NZ238383A

NZ238383A - Recombinant dna and process for the production of chimeric antibodies

Info

Publication number: NZ238383A
Application number: NZ238383A
Authority: NZ
Inventors: Ulrich H Weidle; Brigitte Kaluza; Walter Knapp
Original assignee: Boehringer Mannheim Gmbh
Priority date: 1990-06-08
Filing date: 1991-06-04
Publication date: 1993-10-26
Also published as: NO912192D0; CA2043516A1; AU629752B2; KR920000922A; ZA914363B; FI912763A; EP0460674A3; IL98403A0; DE4018442A1; HUT58795A; AU7824391A; JPH04330286A; PT97916A; HU911919D0; CS175691A3; IE911808A1; EP0460674A2; NO912192L; FI912763A0

Description

<div id="description" class="application article clearfix"> * Con. ^ i ■_ C\oc.Z- ''-'V '. <* w Pt:h- 2 6 OCT 1993 . » ,.r;, \ ' % "T- \ ' ' \ NEW ZEALAND PATENTS ACT, 1953 No.: Date: COMPLETE SPECIFICATION ■RECOMBINANT DMA AND PROCESS FOR THE PRODUCTION OF CHIMERIC ANTIBODIES" We, BOEHRINGER MANNHEIM GmbH, a German Corporation, of Sandhofer Strasse 112-132, D—6800 Mannheim Waldhof, Germany, hereby declare the invention for which we pray that a patent may be granted to us, and the method by which it is to be performed, to be particularly described in and by the following statement:- - 1 - (followed by page la) f .J 1 •- Description The invention concerns recombinant DNA which codes for the light or heavy chain of an antibody whose constant regions are of human origin and whose variable regions are of non-human origin, expression vectors containing such a recombinant DNA, as well as processes for the production of the recombinant DNA or the expression vectors and finally processes for the production of the chimeric antibody. The use of antibodies in therapy is becoming increasingly important. Thus for example antibodies against the interleukin 2 (IL-2) receptor are of great therapeutic interest as immunosuppressants. The in vivo effectiveness of such antibodies could be demonstrated in a series of experimental animal models. Examples of this are described for heart and skin transplantation in the mouse by Kirkman et al., Transplantation Proceedings 19 (1987) 618-690 and T. Diamantstein et al., Transplantation Reviews 1 (1987), 177-196, for heart transplantation in the rat by J.W. Kupiec-Weglinski et al., Proc. Natl. Acad. Sci. USA 83 (1986) 2624, for the transplantation of islets of Langerhans in the rat by Hahn et al., Diabetologia 30 (1987), 40 and for kidney transplantation in primates by T. Diamantstein et al., Transplantation Reviews 1 (1987) 177-196. The successful preventive application of rat antibodies against the IL-2 receptor in kidney transplantations has also been described for humans (J.P. Soulillou et al., J. of Autoimmunity 1 (1988) 655-661; D. Cantarovitch et al., Am. J. of Kidney Disease 11 (1988) 101-106) . A disadvantage is, however, that mouse and rat antibodies are potent iininunogens after injection into the blood of humans which can lead to neutralization of the therapeutic activity. There is therefore a great interest in the availability of hybrid mouse/human antibodies or humanized antibodies which promise to have a substantially reduced or even eliminated immunogenicity in humans (S.L. Morrison et al., Proc. Natl. Acad. Sci. USA 31 (1984) 6851-6855; P.T. Jones et al., Nature 321 (1986) 522-525). Such hybrid antibodies have up to now mainly been produced by genetic engineering in which corresponding cDNAs are fused and expressed in suitable host cells. However, a drawback of this is that the cDNAs coding for the hybrid antibodies are poorly expressed. In another production method, in order to construct such antibodies the genes for the light and heavy chain are usually first isolated from a phage library and characterized. Afterwards the genomic DNA of the VJ region or the VDJ region is fused by genetic engineering to the corresponding genomic DNA of the constant regions of the light and heavy human chains ( cf. for this S.L. Morrison et al., Proc. Natl. Acad. Sci. USA 81 (1984) 6851-6855; S.H. Boulianne et al., Nature 312 (1984) 641-646; L.K. Sun et al., Proc. Natl. Acad. Sci. USA 84 (1987) 214-218; Y. Nishimura et al., Cancer Res. 47 (1987) 999-1005; B.A. Brown et al., Cancer Res. 47 (1987) 3577-3583). Since as a rule 106 plaques have to be examined in order to find a gene with a copy number of 1, this second type of procedure is extremely laborious. Moreover the characterization of the genomic isolates (restriction mapping, differentiation of the gene structure in o % : - - 3 - somatic and germ line cells, differentiation between abberantly and correctly rearranged genes) is extremely time-consuming. The object of the present invention was therefore to facilitate the production of chimeric antibodies. This object is achieved according to the present invention by a recombinant DNA which codes for the light or heavy chain of an antibody whose constant regions are of human origin and whose variable regions are of non-human origin, which is characterized in that it contains in the direction of transcription (a) a cDNA sequence which codes for the variable non-human region, including the region J and, if desired, D, (b) an intron sequence which has a splice donor site at its 5 1 end and is composed of a non-human intron partial sequence at the 51 end and a human intron partial sequence at the 3' end and (c) a genomic DNA sequence coding for the human constant region. The light and heavy chains for chimeric antibodies having the desired specificity can be produced in a surprisingly high yield with the aid of the recombinant DNA. In this connection an additional special advantage is that the easily obtainable cDNA sequence for the variable region of desired specificity (cDNA for antibody genes is easy to isolate since the corresponding mRNA is present in hybridoma cells as a large proportion of the total mRNA) can be connected via the intron sequence with an already subcloned genomic DNA segment which codes for the appropriate human constant regions and thus has a wide spectrum of ^ o Go u o - 4 - applicability. Thus the invention offers the opportunity to easily produce recombinant DNA molecules which each have the DNA sequence encoding the corresponding specificity. The cDNA sequence a) of the recombinant DNA according to the present invention includes the V and the J region for a light chain and in addition the D region between V and J for a heavy chain. The recombinant DNA according to the present invention contains with its components a), b) and c) at all sites at which introns are naturally present in antibody genes corresponding DNA sequences except from locations at which introns occur in the signal sequences in all light and heavy chains. The expression of the recombinant DNA according to the present invention in suitable host cells leads to a much higher expression of the desired antibody in comparison to processes which have been known up to now for the production of chimeric antibodies using cDNA expression. The term intron sequence as used herein includes naturally occurring intron sequences and fragments and equivalents thereof. In a preferred embodiment of the invention the sequence a) as well as the non-human intron partial sequence of b) are of murine origin and the non-human intron partial sequence of b) is preferably 15 to 20 nucleotides long. In a particularly preferred embodiment the non-human intron partial sequence of b) is a part of the intron sequence which naturally follows the sequence a) i.e. in the genomic DNA. However, within the scope of the invention other non-human intron sequences can also be used, preferably however of the same species and if possible also derived from a gene encoding the light or heavy chain of an antibody. y *. '■ \ v X L. , '■ -.J - 5 - In a further preferred embodiment of the invention the splice donor site in b) has the sequence GT. According to the present invention a branch site is preferably located in the human part of the intron sequence which can e.g. correspond to one of the known sequences such as those described by Sharp, P.A., Science 235 (1987) 766-771. The branch site can, however, also be located in the murine part of the intron. A promoter sequence is preferably also added to the 5' end of the recombinant DNA under the control of which the sequences coding for the antibody chains can be expressed. The promoters which naturally, i.e. as in the genome, exert control over the corresponding sequences of the recombinant DNA can e.g. be used for this. However, preferably promoters are used which enable an increased, and if desired regulatable, expression. Such promoters are known to one skilled in the art. In a particularly preferred embodiment the recombinant DNA has the promoter of the cytomegalo-virus. In addition a further preferred embodiment of the invention is a recombinant DNA whose sequence a) codes for the variable region of the light or heavy chain of an antibody capable of specific binding to the interleukin 2 receptor. In addition the human sequence c) of the recombinant DNA according to the present invention coding for a heavy chain preferably codes for the constant region of the heavy chain of a human antibody of the IgG type. Such recombinant DIJAs are contained in the plasmids pKchim. and p^chim. whereby the plasmid pKchim. contains a DMA sequence coding for the light chain, i.e. kappa chain and the plasmid p ^chim. carries a recombinant DNA coding for a heavy chain of the type which together code for an antibody of the IgG type whose specificity is directed against the alpha chain of the human interleukin 2 receptor. The invention also provides an expression vector which contains one of the recombinant DNAs according to the present invention as well as all necessary elements for the expression of this recombinant DNA. The elements which are necessary for this or which are preferably used are promoters, regulatory sequences and suchlike. Expression vectors are well-known to one skilled in the art and are described for example in more detail by E.L. Winnacker in "From Genes To Clones", 1987, Verlag Chemie, Weinheim. With the expression vectors according to the present invention it is possible to incorporate a recombinant DNA according to the present invention into suitable host cells and to express it there. Particularly preferred expression vectors which contain recombinant DNA according to the present invention and which are also the subject matter of the invention are the already mentioned plasmids pKchim. and p^-chim. The invention in addition provides a process for the production of a recombinant DNA according to the present invention in which polyA+ RNA is isolated from a hybridoma cell line secreting an antibody of the desired specificity, a cDNA library of this hybridoma cell line is prepared in suitable vectors and examined for clones which contain the cDNA for antibody chains by hybridization with oligonucleotides which are complementary to the DNA coding for the constant part of the antibody, the V, J, and if desired D, sequences are isolated, a splice donor site, a part of an antibody intron sequence of non-human origin and a restriction cleavage site adjacent to the respective J domain in the direction of transcription are introduced by site-directed mutagenesis and the DNA obtained is ligated with a genomic DNA sequence which codes for the constant region of the light or heavy chain of a human antibody and has a part of a corresponding human intron sequence at its 51 end. The isolation of the polyA+ RNA, cDNA synthesis, as well as the establishment of a cDNA library are carried out according to known methods such as those described e.g. in Maniatis et al., Molecular Cloning: a Laboratory Manual, 1932, Cold Spring Harbor. The selection of cDNA clones coding for antibody chains is also carried out in a known manner, i.e. by examining for clones which hybridize with an oligonucleotide which is complementary to a DNA which codes for the constant region of an antibody which is derived from the same hybridoma cell species. The site-directed mutagenesis for the introduction of a splice donor site and a unique restriction enzyme cleavage site is also well-known and is carried out according to the method which was described by Morinaga et al., Bio/Technology 2 (1984) 636-639. In a preferred embodiment of the invention a mouse or rat hybridoma cell is used. The establishment of hybridoma cells which secrete antibodies of the desired specificity is carried out according to the method which was first described by Kohler and Milstein (Nature 256 (1975), 495) and which was subsequently developed further. These techniques are very familiar to one skilled in the art. In the process according to the present invention it is particularly preferable to use a mouse hybridoma cell which secretes antibodies directed against the alpha chain of the human interleukin 2 receptor. For the introduction of the non-human intron partial sequence, a 15 to 20 base pair sequence is preferably used. In this case it is particularly preferably to use the partial intron sequence which follows in the authentic gene. In addition it is preferred to introduce the nucleotide sequence GT as splice donor site. Finally it is preferred according to the present invention to use a human genomic DNA whose intron partial sequence contains a branch site. In order to obtain a recombinant DNA which can be expressed well, a promoter sequence is preferably placed in front of the DNA sequence which is finally obtained or the manipulations which are necessary for the process according to the present invention are carried out from the beginning in a vector which contains a promoter in a suitable position. In this connection it is particularly preferable to use the promoter of the cytomegalo-virus genome. In yet another preferred embodiment of the invention a human genomic DNA sequence which codes for the constant region of the light or heavy chain of an antibody of the IgG type is used for the construction of a recombinant DNA coding for a light or heavy chain. The invention also provides a process for the construction of an expression vector according to the present invention in which a recombinant DNA according to the present invention is inserted into a suitable vector for the expression of a foreign gene. As already set forth above such vectors are known to one skilled in the art and contain all necessary components such as e.g. polylinker for inserting the recombinant DNA, antibiotic resistance genes in order to select colonies which contain the recombinant DNA, an origin of replication, regulatory elements, a promoter, if the recombinant DNA does not already have one, as well as, if desired, further components such as e.g. suppressor genes for selection of colonies carrying plasmid DNA. The invention in turn also provides a process for the production of a chimeric antibody whose variable regions are of non-human origin and whose constant regions are of human origin in which in this case one each of an expression vector which contains a recombinant DNA according to the present invention which codes for the light chain and an expression vector which contains a recombinant DNA according to the present invention which codes for the heavy chain of the antibody are introduced into suitable host cells, stable transformants are isolated and the antibodies are isolated from the culture supernatant of the cells according to known methods. In this process a non-producer hybridoma cell is preferably used as the host cell, the cell line Sp2/0-Agl4 (ATCC CRL 8922) is particularly preferred. In the process according to the present invention it is preferable to carry out an electroporation (Nucl. Acids Res. 15 (1987), 1311-1326, Bio Techniques 6 (1988), 742-751) in order to introduce the vectors into the host cells, if desired with linearized DNA molecules. - 10 - However, other processes known to one skilled in the art can also be used for the transfection of the host cells. The process according to the present invention enables antibodies to be produced in a simple manner with a variety of specificities. These antibodies are not immunogenic or only very weakly immunogenic when applied therapeutically in humans since the constant regions are of human origin. Nowadays there are relatively simple methods to produce e.g. mouse hybridoma cells which secrete antibodies of a desired specificity and to isolated cDNA from them, this cDNA can be easily introduced into previously prepared vectors according to the process according to the present invention which each contain the genomic human part for the constant regions of the light or heavy chain. Thus it is possible to obtain chimeric antibodies of the desired specificity in each case by simple ligation of the desired cDNA fragment into the appropriately prepared vectors and expression of recombinant DNA on both vectors in a host cell. The production of chimeric antibodies is not only much more simple than with the methods known hitherto but the yields are also greatly increased. The invention therefore also provides the chimeric antibodies MAB 179, MAB 215 and MAB 447 whose sequences for the light and heavy chains are shown in the sequence protocols SEQ ID N0:1 to 6 (the sequences of the variable regions are shown, the sequences of the constant regions are known and described e.g. in Sequences of proteins of immunological interest; E. Kabat, T. Wu, M. Reid-Miller, H. Perry and K. Gottesman, US Department of Health and Human Services, 1987, p. 282-325) and whose production is described in the *=—• ~,J - 11 - examples. All three antibodies are specific for the alpha chain of the human IL 2 receptor. The invention is elucidated further by the following examples in conjunction with the sequence protocols and figures. SEQ ID N0.:1 shows the DNA and amino acid sequence of the variable region as well as the beginning of the constant region of the light chain of MAB 179, SEQ ID NO.: 2 shows the DNA and amino acid sequence of the variable region as well as the beginning of the constant region of the light chain of MAB 447 SEQ ID NO.: 3 shows the DNA and amino acid sequence of the variable region as well as the beginning of the constant region of the light chain of MAB 215, SEQ ID NO.: 4 to 6 show the sequences of the respective variable regions of their corresponding heavy chains; Fig. 1 shows diagrammatically the isolation of a murine cDNA fragment coding for the variable region of the light immunoglobulin chain and the procedure for the site-directed mutagenesis; Fig. 2a shows the insertion of the variable murine region of the light immunoglobulin chain into an expression vector; Fig. 2b shows diagrammatically the assembly of the murine and human antibody coding sequences for the light chain; Fig. 3 and 4a as well as 4b show a diagram of the same process for the DNA of the heavy immunoglobulin chains. Example 1 Cloning and sequence analysis of the light and heavy chains of MAB179. 447 and 215 R2JA was prepared from the hybridoma lines which secrete the monoclonal antibodies 179, 447 or 215 (Cleary, et al.: Cell 44 (1986) 97-106) and polyA+RNA was isolated from it (Maniatis, T. , et al., Molecular Cloning: A Laboratory Manual, (Cold Spring Harbor Lab., Cold Spring Harbor, NY, 1982) using an oligo-dT cellulose column (Collaborative Research, Bedford, MA). A cDNA library was constructed for each hybridoma cell line with a cDNA cloning kit from Pharmacia according to the instructions of the manufacturer (analogous to Gubler, U. and Hoffman, G.J.: Gene (1983) 25, 263). This cDNA library comprised about 10000 recombinants for each hybridoma line. The following primer was used to screen for clones of the kappa chain: 51CCCGACTACGACGT3• - 13 - The following primer was used to screen for clones of the £ chain (^-1 and ^2b) : 5'CAGATAGGTGACCGG31 All the heavy chains of mouse immunoglobulin genes are detected with this primer (Sablitzky, F. and Rajewski, K.: EMBO J. 3 (1984) 3005-3012). The cDNA library was established in the vector pT7T318U (Pharmacia). By this means it was possible to regain the insertions as EcoRI fragments. By analysis with restriction endonucleases it was found that clones of complete length were obtained for the heavy and light chains of MAB179, 447 and 215. The relevant regions were subcloned in M13 vectors and sequenced (Sanger, F., et al.: Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467). The sequences of the variable regions are shown in the sequence protocols SEQ ID NO:1 to NO:6. In this case it can be seen that MAB179 and 447 use the same and VH segments for the light and the heavy chains. Both kappa chains use the J1 region and have identical nucleotides at the VJ junctions which indicates that the VJ region of both kappa genes has the same origin. Both yl chains have the same D region, the same J region (JH3) and an identical VDJ recombination from which it can be deduced that both VDJ regions of the jj-1 genes have the same origin. The comparison of the amino acid sequences of the light chains shows 3 amino acid substitutions in the V regions of the kappa cDNA of MAB179 and MAB447. The substitutions are as follows: (Thr to Ser, amino acid 20), (Lys to Arg, amino acid 45) , (Asn to Lys, amino acid 53). 98 % of the amino acids of the VJ region of MAB179 and 447 are identical. There are 6 amino acid substitutions in the V regions of the jfl cDNA of MAB179 and MAB447. The substitutions are as follows: (Val to Ala, amino acid 23; Gly to Ser, amino acid 56; lie to Val, amino acid 58; Thr to Arg, amino acid 63; Lys to Arg, amino acid 65; Gin to Glu, amino acid 82). 94 % of the amino acids of the VJ regions of MAB179 and 447 are identical. The data suggest that the differences in the amino acid sequences of MAB179 and MAB447 are due to somatic mutations. The initiation codon (Met) = start of the signal sequence is shown in the sequence protocols for kappa and yl cDNA of MAB179 and 447. The J or DJ regions are also shown as well as the beginning of each of the constant regions. The sequences of the variable regions for the kappa and the chain of the non-inhibitory (with respect to IL 2 binding) antibody MAB215 are shown in SEQ ID NO:3 and NO: 6. The J4 region is used for the kappa chain. A V segment is used which greatly differs from that of the light chains of MAB179 and 447. Only 51 % of the amino acids are identical compared to the V segment of 179. A J 7 - 15 - The sequence of the ^2b c^ain shown in SEQ ID NO:6. A V segment is used which clearly differs from that of the heavy chain of the clones MAB179 and MAB447. The D region (comprising seven amino acids) as well as the J region (J^3^ anc* t*le beginning of the constant region are shown. Only 57 % of amino acids are identical compared to the V segment of the heavy chain of the clone MAB17 9. Example 2: Chiroerization of the light chain of MAB179 and construction of an expression vector for the chimerized light chain a) Introduction of splice donor, intron and NotI sequences downstream of the VJl region of the kappa chain of MAB179 (Fig. 1) . The cDNA for the light chain of the murine MAB 179 was subcloned into pUCl8 (Yanisch-Perron, C., et al.: Gene 33 (1985) 103-109) as an EcoRI-Hpal fragment giving rise to plasmid pUCk. An EcoRI-NotI fragment which can be cloned (and is portable) via EcoRI and NotI ends is produced by mutagenesis. This fragment contains the VJl region and is followed by 20 nucleotide intron sequences starting with the splice donor sequence GT of the genomic J1 segment of the mouse kappa chain (Max, E.E., et al., J. Biol. Chem. 256 (1981) 5116-5220) and a recognition sequence (GCGGCCGC) for the restriction endonuclease NotI. The mutagenesis procedure (see above) is carried out according to Morinaga, et al. (Bio/Technology 2 (1984) 636-639). - 16 - Sequence of the oligonucleotide used for mutagenesis: splice donor sequence 51GCAAATCAAAC GTAAGTAGAATCCAAAGTCT GCGGCCGC GGGCTGATGCT 3' J1 Jl intron NotI mouse kappa constant region Two fragments were isolated from pUCk for the heteroduplex formation. Fragment A: pUCk was cleaved with the restriction enzymes EcoRI and BamHI, both fragments were separated by agarose gel-electrophoresis and the large EcoRI-BamHI fragment was isolated from the gel. This fragment contains no mouse kappa sequences. Fragment B: pUCk was treated with Nael (unique cleavage site in the pUC part), the 5' phosphate residues were removed by treatment with alkaline phosphatase and subsequently the fragment was purified twice on a 0.7 % agarose gel. Fragment A, fragment B (500 fmol each) and the oligonucleotide (80 fmol) were mixed for heteroduplex formation and incubated at 100°C for three minutes with 50 mmol/1 NaCl, 10 mmol/1 Tris-HC1, pH 7.5, 10 mraol/1 MgS04 and subsequently transferred onto ice. Afterwards the DNA was renatured (20 min at 60°C). For the repair synthesis the reaction mixture was adjusted to: deoxynucleoside triphosphate (0.25 mmol/1), ATP (1 mmol/1), NaCl (100 mmol/1), Tris-HCl pH 7.5 (6.5 mmol/1), MgCl-, (3 mmol/1), B-mercaptoethanol (1 mmol/1), Klenow fragment of the DNA polymerase from E. coli (0.125 U//il preparation) and T4 ligase (0.1 U/fil preparation) and incubated at 16°C for 4 hours. Afterwards E. coli HB101 was transformed v/ith the reaction mixture and colonies were selected on agar plates containing ampicillin (50 jig/ml) . Those colonies in whose plasmid DNA the above mentioned oligonucleotide was incorporated could be identified with the aid of the colony hybridization technique (Maniatis et al.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 1982). The characterization was first carried out by analysis with restriction endonucleases. Subsequently the desired change in the sequence was confirmed by sequencing (Sanger, F., et al.: Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467). b) Construction of an expression vector for the chimerized kappa chain of MAB179 (Fig. 2a and 2b). pcDNAl (Invitrogen, San Diego; Aruffo, A. and Seed, B. (1987) Proc. Natl. Acad. Sci. USA 84 8573-8577) served as the starting plasmid. It contains the promoter of the human cytomegalo-virus, promoters of the phages T7 and SP6, a polylinker, splice and polyadenylation sequences from SV40, a supF tRNA for the selection as well as "origins of replication" from M13, ColEl, SV40 and polyoma. For cloning reasons the Ndel site shown is converted into a Pvul site (= pcDNAl-PvuI) by ligation of a - 13 - corresponding linker. The latter plasmid was cleaved with EcoRI and NotI in the polylinker and the EcoRI-NotI fragment of the DNA obtained according to (a) (ca 400 bp) containing the VJl region and intron sequences of MAB179 kappa was ligated into the vector. The ligation mixture was transfected into the E. coli strain MC1061/P3 (Aruffo, A. and Seed, B.: Proc. Natl. Acad. Sci. USA 84 (1937) 8573-8577); Seed, B.: Nucl. Acids Res. 11 (1983) 2327-2445) and ampicillin-resistant colonies were isolated on agar plates. The plasmid formed is denoted pcDNAk. pcDNAk was then cleaved with Pvul and NotI and the shorter fragment was isolated on a low-melting agarose gel. The plasmid pl0195 (constructed according to EP-A 0 378 175) was also cleaved with NotI and Pvul and the larger fragment (Fig. 2b) was isolated on a low-melting agarose gel. pl0195 contains intron sequences of the mouse for the kappa chain as well as coding and non-coding regions of the constant human kappa region. Both the fragments of pcDNAk and pl0195 were ligated with T4 ligase, transfected into MC1061/P3 and ampicillin-resistant colonies were isolated. The plasmid formed is denoted pKchim. The hybrid gene (VJl mouse Ckappa-human) is expressed under the control of the human CMV promoter (cytomegalovirus) . An expression cassette for the phosphotransferase neo (inserted into pKchim. from pl0195) allows selection of G418 resistant colonies after transfection into mammalian cells (Southern, P. and Berg, P.: J. Mol. Appl. Genet. 1 (1982) 327-341) . - 19 - Example 3 Chimerization of the heavy chain of MAB179 and construction of an expression vector for the chirnerized heavy chain. a) Introduction of splice donor, intron and NotI sequences into the VDJ3 region of the ^1 chain of MAB179 (Fig. 3). The cDNA for the^-1 chain (5' untranslated region and coding region upstream of the BamHI site in the constant region) was subcloned as an EcoRI-BamHI fragment into pUC18 = plasmid pUC^l (Yanisch-Perron, C., et al.: Gene 33 (1985) 103-109). A portable EcoRI-NotI fragment is prepared by mutagenesis which contains the VDJ3 region of the mouse ^1 chain followed by 20 nucleotide intron sequences starting with the splice donor sequence GT of the genomic J3 segment of the mouse y-1 chain (Sakano, et al., Nature 286 (1980) 676-682). This is followed by a recognition sequence (GCGGCCGC) for the restriction endonuclease NotI. The mutagenesis was carried out according to Morinaga et al. (Bio/Technology 2 (1984) 636-639). The sequence of the oligonucleotide used for mutagenesis: rt "v t J "? J- - 20 - splice donor sequence 5 » GTCTCTGCAG GTGAGTCCTAACTTCTCCCA GCGGCCGC TGCCTGGTCA 3 ' J3 J3 intron NotI mouse frl constant region Two fragments were isolated from pUC^-1 for heteroduplex formation. Fragment C: pUC^-1 was cleaved with the restriction enzymes EcoRI and BamHI, the two fragments were separated by gel electrophoresis (1 % agarose gel) and the large EcoRI-BamHI fragment was isolated from the gel. This fragment contains no mouse £-1 sequences. Fragment D: pUC^l was cleaved with Nael (unique cleavage site in the pUC part)f the 5' phosphate residues were removed by treatment with alkaline phosphatase and subsequently the fragment was purified twice on a 0.7 % agarose gel. After mixing the fragments C and D (500 fmol each) and the oligonucleotide (80 fmol), the mutagenesis was carried out as described in Example 2. Those colonies in whose plasmid DNA the oligonucleotide described above was incorporated could be identified with the aid of the colony hybridization technique (Maniatis, et al: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 1982) . The characterization was first carried out with restriction endonucleases. Subsequently the desired change in the sequence was confirmed by sequencing (Sanger, - 21 - F. , et al.: Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467) . Fig. 3 shows diagrammatically the isolation of the desired EcoRI-NotI fragment. b) Construction of the expression vector for the chimerized yl chain of MAB179 (Fig. 4a and 4b). The unique Ndel site in the vector pcDNAl (Invitrogen, San Diego; Aruffo, A. and Seed, B. (1987) Proc. Natl. Acad. Sci. USA 84, 8573-8577) was converted into a Pvul site by insertion of a corresponding linker. The plasmid which formed is denoted pcDNAl-Pvul. pcDNAl-PvuI cleaved with EcoRI and NotI and the EcoRI-NotI fragment of pUC^-1 Mut (with VDJ3 and intron sequences of ^1) described in Fig. 3 were linked by ligation. The plasmid formed is designated pcDNA^-1. The plasmid pll201 (constructed according to EP-A 0 378 175) is cleaved with NotI and BamHI, the protruding ends filled in with Klenow, ligated with NotI linkers, cleaved again with NotI and the fragment shown in Fig. 4b is isolated on a low-melting agarose gel. This fragment contains intron sequences of the heavy chains of the mouse, intron sequences of the human heavy chains as well as the genomic equivalent of the constant region of the human fl gene. This fragment was ligated into the unique NotI site of the vector pcDNAjjl. The correct orientation was determined by cleavage with restriction endonucleases. The expression vector which formed for the chimerized ^-1 chain of MAB179 is denoted p ^chim. Chimerized chains of other isotypes (such as e.g. /jl, £-2, y-3, £-4, al, a2,S, £) can also be constructed according to this principle. Example 4: Establishment of permanent cell lines of non-producer hybridoma lines by electroporation with expression plasmids for the chimerized chains of MAB179. The plasmids pKchim. and pjfl chim. were mixed in equal amounts and transfected by electroporation into the immunoglobulin non-producer hybridoma line Sp2/0-Agl4 (ATCC CRL 8923) (Ochi, A., et al., Proc. Natl. Acad. Sci. USA 80 (1983) 6351-6355). All other non-immunoglobulin-producer hybridoma cell lines such as e.g. P3X63-Ag8.653 (ATCC CRL 8375) are also suitable. Both plasmids were linearized with the restriction endonuclease Pvul before transfection. The electroporation was carried out as described in Nucleic Acids Res. 15 (1937) 1311-1326 or Bio Techniques 6 (1988) 742-751. After centrifugation, the cells were washed with cold HeBS buffer (20 mmol/1 HEPES, pH 7.05, 137 mmol/1 NaCl, 5 mmol/1 KC1, 0.7 mmol/1 Na2HP04, 6 mmol/1 dextrose), resuspended with HeBS buffer, adjusted to a concentration of 10® cells/ml and placed on ice. After the addition of plasmid the cells were pulsed (conditions: capacity 500 pF and voltage range between 240 and 280 V, or 200 to 240 V at 160 nF). After pulsing, the cells were kept on ice for about 10 minutes and subsequently incubated at 37°C in medium I (RPMI 1640, 10 % foetal calf serum, 2 mmol/1 glutamine, 1 mmol/1 sodium pyruvate, 0.1 mmol/1 non-essential amino acids). The medium was changed 30 h after the transfection and incubated with medium 1 + 800 jug/ml G418 after plating 103 cells per well in 96 well microtitre plates. 10 microtitre plates (96 wells each) - 23 - were prepared. 7-10 days after plating, G418 resistant colonies could be identified in the wells. Their culture supernatants were tested for reconstituted chimerized MAB179 as described in the following example. The best producers were propagated in mass culture in medium I. Example 5; Detection of reconstituted antibodies against the human IL-2 receptor Firstly a microtitre plate is coated with polyclonal antibodies against human Fc^-. For this the wells of a microtitre plate are incubated overnight at 4°C or for 1 hour at room temperature with 200 /xl corresponding to 2.5 /ig of a polyclonal antibody against human Fc^-(IgG) in 0.2 mol/1 carbonate/bicarbonate, pH 9.5. After aspirating the wells they were incubated for 30 min to 1 h at room temperature with 300 /xl 50 mmol/1 HEPES, 0.15 mol/1 NaCl/1 % Crotein C, pH 7.0. Subsequently 200 Ml calibration sample or culture supernatant of transfected cells was added and incubated for 1 h at room temperature while shaking (500 rpm) or for 90 min at room temperature without shaking. The calibration curve was established with a model chimeric antibody (produced by chemically cross-linking a human IgG MAB and Fab fragments of MAB179). After aspirating the wells they were each washed twice with 300 /il IB = incubation buffer (50 mmol/1 HEPES, pH 7.0, 0.15 mol/1 NaCl, 0.2 mol/1 di-sodium tartrate, 1 % Crotein C, 0.75 % PEG 40000 (Serva), 0.5 % Pluronic F68 (Boehringer Mannheim), 0.01 % phenol). Afterwards 200 n1 of a solution of IL-2 receptor-POD-antibody conjugate complex was added (as described below) and incubated for 1 h at room temperature while shaking (500 rpm) or for 90 min at room temperature without shaking. The preformed complex consists of soluble interleukin 2 receptor and POD-labelled Fab fragments of the IL-2 receptor MAB215. Formation of the complex solution: 20 fi 1 of the POD-labelled Fab fragments of MAB 215 (150 U/ml) + 19.5 ml incubation buffer (IB) (see above) + 3 ml soluble IL-2 receptor standard (6400 U/ml; units defined via standard of T-cell Sciences). The soluble IL-2 receptor was obtained from culture supernatants of a recombinant mouse fibroblast cell line described by Shimizu et al. (Mol. Biol. Med. 3 (1986) 509-520). After carrying out the incubation the wells were rinsed three times with the wash buffer described above and subsequently the POD activity was determined with ABTS solution [2,2'-azino-di-3-ethylbenzthiazoline-sulphonate] + H202 after incubating for 45-60 min at room temperature by reading the absorbance at 4 05 nm in an ELISA reader. Clones with high expression (up to 10 /ng/ml) were determined using this method. - 25 - Q L SEQ ID NO: 1 (light chain clone 179) TYPE OF SEQUENCE: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 432 base pairs CHARACTERISTICS: aa -20 (Met): start of the signal sequence aa 1 (Asp) : beginning of the V region from aa 96 (Arg) to aa 107 (Lys) : Jl region from aa 108 (Arg) : beginning of the C reqicn ATG ATG GTC CTT GCT CAG TTT CTT GCA TTC TTG TTG CTT TGG TTT CCA 48 Met Met Val Leu Ala Gin Phe Leu Ala Phe Leu Leu Leu Trs Phe Pro -20 -15 -10 " -5 GGT GCA AGA TGT GAC ATC CTG ATG ACC CAA TCT CCA TCC TCC ATG TCT 96 Gly Ala Arg Cys Asp lie Leu Met Thr Gin Ser Pro Ser Ser Met Ser 15 10 GTA TCT CTG GGA GAC ACA GTC AGC ATC ACT TGC CAT GCA AGT CAG GGC 144 Val Ser Leu Glv Asd Thr Val Ser lie Thr Cvs His Ala Ser Gin Glv 15 20 :5 ATC AGA AGT AAT ATA GTG TGG TTG CAG CAG AAA CCA GGG AAA TCA TTT 192 lie Arg Ser Asn lie Val Trt> Leu Gin Gin Lys Pro Glv Lvs Ser Phe 30 35 40 AGG GGC CTG ATC TAT CAT GGA ACC AAG TTG GAA GAT GGA GTT CCA TCA 240 Arg Gly Leu lie Tyr His Gly Thr Lys Leu Glu Asp Glv Val Pro Ser 45 50 55 " 60 AGG TTC AGT GGC AGT GGA TCT GGA GCA GAT TAT TCT CTC ACC ATC AGC 288 Arg Phe Ser Gly Ser Gly Ser Gly Ala Asp Tyr Ser Leu Thr He Ser 65 70 75 AGC CTG GAA TCT GAA GAT TTT GCA GAC TAT TAT TGT GTA CAG TAT GCT 336 Ser Leu Glu Ser Glu Asp Phe Ala Asp Tyr Tyr Cys Val Gin Tyr Ala 80 85 90 CAG TTT CCT CGG ACG TTC GGT GGA GGC ACC AAG CTG GAA ATC AAA CGG 384 Gin Phe Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu lie Lys Arg 95 100 105 GCT GAT GCT GCA CCA ACT GTA TCC ATC TTC CCA CCA TCC AGT GAG CAG 432 Ala Asd Ala Ala Pro Thr Val Ser lie Phe Pro Pro Ser Ser Glu Gin 110 115 120 - 26 :HQ ID NO: - (light chain clone 447) TYPE OF SEQUENCE: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 43 2 base pairs CHARACTERISTICS: aa -20 (Met): start of the signal sequence aa 1 (Asp): beginning of the V region from aa 96 (Arg) to aa 107 (Lys): Ji region fron aa 103 (Arg): beginning of the C region ATG ATG GTC CTT GCT CAG TTT CTT GCA TTC TTG TTG CTT TGG TTT CCA 4 8 Met Met Val Leu Ala Gin Phe Leu Ala Phe Leu Leu Leu Trn Phe Pro -20 -15 -10 " -5 GGT GCA AGA TGT GAC ATC CTG ATG ACC CAA TCT CCA TCC TCC ATG TCT 96 Gly Ala Arg Cys Asp lie Leu Met Thr Gin Ser Pro Ser Ser Met Ser 15 10 GTT TCT CTG GGA GAC ACA GTC ACC ATC ACT TGC CAT GCA AGT CAG GGC 144 Val Ser Leu Glv Asd Thr Val Thr lie Thr Cvs His Ala Ser Gin Glv 15 20 "25 ATT AGA AGT AAT ATA GTG TGG TTG CAG CAG AAA CCA GGG AAA TCA TTT 192 lie Arg Ser Asn lie Val Tro Leu Gin Gin Lvs Pro Gly Lvs Ser Phe 30 35 40 AAG GGC CTG ATC TAT CAT GGA ACC AAC TTG GAA GAT GGA GTT CCA TCA 240 Lvs Gly Leu lie Tyr His Gly Thr Asn Leu Glu Asd Glv Val Pro Ser 45 50 55 60 CGG TTC AGT GGC AGT GGA TCT GGA CCA GAT TAT TCT CTC ACC ATC AGC 288 Arg Phe Ser Gly Ser Gly Ser Gly Ala Asp Tyr Ser Leu. Thr lie Ser 65 70 "75 AGC CTG GAA TCT GAA GAT TTT GCA GAC TAT TAC TGT GTA CAG TAT GCT 336 Ser Leu Glu Ser Glu Asd Phe Ala Asd Tyr Tyr Cys Val Gin Tyr Ala 80 " 85 90 CAG TTT CCT CGG ACG TTC GGT GGA GGC ACC AAG CTG GAA ATC AAA CGG 384 Gin Phe Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu lie Lys Arc 95 100 105 GCT GAT GCT GCA CCA ACT GTA TCC ATC TTC CCA CCA TCC AGT GAG CAG 432 Ala Asd Ala Ala Pro Thr Val Ser lie Phe Pro Pro Ser Ser Glu Gin 110 115 120 - 27 - SEQ ID NO: 3 (light chain clone 215) TYPE OF SEQUENCE: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 435 base pairs CHARACTERISTICS: aa -22 (Met): start of the signal sequence aa 1 (Lys): beginning of the V region from aa 95 (Phe) to aa 106 (Lys): J4 region from aa 107 (Arg): beginning of the C region ATG GAT TTT CAA GTG CAG ATT TTC AGC TTC CTG CTA ATC AGT GCT TCA 4 8 Met Asd Phe Gin Val Gin lie Phe Ser Phe Leu Leu lie Ser Ala Ser -20 -15 -10 GTC ATA ATG TCC AGA GGC AAA ATT GTT CTC TCC CAG TCT CCA GCA ATC 96 Val lie Met Ser Arg Gly Lys lie Val Leu Ser Gin Ser Pro Ala lie -5 15 10 CTG TCT GCA TCT CCA GGG GAG AAG GTC ACA ATG ACT TGC AGG GCC AGC 144 Leu Ser Ala Ser Pro Gly Glu Lvs Val Thr Met Thr Cvs Arc Ala Ser 15 * 20 25 TCA AGT ATA AGT TAC ATG CAC TGG TAC CAG CAG AAG CCA GGA TCC TCC 192 Ser Ser lie Ser Tyr Met His Trp Tyr Gin Gin Lvs Pro Glv Ser Ser 30 35 * 40 CCC AAA CCC TGG ATT CAA GCC ACA TCC AAC CTG GCT TTT GGA GTC CCT 240 Pro Lys Pro Trp lie Gin Ala Thr Ser Asn Leu Ala Phe Gly Val Pro 45 50 55 TCT CGC TTC AGT GGC AGT GGG TCT GGG ACC TCT TAC TCT CTC ACA ATC 288 Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr lie 60 65 70 AGC AGA GTG GAG GCT GAA GAT GCT GCC ACT TAT TAC TGC CAG CAG TGG 336 Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gin Gin Trn 75 80 85 90 AGT AGT AAC CCA TTC ACG TTC GGC TCG GGG ACA AAG TTG GAA ATG AAA 384 Ser Ser Asn Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Met Lys 95 100 105 CGG GCT GAT GCT GCA CCA ACT GTA TCC ATC TTC CCA CCA TCC AGT GAG 432 Arg Ala Asp Ala Ala Pro Thr Val Ser lie Phe Pro Pro Ser Ser Glu 110 115 120 CAG 435 Gin - 28 - r< t L SJ 7 SEQ ID 'JO: ■; (heavy chain clone 179) TYPE OF SEQUENCE: nucleotide with corresponding protein LENGTH OF SEQUENCE: 531 base pairs CHARACTERISTICS: aa -19 (Met): start of the signal sequence aa 1 (Asp): beginning of the V region from aa 99 (Asp) to aa 102 (Asn): D region from aa 103 (Trp) to aa 113 (Ala): J3 region from aa 114 (Ala): beginning of the C region ATG GAC TCC AGG CTC AAT TTA GTT TTC CTT GTC CTT ATT TTA AAA GGT 4 8 Met Asp Ser Arg Leu Asn Leu Val Phe Leu Val Leu lie Leu Lvs Glv -15 -10 -5 GTC CAG TGT GAT GTG CAG CTG GTG GAG TCT GGG GGA GGC TTA GTG CAG 96 Val Gin Cys Asd Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin 1 5 10 144 Pro Glv Glv Ser Ara Lvs Leu Ser Cvs Val Ala Ser Glv Phe Thr Phe 15 20 " 25 AGT ACC TTT GGA ATG CAC TGG GTT CGT CAG GCT CCA GAG AAG GGG CTG 192 Ser Thr Phe Glv Met His Trp Val Arg Gin Ala Pro Glu Lys Glv Leu 30 35 40 45 GAG TGG GTC GCA TAC ATT AGT AGT GGC AGT GGT ACC ATC TAC TAT GCA 24 0 Glu Trn Val Ala Tyr lie Ser Ser Gly Ser Gly Thr lie Tyr Tyr Ala 50 55 60 GAC ACA GTG AAG GGC CGA TTC ACC ATC TCC AGA GAC AAT CCC AAG AAT 288 Asp Thr Val Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Pro Lys Asn 65 70 75 ACC CTG TTC CTG CAA ATG ACC AGT CTA AGG TCT GAG GAC ACG GCC ATG 336 Thr Leu Phe Leu Gin Met Thr Ser Leu Arg Ser Glu Asp Thr Ala Met 80 85 90 TAT TAC TGT GCA AGA GAT TGG ATG AAC TGG GGC CAA GGG ACT CTG GTC 384 Tyr Tyr Cys Ala Arg Asp Trp Met Asn Trp Gly Gin Gly Thr Leu Val 95 100 105 ACT GTC TCT GCA GCC AAA ACG ACA CCC CCA TCT GTC TAT CCA CTG GCC 4 32 Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala 110 115 120 125 CCT GGA TCT GCT GCC CAA ACT AAC TCC ATG GTG ACC CTG GGA TGC CTG 480 Pro Gly Ser Ala Ala Gin Thr Asn Ser Met Val Thr Leu Gly Cys Leu 130 135 140 GTC AAG GGC TAT TTC CCT GAG CCA GTG ACA GTG ACC TGG AAC TCT GGA 528 Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly 145 150 155 TCC 531 Ser - 29 - :JEQ ID :!0: o (heavy chain clone 447) TYPE OF SEQUENCE: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 531 base pairs CHARACTERISTICS: aa -19 (Met): start of the signal sequence aa 1 (Asp): beginning of the V region from aa 99 (Asp) to aa 102 (Asn): D region from aa 103 (Trp) to aa 113 (Thr): J3 region from aa 114 (Ala): beginning of the C region ATG GAC TCC AGG CTC AAT TTA GTG TTC CTT GTC CTT ATT TTA AAA GGT 4 8 Met Asp Ser Arg Leu Asn Leu Val Phe Leu Val Leu lie Leu Lvs Glv -15 -10 -5 GTC CAG TGT GAT GTG CAA CTG GTG GAG TCT GGG GGA GGC TTA GTG CAG 96 Val Gin Cys Asp Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin 15 10 CCT GGA GGG TCC CGG AAA CTC TCC TGT GCA GCC TCT GGA TTC ACT TTC 14 4 Pro Glv Glv Ser Arg Lvs Leu Ser Cvs Ala Ala Ser Glv Phe Thr Phe 15 20 25 AGT ACC TTT GGA ATG CAC TGG GTT CGT CAG GCT CCA GAG AAG GGG CTG 192 Ser Thr Phe Gly Met His Trp Val Arg Gin Ala Pro Glu Lvs Glv Leu 30 35 40 45 GAG TGG GTC GCA TAT ATT AGT AGT GGC AGT AGT ACC GTC TAC TAT GCA 24 0 Glu Trp Val Ala Tyr lie Ser Ser Gly Ser Ser Thr Val Tvr Tvr Ala 50 55 50 GAC AGA GTG AGG GGC CGA TTC ACC ATC TCC AGA GAC AAT CCC AAG AAC 288 Asd Arg Val Arg Gly Arg Phe Thr lie Ser Arg Asd Asn Pro Lvs Asn 65 70 75 ACC CTG TTC CTG GAA ATG ACC AGT CTA AGG TCT GAG GAC ACG GCC ATG 336 Thr Leu Phe Leu Glu Met Thr Ser Leu Arg Ser Glu Asp Thr Ala Met 80 85 90 TAT TAC TGT GCA AGA GAT TGG ATG AAC TGG GGC CAA GGG ACT CTG GTC 384 Tyr Tyr Cys Ala Arg Asp Trp Met Asn Trp Gly Gin Gly Thr Leu Val 95 100 105 ACT GTC TCT ACA GCC AAA ACG ACA CCC CCA TCT GTC TAT CCA CTG GCC 4 32 Thr Val Ser Thr Ala Lvs Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala 110 115 120 125 CCT GGA TCT GCT GCC CAA ACT AAC TCC ATG GTG ACC CTG GGA TGC CTG 480 Pro Gly Ser Ala Ala Gin Thr Asn Ser Met Val Thr Leu Glv Cvs Leu 130 135 " 140 GTC AAG GGC TAT TTC CCT GAG CCA GTG ACA GTG ACC TGG AAC TCT GGA 52 8 Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly 145 150 155 TCC 531 Ser - 30 - geq ID ::O; 6 ;heavy chain clone 215) TYPE OF SEQUENCE: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 549 base pairs CHARACTERISTICS: aa -19 (Met): aa 1 (Gin) from aa 98 (Thr) from aa 105 (Trp) from aa 120 (Ala) start of the signal sequence beginning of the v region to aa 104 (Ser): D region to aa 119 (Ala): J3 region : beginning of the C region ATG GCT GTG CTG GGG CTG CTT CTC TGC CTG GTG ACT TTC CCA AGC TGT 48 Met Ala Val Leu Glv Leu Leu Leu Cvs Leu Val Thr Phe Pro Ser Cvs -15 * -10 -5 GTC CCG TCC CAG GTG CAG CTG AAG GAG TCA GGG CCT GGC CTG GTG GCG 96 Val Pro Ser Gin Val Gin Leu Lys Glu Ser Gly Pro Gly Leu Val Ala 15 10 CCC TCA CAG AGC CTG TCC ATC ACA TGC ACC GTC TCA GGG TTC TCA TTA 144 Pro Ser Gin Ser Leu Ser lie Thr Cvs Thr Val Ser Glv Phe Ser Leu 15 20 25 AGT ACC TAT AGT GTA TAC TGG GTT CGC CAG CCT CCA GGA AAG GGT CTG 192 Ser Thr Tyr Ser Val Tvr Trp Val Arg Gin Pro Pro Glv Lvs Gly Leu 20 35 40 * 45 GAG TGG CTG GGA GTG ATA TGG AGT GAT GGA AGC ACA ACC TAT AAT TCA 240 Glu Tro Leu Glv Val lie Trp Ser Asp Gly Ser Thr Thr Tyr Asn Ser 50 55 60 ACT CTC AAA TCC AGA CTG ACC ATC AGC AAG GAC AAC TCC AAG AGT CAA 288 Thr Leu Lys Ser Arg Leu Thr He Ser Lys Asp Asn Ser Lys Ser Gin 65 70 75 GTT TTC TTA AAA GTG AAC AGT CTC CAA ACT GAT GAC ACA GCC ATG TAC 336 Val Phe Leu Lys Val Asn Ser Leu Gin Thr Asp Asp Thr Ala Met Tyr 80 85 90 TAC TGT GCC AGA ACC TAT GGT TAT GAC GGG TCC TGG CTT GCT TAC TGG 384 Tyr Cys Ala Arg Thr Tyr Gly Tyr Asp Gly Ser Trp Leu Ala Tyr Trp 95 100 105 GGC CAA GGG ACT CTG GTC ACT GTC TCT GCA GCC AAA ACA ACA CCC CCA 432 Gly Gin Gly Thr Leu Val Thr Val Ser Ala Ala Lys Thr Thr Pro Pro 110 115 120 125 TCA GTC TAT CCA CTG GCC CCT GGG TGT GGA GAT ACA ACT GGT TCC TCC 4 80 Ser Val Tyr Pro Leu Ala Pro Gly Cys Gly Asp Thr Thr Gly Ser Ser 130 135 140 GTG ACT CTG GGA TGC CTG GTC AAG GGC TAC TTC CCT GAG TCA GTG ACT 528 Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Ser Val Thr 145 150 155 GTG ACT TGG AAC TCT GGA TCC 54 9 Val Thr Trp Asn Ser Gly Ser 160 </div>

Claims

<div id="claims" class="application article clearfix printTableText"> - 32 - O * j o WHAT|/WE CLAIM IS:

1. Recombinant DNA which codes for the light or heavy chain of an antibody whose constant regions are of human origin and whose variable regions are of non-human origin, wherein said DNA contains in the direction of transcription (a) a cDNA sequence which codes for the non-human variable region, comprising the region J and, if desired, D, (b) an intron sequence which has a splice donor site at its 51 end and is composed of a non-human intron sequence (as herein defined) at the 5' end and a human intron sequence at the 31 end and (c) a genomic DNA sequence coding for the human constant region.

2. Recombinant DNA as claimed in claim 1, wherein the sequence (a) and the non-human intron sequence of (b) are of murine origin.

3. Recombinant DNA as claimed in claim 1 or 2, wherein the non-human intron sequence of (b) corresponds to the intron sequence which naturally follows the sequence (a).

4. Recombinant DNA as claimed in claim 1 or 2, wherein the non-human intron sequence of (b) is 15 to 20 base pairs long. lAVet;.93 ' J ' / ' ' f • » O O li O I j - 32 -

5. Recombinant DNA as claimed in any one of the previous claims, wherein the splice donor site in (b) has the sequence 5'-GT-3*.

6. Recombinant DNA as claimed in any one of the previous claims, wherein the human intron sequence of (b) has a branch site.

7. Recombinant DNA as Claimed in any one of the previous claims, wherein it has in addition a promoter under the control of which the sequences coding for the antibody chains can be expressed.

3. Recombinant DNA as claimed in claim 7, wherein it has the promoter of the cytomegalo-virus.

9. Recombinant DNA as claimed in any one of the previous claims, wherein the sequence (a) codes for the variable region of the light or heavy chain of an antibody which is capable of specifically binding to the human interleukin 2 receptor.

10. Recombinant DNA as Claimed in any one of the previous claims, wherein the sequence (c) codes for the constant region of the light or heavy chain of a human antibody of the IgG type.

11. Expression vector containing a recombinant DNA as Claimed in any one of the claims 1 to 10.

12. Plasmid pK chim, as herein defined. 3 2 6 «; o o - 33 -

13. Plasmid p chim as heroin defined.

14. Process for the production of a recombinant DNA as claimed in any one of the claims 1 to 10, wherein polyA+ RNA is isolated from a hybridoma cell line secreting an antibody of the desired specificity, a cDNA library of this hybridoma cell line is prepared in suitable vectors and examined for clones which contain the cDNA for antibody chains by hybridization with oligonucleotides which are complementary to the DNA coding for the constant part of the antibody, the V, J, and if desired D, sequences are isolated, a splice donor site, an antibody intron sequence (as herein defined) of non-human origin and a restriction cleavage site adjacent to the respective J domain in the direction of transcription are introduced by site-directed mutagenesis and the DNA obtained is ligated with a genomic DNA sequence which codes for the constant region of the light or heavy chain of a human antibody and has part of a corresponding human intron sequence at its 5' end.

15. Process as claimed in claim 14, wherein a mouse or rat hybridoma cell line is used.

16. Process as claimed in claim 15, wherein a mouse hybridoma cell is used which secretes antibodies directed against the human interleukin 2 receptor.

17. Process as claimed in claim 14, 15 or 16, wherein a 15 to 20 bp long antibody intron sequence of non-human origin is introduced. (*) O ;4 -

18. Process as claimed in any one of the claims 14 to 17, wherein the authentic adjacent intron sequence (as herein defined) of the genomic DNA sequence of non-human origin is introduced.

19. Process as claimed in any one of the claims 14 to IS, wherein the nucleotide sequence GT is introduced as the splice donor site.

20. Process as claimed in any one of the claims 14 to 19, wherein a human intron DNA is used which has a branch-site.

21. Process as claimed in any one of the claims 14 to 20, wherein a promoter sequence is added to the 5' end of the DNA sequence obtained, or the isolation and ligation steps are carried out in a vector v/hich contains a promoter at a suitable position.

22. Process as claimed in claim 21, wherein the promoter of the cytomegalo-virus genome is used as the promoter.

23. Process as claimed in any one of claims 14 to 22, wherein a human genomic DNA sequence is used which codes for the constant region of the light or heavy chain of an antibody of the IgG type. AT? 7-1-1? MK - 35 -

24. Process for the production of an expression vector, wherein a recombinant DNA as claimed in any one of the claims 1 to 10 or produced as claimed in any one of the claims 14 to 23 is inserted into a vector which is suitable for the expression of a foreign gene.

25. Process for the production of a chimeric antibody whose variable regions are of non-human origin and whose constant regions are of human origin, wherein one each of an expression vector which contains a recombinant DNA as claimed in any one of the claims 1 to 10 or which is produced as claimed in any one of the claims 14 to 23 that codes for the light chain and an expression vector v/hich contains a recombinant DNA as claimed in any one of the claims 1 to 10 or which is produced as claimed in any one of the claims 14 to 23 that codes for the heavy chain of the antibody are introduced into a suitable host cell, stable transforrnants are isolated and the antibody is isolated according to known methods.

26. Process for the production of a chimeric antibody as claimed in claim 25, wherein non-producer hybridoma cells are used as host cells.

27. Process as claimed in claim 25, wherein the cell line Sp2/0-Agl4 (ATCC CRL 8922) is used.

28. Process as claimed in any one of the claims 25 to 27, wherein the vectors pK chim? as herein defined, and p^chim, as herein defined, are introduced into said host cells. - 36 -

29. Process as claimed in any one of the claims 25 to 28, where in the vectors are transfected by electroporation.

30. Chimeric antibody MAB 179 as herein defined.

31. Chimeric antibody MAB 215 as herein defined.

32. Chimeric antibody MAB 447 as herein defined.

33. Recombinant DNA as defined in claim 1 substantially as herein described with reference to any example thereof and/or the accompanying drawings.

34. An expression vector substantially as herein described with reference to any example thereof and/or the accompanying drawings.

35. A process as defined in claim 14 for the production of a recombinant DNA substantially as herein described with reference to any example thereof and/or the accompanying drawings.

36. A process for the production of an expression vector substantially as herein described with reference to any example thereof and/or the accompanying drawings.

37. A process as defined in claim 25 for the production of a chimeric antibody substantially as herein described with reference to any example thereof and/or the accompanying drawings. «:;<■< "v n. • * c •> •■-Q-'fti ..J. fvJiK St </div>