98/07801 For topical administration, the compounds of the invention are formulated into ointments, salves, gels, or creams, as is generally known in the art. If desired, solutions of the above compositions may be 5 thickened with a thickening agent such as methyl cellulose. They may be prepared in emulsified form, either water in oil or oil in water. Any of a wide variety of pharmaceutically acceptable emulsifying agents may be employed including, for example, acacia powder, a non-ionic surfactant (such as a 10 Tween), or an ionic surfactant (such as alkali polyether alcohol sulfates or sulfonates, e.g., a Triton). Compositions useful in the invention are prepared by mixing the ingredients following generally accepted procedures. For example, the selected components may be simply mixed in a 15 blender or other standard device to produce a concentrated mixture which may then be adjusted to the final concentration and viscosity by the addition of water or thickening agent and possibly a buffer to control pH or an additional solute to control tonicity. 20 The amounts of various compounds of this invention to be administered can be determined by standard procedures. Generally, a therapeutically effective amount is between about 1 nmole and 3 fxmole of the molecule, preferably between about 10 nmole and 1 jxmole depending on the age and size of the 25 patient, and the disease or disorder associated with the patient. Generally, it is an amount between about 0.1 and 50 mg/kg, preferably 1 and 20 mg/kg of the animal to be treated. For use by the physician, the compositions will be provided in dosage unit form containing an amount of a 30 truncated VRP, VRP polypeptide, or VRP subunit. Gene Therapy A truncated VRP or its genetic sequences will also be useful in gene therapy (reviewed in Miller, Nature 357:455-460 Printed from Mimosa WO 98/49300 43 PCT/US98/07801 (1992)). Miller states that advances have resulted in practical approaches to human gene therapy that have demonstrated positive initial results. The basic science of gene therapy is described in Mulligan, Science 260:926-931 5 (1993). One example of gene therapy is presented in Example 7, which describes the use of adenovirus-mediated gene therapy. As another example, an expression vector containing the truncated VRP coding sequence may be inserted into cells, the cells are grown in vitro and then injected or infused in large 10 numbers into patients. In another example, a DNA segment containing a promoter of choice (for example a strong promoter) is transferred into cells containing an endogenous truncated VRP in such a manner that the promoter segment enhances expression of the endogenous truncated VRP gene (for example, 15 the promoter segment is transferred to the cell such that it becomes directly linked to the endogenous truncated VRP gene). The gene therapy may involve the use of an adenovirus vector including a nucleotide sequence coding for a truncated VRP subunit, or a naked nucleic acid molecule coding for a 20 truncated VRP subunit. Alternatively, engineered cells containing a nucleic acid molecule coding for a truncated VRP subunit may be injected. Example 7 illustrates a method of gene therapy using an adenovirus vector to provide angiogenesis therapy. 25 Expression vectors derived from viruses such as retroviruses, vaccinia virus, adenovirus, adeno-associated virus, herpes viruses, several RNA viruses, or bovine papilloma virus, may be used for delivery of nucleotide sequences (e.g., cDNA) encoding recombinant truncated VRP subunit into the 30 targeted cell population. Methods which are well known to those skilled in the art can be used to construct recombinant viral vectors containing coding sequences. See, for example, the techniques described in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. Printed from Mimosa WO 98/49300 44 PCT/US98/07801 (1989), and m Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y. (1989). Alternatively, recombinant nucleic acid molecules encoding protein sequences can be used as naked DNA or in 5 reconstituted system e.g., liposomes or other lipid systems for delivery to target cells (See e.g., Feigner et al., Nature 337:387-8, 1989). Several other methods for the direct transfer of plasmid DNA into cells exist for use in human gene therapy and involve targeting the DNA to receptors on cells by 10 complexmg the plasmid DNA to proteins. See, Miller, Nature 357:455-60, 1992. In its simplest form, gene transfer can be performed by simply injecting minute amounts of DNA into the nucleus of a cell, through a process of microinjection. Capecchi MR, Cell 15 22:479-88 (1980). Once recombinant genes are introduced into a cell, they can be recognized by the cells normal mechanisms for transcription and translation, and a gene product will be expressed. Other methods have also been attempted for introducing DNA into larger numbers of cells. These methods 20 include: transfection, wherein DNA is precipitated with calcium phosphate and taken into cells by pinocytosis (Chen C. and Okayama H, Mol. Cell Biol. 7:2745-52 (1987)); electroporation, wherein cells are exposed to large voltage pulses to introduce holes into the membrane (Chu G. et al., 25 Nucleic Acids Res., 15:1311-26 (1987)); lipofection/liposome fusion, wherein DNA is packaged into lipophilic vesicles which fuse with a target cell (Feigner PL., et al., Proc. Natl. Acad. Sci. USA. 84:7413-7 (1987)); and particle bombardment using DNA bound to small projectiles (Yang NS. et al., Proc. 30 Natl. Acad. Sci. 87:9568-72 (1990)). Another method for introducing DNA into cells is to couple the DNA to chemically modified proteins. It has also been shown that adenovirus proteins are capable of destabilizing endosomes and enhancing the uptake of Printed from Mimosa WO 98/49300 45 PCT/US98/07801 DNA into cells. The admixture of adenovirus to solutions containing DNA complexes, or the binding of DNA to polylysine covalently attached to adenovirus using protein crosslinking agents substantially improves the uptake and expression of the 5 recombinant gene. Curiel DT et al., Am. J. Respir. Cell. Mol. Biol., 6:247-52 (1992). In addition, it has been shown that adeno-associated virus vectors may be used for gene delivery into vascular cells (Gnatenko, D., J. of Invest. Med. 45:87-97, (1997)). 10 As used herein "gene transfer" means the process of introducing a foreign nucleic acid molecule into a cell. Gene transfer is commonly performed to enable the expression of a particular product encoded by the gene. The product may include a protein, polypeptide, anti-sense DNA or RNA, or 15 enzymatically active RNA. Gene transfer can be performed in cultured cells or by direct administration into animals. Generally gene transfer involves the process of nucleic acid molecule contact with a target cell by non-specific or receptor mediated interactions, uptake of nucleic acid molecule into the 20 cell through the membrane or by endocytosis, and release of nucleic acid molecule into the cytoplasm from the plasma membrane or endosome. Expression may require, in addition, movement of the nucleic acid molecule into the nucleus of the cell and binding to appropriate nuclear factors for 25 transcription. As used herein "gene therapy" is a form of gene transfer and is included within the definition of gene transfer as used herein and specifically refers to gene transfer to express a therapeutic product from a cell m vivo or in vitro. Gene 30 transfer can be performed ex vivo on cells which are then transplanted into a patient, or can be performed by direct administration of the nucleic acid molecule or nucleic acid-protein complex into the patient. Printed from Mimosa WO 98/49300 46 PCT/US98/07801 In another preferred embodiment, a vector having nucleic acid molecule sequences encoding a truncated VRP is provided in which the nucleic acid molecule sequence is expressed only in a specific tissue. Methods of achieving tissue-specific gene 5 expression as set forth in International Publication No. WO 93/09236, filed November 3, 1992 and published May 13, 1993. In another preferred embodiment, a method of gene replacement is set forth. "Gene replacement" as used herein means supplying a nucleic acid molecule sequence which is 10 capable of being expressed in vivo in an animal and thereby providing or augmenting the function of an endogenous gene which is missing or defective in the animal. In all of the preceding vectors set forth above, a further aspect of the invention is that the nucleic acid sequence 15 contained in the vector may include additions, deletions or modifications to some or all of the sequence of the nucleic acid, as defined above. Examples 20 To assist m understanding the present invention, the following Examples are included which describes the results of a series of experiments. The experiments relating to this invention should not, of course, be construed as specifically limiting the invention and such variations of the invention, 25 now known or later developed, which would be within the purview of one skilled in the art are considered to fall within the scope of the invention as described herein and hereinafter claimed. Printed from Mimosa WO 98/49300 47 PCT/US98/07801 Example 1 Cloning of N-Terminally Truncated VEGF-B, (des-(1-20)-p21-VEGF-B (or des(2-21)-VEGF-B). In order to create a novel VEGF-B-related protein that 5 lacks the first 20 amino acids, a cDNA construct is created in the following manner: A DNA encoding human VEGF-B is amplified from a human heart or skeletal muscle cDNA),or a human fetal brain cDNA library, or a cDNA preparation from another suitable human 10 tissue source by PCR with oligonucleotides corresponding to the published sequence of human VEGF-B. Using standard molecular biology techniques (Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor NY), a DNA fragment then is generated that 15 encodes at its 5' end the signal sequence of human VEGF-B, followed by a codon for proline, the first amino acid residue in mature VEGF-B, and then followed by codons corresponding to amino acids from residues 22 to the C-terminus of human VEGF-B, followed by a stop codon. Appropriate additional non-coding 20 nucleotide sequences are added to the 5' and 3' ends of this DNA construct so as to allow insertion of the DNA into an appropriate expression vector. In this manner the cleavage site for the signal peptide is preserved in a manner identical to that found in native VEGF-25 B. However, this strategy results in a change in the new N-terminal amino acid of the truncated VEGF-B. Whereas the normal N-terminal amino acid residue in des(1-20)-VEGF-B is a tyrosine residue: mspllrrlllvallqlartqa[PVSQFDGPSHQKKVVPWIDV]YTRAT, the new 30 N-terminal amino acid is proline, and the resulting truncated VEGF-B is equivalent to des(2-21)-VEGF-B): mspllrrlllvallqlartqaPTRAT... The change from the native amino acid of the truncated VEGF-B (tyrosine in the case of a a)20-residue truncation) is Printed from Mimosa WO 98/49300 48 PCT/US98/07801 not expected to have any effect on the biological activity of the truncated VEGF-B. The advantage of this strategy is that the signal peptide sequence is maintained thus ensuring efficient cleavage of the signal peptide from the precursor 5 during protein processing/secretion. In another example, truncated VEGF-B, des(1-15)-VEGF-B, is constructed by deleting the first 15 amino acids. The signal peptide cleavage site would be preserved in this case because residue#16 and residue#l (the new and old N-termini) are 10 identical (proline): mspllrrillvallqlartqa[PVSQFDGPSHQKKVV]PWIDVYTRAT... 4 mspllrrillvallqlartqaPWIDVYTRAT.. One of skill in the art would understand that other signal 15 peptides may be used in the present invention. For example, the signal peptide of VEGF-B or VEGF-C could be used which would require that the first amino acid of the truncated protein be an alanine or glycine, respectively, in order to preserve the respective signal peptide cleavage sites. A 20 further alternative would be to use signal peptide sequences from other known proteins; some of these may have cleavage sites compatible with the N-terminal tyrosine of the truncated des(1-20)-VEGF-B. Another alternative would be to generate a construct that 25 encodes a precursor protein with a cleavage site that incorporates two, rather than one, amino acids from the N-terminus of the original VEGF-B protein sequence. The purpose of this strategy would be to ensure more fully that the cleavage site is compatible with signal peptidase function. 30 This would introduce two new amino acids at the N-terminus of the truncated VEGF-B sequence but such a change would not be expected to alter biological function of the truncated peptide. Printed from Mimosa WO 98/49300 49 PCT/US98/07801 The strategy described to generate DNA for expression of des (1-20)-VEGF-B is useful for generation in an analogous manner of VEGF-B mutants with N-terminal truncations of other desired lengths. Further, the strategy is useful to generate 5 N-terminal truncations of other desired lengths in other VEGF-related forms and their isoforms of other species. Example 2: Expression Of N-Terminally Truncated VEGF-B Subunits The DNA fragment encoding truncated VEGF-B from Example 1 10 may be cloned into a suitable plasmid vector. Sf9 (Sporoptera frugiperda) cells are co-transfected with baculovirus transfer vector pAcUW51 containing cDNA encoding truncated VEGF-B and baculovirus (Baculogold, Pharmingen, San Diego, CA) . Selection and plaque purification of recombinant 15 virus are performed according to established protocols using Blue agar overlays (Gibco BRL). High stock of recombinant virus is produced in exponentially growing Sf9 cells using a multiplicity of infection of 0.05. For expression of truncated VEGF-B, Sf9 cells (1x106 cells/ml) growing in serum free medium 20 are infected with recombinant virus at a multiplicity of 10. Supernatant is collected after 72 hours post infection. VEGF expression in baculovirus-infected insect cells, which can be used to express the truncated VRPs of the present invention is also described in Fiebich et al., (Eur. J. Biochem. 211: 19-26, 25 1993) . In this system, VEGF has been shown to be produced in high yield, with efficient glycosylation similar to that seen in mammalian cells. In fact, those skilled in the art will recognize that expression in other systems, including mammalian cell expression systems, is considered to be within the scope 30 of this invention. Methods of expressing VEGF proteins which can be used to express the truncated VRPs of the present invention using baculovirus systems are also provided in references which describe VEGF expression, for example, U.S. Patent Serial No. 5,521,073, and in O'Reilly et al., Printed from Mimosa WO 98/49300 50 PCT/US98/07801 (Baculovirus Expression Vectors: A Laboratory Manual (W.H. Freeman, New York) , 1992). Those skilled in the art will recognize that other expression systems may also be used to express functionally 5 active truncated VRPs. Functionally active recombinant VEGF isoforms have been expressed in E. Coli (Wilting et al., Dev. Biol. 176, 76-85, 1996) from inclusion body by refolding according to the procedure described previously for homo- and heterodimers of 10 PDGF (Schneppe et al., Gene 143, 201-09, 1994) and in yeast (Mohanraj et al., Biochem. Biophys. Res. Commun. 215:750-56, 1995). Still other methods of expressing VEGF which can be used to express VRPs in the present invention are described, for 15 example, m Jasny, Science 238:1653, 1987; and Miller et al., In: Genetic Engineering, 1986), Setlow, J.K., et al., eds., Plenum, Vol. 8, pp. 277-297). Example 3: Purification Of Recombinant Truncated VRPS 20 For purification of the baculovirus-expressed truncated VEGF-B of Example 2 from insect-cell supernatant, a number of standard techniques can be used. These techniques include, but are not limited to ammonium sulfate precipitation, acetone precipitation, ion-exchange chromatography, size exclusion 25 chromatography, hydrophobic interaction chromatography, reverse-phase HPLC, concanavalin A affinity chromatography, isoelectric focusing, and chromatofocusing. Other standard protein purification techniques are readily obvious to one skilled in the art. For example, proteins with specific tags, 30 such as histidine tags, antigen tags, etc., could be produced by engineering DNA encoding such tags into the VEGF-B DNA such that proteins containing said tags in a manner compatible with the protein's biological activity would be expressed and purified by affinity chromatography directed at the tag. Such Printed from Mimosa WO 98/49300 51 PCT/US98/07801 methods are considered within the scope of the present invention. A preferred purification method for truncated forms of VEGF-B is described in the following: Sf9 Cell supernatant is centrifuged at 10000 rpm for 30 minutes to remove cell debris and viral particles. Supernatant is then concentrated and dialyzed against 20 mM Tris (pH 8.3) for 24 hours. The dialyzed supernatant is centrifuged again to remove insoluble material and loaded onto a Sepharose Q anion exchange column. Protein is eluted from the column by gradient elution using a gradient of NaCl (0 - 1 M NaCl) . Chromatography fractions are analyzed by SDS polyacrylamide gel electrophoresis and by ELISA using an antibody that recognizes VEGF-B. Fractions with VEGF-B immunoreactivity are pooled, concentrated, and dialyzed overnight against 0.1% trifluoroacetic acid. Material so prepared is further purified by reverse phase HPLC. Typically approximately 2-5 mg of protein is loaded on a semipreparative C4 column and eluted with a gradient of acetonitrile in 0.1% trifluoracetic acid as described in Esch et al., Meth. Enzymol. 103, 72-89, 1983. Fractions containing truncated VEGF-B are pooled and stored at -80 degrees Celsius until further use. A preferred method of purification of the basic and heparin-binding N-terminally truncated forms of VEGF-related protein subunits and analogs thereof includes the combined use of heparin-Sepharose affinity chromatography and cation-exchange chromatography, optionally followed by reverse-phase HPLC, essentially as described in Connolly et al., J. Biol. Chem. 264:20017-24, 1989, Gospodarowicz et al., (Proc. Natl. Acad. Sci. USA, 86:7311-15, 1989), or Plouet et al., (Embo J. 8:3801-06, 1989). Purification is monitored by following the elution of VRP-like material using a number of techniques including radioreceptor assay using 125I-labeled VRP and receptor Printed from Mimosa WO 98/49300 52 PCT/US98/07801 preparations consisting of cells or cell membrane preparations in functional assays as described in Examples 4-6. The truncated VRPs expressed in other eukaryotic cell systems such as yeast or mammalian cells, may be purified in 5 the same manner. Truncated VRPs expressed in prokaryotic cells will likely need to undergo a re-folding step for proper dimerization of subunits, as described in, for example, Schneppe et al., (Gene 143:201-09, 1994). 10 Example 4: Receptor-Binding Assay The binding of truncated VRPs to VEGF receptors can be assessed in various ways. Useful methods include the determination of the ability of VRP analogs to bind to 15 endothelial cells or to cells artificially transfected with KDR, or to soluble forms of the KDR receptor (for example, a KDR/alkaline phosphatase fusion protein (Gitay-Goren et al., J. Biol. Chem. 271:5519-23 (1996)). A preferred procedure has been described by Terman et al. (Biochem. Biophys. Res. Commun. 20 187:1579-86, 1992). In this procedure, KDR cDNA is transfected into CMT-3 monkey kidney cells by the DEAE-dextran method by incubating plated cells with DMEM containing 1 |ig/ml DNA, 0.5 ng/ml DEAE dextran, and 100 |xM chloroquine. Following incubation for 4 25 hours at 37 degrees Celsius, the medium is aspirated and cells are exposed to 10% DMSO in PBS for one minute. The cells are then washed once with DMEM containing 10% calf serum and then incubated for 40 hours at 37 degrees Celsius in DMEM/10% calf serum containing 100 p.M ZnCl2 and 1 (J.M CdCl2. 30 • VEGF-B is radioiodinated using either the Iodogen method or the chloramine T method. Radiolabelled VEGF-B is separated from excess free iodine-125 using gel filtration on a Sephadez G25 column or a heparin-Sepharose column. Specific activity of radiolabelled 125I-VEGF-B analog should typically be in the Printed from Mimosa WO 98/49300 53 PCT/US98/07801 order of 105 cpm/ng. For radioceptor assays, CMT-3 (105 cells/well) are plated in 12-well plates. Twenty four hours later, cells are washed twice with PBS, and 0.5 ml of DMEM containing 0.15% gelatin and 25 mM HEPES, pH 7.4 is added. 125I-VEGF-B, at concentrations ranging from 1-500 pM, is then added. Binding experiments are done in the presence or absence of 0.5 nM unlabeled VEGF-B for the determination of specific binding. After a 90-minute incubation at room temperature, a 50 jil sample of the media from each well is used to determine the concentration of free radioligand, and the wells are washed 3 times with ice cold PBS containing 0.1% BSA. Cells are extracted from the wells by incubation for 30 minutes with 1% Triton X100 in 100 mM sodium phosphate, pH 8.0, and the radioactivity of the extract is determined in a gamma counter. Example 5: Mitogenic Assay The mitogenic activity of truncated VRPs on endothelial cells of human or mammalian origin can be determined by a number of different procedures, including assays where cell proliferation is measured by growth of cell numbers or by incorporation of radioactive DNA precursors (thymidine incorporation) or otherwise appropriately labeled DNA precursors (bromo-deoxyuridine incorporation). These and other methods generally used to determine cell proliferation, including those methods where mitogenic activity is assessed in vivo (for example by determining the mitotix index of endothelial cells) are considered within the scope of this invention. A preferred method is described herein (Bohlen et al., Proc. Natl. Acad. Sci. USA 81:5364-68, 1994): Bovine aortic arch endothelial cells maintained in stock cultures in the presence of Dulbecco's modified Eagle's medium supplemented with 10% calf serum and antibiotics (gentamycin at 50 |ig/ml and fungizine at 0.25 |ig/ml) and basic fibroblast growth factor (1-10 ng/ml, added every 48 h) are passaged weekly at a split Printed from Mimosa WO 98/49300 54 PCT/US98/07801 ratio of 1:64. For mitogenic assays, cell monolayers from stock plates (at passages 3-10) are dissociated using trypsin. Cells are then seeded at a density of approximately 8000 cells/well in 24-well plates in the presence of DMEM and 5 antibiotics as described above. Samples to be assayed (1-10 p.1), appropriately diluted in DMEM/0.1% bovine serum albumin), are added six hours after plating of cells and again after 48 hours. After 4 days of culture, endothelial cells are detached from plates with trypsin and counted using a Coulter particle 10 counter. Another mitogenic activity assay is provided in Olofsson, B. et al., Proc. Natl. Acad. Sci. USA 93:2576-81, 1996). Second passage human umbilical vein endothelial cells (HUVECs) are plated into 96-well plates (4 X 103 cells per well) in M-199 15 medium supplemented with 10% (vol/vol) fetal bovine serum and incubated for 24 hours. Cell culture conditioned medium containing the truncated VRP, in the presence of 1-10 fig/ml heparin, or purified truncated VRP is added to the HUVECs, and the cells are stimulated for 48 hours. Fresh cell culture 20 conditioned medium containing [3H] thymidine (Amersham; 10 (iCi/ml) is added to the cells and stimulation is continued for another 48 hours. Cells are washed with PBS and trypsinized and the incorporated radioactivity is determined by liquid scintillation counting. The activity of truncated VRP is 25 compared to the activity of non-truncated VRP. In another alternative method, bovine capillary endothelial (BCE) cells are seeded into 24-well plates and grown until confluence in minimal essential medium (MEM) supplemented with 10% fetal calf serum. Cells are starved in 30 MEM supplemented with 3% fetal calf serum for 72 hours, after which conditioned medium diluted into serum-free medium is added to the cells and the cells are stimulated for 24 hours. [3H] thymidine is included during the last 4 hours of the stimulation (1 ^Ci/ml) . Cells are washed with PBS and lysed Printed from Mimosa WO 98/49300 55 PCT/US98/07801 with NaOH, and incorporated radioactivity is determined by liquid scintillation counting. The activity of truncated VRP is compared to that of non-truncated VRP. Bovine fibroblast growth factor (b-FGF) may be used as an additional control for mitogenic activity, and may also be used to measure its potentiating activity of truncated VRP activity. Example 6: Angiogenic Activity Of Truncated VRPS The angiogenic activity of substances can be determined using a variety of in vivo methods. Commonly used methods include the chick chorioallantoic membrane assay, the corneal pouch assay in rabbits, rats, or mice, the matrigel implant assay in mice, the rabbit ear chamber angiogenesis assay, the hamster cheek pouch assay, the Hunt-Schilling chamber model and the rat sponge implant model. Other assay methods to assess the formation of new blood vessels have been described in the literature and are considered to be within the scope of this invention. A preferred method for demonstrating the angiogenic activity of truncated VRPs is the rabbit corneal pouch assay. In this assay, Elvax (ethylene vinyl acetate) polymer pellets containing approximately 1-1000 ng of the growth factor and a constant amount of rabbit serum albumin as carrier is implanted into a surgical incision in the cornea as described in more detail in Phillips and Knighton, Wound Rep. Reg. 3, 533-539, 1995; Gimbrone et al., J. Natl. Cane. Inst. 52:413-27, 1974; Risau, Proc. Natl. Acad. Sci. USA 83:3855-59, 1986). Growth factor-induced vascularization of the cornea is then observed over a period of 2 weeks. Semiquantitative analysis is possible with morphometric and image analysis techniques using photographs of corneas. Printed from Mimosa WO 98/49300 56 PCT/US98/07801 Example 7: Gene-Transfer-Mediated Angiogenesis Therapy Using Truncated VRPS Truncated VRPs are used for gene-transfer-mediated angiogenesis therapy as described, for example, in 5 PCT/US96/02631, published September 6, 1996 as W096/26742, hereby incorporated by reference herein in its entirety. Adenoviral Constructs 10 A helper independent replication deficient human adenovirus 5 system may be used for gene-transfer. A nucleic acid molecule coding for a truncated VRP subunit may be cloned into the polylinker of plasmid ACCMVPLPA which contains the CMV 15 promoter and SV40 polyadenylation signal flanked by partial adenoviral sequences from which the ElA and E1B genes (essential for viral replication) have been deleted. This plasmid is co-transferred (lipofection) into 293 cells with plasmid JM17 which contains the entire human adenoviral 5 20 genome with an additional 4.3 kb insert making pJM17 too large to be encapsidated. Homologous rescue recombination results in adenoviral vectors containing the transgene in the absence of E1A/E1B sequences. Although these recombinants are nonreplicative in mammalian cells, they can propagate in 293 25 cells which have been transformed with E1A/E1B and provided these essential gene products in trans. Transfected cells are monitored for evidence of cytopathic effect which usually occurs 10-14 days after transfection. To identify successful recombinants, cell supernatant from plates showing a cytopathic 30 effect is treated with proteinase K (50 mg/ml with 0.5% sodium dodecyl sulfate and 20 mM EDTA) at 56°C for 60 minutes, phenol/ chloroform extracted and ethanol precipitated. Successful recombinants are then identified with PCR using primers (Biotechniques 15:868-72, 1993) complementary to the CMV Printed from Mimosa WO 98/49300 57 PCT/US98/07801 promoter and SV40 polyadenylation sequences to amplify the truncated VRP subunit nucleic acid insert and primers (Biotechniques 15:868-72, 1993) designed to concomitantly amplify adenoviral sequences. Successful recombinants then are 5 plaque purified twice. Viral stocks are propagated in 293 cells to titers ranging between 1010 and 1012 viral particles, and are purified by double CsCl gradient centrifugation prior to use. The system used to generate recombinant adenoviruses imposed a packing limit of 5kb for transgene inserts. The 10 truncated VRP genes, driven by the CMV promoter and with the SV40 polyadenylation sequences are well within the packaging constraints. Recombinant vectors are plaque purified by standard procedures. The resulting viral vectors are propagated on 293 cells to titers in the 1010-1012 viral 15 particles range. Cells are infected at 80% confluence and harvested at 36-48 hours. After freeze-thaw cycles the cellular debris is pelleted by standard centrifugation and the virus further purified by double CsCl gradient ultracentrifugation (discontinuous 1.33/1.45 CsCl gradient; 20 cesium prepared in 5 mM Tris, 1 mM EDTA (pH 7.8); 90,000 x g (2 hr) , 105,000 x g (18 hr) ) . Prior to in vivo injection, the viral stocks are desalted by gel filtration through Sepharose columns such as G25 Sephadex. The resulting viral stock has a final viral titer approximately in the 1010-1012 viral particles 25 range. The adenoviral construct should thus be highly purified, with no wild-type (potentially replicative) virus. Porcine Ischemia Model For Angiogenesis A left thoracotomy is performed on domestic pigs (30-40 30 kg) under sterile conditions for instrumentation. (Hammond, et al. J Clin Invest. 92:2644-52 (1993); Roth, et al. J. Clin. Invest. 91:939-49, 1993). Catheters are placed in the left atrium and aorta, providing a means to measure regional blood flow, and to monitor pressures. Wires are sutured on the left Printed from Mimosa WO 98/49300 58 PCT/US98/07801 atrium to permit ECG recording and atrial pacing. Finally, an ameroid constrictor (ameroid), a metal ring including an ameroid substance, is placed around the proximal left circumflex coronary artery (LCx) (Hammond et al. J. Clin. 5 Invest. 92:2644-52 (1993)). After a stable degree of ischemia develops, the treatment group receives an adenoviral construct that includes a truncated VRP gene driven by a CMV promoter. Control animals receive gene transfer with an adenoviral construct that includes a reporter gene, lacZ, driven by a CMV 10 promoter. Studies are initiated 35+3 days after ameroid placement, at a time when collateral vessel development and pacing-induced dysfunction are stable (Roth, et al. Am J Physiol 253:1-11279-1288, 1987, and Roth, et al. Circulation 82:1778-89). 15 Conscious animals are suspended in a sling and pressures from the left ventricle (LV), left atrium (LA) and aorta, and electrocardiogram are recorded in digital format on-line (at rest and during atrial pacing at 200 bpm). Two-dimensional and M-mode images are obtained using a Hewlett Packard ultrasound 20 imaging system. Images are obtained from a right parasternal approach at the mid-papillary muscle level and recorded on VHS tape. Images are recorded with animals in a basal state and again during right atrial pacing (HR=200 bpm). These studies are performed one day prior to gene transfer and repeated 14 + 25 1 days later. Rate-pressure products and left atrial pressures should be similar in both groups before and after gene transfer, indicating similar myocardial oxygen demands and loading conditions. Echocardiographic measurements are made using standardized criteria (Sahn, et al. Circulation 58:1072, 30 1978). End-diastolic wall thickness (EDWTh) and end-systolic wall thickness (ESWTh) are measured from 5 continuous beats and averaged. Percent wall thickening (%WTh) is calculated [(EDWTh-ESWTh)/EDWTh] X 100. Data should be analyzed without knowledge of which gene the animals had received. To Printed from Mimosa WO 98/49300 59 PCT/US98/07801 demonstrate reproducibility of echocardiography measurements, animals should be imaged on two consecutive days, showing high correlation (r2=0.90; p=0.005) . 35+3 days after ameroid placement, well after ameroid 5 closure, but before gene transfer, contrast echocardiographic studies are performed using the contrast material (Levovist) which is injected into the left atrium during atrial pacing (200 bprn). Studies are repeated 14+1 days after gene transfer. Peak contrast intensity is measured from the video 10 images using a computer-based video analysis program (Color Vue II, Nova Microsonics, Indianapolis, Indiana), that provides an objective measure of video intensity. The contrast studies are analyzed without knowledge of which gene the animals have received. 15 At completion of the study, animals are anesthetized and midline thoracotomy performed. The brachycephalic artery is isolated, a canula inserted, and other great vessels ligated. The animals receive intravenous heparin (10,000 IU) and papaverine (60 mg) . Potassium chloride is given to induce 20 diastolic cardiac arrest, and the aorta cross-clamped. Saline is delivered through the brachycephalic artery cannula (120 mmHg pressure), thereby perfusing the coronary arteries. Glutaraldehyde solution (6.25%, 0.1 M cacodylate buffer) was perfused (120 mmH pressure) until the heart is well fixed (10-25 15 min) . The heart is then removed, the beds identified using color-coded dyes injected anterograde through the left anterior descending (LAD), left circumflex (LCx), and right coronary arteries. The ameroid is examined to confirm closure. Samples taken from the normally perfused and ischemic regions are 30 divided into thirds and the endocardial and epicardial thirds are plastic-imbedded. Microscopic analysis to quantitate capillary number is conducted as previously described (Mathieu-Costello, et al. Am J Physiol 359:H204, 1990). Four 1 nm thick transverse sections are taken from each subsample (endocardium Printed from Mimosa WO 98/49300 60 PCT/US98/07801 and epicardium of each region) and point-counting is used to determine capillary number per fiber number ratio at 400X magnification. Twenty to twenty-five high power fields are counted per subsample. Within each region, capillary number to fiber number rations should be similar in endocardium and epicardium so the 40-50 field per region should be averaged to provide the transmural capillary to fiber number ratio. To establish that improved regional function and blood flow result from transgene expression, PCR and RT-PCR may be used to detect transgenic truncated VRP DNA and mRNA in myocardium from animals that have received truncated VRP gene transfer. Using a sense primer to the CMV promoter [GCAGAGCTCGTTTAGTGAAC] [SEQ I.D. NO. 41]; and an antisense primer to the internal truncated VRP subunit sequence, PCR is used to amplify the expected 500 bp fragment. Using a sense primer to the beginning of the truncated VRP subunit sequence, and an antisense primer to the internal truncated VRP sequence, RT-PCR is used to amplify the expected 400 bp fragment. Finally, using a polyclonal antibody directed against VRP, truncated VRP expression may be demonstrated 48 hours as well as 14 ± 1 days after gene transfer in cells and myocardium from animals that have received gene transfer with a truncated VRP gene. The helper independent replication deficient human adenovirus 5 system is used to prepare transgene containing vectors. The material injected in vivo should be highly purified and contain no wild-type (replication competent) adenovirus. Thus adenoviral infection and inflammatory infiltration in the heart are minimized. By injecting the material directly into the lumen of the coronary artery by coronary catheters, it is possible to target the gene effectively. When delivered in this manner there should be no transgene expression in hepatocytes, and viral RNA should not Printed from Mimosa WO 98/49300 61 PCT/US98/07801 be found in the urine at any time after intracoronary injection. Injection of the construct (4.0 ml containing about 1011 viral particles of adenovirus) is performed by injecting 2.0 ml into both the left and right coronary arteries (collateral flow to the LCx bed appeared to come from both vessels) . Animals are anesthetized, and arterial access acquired via the right carotid by cut-down; a 5F Cordis sheath is then placed. A 5F Multipurpose (A2) coronary catheter is used to engage the coronary arteries. Closure of the LCx ameroid is confirmed by contrast injection into the left main coronary artery. The catheter tip is then placed 1 cm within the arterial lumen so that minimal material is lost to the proximal aorta during injection. This procedure is carried out for each of the pigs. Once gene transfer is performed, three strategies are used to establish successful incorporation and expression of the gene. (1) Some constructs may include a reporter gene (lacZ) ; (2) myocardium from the relevant beds is sampled, and immunoblotting is performed to quantitate the presence of truncated VRP and (3) PCR is used to detect truncated VRP mRNA and DNA. The regional contractile function data obtained should show that control pigs show a similar degree of pacing-induced dysfunction in the ischemic region before and 14+1 days after gene transfer. In contrast, pigs receiving truncated gene transfer should show an increase in wall thickening in the ischemic region during pacing, demonstrating that truncated VRP subunit gene transfer in accordance with the invention is associated with improved contraction in the ischemic region during pacing. Wall thickening in the normally perfused region (the interventricular septum) should be normal during pacing and unaffected by gene transfer. The percent decrease in function measured by transthoracic echocardiography should be very similar to the percentage decrease measured by Printed from Mimosa WO 98/49300 62 PCT/US98/07801 sonomicrometry during atrial pacing in the same model (Hammond, et al. J. Clin. Invest. 92:2644, 1993), documenting the accuracy of echocardiography for the evaluation of ischemic dysfunction. Printed from Mimosa WO 98/49300 63 PCT/US98/07801 Sequence Listing 0 5 0 5 (1) GENERAL INFORMATION: (i) APPLICANT: (xi) TITLE OF INVENTION: (ill) NUMBER OF SEQUENCES: (iv) CORRESPONDENCE ADDRESS: (A) (B) (C) (D) (E) (F) ADDRESSEE: STREET: CITY: STATE: COUNTRY: ZIP: (v) COMPUTER READABLE FORM: (A) MEDIUM TYPE: (B) COMPUTER: (C) OPERATING SYSTEM: (D) SOFTWARE: Collateral Therapeutics TRUNCATED VEGF-RELATED PROTEINS 41 Lyon & Lyon 633 West Fifth Street Suite 4700 Los Angeles California U.S.A. 90071-2066 3.5" Diskette, 1.44 Mb storage IBM Compatible IBM P.C. DOS 5.0 FastSEQ for Windows 2.0 0 5 0 (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATE: (C) CLASSIFICATION: (vii) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATE: 08/842,984 April 2 5, 1997 (viii) ATTORNEY/AGENT INFORMATION: 5 (A) NAME: Warburg, Richard J. (B) REGISTRATION NUMBER: 32,327 (C) REFERENCE/DOCKET NUMBER: 221/062 .0 >5 iO (ix) TELECOMMUNICATION INFORMATION: (A) (B) (C) TELEPHONE: TELEFAX: TELEX: (213) 489-1600 (213) 955-0440 67-3510 (2) INFORMATION FOR SEQ ID NO: 1: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 188 amino acids Printed from Mimosa WO 98/49300 64 PCT/US98/07801 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: Met Ser Pro Leu Leu Arg Arg Leu Leu Leu Val Ala Leu Leu Gin Leu 10 1 5 10 15 Ala Arg Thr Gin Ala Pro Val Ser Gin Phe Asp Gly Pro Ser His Gin 20 25 30 15 Lys Lys Val Val Pro Trp lie Asp Val Tyr Thr Arg Ala Thr Cys Gin 35 40 45 20 35 Pro Arg Glu Val Val Val Pro Leu Ser Met Glu Leu Met Gly Asn Val 50 55 60 Val Lys Gin Leu Val Pro Ser Cys Val Thr Val Gin Arg Cys Gly Gly 65 70 75 80 Cys Cys Pro Asp Asp Gly Leu Glu Cys Val Pro Thr Gly Gin His Gin 25 85 90 95 Val Arg Met Gin lie Leu Met lie Gin Tyr Pro Ser Ser Gin Leu Gly 100 105 110 30 Glu Met Ser Leu Glu Glu His Ser Gin Cys Glu Cys Arg Pro Lys Lys 115 120 125 Lys Glu Ser Ala Val Lys Pro Asp Ser Pro Arg lie Leu Cys Pro Pro 130 135 140 Cys Thr Gin Arg Arg Gin Arg Pro Asp Pro Arg Thr Cys Arg Cys Arg 145 150 155 160 Cys Arg Arg Arg Arg Phe Leu His Cys Gin Gly Arg Gly Leu Glu Leu 40 165 170 175 Asn Pro Asp Thr Cys Arg Cys Arg Lys Pro Arg Lys 180 185 45 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 206 amino acids 50 (B) TYPE: ammo acid (D) TOPOLOGY: linear (n) MOLECULE TYPE: Protein 55 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: Met Ser Pro Leu Leu Arg Arg Leu Leu Leu Ala Ala Leu Leu Gin Leu 15 10 15 60 Ala Pro Ala Gin Ala Pro Val Ser Gin Pro Asp Ala Pro Gly His Gin 20 25 30 Printed from Mimosa WO 98/49300 65 PCT/US98/07801 10 25 35 40 60 Arg Lys Val Val Ser Trp lie Asp Val Tyr Thr Arg Ala Thr Cys Gin 35 40 45 Pro Arg Glu Val Val Val Pro Leu Thr Val Glu Leu Met Gly Thr Val 50 55 60 Ala Lys Gin Leu Val Pro Ser Cys Val Thr Val Gin Arg Cys Gly Gly 65 70 75 80 Cys Cys Pro Asp Asp Gly Leu Glu Cys Val Pro Thr Gly Gin His Gin 85 90 95 Val Arg Met Gin lie Leu Met lie Arg Tyr Pro Ser Ser Gin Leu Gly 15 100 105 110 Glu Met Ser Leu Glu Glu His Ser Gin Cys Glu Cys Arg Pro Lys Lys 115 120 125 20 Asp Ser Ala Val Lys Pro Asp Arg Ala Ala Thr Pro His His Arg Pro 130 135 140 Gin Pro Arg Ser Val Pro Gly Trp Asp Ser Ala Pro Gly Ala Pro Ser 145 150 155 160 Pro Ala Asp lie Thr His Pro Thr Pro Ala Pro Gly Pro Ser Ala His 165 170 175 Ala Ala Pro Ser Thr Thr Ser Ala Leu Thr Pro Gly Pro Ala Ala Ala 30 180 185 190 Ala Ala Asp Ala Ala Ala Ser Ser Val Ala Lys Gly Gly Ala 195 200 205 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 419 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 45 (n) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: Met His Leu Leu Gly Phe Phe Ser Val Ala Cys Ser Leu Leu Ala Ala 50 1 5 10 15 Ala Leu Leu Pro Gly Pro Arg Glu Ala Pro Ala Ala Ala Ala Ala Phe 20 25 30 55 Glu Ser Gly Leu Asp Leu Ser Asp Ala Glu Pro Asp Ala Gly Glu Ala 35 40 45 Thr Ala Tyr Ala Ser Lys Asp Leu Glu Glu Gin Leu Arg Ser Val Ser 50 55 60 Ser Val Asp Glu Leu Met Thr Val Leu Tyr Pro Glu Tyr Trp Lys Met 65 70 75 80 Printed from Mimosa WO 98/49300 PCT/US98/07801 66 Tyr Lys Cys Gin Leu Arg Lys Gly Gly Trp Gin His Asn Arg Glu Gin 85 90 95 Ala Asn Leu Asn Ser Arg Thr Glu Glu Thr lie Lys Phe Ala Ala Ala 100 105 110 10 His Tyr Asn Thr Glu lie Leu Lys Ser lie Asp Asn Glu Trp Arg Lys 115 120 125 15 Thr Gin Cys Met Pro Arg Glu Val Cys lie Asp Val Gly Lys Glu Phe 130 135 140 Gly Val Ala Thr Asn Thr Phe Phe Lys Pro Pro Cys Val Ser Val Tyr 145 150 155 160 Arg Cys Gly Gly Cys Cys Asn Ser Glu Gly Leu Gin Cys Met Asn Thr 20 165 170 175 Ser Thr Ser Tyr Leu Ser Lys Thr Leu Phe Glu lie Thr Val Pro Leu 180 185 190 25 Ser Gin Gly Pro Lys Pro Val Thr He Ser Phe Ala Asn His Thr Ser 195 200 205 30 Cys Arg Cys Met Ser Lys Leu Asp Val Tyr Arg Gin Val His Ser lie 210 215 220 lie Arg Arg Ser Leu Pro Ala Thr Leu Pro Gin Cys Gin Ala Ala Asn 225 230 235 240 Lys Thr Cys Pro Thr Asn Tyr Met Trp Asn Asn His lie Cys Arg Cys 35 245 250 255 Leu Ala Gin Glu Asp Phe Met Phe Ser Ser Asp Ala Gly Asp Asp Ser 260 265 270 40 Thr Asp Gly Phe His Asp lie Cys Gly Pro Asn Lys Glu Leu Asp Glu 275 280 285 45 Glu Thr Cys Gin Cys Val Cys Arg Ala Gly Leu Arg Pro Ala Ser Cys 290 295 300 Gly Pro His Lys Glu Leu Asp Arg Asn Ser Cys Gin Cys Val Cys Lys 305 310 315 320 Asn Lys Leu Phe Pro Ser Gin Cys Gly Ala Asn Arg Glu Phe Asp Glu 50 325 330 335 Asn Thr Cys Gin Cys Val Cys Lys Arg Thr Cys Pro Arg Asn Gin Pro 340 345 350 55 Leu Asn Pro Gly Lys Cys Ala Cys Glu Cys Thr Glu Ser Pro Gin Lys 355 360 365 60 Cys Leu Leu Lys Gly Lys Lys Phe His His Gin Thr Cys Ser Cys Tyr 370 375 380 Arg Arg Pro Cys Thr Asn Arg Gin Lys Ala Cys Glu Pro Gly Phe Ser 385 390 395 - 400 Printed from Mimosa WO 98/49300 PCT/US98/07801 67 Tyr Ser Glu Glu Val Cys Arg Cys Val Pro Ser Tyr Trp Lys Arg Pro 405 410 415 5 Gin Met Ser (2) INFORMATION FOR SEQ ID NO: 4: (l) SEQUENCE CHARACTERISTICS: 10 15 25 40 (A) LENGTH: 170 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (11) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: 20 Met Pro Val Met Arg Leu Phe Pro Cys Phe Leu Gin Leu Leu Ala Gly 15 10 15 Leu Ala Leu Pro Ala Val Pro Pro Gin Gin Trp Ala Leu Ser Ala Gly 20 25 30 Asn Gly Ser Ser Glu Val Glu Val Val Pro Phe Gin Glu Val Trp Gly 35 40 45 Arg Ser Tyr Cys Arg Pro lie Glu Thr Leu Val Asp lie Phe Gin Glu 30 50 55 60 Tyr Pro Asp Glu lie Glu Tyr lie Phe Lys Pro Ser Cys Val Pro Leu 65 70 75 80 35 Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Gly Leu Glu Cys Val Pro 85 90 95 Thr Glu Glu Ser Asn Val Thr Met Gin lie Met Arg lie Lys Pro His 100 105 110 Gin Ser Gin His lie Gly Glu Met Ser Phe Leu Gin His Ser Lys Cys 115 120 125 Glu Cys Arg Pro Leu Arg Glu Lys Met Lys Pro Glu Arg Arg Arg Pro 45 130 135 140 Lys Gly Arg Gly Lys Arg Arg Arg Glu Lys Gin Arg Pro Thr Asp Cys 145 150 155 160 50 His Leu Cys Gly Asp Ala Val Pro Arg Arg 165 170 55 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 221 amino acids 60 (B) TYPE: amino acid (D) TOPOLOGY: linear Printed from Mimosa WO 98/49300 68 PCT/US98/07801 10 35 (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: Met Arg Arg Cys Arg lie Ser Gly Arg Pro Pro Ala Pro Pro Gly Val 15 10 15 Pro Ala Gin Ala Pro Val Ser Gin Pro Asp Ala Pro Gly His Gin Arg 20 25 30 Lys Val Val Ser Trp lie Asp Val Tyr Thr Arg Ala Thr Cys Gin Pro 35 40 45 Arg Glu Val Val Val Pro Leu Thr Val Glu Leu Met Gly Thr Val Ala 15 50 55 60 Lys Gin Leu Val Pro Ser Cys Val Thr Val Gin Arg Cys Gly Gly Cys 65 70 75 80 20 Cys Pro Asp Asp Gly Leu Glu Cys Val Pro Thr Gly Gin His Gin Val 85 90 95 Arg Met Gin lie Leu Met lie Arg Tyr Pro Ser Ser Gin Leu Gly Glu 25 100 105 110 Met Ser Leu Glu Glu His Ser Gin Cys Glu Cys Arg Pro Lys Lys Lys 115 120 125 30 Asp Ser Ala Val Lys Gin Asp Arg Ala Ala Thr Pro His His Arg Pro 130 135 140 Gin Pro Arg Ser Val Pro Gly Trp Asp Ser Ala Pro Gly Ala Pro Ser 145 150 155 160 Pro Ala Asp lie Thr Gin Ser His Ser Ser Pro Arg Pro Leu Cys Pro 165 170 175 Arg Cys Thr Gin His His Gin Cys Pro Asp Pro Arg Thr Cys Arg Cys 40 180 185 190 Arg Cys Arg Arg Arg Ser Phe Leu Arg Cys Gin Gly Arg Gly Leu Glu 195 200 205 45 Leu Asn Pro Asp Thr Cys Arg Cys Arg Lys Leu Arg Arg 210 215 220 (2) INFORMATION FOR SEQ ID NO: 6: 50 (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 133 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 55 (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: 60 Met Lys Leu Leu Val Gly lie Leu Val Ala Val Cys Leu His Gin Tyr 15 10 15 Printed from Mimosa WO 98/49300 69 PCT/US98/07801 Leu Leu Asn Ala Asp Ser Asn Thr Lys Gly Trp Ser Glu Val Leu Lys 20 25 30 Gly Ser Glu Cys Lys Pro Arg Pro lie Val Val Pro Val Ser Glu Thr 35 40 45 His Pro Glu Leu Thr Ser Gin Arg Phe Asn Pro Pro Cys Val Thr Leu 50 55 60 Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Ser Leu Glu Cys Val Pro 65 70 75 80 Thr Glu Glu Val Asn Val Thr Met Glu Leu Leu Gly Ala Ser Gly Ser 85 90 95 Gly Ser Asn Gly Met Gin Arg Leu Ser Phe Val Glu His Lys Lys Cys 100 105 110 Asp Cys Arg Pro Arg Phe Thr Thr Thr Pro Pro Thr Thr Thr Arg Pro 115 120 125 Pro Arg Arg Arg Arg 130 (2) INFORMATION FOR SEQ ID NO: 7: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 148 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (n) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: Met Lys Leu Thr Ala Thr Leu Gin Val Val Val Ala Leu Leu lie Cys 15 10 15 Met Tyr Asn Leu Pro Glu Cys Val Ser Gin Ser Asn Asp Ser Pro Pro 20 25 30 Ser Thr Asn Asp Trp Met Arg Thr Leu Asp Lys Ser Gly Cys Lys Pro 35 40 45 Arg Asp Thr Val Val Tyr Leu Gly Glu Glu Tyr Pro Glu Ser Thr Asn 50 55 60 Leu Gin Tyr Asn Pro Arg Cys Val Thr Val Lys Arg Cys Ser Gly Cys 65 70 75 80 Cys Asn Gly Asp Gly Gin lie Cys Thr Ala Val Glu Thr Arg Asn Thr 85 90 95 Thr Val Thr Val Ser Val Thr Gly Val Ser Ser Ser Ser Gly Thr Asn 100 105 110 Ser Gly Val Ser Thr Asn Leu Gin Arg lie Ser Val Thr Glu His Thr » 115 120 125 Lys Cys Asp Cys lie Gly Arg Thr Thr Thr Thr Pro Thr Thr Thr Arg Printed from Mimosa WO 98/49300 70 PCT/US98/07801 130 135 140 Glu Pro Arg Arg 145 5 (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: 10 (A) LENGTH: 160 amino acids (B) TYPE: ammo acid (D) TOPOLOGY: linear 15 20 40 (u) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: Pro Ser His Gin Lys Lys Val Val Pro Trp lie Asp Val Tyr Thr Arg 15 10 15 Ala Thr Cys Gin Pro Arg Glu Val Val Val Pro Leu Ser Met Glu Leu 20 25 30 Met Gly Asn Val Val Lys Gin Leu Val Pro Ser Cys Val Thr Val Gin 25 35 40 45 Arg Cys Gly Gly Cys Cys Pro Asp Asp Gly Leu Glu Cys Val Pro Thr 50 55 60 30 Gly Gin His Gin Val Arg Met Gin lie Leu Met lie Gin Tyr Pro Ser 65 70 75 80 35 Ser Gin Leu Gly Glu Met Ser Leu Glu Glu His Ser Gin Cys Glu Cys 85 90 95 Arg Pro Lys Lys Lys Glu Ser Ala Val Lys Pro Asp Ser Pro Arg lie 100 105 110 Leu Cys Pro Pro Cys Thr Gin Arg Arg Gin Arg Pro Asp Pro Arg Thr 115 120 125 Cys Arg Cys Arg Cys Arg Arg Arg Arg Phe Leu His Cys Gin Gly Arg 45 130 135 140 Gly Leu Glu Leu Asn Pro Asp Thr Cys Arg Cys Arg Lys Pro Arg Lys 145 150 155 160 50 (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: 55 (A) LENGTH: 155 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 60 (n) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: Printed from Mimosa WO 98/49300 71 PCT/US98/07801 0 5 5 >5 Lys Val Val Pro Trp lie Asp Val Tyr Thr Arg Ala Thr Cys Gin Pro 15 10 15 Arg Glu Val Val Val Pro Leu Ser Met Glu Leu Met Gly Asn Val Val 20 25 30 Lys Gin Leu Val Pro Ser Cys Val Thr Val Gin Arg Cys Gly Gly Cys 35 40 45 Cys Pro Asp Asp Gly Leu Glu Cys Val Pro Thr Gly Gin His Gin Val 50 55 60 Arg Met Gin lie Leu Met lie Gin Tyr Pro Ser Ser Gin Leu Gly Glu 5 65 70 75 80 Met Ser Leu Glu Glu His Ser Gin Cys Glu Cys Arg Pro Lys Lys Lys 85 90 95 0 Glu Ser Ala Val Lys Pro Asp Ser Pro Arg lie Leu Cys Pro Pro Cys 100 105 110 Thr Gin Arg Arg Gin Arg Pro Asp Pro Arg Thr Cys Arg Cys Arg Cys 115 120 125 Arg Arg Arg Arg Phe Leu His Cys Gin Gly Arg Gly Leu Glu Leu Asn 130 135 140 Pro Asp Thr Cys Arg Cys Arg Lys Pro Arg Lys 0 145 150 155 (2) INFORMATION FOR SEQ ID NO: 10: U) SEQUENCE CHARACTERISTICS: (A) LENGTH: 152 ammo acids (B) TYPE: amino acid (D) TOPOLOGY: linear 0 (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: Pro Trp lie Asp Val Tyr Thr Arg Ala Thr Cys Gin Pro Arg Glu Val 5 1 5 10 15 Val Val Pro Leu Ser Met Glu Leu Met Gly Asn Val Val Lys Gin Leu 20 25 30 >0 Val Pro Ser Cys Val Thr Val Gin Arg Cys Gly Gly Cys Cys Pro Asp 35 40 45 Asp Gly Leu Glu Cys Val Pro Thr Gly Gin His Gin Val Arg Met Gin 50 55 60 lie Leu Met lie Gin Tyr Pro Ser Ser Gin Leu Gly Glu Met Ser Leu 65 70 75 80 Glu Glu His Ser Gin Cys Glu Cys Arg Pro Lys Lys Lys Glu Ser Ala >0 85 90 95 Val Lys Pro Asp Ser Pro Arg lie Leu Cys Pro Pro Cys Thr Gin Arg Printed from Mimosa WO 98/49300 72 PCT/US98/07801 100 105 110 Arg Gin Arg Pro Asp Pro Arg Thr Cys Arg Cys Arg Cys Arg Arg Arg 115 120 125 5 Arg Phe Leu His Cys Gin Gly Arg Gly Leu Glu Leu Asn Pro Asp Thr 130 135 140 Cys Arg Cys Arg Lys Pro Arg Lys 10 145 150 15 25 40 55 (2) INFORMATION FOR SEQ ID NO: 11: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 150 amino acids (B) TYPE: amino acid 20 (D) TOPOLOGY: linear (n) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: lie Asp Val Tyr Thr Arg Ala Thr Cys Gin Pro Arg Glu Val Val Val 15 10 15 Pro Leu Ser Met Glu Leu Met Gly Asn Val Val Lys Gin Leu Val Pro 30 20 25 30 Ser Cys Val Thr Val Gin Arg Cys Gly Gly Cys Cys Pro Asp Asp Gly 35 40 45 35 Leu Glu Cys Val Pro Thr Gly Gin His Gin Val Arg Met Gin lie Leu 50 55 60 Met lie Gin Tyr Pro Ser Ser Gin Leu Gly Glu Met Ser Leu Glu Glu 65 70 75 80 His Ser Gin Cys Glu Cys Arg Pro Lys Lys Lys Glu Ser Ala Val Lys 85 90 95 Pro Asp Ser Pro Arg lie Leu Cys Pro Pro Cys Thr Gin Arg Arg Gin 45 100 105 110 Arg Pro Asp Pro Arg Thr Cys Arg Cys Arg Cys Arg Arg Arg Arg Phe 115 120 125 50 Leu His Cys Gin Gly Arg Gly Leu Glu Leu Asn Pro Asp Thr Cys Arg 130 135 140 Cys Arg Lys Pro Arg Lys 145 150 (2) INFORMATION FOR SEQ ID NO: 12: (l) SEQUENCE CHARACTERISTICS: 60 (A) LENGTH: 147 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear Printed from Mimosa WO 98/49300 73 PCT/US98/07801 (11) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: Tyr Thr Arg Ala Thr Cys Gin Pro Arg Glu Val Val Val Pro Leu Ser 15 10 15 Met Glu Leu Met Gly Asn Val Val Lys Gin Leu Val Pro Ser Cys Val 20 25 30 Thr Val Gin Arg Cys Gly Gly Cys Cys Pro Asp Asp Gly Leu Glu Cys 35 40 45 Val Pro Thr Gly Gin His Gin Val Arg Met Gin lie Leu Met lie Gin 50 55 60 Tyr Pro Ser Ser Gin Leu Gly Glu Met Ser Leu Glu Glu His Ser Gin 65 70 75 80 Cys Glu Cys Arg Pro Lys Lys Lys Glu Ser Ala Val Lys Pro Asp Ser 85 90 95 Pro Arg lie Leu Cys Pro Pro Cys Thr Gin Arg Arg Gin Arg Pro Asp 100 105 110 Pro Arg Thr Cys Arg Cys Arg Cys Arg Arg Arg Arg Phe Leu His Cys 115 120 125 Gin Gly Arg Gly Leu Glu Leu Asn Pro Asp Thr Cys Arg Cys Arg Lys 130 135 140 Pro Arg Lys 145 (2) INFORMATION FOR SEQ ID NO: 13: (l) SEQUENCE CHARACTERISTICS: (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: Arg Ala Thr Cys Gin Pro Arg Glu Val Val Val Pro Leu Ser Met Glu 15 10 15 Leu Met Gly Asn Val Val Lys Gin Leu Val Pro Ser Cys Val Thr Val 20 25 30 Gin Arg Cys Gly Gly Cys Cys Pro Asp Asp Gly Leu Glu Cys Val Pro 35 40 45 Thr Gly Gin His Gin Val Arg Met Gin lie Leu Met lie Gin Tyr Pro 50 55 60 Ser Ser Gin Leu Gly Glu Met Ser Leu Glu Glu His Ser Gin Cys Glu 65 70 75 80 (A) LENGTH: (B) TYPE: (D) TOPOLOGY: 145 amino acids amino acid linear (n) MOLECULE TYPE: Protein Printed from Mimosa WO 98/49300 74 PCT/US98/07801 10 25 30 45 60 Cys Arg Pro Lys Lys Lys Glu Ser Ala Val Lys Pro Asp Ser Pro Arg 85 90 95 lie Leu Cys Pro Pro Cys Thr Gin Arg Arg Gin Arg Pro Asp Pro Arg 100 105 110 Thr Cys Arg Cys Arg Cys Arg Arg Arg Arg Phe Leu His Cys Gin Gly 115 120 125 Arg Gly Leu Glu Leu Asn Pro Asp Thr Cys Arg Cys Arg Lys Pro Arg 130 135 140 Lys 15 145 (2) INFORMATION FOR SEQ ID NO: 14: (l) SEQUENCE CHARACTERISTICS: 20 (A) LENGTH: 178 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (n) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: Pro Gly His Gin Arg Lys Val Val Ser Trp lie Asp Val Tyr Thr Arg 15 10 15 Ala Thr Cys Gin Pro Arg Glu Val Val Val Pro Leu Thr Val Glu Leu 20 25 30 Met Gly Thr Val Ala Lys Gin Leu Val Pro Ser Cys Val Thr Val Gin 35 35 40 45 Arg Cys Gly Gly Cys Cys Pro Asp Asp Gly Leu Glu Cys Val Pro Thr 50 55 60 4 0 Gly Gin His Gin Val Arg Met Gin lie Leu Met lie Arg Tyr Pro Ser 65 70 75 80 Ser Gin Leu Gly Glu Met Ser Leu Glu Glu His Ser Gin Cys Glu Cys 85 90 95 Arg Pro Lys Lys Asp Ser Ala Val Lys Pro Asp Arg Ala Ala Thr Pro 100 105 110 His His Arg Pro Gin Pro Arg Ser Val Pro Gly Trp Asp Ser Ala Pro 50 115 120 125 Gly Ala Pro Ser Pro Ala Asp lie Thr His Pro Thr Pro Ala Pro Gly 130 135 140 55 Pro Ser Ala His Ala Ala Pro Ser Thr Thr Ser Ala Leu Thr Pro Gly 145 150 155 160 Pro Ala Ala Ala Ala Ala Asp Ala Ala Ala Ser Ser Val Ala Lys Gly 165 170 175 Gly Ala Printed from Mimosa WO 98/49300 75 PCT/US98/07801 10 15 30 45 55 60 (2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 173 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (li) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15: Lys Val Val Ser Trp lie Asp Val Tyr Thr Arg Ala Thr Cys Gin Pro 15 10 15 Arg Glu Val Val Val Pro Leu Thr Val Glu Leu Met Gly Thr Val Ala 20 25 30 Lys Gin Leu Val Pro Ser Cys Val Thr Val Gin Arg Cys Gly Gly Cys 20 35 40 45 Cys Pro Asp Asp Gly Leu Glu Cys Val Pro Thr Gly Gin His Gin Val 50 55 60 25 Arg Met Gin lie Leu Met lie Arg Tyr Pro Ser Ser Gin Leu Gly Glu 65 70 75 80 Met Ser Leu Glu Glu His Ser Gin Cys Glu Cys Arg Pro Lys Lys Asp 85 90 95 Ser Ala Val Lys Pro Asp Arg Ala Ala Thr Pro His His Arg Pro Gin 100 105 110 Pro Arg Ser Val Pro Gly Trp Asp Ser Ala Pro Gly Ala Pro Ser Pro 35 115 120 125 Ala Asp lie Thr His Pro Thr Pro Ala Pro Gly Pro Ser Ala His Ala 130 135 140 40 Ala Pro Ser Thr Thr Ser Ala Leu Thr Pro Gly Pro Ala Ala Ala Ala 145 150 155 160 Ala Asp Ala Ala Ala Ser Ser Val Ala Lys Gly Gly Ala 165 170 (2) INFORMATION FOR SEQ ID NO: 16: (i) SEQUENCE CHARACTERISTICS: 50 (A) LENGTH: 168 amino acids (B) TYPE: ammo acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 16: lie Asp Val Tyr Thr Arg Ala Thr Cys Gin Pro Arg Glu Val Val Val 15 10 15 Pro Leu Thr Val Glu Leu Met Gly Thr Val Ala Lys Gin Leu Val Pro 20 25 30 Printed from Mimosa WO 98/49300 76 PCT/US98/07801 0 5 0 0 >5 Ser Cys Val Thr Val Gin Arg Cys Gly Gly Cys Cys Pro Asp Asp Gly 35 40 45 Leu Glu Cys Val Pro Thr Gly Gin His Gin Val Arg Met Gin lie Leu 50 55 60 Met lie Arg Tyr Pro Ser Ser Gin Leu Gly Glu Met Ser Leu Glu Glu 65 70 75 80 His Ser Gin Cys Glu Cys Arg Pro Lys Lys Asp Ser Ala Val Lys Pro 85 90 95 Asp Arg Ala Ala Thr Pro His His Arg Pro Gin Pro Arg Ser Val Pro 5 100 105 110 Gly Trp Asp Ser Ala Pro Gly Ala Pro Ser Pro Ala Asp lie Thr His 115 120 125 0 Pro Thr Pro Ala Pro Gly Pro Ser Ala His Ala Ala Pro Ser Thr Thr 130 135 140 Ser Ala Leu Thr Pro Gly Pro Ala Ala Ala Ala Ala Asp Ala Ala Ala 145 150 155 160 Ser Ser Val Ala Lys Gly Gly Ala 165 (2) INFORMATION FOR SEQ ID NO: 17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 163 amino acids (B) TYPE: ammo acid 5 (D) TOPOLOGY: linear (11) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17: Arg Ala Thr Cys Gin Pro Arg Glu Val Val Val Pro Leu Thr Val Glu 15 10 15 Leu Met Gly Thr Val Ala Lys Gin Leu Val Pro Ser Cys Val Thr Val 5 20 25 30 Gin Arg Cys Gly Gly Cys Cys Pro Asp Asp Gly Leu Glu Cys Val Pro 35 40 45 iO Thr Gly Gin His Gin Val Arg Met Gin lie Leu Met lie Arg Tyr Pro 50 55 60 Ser Ser Gin Leu Gly Glu Met Ser Leu Glu Glu His Ser Gin Cys Glu 65 70 75 80 Cys Arg Pro Lys Lys Asp Ser Ala Val Lys Pro Asp Arg Ala Ala Thr 85 90 95 Pro His His Arg Pro Gin Pro Arg Ser Val Pro Gly Trp Asp Ser Ala >0 100 105 110 Pro Gly Ala Pro Ser Pro Ala Asp lie Thr His Pro Thr Pro Ala Pro Printed from Mimosa WO 98/49300 77 PCT/US98/07801 115 120 125 Gly Pro Ser Ala His Ala Ala Pro Ser Thr Thr Ser Ala Leu Thr Pro 130 135 140 Gly Pro Ala Ala Ala Ala Ala Asp Ala Ala Ala Ser Ser Val Ala Lys 145 150 155 160 Gly Gly Ala (2) INFORMATION FOR SEQ ID NO: 18: (i) SEQUENCE CHARACTERISTICS: 15 (A) LENGTH: 194 ammo acids (B) TYPE: amino acid (D) TOPOLOGY: linear 10 20 25 40 55 60 (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18: Pro Gly His Gin Arg Lys Val Val Ser Trp lie Asp Val Tyr Thr Arg 15 10 15 Ala Thr Cys Gin Pro Arg Glu Val Val Val Pro Leu Thr Val Glu Leu 20 25 30 Met Gly Thr Val Ala Lys Gin Leu Val Pro Ser Cys Val Thr Val Gin 30 35 40 45 Arg Cys Gly Gly Cys Cys Pro Asp Asp Gly Leu Glu Cys Val Pro Thr 50 55 60 35 Gly Gin His Gin Val Arg Met Gin lie Leu Met lie Arg Tyr Pro Ser 65 70 75 80 Ser Gin Leu Gly Glu Met Ser Leu Glu Glu His Ser Gin Cys Glu Cys 85 90 95 Arg Pro Lys Lys Lys Asp Ser Ala Val Lys Gin Asp Arg Ala Ala Thr 100 105 110 Pro His His Arg Pro Gin Pro Arg Ser Val Pro Gly Trp Asp Ser Ala 45 115 120 125 Pro Gly Ala Pro Ser Pro Ala Asp lie Thr Gin Ser His Ser Ser Pro 130 135 140 50 Arg Pro Leu Cys Pro Arg Cys Thr Gin His His Gin Cys Pro Asp Pro 145 150 155 160 Arg Thr Cys Arg Cys Arg Cys Arg Arg Arg Ser Phe Leu Arg Cys Gin 165 170 175 Gly Arg Gly Leu Glu Leu Asn Pro Asp Thr Cys Arg Cys Arg Lys Leu 180 185 190 Arg Arg (2) INFORMATION FOR SEQ ID NO: 19: Printed from Mimosa WO 98/49300 78 PCT/US98/07801 10 25 40 50 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 189 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19: Lys Val Val Ser Trp lie Asp Val Tyr Thr Arg Ala Thr Cys Gin Pro 15 10 15 Arg Glu Val Val Val Pro Leu Thr Val Glu Leu Met Gly Thr Val Ala 15 20 25 30 Lys Gin Leu Val Pro Ser Cys Val Thr Val Gin Arg Cys Gly Gly Cys 35 40 45 20 Cys Pro Asp Asp Gly Leu Glu Cys Val Pro Thr Gly Gin His Gin Val 50 55 60 Arg Met Gin lie Leu Met lie Arg Tyr Pro Ser Ser Gin Leu Gly Glu 65 70 75 80 Met Ser Leu Glu Glu His Ser Gin Cys Glu Cys Arg Pro Lys Lys Lys 85 90 95 Asp Ser Ala Val Lys Gin Asp Arg Ala Ala Thr Pro His His Arg Pro 30 100 105 110 Gin Pro Arg Ser Val Pro Gly Trp Asp Ser Ala Pro Gly Ala Pro Ser 115 120 125 35 Pro Ala Asp lie Thr Gin Ser His Ser Ser Pro Arg Pro Leu Cys Pro 130 135 140 Arg Cys Thr Gin His His Gin Cys Pro Asp Pro Arg Thr Cys Arg Cys 145 150 155 160 Arg Cys Arg Arg Arg Ser Phe Leu Arg Cys Gin Gly Arg Gly Leu Glu 165 170 175 Leu Asn Pro Asp Thr Cys Arg Cys Arg Lys Leu Arg Arg 45 180 185 (2) INFORMATION FOR SEQ ID NO: 20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 184 ammo acids (B) TYPE: amino acid (D) TOPOLOGY: linear 55 (u) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20: lie Asp Val Tyr Thr Arg Ala Thr Cys Gin Pro Arg Glu Val Val Val 60 1 5 10 15 Pro Leu Thr Val Glu Leu Met Gly Thr Val Ala Lys Gin Leu Val Pro Printed from Mimosa WO 98/49300 79 PCT/US98/07801 20 25 30 Ser Cys Val Thr Val Gin Arg Cys Gly Gly Cys Cys Pro Asp Asp Gly 35 40 45 5 Leu Glu Cys Val Pro Thr Gly Gin His Gin Val Arg Met Gin lie Leu 50 55 60 Met lie Arg Tyr Pro Ser Ser Gin Leu Gly Glu Met Ser Leu Glu Glu 10 65 70 75 80 His Ser Gin Cys Glu Cys Arg Pro Lys Lys Lys Asp Ser Ala Val Lys 85 90 95 15 Gin Asp Arg Ala Ala Thr Pro His His Arg Pro Gin Pro Arg Ser Val 100 105 110 20 40 50 Pro Gly Trp Asp Ser Ala Pro Gly Ala Pro Ser Pro Ala Asp lie Thr 115 120 125 Gin Ser His Ser Ser Pro Arg Pro Leu Cys Pro Arg Cys Thr Gin His 130 135 140 His Gin Cys Pro Asp Pro Arg Thr Cys Arg Cys Arg Cys Arg Arg Arg 25 145 150 155 160 Ser Phe Leu Arg Cys Gin Gly Arg Gly Leu Glu Leu Asn Pro Asp Thr 165 170 175 30 Cys Arg Cys Arg Lys Leu Arg Arg 180 (2) INFORMATION FOR SEQ ID NO: 21: 35 (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 179 ammo acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21: 45 Arg Ala Thr Cys Gin Pro Arg Glu Val Val Val Pro Leu Thr Val Glu 15 10 15 Leu Met Gly Thr Val Ala Lys Gin Leu Val Pro Ser Cys Val Thr Val 20 25 30 Gin Arg Cys Gly Gly Cys Cys Pro Asp Asp Gly Leu Glu Cys Val Pro 35 40 45 Thr Gly Gin His Gin Val Arg Met Gin lie Leu Met lie Arg Tyr Pro 55 50 55 60 Ser Ser Gin Leu Gly Glu Met Ser Leu Glu Glu His Ser Gin Cys Glu 65 70 75 80 60 Cys Arg Pro Lys Lys Lys Asp Ser Ala Val Lys Gin Asp Arg Ala Ala 85 90 95 Printed from Mimosa WO 98/49300 80 PCT/US98/07801 Thr Pro His His Arg Pro Gin Pro Arg Ser Val Pro Gly Trp Asp Ser 100 105 110 Ala Pro Gly Ala Pro Ser Pro Ala Asp lie Thr Gin Ser His Ser Ser 5 115 120 125 Pro Arg Pro Leu Cys Pro Arg Cys Thr Gin His His Gin Cys Pro Asp 130 135 140 10 Pro Arg Thr Cys Arg Cys Arg Cys Arg Arg Arg Ser Phe Leu Arg Cys 145 150 155 160 15 35 50 Gin Gly Arg Gly Leu Glu Leu Asn Pro Asp Thr Cys Arg Cys Arg Lys 165 170 175 Leu Arg Arg (2) INFORMATION FOR SEQ ID NO: 22: 20 (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 307 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 25 (n) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22. 30 His Tyr Asn Thr Glu lie Leu Lys Ser lie Asp Asn Glu Trp Arg Lys 15 10 15 Thr Gin Cys Met Pro Arg Glu Val Cys lie Asp Val Gly Lys Glu Phe 20 25 30 Gly Val Ala Thr Asn Thr Phe Phe Lys Pro Pro Cys Val Ser Val Tyr 35 40 45 Arg Cys Gly Gly Cys Cys Asn Ser Glu Gly Leu Gin Cys Met Asn Thr 40 50 55 60 Ser Thr Ser Tyr Leu Ser Lys Thr Leu Phe Glu lie Thr Val Pro Leu 65 70 75 80 4 5 Ser Gin Gly Pro Lys Pro Val Thr lie Ser Phe Ala Asn His Thr Ser 85 90 95 Cys Arg Cys Met Ser Lys Leu Asp Val Tyr Arg Gin Val His Ser lie 100 105 110 lie Arg Arg Ser Leu Pro Ala Thr Leu Pro Gin Cys Gin Ala Ala Asn 115 120 125 Lys Thr Cys Pro Thr Asn Tyr Met Trp Asn Asn His lie Cys Arg Cys 55 130 135 140 Leu Ala Gin Glu Asp Phe Met Phe Ser Ser Asp Ala Gly Asp Asp Ser 145 150 155 160 60 Thr Asp Gly Phe His Asp lie Cys Gly Pro Asn Lys Glu Leu Asp Glu 165 170 175 Printed from Mimosa WO 98/49300 81 PCT/US98/07801 Glu Thr Cys Gin Cys Val Cys Arg Ala Gly Leu Arg Pro Ala Ser Cys 180 185 190 Gly Pro Hxs Lys Glu Leu Asp Arg Asn Ser Cys Gin Cys Val Cys Lys 195 200 205 Asn Lys Leu Phe Pro Ser Gin Cys Gly Ala Asn Arg Glu Phe Asp Glu 210 215 220 Asn Thr Cys Gin Cys Val Cys Lys Arg Thr Cys Pro Arg Asn Gin Pro 225 230 235 240 Leu Asn Pro Gly Lys Cys Ala Cys Glu Cys Thr Glu Ser Pro Gin Lys 245 250 255 Cys Leu Leu Lys Gly Lys Lys Phe His His Gin Thr Cys Ser Cys Tyr 260 265 270 Arg Arg Pro Cys Thr Asn Arg Gin Lys Ala Cys Glu Pro Gly Phe Ser 275 280 285 Tyr Ser Glu Glu Val Cys Arg Cys Val Pro Ser Tyr Trp Lys Arg Pro 290 295 300 Gin Met Ser 305 (2) INFORMATION FOR SEQ ID NO: 23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 302 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23: lie Leu Lys Ser lie Asp Asn Glu Trp Arg Lys Thr Gin Cys Met Pro 15 10 15 Arg Glu Val Cys lie Asp Val Gly Lys Glu Phe Gly Val Ala Thr Asn 20 25 30 Thr Phe Phe Lys Pro Pro Cys Val Ser Val Tyr Arg Cys Gly Gly Cys 35 40 45 Cys Asn Ser Glu Gly Leu Gin Cys Met Asn Thr Ser Thr Ser Tyr Leu 50 55 60 Ser Lys Thr Leu Phe Glu lie Thr Val Pro Leu Ser Gin Gly Pro Lys 65 70 75 80 Pro Val Thr lie Ser Phe Ala Asn His Thr Ser Cys Arg Cys Met Ser 85 90 95 Lys Leu Asp Val Tyr Arg Gin Val His Ser lie lie Arg Arg Ser Leu 100 105 110 Pro Ala Thr Leu Pro Gin Cys Gin Ala Ala Asn Lys Thr Cys Pro Thr 115 120 125 Printed from Mimosa WO 98/49300 82 PCT/US98/07801 Asn Tyr Met Trp Asn Asn His lie Cys Arg Cys Leu Ala Gin Glu Asp 130 135 140 Phe Met Phe Ser Ser Asp Ala Gly Asp Asp Ser Thr Asp Gly Phe His 145 150 155 160 Asp lie Cys Gly Pro Asn Lys Glu Leu Asp Glu Glu Thr Cys Gin Cys 165 170 175 10 15 30 40 60 Val Cys Arg Ala Gly Leu Arg Pro Ala Ser Cys Gly Pro His Lys Glu 180 185 190 Leu Asp Arg Asn Ser Cys Gin Cys Val Cys Lys Asn Lys Leu Phe Pro 195 200 205 Ser Gin Cys Gly Ala Asn Arg Glu Phe Asp Glu Asn Thr Cys Gin Cys 20 210 215 220 Val Cys Lys Arg Thr Cys Pro Arg Asn Gin Pro Leu Asn Pro Gly Lys 225 230 235 240 25 Cys Ala Cys Glu Cys Thr Glu Ser Pro Gin Lys Cys Leu Leu Lys Gly 245 250 255 Lys Lys Phe His His Gin Thr Cys Ser Cys Tyr Arg Arg Pro Cys Thr 260 265 270 Asn Arg Gin Lys Ala Cys Glu Pro Gly Phe Ser Tyr Ser Glu Glu Val 275 280 285 Cys Arg Cys Val Pro Ser Tyr Trp Lys Arg Pro Gin Met Ser 35 290 295 300 (2) INFORMATION FOR SEQ ID NO- 24: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 297 amino acids (B) TYPE: ammo acid (D) TOPOLOGY: linear 45 (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24: Asp Asn Glu Trp Arg Lys Thr Gin Cys Met Pro Arg Glu Val Cys lie 50 1 5 10 15 Asp Val Gly Lys Glu Phe Gly Val Ala Thr Asn Thr Phe Phe Lys Pro 20 25 30 55 Pro Cys Val Ser Val Tyr Arg Cys Gly Gly Cys Cys Asn Ser Glu Gly 35 40 45 Leu Gin Cys Met Asn Thr Ser Thr Ser Tyr Leu Ser Lys Thr Leu Phe 50 55 60 Glu lie Thr Val Pro Leu Ser Gin Gly Pro Lys Pro Val Thr lie Ser 65 70 75 80 Printed from Mimosa WO 98/49300 83 PCT/US98/07801 10 25 40 45 55 Phe Ala Asn His Thr Ser Cys Arg Cys Met Ser Lys Leu Asp Val Tyr 85 90 95 Arg Gin Val His Ser lie lie Arg Arg Ser Leu Pro Ala Thr Leu Pro 100 105 110 Gin Cys Gin Ala Ala Asn Lys Thr Cys Pro Thr Asn Tyr Met Trp Asn 115 120 125 Asn His lie Cys Arg Cys Leu Ala Gin Glu Asp Phe Met Phe Ser Ser 130 135 140 Asp Ala Gly Asp Asp Ser Thr Asp Gly Phe His Asp lie Cys Gly Pro 15 145 150 155 160 Asn Lys Glu Leu Asp Glu Glu Thr Cys Gin Cys Val Cys Arg Ala Gly 165 170 175 20 Leu Arg Pro Ala Ser Cys Gly Pro His Lys Glu Leu Asp Arg Asn Ser 180 185 190 Cys Gin Cys Val Cys Lys Asn Lys Leu Phe Pro Ser Gin Cys Gly Ala 195 200 205 Asn Arg Glu Phe Asp Glu Asn Thr Cys Gin Cys Val Cys Lys Arg Thr 210 215 220 Cys Pro Arg Asn Gin Pro Leu Asn Pro Gly Lys Cys Ala Cys Glu Cys 30 225 230 235 240 Thr Glu Ser Pro Gin Lys Cys Leu Leu Lys Gly Lys Lys Phe His His 245 250 255 35 Gin Thr Cys Ser Cys Tyr Arg Arg Pro Cys Thr Asn Arg Gin Lys Ala 260 265 270 Cys Glu Pro Gly Phe Ser Tyr Ser Glu Glu Val Cys Arg Cys Val Pro 275 280 285 Ser Tyr Trp Lys Arg Pro Gin Met Ser 290 295 (2) INFORMATION FOR SEQ ID NO: 25: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 292 amino acids (B) TYPE: amino acid 50 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25: Lys Thr Gin Cys Met Pro Arg Glu Val Cys lie Asp Val Gly Lys Glu 15 10 15 Phe Gly Val Ala Thr Asn Thr Phe Phe Lys Pro Pro Cys Val Ser Val 60 20 25 30 Tyr Arg Cys Gly Gly Cys Cys Asn Ser Glu Gly Leu Gin Cys Met Asn Printed from Mimosa WO 98/49300 PCT/US98/07801 &4 35 40 45 Thr Ser Thr Ser Tyr Leu Ser Lys Thr Leu Phe Glu lie Thr Val Pro 50 55 60 5 Leu Ser Gin Gly Pro Lys Pro Val Thr lie Ser Phe Ala Asn His Thr 65 70 75 80 Ser Cys Arg Cys Met Ser Lys Leu Asp Val Tyr Arg Gin Val His Ser 10 85 90 95 lie lie Arg Arg Ser Leu Pro Ala Thr Leu Pro Gin Cys Gin Ala Ala 100 105 110 15 Asn Lys Thr Cys Pro Thr Asn Tyr Met Trp Asn Asn His lie Cys Arg 115 120 125 20 35 50 60 Cys Leu Ala Gin Glu Asp Phe Met Phe Ser Ser Asp Ala Gly Asp Asp 130 135 140 Ser Thr Asp Gly Phe His Asp lie Cys Gly Pro Asn Lys Glu Leu Asp 145 150 155 160 Glu Glu Thr Cys Gin Cys Val Cys Arg Ala Gly Leu Arg Pro Ala Ser 25 165 170 175 Cys Gly Pro His Lys Glu Leu Asp Arg Asn Ser Cys Gin Cys Val Cys 180 185 190 30 Lys Asn Lys Leu Phe Pro Ser Gin Cys Gly Ala Asn Arg Glu Phe Asp 195 200 205 Glu Asn Thr Cys Gin Cys Val Cys Lys Arg Thr Cys Pro Arg Asn Gin 210 215 220 Pro Leu Asn Pro Gly Lys Cys Ala Cys Glu Cys Thr Glu Ser Pro Gin 225 230 235 240 Lys Cys Leu Leu Lys Gly Lys Lys Phe His His Gin Thr Cys Ser Cys 40 245 250 255 Tyr Arg Arg Pro Cys Thr Asn Arg Gin Lys Ala Cys Glu Pro Gly Phe 260 265 270 45 Ser Tyr Ser Glu Glu Val Cys Arg Cys Val Pro Ser Tyr Trp Lys Arg 275 280 285 Pro Gin Met Ser 290 (2) INFORMATION FOR SEQ ID NO: 26: (i) SEQUENCE CHARACTERISTICS: 55 (A) LENGTH: 116 amino acids (B) TYPE: ammo acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 26: Printed from Mimosa WO 98/49300 85 PCT/US98/07801 Leu Asn Ala Asp Ser Asn Thr Lys Gly Trp Ser Glu Val Leu Lys Gly 15 10 15 Ser Glu Cys Lys Pro Arg Pro lie Val Val Pro Val Ser Glu Thr His 5 20 25 30 Pro Glu Leu Thr Ser Gin Arg Phe Asn Pro Pro Cys Val Thr Leu Met 35 40 45 10 Arg Cys Gly Gly Cys Cys Asn Asp Glu Ser Leu Glu Cys Val Pro Thr 50 55 60 15 25 30 50 Glu Glu Val Asn Val Thr Met Glu Leu Leu Gly Ala Ser Gly Ser Gly 65 70 75 80 Ser Asn Gly Met Gin Arg Leu Ser Phe Val Glu His Lys Lys Cys Asp 85 90 95 Cys Arg Pro Arg Phe Thr Thr Thr Pro Pro Thr Thr Thr Arg Pro Pro 20 100 105 110 Arg Arg Arg Arg 115 (2) INFORMATION FOR SEQ ID NO: 27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 111 ammo acids (B) TYPE: ammo acid (D) TOPOLOGY: linear 35 (11) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 27: Asn Thr Lys Gly Trp Ser Glu Val Leu Lys Gly Ser Glu Cys Lys Pro 40 1 5 10 15 Arg Pro lie Val Val Pro Val Ser Glu Thr His Pro Glu Leu Thr Ser 20 25 30 45 Gin Arg Phe Asn Pro Pro Cys Val Thr Leu Met Arg Cys Gly Gly Cys 35 40 45 Cys Asn Asp Glu Ser Leu Glu Cys Val Pro Thr Glu Glu Val Asn Val 50 55 60 Thr Met Glu Leu Leu Gly Ala Ser Gly Ser Gly Ser Asn Gly Met Gin 65 70 75 80 Arg Leu Ser Phe Val Glu His Lys Lys Cys Asp Cys Arg Pro Arg Phe 55 85 90 95 Thr Thr Thr Pro Pro Thr Thr Thr Arg Pro Pro Arg Arg Arg Arg 100 105 110 60 (2) INFORMATION FOR SEQ ID NO: 28: (i) SEQUENCE CHARACTERISTICS: Printed from Mimosa WO 98/49300 86 PCT/US98/07801 (A) LENGTH: 106 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 5 (n) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 28: 10 Ser Glu Val Leu Lys Gly Ser Glu Cys Lys Pro Arg Pro lie Val Val 15 10 15 Pro Val Ser Glu Thr His Pro Glu Leu Thr Ser Gin Arg Phe Asn Pro 20 25 30 15 30 40 45 60 Pro Cys Val Thr Leu Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Ser 35 40 45 Leu Glu Cys Val Pro Thr Glu Glu Val Asn Val Thr Met Glu Leu Leu 20 50 55 60 Gly Ala Ser Gly Ser Gly Ser Asn Gly Met Gin Arg Leu Ser Phe Val 65 70 75 80 25 Glu His Lys Lys Cys Asp Cys Arg Pro Arg Phe Thr Thr Thr Pro Pro 85 90 95 Thr Thr Thr Arg Pro Pro Arg Arg Arg Arg 100 105 (2) INFORMATION FOR SEQ ID NO: 29: (l) SEQUENCE CHARACTERISTICS: 35 (A) LENGTH: 101 amino acids (B) TYPE: ammo acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29: Gly Ser Glu Cys Lys Pro Arg Pro lie Val Val Pro Val Ser Glu Thr 15 10 15 His Pro Glu Leu Thr Ser Gin Arg Phe Asn Pro Pro Cys Val Thr Leu 20 25 30 Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Ser Leu Glu Cys Val Pro 50 35 40 45 Thr Glu Glu Val Asn Val Thr Met Glu Leu Leu Gly Ala Ser Gly Ser 50 55 60 55 Gly Ser Asn Gly Met Gin Arg Leu Ser Phe Val Glu His Lys Lys Cys 65 70 75 80 Asp Cys Arg Pro Arg Phe Thr Thr Thr Pro Pro Thr Thr Thr Arg Pro 85 90 95 Pro Arg Arg Arg Arg 100 Printed from Mimosa WO 98/49300 87 PCT/US98/07801 (2) INFORMATION FOR SEQ ID NO: 30: (l) SEQUENCE CHARACTERISTICS: 5 (A) LENGTH: 121 ammo acids (B) TYPE: amino acid (D) TOPOLOGY: linear 10 (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30: Asn Asp Ser Pro Pro Ser Thr Asn Asp Trp Met Arg Thr Leu Asp Lys 15 1 5 10 15 Ser Gly Cys Lys Pro Arg Asp Thr Val Val Tyr Leu Gly Glu Glu Tyr 20 25 30 20 Pro Glu Ser Thr Asn Leu Gin Tyr Asn Pro Arg Cys Val Thr Val Lys 35 40 45 25 55 Arg Cys Ser Gly Cys Cys Asn Gly Asp Gly Gin lie Cys Thr Ala Val 50 55 60 Glu Thr Arg Asn Thr Thr Val Thr Val Ser Val Thr Gly Val Ser Ser 65 70 75 80 Ser Ser Gly Thr Asn Ser Gly Val Ser Thr Asn Leu Gin Arg lie Ser 30 85 90 95 Val Thr Glu His Thr Lys Cys Asp Cys lie Gly Arg Thr Thr Thr Thr 100 105 110 35 Pro Thr Thr Thr Arg Glu Pro Arg Arg 115 120 (2) INFORMATION FOR SEQ ID NO: 31: 40 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 116 amino acids (B) TYPE: ammo acid (D) TOPOLOGY: linear 45 (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 31: 50 Ser Thr Asn Asp Trp Met Arg Thr Leu Asp Lys Ser Gly Cys Lys Pro 15 10 15 Arg Asp Thr Val Val Tyr Leu Gly Glu Glu Tyr Pro Glu Ser Thr Asn 20 25 30 Leu Gin Tyr Asn Pro Arg Cys Val Thr Val Lys Arg Cys Ser Gly Cys 35 40 45 Cys Asn Gly Asp Gly Gin lie Cys Thr Ala Val Glu Thr Arg Asn Thr 60 50 55 60 Thr Val Thr Val Ser Val Thr Gly Val Ser Ser Ser Ser Gly Thr Asn Printed from Mimosa WO 98/49300 88 PCT/US98/07801 65 70 75 80 Ser Gly Val Ser Thr Asn Leu Gin Arg lie Ser Val Thr Glu His Thr 85 90 95 5 Lys Cys Asp Cys lie Gly Arg Thr Thr Thr Thr Pro Thr Thr Thr Arg 100 105 110 Glu Pro Arg Arg 10 115 (2) INFORMATION FOR SEQ ID NO: 32: (i) SEQUENCE CHARACTERISTICS: 15 (A) LENGTH: 111 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 20 (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 32: Met Arg Thr Leu Asp Lys Ser Gly Cys Lys Pro Arg Asp Thr Val Val 25 1 5 10 15 Tyr Leu Gly Glu Glu Tyr Pro Glu Ser Thr Asn Leu Gin Tyr Asn Pro 20 25 30 30 Arg Cys Val Thr Val Lys Arg Cys Ser Gly Cys Cys Asn Gly Asp Gly 35 40 45 Gin lie Cys Thr Ala Val Glu Thr Arg Asn Thr Thr Val Thr Val Ser 50 55 60 Val Thr Gly Val Ser Ser Ser Ser Gly Thr Asn Ser Gly Val Ser Thr 65 70 75 80 35 Asn Leu Gin Arg lie Ser Val Thr Glu His Thr Lys Cys Asp Cys lie 40 85 90 95 Gly Arg Thr Thr Thr Thr Pro Thr Thr Thr Arg Glu Pro Arg Arg 100 105 110 45 (2) INFORMATION FOR SEQ ID NO: 33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 106 amino acids 50 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein 55 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 33: Lys Ser Gly Cys Lys Pro Arg Asp Thr Val Val Tyr Leu Gly Glu Glu 15 10 15 60 Tyr Pro Glu Ser Thr Asn Leu Gin Tyr Asn Pro Arg Cys Val Thr Val 20 25 30 Printed from Mimosa WO 98/49300 89 PCT/US98/07801 Lys Arg Cys Ser Gly Cys Cys 35 Val Glu Thr Arg Asn Thr Thr 5 50 55 Ser Ser Ser Gly Thr Asn Ser 65 70 10 Ser Val Thr Glu His Thr Lys 85 15 20 25 30 35 40 Gly Leu Glu Cys Val Pro Thr 65 70 Leu Met lie Gin Tyr Pro Ser 45 85 Glu His Ser Gin Cys Glu Cys 100 50 Lys Pro Asp Ser Pro Arg lie 115 Gin Arg Pro Asp Pro Arg Thr 130 135 55 Phe Leu His Cys Gin Gly Arg 145 150 Arg Cys Arg Lys Pro Arg Lys 60 165 Asn Gly Asp Gly Gin lie Cys Thr Ala 40 45 Val Thr Val Ser Val Thr Gly Val Ser 60 Gly Val Ser Thr Asn Leu Gin Arg lie 75 80 Cys Asp Cys lie Gly Arg Thr Thr Thr 90 95 Thr Pro Thr Thr Thr Arg Glu Pro Arg Arg 100 105 (2) INFORMATION FOR SEQ ID NO: 34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 167 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 34: Pro Val Ser Gin Phe Asp Gly Pro Ser His Gin Lys Lys Val Val Pro 15 10 15 Trp lie Asp Val Tyr Thr Arg Ala Thr Cys Gin Pro Arg Glu Val Val 20 25 30 Val Pro Leu Ser Met Glu Leu Met Gly Asn Val Val Lys Gin Leu Val 35 40 45 Pro Ser Cys Val Thr Val Gin Arg Cys Gly Gly Cys Cys Pro Asp Asp 50 55 60 Gly Gin His Gin Val Arg Met Gin lie 75 80 Ser Gin Leu Gly Glu Met Ser Leu Glu 90 95 Arg Pro Lys Lys Lys Glu Ser Ala Val 105 110 Leu Cys Pro Pro Cys Thr Gin Arg Arg 120 125 Cys Arg Cys Arg Cys Arg Arg Arg Arg 140 Gly Leu Glu Leu Asn Pro Asp Thr Cys 155 160 (2) INFORMATION FOR SEQ ID NO: 35: Printed from Mimosa WO 98/49300 90 PCT/US98/07801 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 185 amino acids 5 (B) TYPE. amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein 10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 35: Pro Val Ser Gin Pro Asp Ala Pro Gly His Gin Arg Lys Val Val Ser 15 10 15 15 Trp lie Asp Val Tyr Thr Arg Ala Thr Cys Gin Pro Arg Glu Val Val 20 25 30 20 35 50 60 Val Pro Leu Thr Val Glu Leu Met Gly Thr Val Ala Lys Gin Leu Val 35 40 45 Pro Ser Cys Val Thr Val Gin Arg Cys Gly Gly Cys Cys Pro Asp Asp 50 55 60 Gly Leu Glu Cys Val Pro Thr Gly Gin His Gin Val Arg Met Gin lie 25 65 70 75 80 Leu Met lie Arg Tyr Pro Ser Ser Gin Leu Gly Glu Met Ser Leu Glu 85 90 95 30 Glu His Ser Gin Cys Glu Cys Arg Pro Lys Lys Asp Ser Ala Val Lys 100 105 110 Pro Asp Arg Ala Ala Thr Pro His His Arg Pro Gin Pro Arg Ser Val 115 120 125 Pro Gly Trp Asp Ser Ala Pro Gly Ala Pro Ser Pro Ala Asp lie Thr 130 135 140 His Pro Thr Pro Ala Pro Gly Pro Ser Ala His Ala Ala Pro Ser Thr 40 145 150 155 160 Thr Ser Ala Leu Thr Pro Gly Pro Ala Ala Ala Ala Ala Asp Ala Ala 165 170 175 45 Ala Ser Ser Val Ala Lys Gly Gly Ala 180 185 (2) INFORMATION FOR SEQ ID NO: 36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 201 amino acids (B) TYPE: amino acid 55 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 36: Pro Val Ser Gin Pro Asp Ala Pro Gly His Gin Arg Lys Val Val Ser 15 10 15 Printed from Mimosa WO 98/49300 91 PCT/US98/07801 10 25 55 Trp lie Asp Val Tyr Thr Arg Ala Thr Cys Gin Pro Arg Glu Val Val 20 25 30 Val Pro Leu Thr Val Glu Leu Met Gly Thr Val Ala Lys Gin Leu Val 35 40 45 Pro Ser Cys Val Thr Val Gin Arg Cys Gly Gly Cys Cys Pro Asp Asp 50 55 60 Gly Leu Glu Cys Val Pro Thr Gly Gin His Gin Val Arg Met Gin lie 65 70 75 80 Leu Met lie Arg Tyr Pro Ser Ser Gin Leu Gly Glu Met Ser Leu Glu 15 85 90 95 Glu His Ser Gin Cys Glu Cys Arg Pro Lys Lys Lys Asp Ser Ala Val 100 105 110 20 Lys Gin Asp Arg Ala Ala Thr Pro His His Arg Pro Gin Pro Arg Ser 115 120 125 Val Pro Gly Trp Asp Ser Ala Pro Gly Ala Pro Ser Pro Ala Asp lie 130 135 140 Thr Gin Ser His Ser Ser Pro Arg Pro Leu Cys Pro Arg Cys Thr Gin 145 150 155 160 His His Gin Cys Pro Asp Pro Arg Thr Cys Arg Cys Arg Cys Arg Arg 30 165 170 175 Arg Ser Phe Leu Arg Cys Gin Gly Arg Gly Leu Glu Leu Asn Pro Asp 180 185 190 35 Thr Cys Arg Cys Arg Lys Leu Arg Arg 195 200 (2) INFORMATION FOR SEQ ID NO: 37: 40 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 399 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 45 (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 37: 50 Gly Pro Arg Glu Ala Pro Ala Ala Ala Ala Ala Phe Glu Ser Gly Leu 15 10 15 Asp Leu Ser Asp Ala Glu Pro Asp Ala Gly Glu Ala Thr Ala Tyr Ala 20 25 30 Ser Lys Asp Leu Glu Glu Gin Leu Arg Ser Val Ser Ser Val Asp Glu 35 40 45 Leu Met Thr Val Leu Tyr Pro Glu Tyr Trp Lys Met Tyr Lys Cys Gin 60 50 55 60 Printed from Mimosa WO 98/49300 92 PCT/US98/07801 Leu Arg Lys Gly Gly Trp Gin His Asn Arg Glu Gin Ala Asn Leu Asn 65 70 75 80 Ser Arg Thr Glu Glu Thr lie Lys Phe Ala Ala Ala His Tyr Asn Thr 5 85 90 95 Glu lie Leu Lys Ser lie Asp Asn Glu Trp Arg Lys Thr Gin Cys Met 100 105 110 10 Pro Arg Glu Val Cys lie Asp Val Gly Lys Glu Phe Gly Val Ala Thr 115 120 125 15 Asn Thr Phe Phe Lys Pro Pro Cys Val Ser Val Tyr Arg Cys Gly Gly 130 135 140 Cys Cys Asn Ser Glu Gly Leu Gin Cys Met Asn Thr Ser Thr Ser Tyr 145 150 155 160 Leu Ser Lys Thr Leu Phe Glu lie Thr Val Pro Leu Ser Gin Gly Pro 20 165 170 175 Lys Pro Val Thr lie Ser Phe Ala Asn His Thr Ser Cys Arg Cys Met 180 185 190 25 Ser Lys Leu Asp Val Tyr Arg Gin Val His Ser lie lie Arg Arg Ser 195 200 205 30 Leu Pro Ala Thr Leu Pro Gin Cys Gin Ala Ala Asn Lys Thr Cys Pro 210 215 220 Thr Asn Tyr Met Trp Asn Asn His lie Cys Arg Cys Leu Ala Gin Glu 225 230 235 240 Asp Phe Met Phe Ser Ser Asp Ala Gly Asp Asp Ser Thr Asp Gly Phe 35 245 250 255 His Asp lie Cys Gly Pro Asn Lys Glu Leu Asp Glu Glu Thr Cys Gin 260 265 270 40 Cys Val Cys Arg Ala Gly Leu Arg Pro Ala Ser Cys Gly Pro His Lys 275 280 285 45 Glu Leu Asp Arg Asn Ser Cys Gin Cys Val Cys Lys Asn Lys Leu Phe 290 295 300 Pro Ser Gin Cys Gly Ala Asn Arg Glu Phe Asp Glu Asn Thr Cys Gin 305 310 315 320 Cys Val Cys Lys Arg Thr Cys Pro Arg Asn Gin Pro Leu Asn Pro Gly 50 325 330 335 Lys Cys Ala Cys Glu Cys Thr Glu Ser Pro Gin Lys Cys Leu Leu Lys 340 345 350 55 Gly Lys Lys Phe His His Gin Thr Cys Ser Cys Tyr Arg Arg Pro Cys 355 360 365 60 Thr Asn Arg Gin Lys Ala Cys Glu Pro Gly Phe Ser Tyr Ser Glu Glu 370 375 380 Val Cys Arg Cys Val Pro Ser Tyr Trp Lys Arg Pro Gin Met Ser 385 390 395 Printed from Mimosa WO 98/49300 93 PCT/US98/07801 (2) INFORMATION FOR SEQ ID NO: 38: (l) SEQUENCE CHARACTERISTICS: 5 (A) LENGTH: 133 ammo acids (B) TYPE: amino acid (D) TOPOLOGY: linear 10 (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 38: Met Lys Leu Leu Val Gly lie Leu Val Ala Val Cys Leu His Gin Tyr 15 1 5 10 15 Leu Leu Asn Ala Asp Ser Asn Thr Lys Gly Trp Ser Glu Val Leu Lys 20 25 30 20 Gly Ser Glu Cys Lys Pro Arg Pro lie Val Val Pro Val Ser Glu Thr 35 40 45 25 40 45 His Pro Glu Leu Thr Ser Gin Arg Phe Asn Pro Pro Cys Val Thr Leu 50 55 60 Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Ser Leu Glu Cys Val Pro 65 70 75 80 Thr Glu Glu Val Asn Val Thr Met Glu Leu Leu Gly Ala Ser Gly Ser 30 85 90 95 Gly Ser Asn Gly Met Gin Arg Leu Ser Phe Val Glu His Lys Lys Cys 100 105 110 35 Asp Cys Arg Pro Arg Phe Thr Thr Thr Pro Pro Thr Thr Thr Arg Pro 115 120 125 Pro Arg Arg Arg Arg 130 (2) INFORMATION FOR SEQ ID NO: 39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 8 ammo acids (B) TYPE: amino acid (D) TOPOLOGY: linear 50 (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 39: Met Lys Leu Thr Ala Thr Leu Gin Val Val Val Ala Leu Leu lie Cys 55 1 5 10 15 Met Tyr Asn Leu Pro Glu Cys Val Ser Gin Ser Asn Asp Ser Pro Pro 20 25 30 60 Ser Thr Asn Asp Trp Met Arg Thr Leu Asp Lys Ser Gly Cys Lys Pro 35 40 45 Printed from Mimosa WO 98/49300 94 PCT/US98/07801 Arg Asp Thr Val Val Tyr Leu Gly Glu Glu Tyr Pro Glu Ser Thr Asn 50 55 60 Leu Gin Tyr Asn Pro Arg Cys Val Thr Val Lys Arg Cys Ser Gly Cys 5 65 70 75 80 Cys Asn Gly Asp Gly Gin lie Cys Thr Ala Val Glu Thr Arg Asn Thr 85 90 95 10 Thr Val Thr Val Ser Val Thr Gly Val Ser Ser Ser Ser Gly Thr Asn 100 105 110 15 25 50 Ser Gly Val Ser Thr Asn Leu Gin Arg lie Ser Val Thr Glu His Thr 115 120 125 Lys Cys Asp Cys lie Gly Arg Thr Thr Thr Thr Pro Thr Thr Thr Arg 130 135 140 Glu Pro Arg Arg 20 145 (2) INFORMATION FOR SEQ ID NO: 40: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 30 (ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 40: Met Asn Phe Leu Leu Ser Trp Val His Trp Ser Leu Ala Leu Leu Leu 35 1 5 10 15 Tyr Leu His His Ala Lys Trp Ser Gin Ala 20 25 40 (2) INFORMATION FOR SEQ ID NO: 41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs 45 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 41: GCAGAGCTCG TTTAGTGAAC Printed from Mimosa 95 </div>

Claims

<div class="application article clearfix printTableText" id="claims"> Claims

1. A truncated VRP subunit having a deletion of at least one of the amino acid residues N-terminal to the first cysteine of the core sequence of said subunit, with the proviso that said truncated VRP subunit is not a truncated VEGF-3 subunit.

2. The truncated VRP subunit of claim 1 wherein the VRP is a human VRP.

3. The truncated VRP subunit of claim 1 wherein said VRP is selected from the group consisting of VEGF-B, VRF-2, VEGF-C, P1GF, poxvirus ORF-1, and poxvirus ORF-2.

4. The truncated VRP subunit of claim 1 wherein said VRP is VEGF-B.

5. The truncated VRP subunit of claim 1 wherein said VRP subunit comprises an amino acid sequence of Figure 2.

6. The truncated VRP subunit of claim 1 wherein the amino acid residues N-terminal to the first cysteine of the core sequence of said subunit are deleted.

7. The truncated VRP subunit of claim 1 wherein the amino acid sequence N-terminal to said core sequence comprises 2 to 5 amino acid residues. intellectual property office of n z. 1 7 OCT 2001 RECEIVED * 1 96

8. The truncated VRP subunit of claim 7 wherein said 2 to 5 amino acid residues comprise 2 to 5 of the consecutive amino acid residues immediately N-terminal to the first cysteine of the core sequence of said VRP subunit.

9. The truncated VRP subunit of claim 1 wherein the amino acid sequence N-terminal to said core sequence comprises 6 to 10 amino acid residues.

10. The truncated VRP subunit of claim 9 wherein said 6 to 10 amino acid residues comprise 6 to 10 of the consecutive amino acid residues immediately N-terminal to the first cysteine of the core sequence of said VRP subunit.

11. The truncated VRP subunit of claim 1 wherein the amino acid sequence N-terminal to said core sequence comprises 11 to 20 amino acid residues.

12. The truncated VRP subunit of claim 11 wherein said 11 to 20 amino acid residues comprise 11 to 20 of the consecutive ammo acid residues immediately N-terminal to the first cysteine of the core sequence of said VRP subunit.

13. The truncated VRP subunit according to claim 1, further comprising at the N-terminus of said truncated VRP subunit, the first one or two amino acid residues of the mature non-truncated VRP subunit, with the proviso that the deletion comprises more than two amino acid residues. intellectual property office of n.z. 3 0 OCT 2001 D C r» n i ii — — 97

14. A truncated VRP comprising two VRP subunits of claim 13.

15. A truncated VRP comprising two VRP subunits of claim 1, wherein said two VRP subunits have the same amino acid sequence.

16. A truncated VRP heterodimer comprising a first subunit comprising a truncated VRP subunit of claim 1/ and a second subunit comprising a subunit selected from the group consisting of VRP subunits, and a truncated VRP subunit of claim 1, wherein said second subunit has a different amino acid sequence than said first subunit.

17. A nucleic acid molecule coding for a truncated VRP subunit of claim 1.

18. The nucleic acid molecule of claim 17 wherein the nucleic acid molecule is a DNA molecule.

19. The nucleic acid molecule of claim 17 wherein the nucleic acid molecule is an RNA molecule.

20. A recombinant DNA vector comprising the nucleic acid molecule of claim 17.

21. A recombinant DNA expression vector comprising a nucleic acid molecule of claim 17.

22. The recombinant DNA expression vector of claim 21 wherein said nucleic acid molecule is operably linked at intellectual property office of nz. 1 7 OCT 2001 RECEIVED 98 the 5' end of said nucleic acid molecule to a DNA sequence that codes for a signal peptide.

23. The recombinant DNA expression vector of claim 22 wherein said signal peptide is selected from the group consisting of VEGF signal peptide, VEGF-B signal peptide, VRF-2 signal peptide, VEGF-C signal peptide, VEGF-3 signal peptide, and P1GF signal peptide.

24. The recombinant DNA expression vector of claim 22 wherein said signal peptide is selected from the group consisting of poxvirus ORF-1 signal peptide, and poxvirus ORF-2 signal peptide.

25. The recombinant DNA expression vector of claim 22 wherein said signal peptide is VEGF-B signal peptide.

26. The recombinant DNA expression vector of claim 22 wherein said DNA sequence coding for said signal peptide is operably linked at the 3' end of said DNA sequence to DNA coding for the first amino acid residue of the mature non-truncated VRP subunit and wherein the 3' end of said DNA coding for said residue is operably linked to said nucleic acid molecule coding for said truncated VRP subunit.

27. The recombinant DNA expression vector of claim 22 wherein said DNA sequence coding for said signal peptide is operably linked at the 3' end of said DNA sequence to DNA coding for the first two amino acid residues of the mature non-truncated VRP subunits and wherein the 3' end of said DNA coding for said two residues is operably linked to said intellectual property office of n.z. 1 7 OCT 2001 RECEIVED 99 nucleic acid molecule coding for said truncated VRP subunit.

28. The recombinant DNA expression vector of claim 22 wherein said nucleic acid molecule is operably linked to control sequences operable in a host cell transformed with said vector.

29. A transformed or transfected host cell comprising the recombinant DNA expression vector of claim 21.

30. A transformed or transfected host cell comprising the recombinant DNA expression vector of claim 22.

31. A transformed or transfected host cell comprising the recombinant DNA expression vector of claim 26.

32. A delivery vector comprising a nucleic acid molecule of claim 17.

33. A delivery vector of claim 32, wherein said delivery vector is a viral delivery vector.

34. An adenovirus vector comprising the nucleic acid molecule of claim 17.

35. The adenovirus vector of claim 34 wherein said nucleic acid molecule is operably linked at the 5' end of said nucleic acid molecule to a DNA sequence that codes for a signal peptide. intellectual property office of n z. 1 7 OCT 2001 RECEIVED 100

36. The adenovirus vector of claim 35 wherein said signal peptide is selected from the group consisting of VEGF signal peptide, VEGF-B signal peptide, VRF-2 signal peptide, VEGF-C signal peptide, and P1GF signal peptide.

37. The adenovirus vector of claim 35 wherein said signal peptide is selected from the group consisting of poxvirus ORF-1 signal peptide, and poxvirus ORF-2 signal peptide.

38. The adenovirus vector of claim 35 wherein said signal peptide is VEGF-B signal peptide.

39. The adenovirus vector of claim 35 wherein said DNA sequence coding for said signal peptide is operably linked at the 31 end of said DNA sequence to DNA coding for the first amino acid residue of the mature non-truncated VRP subunit, and wherein the 3' end of said DNA coding for said residue is operably linked to said nucleic acid molecule coding for said truncated VRP subunit.

40. A filtered injectable adenovirus vector preparation, comprising: a recombinant adenoviral vector, said vector containing no wild-type virus and comprising: a partial adenoviral sequence from which the E1A/E1B genes have been deleted, and a transgene coding for a truncated VRP subunit of claim 1, driven by a promoter flanked by the partial adenoviral sequence; and a pharmaceutically acceptable carrier. intellectual property office of nz. j 1 7 OCT 2001 RECEIVED 101

41. The preparation of claim 40 wherein said adenovirus vector has been filtered through a 30 micron filter.

42. The injectable adenoviral vector preparation according to claim 40 wherein said promoter is selected from the group consisting of a CMV promoter, a ventricular myocyte-specific promoter, and a myosin heavy chain promoter.

43. A method of producing a truncated VRP polypeptide comprising growing, under suitable conditions, a host cell transformed or transfected with the recombinant DNA expression vector of claim 21 in a manner allowing expression of said polypeptide, and isolating said polypeptide from the host cell.

44. A pharmaceutical composition comprising a VRP comprising at least one truncated VRP subunit of claim 1, in a suitable carrier.

45. A method of stimulating endothelial cell growth or cell migration in vitro comprising treating said endothelial cells with a truncated VRP comprising at least one truncated VRP subunit of claim 1, in a suitable carrier.

46. A pharmaceutical composition comprising a truncated VRP comprising at least one truncated VRP subunit of claim 1, and one or more potentiating agents in a pharmaceutically acceptable carrier. intellectual property office of N Z. 1 1 OCT 2001 Received 102

47. The pharmaceutical composition of claim 4 6 wherein said potentiating agent is an angiogenic FGF.

48. The pharmaceutical composition of claim 47, wherein said potentiating agent is selected from the group consisting of FGF-1, FGF-2, FGF-4, FGF-5, and FGF-6, in a pharmaceutically acceptable carrier.

49. A truncated VRP subunit as claimed in claim 1 substantially as herein described or exemplified.

50. A truncated VRP as claimed in any one of claims 14 to 16 substantially as herein described or exemplified.

51. A nucleic acid molecule as claimed in claim 17 substantially as herein described or exemplified.

52. A recombinant DNA vector as claimed in claim 20 or 21 substantially as herein described or exemplified.

53. A host cell as claimed in any one of claims 29 to 31 substantially as herein described or exemplified.

54. A delivery vector as claimed m claim 32 substantially as herein described or exemplified.

55. An adenovirus vector as claimed in claim 34 substantially as herein described or exemplified.

56. A filtered injectable adenovirus vector preparation as claimed in claim 40 substantially as herein described or exemplified. intellectual property office of n z. 1 7 OCT 2001 received 103

57. A method as claimed in claim 43 or 45 substantially as herein described or exemplified.

58. A pharmaceutical preparation as claimed in claim 44 or 46 substantially as herein described or exemplified. intellectual property office of nz. 1 7 OCT 2001 received </div>