WO1993011252A1

WO1993011252A1 - Cloning vectors for expressing pcr generated variable regions as complete heavy and/or light chain(s)

Info

Publication number: WO1993011252A1
Application number: PCT/US1992/010207
Authority: WO
Inventors: Sherie L. Morrison; Letitia Wims; Alice Hastings
Original assignee: The Regents Of The University Of California
Priority date: 1991-11-26
Filing date: 1992-11-24
Publication date: 1993-06-10
Also published as: AU3226593A

Abstract

The present invention provides an expression plasmid designated pAG4235 (ATCC No. 75038) or a derivative thereof. Additionally, this invention provides an expression plasmid designated pAG4270 (ATCC No. 75037) or a derivative thereof. Finally, the present invention provides an expression plasmid designated pAH4604 (ATCC No. 75104) or a derivative thereof.

Description

CLONING VECTORS FOR EXPRESSING PCR GENERATED VARIABLE REGIONS AS COMPLETE HEAVY AND/OR LIGHT CHAIN (B)

This invention was made with support under Grant Number CA16858 from the National Institute of Health, U.S. Department of Health and Human Resources. Accordingly, the U.S. Government has certain rights in the invention.

Throughout this application, various publications are referenced by Arabic numerals within parentheses. Full citations for these publications may be found at the end of the specification immediately preceding the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein.

BACKGROUND OF THE INVENTION

Over the years many investigators have attempted to harness the immune system for therapeutic and diagnostic use. Immunoglobulin (Ig) molecules which constitute an important part of the immune system are of great interest because they (1) react with a diverse family of ligands, (2) possess different effector functions and (3) are of great biological importance. Additionally, antibodies exhibit exquisite specificity for their target and thus have widespread potential as therapeutic and diagnostic agents.

Despite its potential, a persisting problem with antibody technology has been the difficulty in obtaining large quantities of specific antibody. Historically, antibodies were obtained from sera. However, sera were often limited in quantity and of variable quality. More recently, antibodies have been obtained from hybridomas of rodent origin. Unfortunately, rodent antibodies are recognized as foreign when administered in vivo in humans which precludes their continued therapeutic use.

In order to overcome the problems which specifically plague antibody technology and more generally the problems associated with the production of substantial amounts of functional protein molecules, a new expression plasmid system which facilitates the cloning of protein molecules and the expression of these functional protein molecules is described herein. Specifically, coding regions may be cloned using polymerase chain reaction (PCR) and the coding regions so cloned may be expressed using the expression plasmids described herein. The expression plasmids described herein are superior to any described in the literature for the txpression of antibodies because these plasmids use the leader sequences to facilitate cloning of the antibodies so that the resulting protein molecules have no amino acids changes within the functional protein. A family of degenerate oligonucleotide primers is used which will prime virtually all antibody molecules at their 5* terminus. When used concurrently with the appropriate 3' primer, variable regions can be amplified and cloned into expression plasmids. A similar approach can be applied to any protein possessing a leader sequence.

SUMMARY OF THE INVENTION

The present invention provides an expression plasmid designated pAG4235 (ATCC No. 75038) or a derivative thereof. Additionally, this invention provides an expression plasmid designated pAG4270 (ATCC No. 75037) or a derivative thereof. Finally, the present invention provides an expression plasmid designated pAH4604 (ATCC No. 75104) or a derivative thereof. The plasmids are designed for the expression of genes possessing leader sequences.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Construction of heavy chain expression vectors.

(Figure 1A) The 3.5 kb Sal I-BamH I geno ic fragment containing the human γl, constant region was cloned into M13mpl9 and an Nhe I site introduced into C_H1 between amino acid positions 118-119. (thereby producing plasmid M4205) . A V_H with an EcoR V site at its 5/ end and an Nhe I site at its 3' end was generated using PCR and cloned into Bluescript KS(+) with an Nhe I site yielding KS4214. KS4214 was cleaved with Nhe I and Ba H I and the Nhe I- Ba H fragment with a human gamma 1 inserted. (Figure IB) The resulting plasmid (KS4222) was then cleaved with Kpn I and EcoR V and the 1.8 kb Kpn 1-EcoR V fragment from plasmid M4218 with the dansyl V_H promoter inserted. The 5.2 kb BamH I fragment containing the heavy chain transcription unit lacking an enhancer was inserted into BamH I cut psV2gpt. The resulting plasmid (pAG4231) was cut with EcoR I and the 1 kb EcoR I fragment with the heavy chain enhancer inserted. The resulting expression vector, pAG4235, has the heavy chain transcription unit and enhancer in pSV2gpt. By inserting the Pvu I-Hpa I fragment from pSV2his into Pvu I-Hpa I cleaved pAG4235, a heavy chain transcription unit linked to a his selectable marker was also produced. The isotype of the gamma heavy chain can be changed by cleaving with Nhe I and BamH I (BamH I must be a partial digest) and exchanging the constant region with the other human gamma constant regions with a Nhe I site introduced at a comparable location.

Figure 2. Diagram of heavy chain vector. The heavy chain plasmid pAG4235 is shown with the site of digestion of selected restriction endonucleases that recognize six- base sequences shown. The heavy chain promoter and upstream regions are indicated by dark stippled region. The VH region, indicated by light stippling, is on an EcoR V-Nhe I fragment. Heavy chain exons are indicated as large cross-hatched boxes; human intronic and 3' 5. regions are striped.

Figure 3. Approximate nucleotide sequence of the heavy chain expression vector pAG4235. (Figures 3A-3F) The variable region and constant regions exons were 0 sequenced, however the other sequences are from published references and have not been verified for this particular plasmid. Regions for which there is no sequence information are indicated by N's with the length determined by sizes of fragments observed on agarose gels.

Figure 4. Diagram of vector pAH4604 in which a polylinker replaces the variable region. The vector was generated by cleavage with EcoR V and Nhe I and insertion of the EcoR V-Nhe I polylinker sequence from Bluescript which had a Nhe I linker inserted into the S a I site.

Figure 5. Construction of kappa expression vector with a splice. (Figure 5A) The V_H-dansyl promoter with an EcoR V site was cloned into pUC19 yielding pUC4264. The V_L fragment with EcoR V and Sal I ends generated by PCR was cloned into Bluescript SK (yielding SK4253) . The EcoR V-Sal I V_L was transferred into EcoR V-Sal I cleaved pUC4264, resulting in a V_L region with the V_H-dansyl promoter at its 5' and a splice junction and Sal I restriction site at its 3' (pUC4268) end. (Figure 5B) To introduce a Sal I site into the intron 3' of Jk5, the 2.7 kb Hind III genomic fragment was cloned into M13, a Sal I site introduced by in vitro utagenesis and the 3 ' Sal I-Hind III fragment cloned into pUC19 (yielding pUC4265) .

SUBSTITUTE SHEET This intronic segment was cloned as a BamH I (BamH I is 5' of Sal I in the polylinker)-Hind III fragment into pSVgpt-S107-HUK which had been cleaved with Hind III and partially digested with BamH I. The resulting plasmid (pAG4271) had a Sal I site located in the intron 5' of human Ck. The 3.4 Pvu I-Sal fragment from pUC4268 containing the V_H dansyl promoter joined to the Leader and V_L with a splice junction and 3' Sal I site was joined to the 9.5 kb Sal I-Pvu I fragment with human Ck and the gpt selectable marker. The resulting expression vector, pAG4270 contained the L chain transcription unit as an 8.5 kb-BamHI fragment inserted into pSV2gpt. The variable region can now be changed by digesting this vector with Sal I and EcoR V and inserting a new V_L cloned by PCR.

Figure 6. Diagram of the light chain expression vector.

The light chain expression vector pAG4270 is shown with the site of cleavage by selected restriction endonucleases shown. Striped boxes represent the VL and kappa constant region exons. Dark stippled regions are of murine origin, cross-hatched sequences are non-coding regions of human origin.

Figure 7. Approximate nucleotide sequence of the expression vector pAG4270. (Figures 7A-7G) The variable region contained within the vector has been sequenced directly. The other nucleotide sequences shown are from published information and have not been confirmed in this vector. BRIEF DESCRIPTION OF THE INVENTION

The present invention provides an expression plasmid designated pAG4235 (ATCC No. 75038) or a derivative thereof capable of expressing a protein molecule. In accordance with the practice of this invention the protein molecule may be an antibody such as a chimeric monoclonal antibody.

As used herein, an "expression plasmid" means a nucleic acid molecule comprising (1) a promoter and other sequences necessary to direct expression of a desired gene, (2) the desired gene, and (3) a selection marker to determine whether the plasmid has been in fact incorporated in the cell. The nucleic acid molecule may comprise a poly A signal sequence to enhance the stability of the gene transcript and an enhancer sequence to increase the transcription of the gene thereby affecting the expression of the gene. Examples of selection markers include, but are not limited to, histidinol (his) , adenosine dea inase (ADA) , aminoglycoside phosphotransferase (neo, G418, APH) , dihydrofolate reductase (DHFR) , hygromycin-B- phosphotransferase (HPH) , thymidine kinase (TK)., xanthine-guanine phosphoribosyltransferase (XGPRT, gpt) .

Gpt, his, neo, and gpt(deltaEcoRV) are preferred.

It would be clear to those skilled in the art that selection of cells incorporating the plasmid may be effected by using any of the above-described selection markers or a combination thereof in the presence of an appropriate selection medium.

Further, as used herein, the term "derivative thereof" means a plasmid obtained by modifying any of the expression plasmids described herein by wholly or partially replacing particular coding sequences or regulatory sequences, i.e. a promoter or other sequences necessary to direct expression of the desired gene, within the expression plasmid.

It would be clear to one skilled in the art that the promoter may be easily replaced with other promoters depending on the type of cells used for expression, selection marker being used, or the gene-of-interest being inserted.

The sequences so replaced may include the coding sequence for the production of a protein. In one example the coding sequence encodes a variable region of either a light or heavy immunoglobulin chain. Alternatively, the sequences so replaced may be the coding region for a constant region of either a light or heavy immunoglobulin chain. Further alternatively, the sequences so replaced may be the coding regions for both the variable and constant region of either a light or heavy immunoglobulin chain or both. Preferably, the sequences so inserted are cloned by PCR. PCR may be used to produce a multiplicity of coding sequences which can be inserted into the expression plasmid which in turn can transform a cell and thereby express the coding sequence.

As stated previously, the replacement sequence may encode any protein. The primary consideration on whether to insert a particular replacement sequence is whether the sequence so inserted is positioned "in-frame" so that the desired protein can be expressed.

Derivative expression plasmids of plasmid pAG4235 have been constructed. These include pAH 274 in which the selectable marker has been changed from gpt to his. By digesting the plasmid pAG4235 or its derivatives with EcoRV/Nhel and/or Nhel/BamHI the sequence encoding the variable heavy and/or constant heavy chain region may be replaced. The resulting derivative expression plasmid may now transform a cell which in turn can express and produce the protein encoded by the replacement sequence. Examples include pAH 4602 in which the variable region has been replaced so that the heavy chain now has a different binding specificity.

Further, this invention also provides a cell comprising the aforementioned plasmid. In one example, the cell is a eucaryotic cell. An example of a eucaryotic cell is a mammalian cell.

In principle, any mammalian cell is useful in the practice of the subject invention including human cells, for example fibroblast cells, the cells from other animals such as ovine, porcine, murine, bovine. Specific examples of mammalian cells include CHO, melanoma, myeloma, NRK, COS, and HEPM cells.

This invention also provides a method for producing. a protein molecule comprising growing the above-described cell so as to produce the protein molecule in the cell and recovering the protein molecule so produced. In accordance with the practice of this method, the protein molecule so produced may be a chimeric monoclonal antibody.

As used in this application "chimeric monoclonal antibody" means any immunologically reactive molecule which specifically recognizes and binds to a target. The immunologically reactive molecule may be a heavy chain or a light chain immunoglobulin or a combination thereof. Alternatively, this immunologically reactive molecule may be a complex comprising two heavy and light chain immunoglobulins or portions thereof. Such immunologically reactive molecules may arise from cells of different animals such as a man, a cow, a pig, a bird, a fish, a rat, a mouse, a sheep or a horse or "any combination thereof.

Conditions for culturing the cells and for recovering the protein molecule so produced are known in the art and vary depending upon the nature of the cell, expression plasmid and the like.

The present invention further provides an expression plasmid designated pAG4270 (ATCC No. 75037) or a derivative thereof capable of expressing a protein molecule.

One example of a derivative plasmid of pAG4270 is pAG

4622 in which the gpt gene has been mutated to remove the internal EcoR V site without altering the coding sequence. This plasmid now contains only one EcoR V site, thereby facilitating subsequent cloning steps...

A derivative expression plasmid from plasmid pAG4270 may also be constructed by digesting the plasmid with EcoR V/Sal I and/or Sal I/BamH I in order to replace the sequence encoding the variable light and/or constant light chain region of the plasmid pAG4270, respectively, with a replacement sequence thereby producing a derivative expression plasmid of plasmid pAG4270. The replacement sequence may encode any protein. Alternatively, or in addition to replacing the sequence encoding the variable light and/or constant light chain region of pAG4270, regulatory sequences such as the promoter or other sequences necessary to direct expression of the desired gene may be wholly or partially replaced with another regulatory sequence so as to produce a derivative expression plasmid. In any of the above-described situations, the resulting derivative expression plasmid may now transform a cell which in turn can express and produce the protein encoded by the replacement sequence. An example of such a derivative plasmid is pAG4609 in which the variable region of a light chain specific for a cell surface molecule has replaced the variable region in pAG4270.

Additionally, this invention provides a cell comprising plasmid pAG4270 or any derivative thereof. In one example, the cell is a eucaryotic cell. An example of a eucaryotic cell is a mammalian cell.

This invention further provides a method for producing a protein molecule comprising growing the aforementioned cell so as to produce the protein molecule in the cell and recovering the protein molecule so produced. In accordance with the practice of this method, the protein molecule so produced may be a chimeric monoclonal antibody.

The present invention further provides an expression plasmid designated pAH4604 (ATCC No. 75104) or a derivative thereof comprising a polylinker sequence positioned 3' of the promoter region.

As used in this application, the "polylinker sequence" is a DNA molecule which contains a site cleavable by restriction endonuclease and is not expressed by the expression plasmid. This plasmid has the advantage that it will express a protein product only after the polylinker sequence has been replaced by the desired coding sequence.

Like the two expression plasmids described hereinabove, a derivative expression plasmid may also be constructed from plasmid pAH4604 (ATCC No. 75104) by digesting the plasmid with a restriction enzyme in order to cleave the polylinker sequence so as to insert a gene-of-interest and thereby produce a derivative expression plasmid of plasmid pAH4604 (ATCC No. 75104) . The gene-of-interest may encode any protein. Alternatively, or in addition to inserting a gene-of-interest, regulatory sequences such as the promoter or other sequences necessary to direct expression of the desired gene may be wholly or partially replaced with another regulatory sequence so as to produce a derivative expression plasmid. In any of the above-described situations, the resulting derivative expression plasmid may now transform a cell which in turn can express and produce the protein encoded by the gene.

Additionally, this invention provides a cell comprising derivatives of plasmid pAH4604 (ATCC No. 75104) . In one example, the cell is a eucaryotic cell. An example of.a eucaryotic cell is a mammalian cell. Preferably, the mammalian cell is of the B lineage.

This invention further provides a method for producing a protein molecule comprising growing the aforementioned cell so as to produce the protein molecule in the cell and recovering the protein molecule so produced. In accordance with the practice of this method, the protein molecule so produced may be a chimeric monoclonal antibody. This invention is illustrated in the Experimental Details section which follows. This section is set forth to aid in an understanding of the invention but is not intended to, and should not be construed to, limit in any way the invention as set forth in the claims which follow.

EXPERIMENTAL DETAILS

Construction of the heavy chain expression plasmids: The 3.5 kb Sall-BamHI fragment containing the genomic human γ gene was cloned into M13mpl9. Using a mutagenic oligomer an Nhe I site (GCTAGC) was created at amino acid 118-119 (Eu numbering) :

GCC TCC

4- GCT AGC

Using this approach a restriction site can be introduced without changing the amino acid sequence. In addition to γl, this approach has been applied to γ2, γ3, and γ4.

The 2.2 kb BamHI fragment containing the anti-dansyl specific V_H from the hybridoma 27.44 was cloned into M13mpl8. An EcoRV (GATATC) site was introduced from nucleotides -10 to -5.

AACATTCACCATG SEQ. ID. NO. 1 i GATATCCACCATG SEQ. ID." NO. 2

These changes leave the upstream regulatory elements and translation start sequences intact.

Primers for PCR amplification: For priming the 5* of the gene the following primer was used:

GATATCCACCATG[- Leader] SEQ. ID. NO. 3

This primer contains the EcoRV cloning site. Several different sequences may be used for the leader. If the sequence of the heavy or light chain leader had been determined, the exact leader sequence was used. In cases where the sequence of the leader was unknown, a mixture of redundant oligonucleotides designed to prime all known leader sequences was used. It was reasoned that since the leader is cleaved from the mature protein, and many different sequences function to direct the protein to the secretory pathway, it was not important for the leader sequence to exactly match that of the original hybridoma protein.

For priming at the 3' of the heavy chain a primer complementary to the J_H with an attached Nhe I site was used. Since J_H can make significant contributions to the specificity of the antibody, the J region of each antibody was sequenced prior to cloning to guarantee that no amino acid substitutions were introduced by the cloning process. Alternatively, if amino acid substitutions may be introduced into the protein, mixed primers may be used during the cloning process.

To clone the variable region present in pAG4235 (Figures

1 and 2) One μg of a polyA+ RNA from the murine hybridoma 4C10.3 was mixed with 100 ng of the J region primer. dXTPs were added to a final concentration of 200 μM, MgCl₂ to 1.5 mM, KCl to 50 mM, Tris-Cl pH 8.3 to 10 mM, and gelatin to 0.01%. The reaction mix was heated to 70* C, cooled, 20 U of reverse transcriptase added and incubated for 1 hr at 37*C. 100 ng of the 5' primer was then added and amplification continued for 25 cycles.

The primers used were:

Heavy Chain Leader:CATAGGATATCCACCATGGGATGGAGCTGGATC (SEQ. ID. NO. 4) This sequence contains an EcoRV site to facilitate cloning into the promoter and contains the heavy chain leader sequence that had been determined by sequencing.

J region: CTTGGTGCTAGCTGCAGAGACAGTGACCAG (SEQ. ID. NO.5)

This sequence contains a Nhe I site for cloning into^"c_Hl of IgG. The VH region generated was cloned in KS4214, a derivative of Bluescript KS(+) into which an Nhe I site had been introduced.

The human γ_1# constant region with an Nhe I site was introduced into CHI at amino acid 118-119 (M4205) and the V_H with an EcoR V site at its 5* end and an Nhe I site at the 3' end, generated using PCR, cloned in Bluescript

(KS4214) described above were used. KS4214 was cleaved with Nhe I and BamH I and the 3.0 kb Nhe I-BamH I fragment with human γl inserted so as to produce a resulting plasmid KS4222. KS4222 was then cleaved with Kpnl and EcoR V and the 1.8 kb KpnI-EcoR V fragment from

M4218 with the dansyl V_H promoter inserted. The 5.2 kb BamH I fragment containing the heavy chain transcription unit was then cloned into BamH I cut pSV2gpt which resulted in the plasmid designated pAG4231. pAG4231 was cut with EcoRI and an EcoRI fragment with the heavy chain enhancer inserted yielding the expression plasmid pAG4235 (Table 1) which has the heavy chain transcription unit in pSVgpt (Figures 2 and 3) . By inserting the Pvu I-Hpa I fragment from pSV2his into Pvu I-Hpa I cleaved plasmid pAG4235, a heavy chain transcription unit linked to a his selectable marker was produced yielding the vector pAH4274 (Table I) . The isotype of a gamma heavy chain can be changed by cleaving with Nhe I and BamH I (BamH I must be partial digest) and exchanging the constant region with the other human gamma constant regions with' a Nhe I site introduced at a comparable location using the same protocol.

Construction of kappa expression plasmid with a splice. In initial attempts to produce a kappa expression plasmid, a vector had been produced which lacked a splicing sequence within the kappa coding region. This vector was not expressed. Therefore, a vector was constructed which contained an intronic sequence within the kappa coding region. To introduce a Sal I site into the intron 3' of Jk5, the 2.7 kb Hind III genomic Jk fragment was cloned into M13. A Sal I (GTCGAC) cleavage site was introduced 3* of Jk5 such that the splice signal remained intact:

GTAAGTACAC i GTAAGTCGAC

The 3• Sail-Hind III fragment was cloned into pUC19

(yielding pUC4265) . This intronic segment was cloned as a BamH I (BamH I is 5' of Sal I in the polylinker)-Hind III fragment into pSVgpt-S107-HUK which had been cleaved with Hind III and partially digested with BamH I so as to produce a resulting plasmid designated pAG4271. pAG4271 thereby had a Sal I site located in the intron 5* of human Ck. The 3.4 kb Pvu I-Sal I fragment from pUC4268 containing the V_H dansyl promoter joined to the Leader and V_L with a splice junction and 3' Sal I site was joined to the 9.5 kb Sall-Pvu I fragment with human Ck and the opt selectable marker so as to produce a resulting expression plasmid designated pAG4270. pAG4270 contained the L chain transcription unit as an 8.5 kb-BamH I fragment inserted into pSV2gpt. Steps in the construction of pAG4270 are shown in Figure 5 and the sequence of the 28 resulting plasmid as shown in Figure 7 a-f. The variable region for expression was cloned from the hybridoma 4C10.3 using PCR.

Cloning of V . RNA was prepared from the 4C10 mouse myeloma cell line using guanidinium thiocyanate and the polyA containing fraction isolated using oligodT cellulose. Direct mRNA sequencing with a murine cit pri er indicated that the light chain used Jκl; from the sequence of framework 3 (FR3) it was found that the light chain was in the VKIII group of Kabat (7) . Many members of that group share similar or identical leader sequences. Therefore, a consensus leader primer was synthesized and in conjunction with a J l primer was used to amplify the mRNA which had been reverse transcribed using a CK primer.

Light Chain

For cloning the following primers were used:

Leader: CATAGGATATCCACCATGGAGACAGACACACTC (SEQ. ID. NO. 6) . This region contains an EcoR V site to facilitate cloning into the promoter.

J region: GGAAGTCGACTTACGTTTGATTTCCAGCTTGGAG (SEQ. ID.

NO. 7) . This region contains a Sal I site for cloning into the intron. The PCR products were cloned into Bluescript and the expression plasmid and sequenced. The variable region in pAG4270 can now be changed by digesting this expression plasmid with Sal I and EcoR V and inserting a new V_L cloned by PCR.

Construction of a vector with a polylinker replacing the coding sequence: A potential problem in using variable region replacement to generate new vector is the difficulty in ascertaining that the proper variable region has been inserted. To circumvent this potential problem the variable region in the plasmid was replaced by a polylinker sequence. This was achieved by digesting the plasmid pAH4274 with EcoR V and Nhe I and inserting the Nhe I-EcoR V polylinker sequence from a Bluescript derivative with Nhe I linkers inserted into the Sma I site. The resulting vector is shown in Figure 4. This vector cannot direct the production of a functional protein. It therefore has the advantage that when it is used for cloning, the resulting vectors can direct the synthesis of a protein product only if a coding sequence has been inserted.

Heavy and light chain expression plasmids and some derivatives: Table 1 lists the variable heavy and constant heavy coding sequences contained in plasmid pAG4235 and some derivatives. Also, Table 1 shows the variable light and constant light coding sequences contained in plasmid pAG4270 and some possible derivatives.

TABLE 1

Heavy Chain plasmid: Name REGION 1 REGION 2 Selectable Marker

PA04235 anti-Id human

PAH4274 anti-Id human p___4«04 poly-linker human pAH 4618 poly-linker human

PAH 619 poly-linker human

PAH 620 poly-linker human

PAH4602 anti-TF receptor human

Liσht Chain plasmid: Name REGION 1 REGION 2 Selectable Marker pAG 4270 pAN 4621 pAG 4622 pAG 609

The derivatives include those which have been produced to facilitate the cloning procedures. When the variable region is replaced by a polylinker sequence. A functional product will only result when the sequence of interest is inserted. Use of this derivative guarantees that there will be no background expression of an undesirable protein product.

Initial vectors with gpt as the selectable marker contained two EcoR V sites. Cloning using the enzyme

EcoR V therefore required partial digestions. To produce vectors more easily used for cloning, site directed mutagenesis was used to change the sequence of the gpt gene so as to remove the EcoR V site without changing the coding sequence (vector pAG 4622) .

The vectors with gpt delta EcoR V therefore contain only the one EcoR V site at the 3• end of the promoter and are more easily used for cloning.

Transfection and expression: To confirm that the heavy chain expression plasmid was functional, DNA linearized at the unique Pvu I restriction site localized in the β- lactamasegene was transfected into the J558L myeloma which synthesizes only a murine lambda light chain. Stable transfectants were selected for growth in HXM medium and screened by Elisa using anti-human IgG to detect secretion of functional Ig. Several clones identified as positive were recovered and their immunoglobulins characterized by growing the cells in ³⁵S- Methionine, immunoprecipitating the labeled immunoglobulins with specific antisera, and analyzing the proteins by SDS-PAGE. The heavy chain was of the expected molecular weight, assembled with the endogenous lambda light chain, and was secreted. Therefore, the pAG4235 expression plasmid was functional.

To check the function of the light chain vector pAG4270 the non-producing P3X63Ag8653 myeloma cell line was electroporated using a mixture of the heavy chain expression plasmid pAH4274 with the his selectable marker and the L chain VECTOR pAG4270 with the splice junction. Both plasmids were linearized at the Pvu I site in amp prior to electroporation. The recipient cells were selected either with HXM, his, or medium containing both. The results are shown in Table 2.

Surviving clones were screened for antibody production by

Elisa. A large number of clones secreting Ig were identified. Several of these clones were recovered, radiolabeled by growth in ³⁵s-Methionine, the Ig immunoprecipitated and analyzed by SDS-PAGE. The heavy and light chains were of the expected molecular weight.

Moreover, assembled complete H_jL_j molecules were secreted.

Table 2. Transfection Frequency and Antibody Production

Expression plasmids PAH4274 + pA64270

Selection Clones* Ab Producers

HXM histidinol

HXM 4- histidinol

1.1 X 10⁷ cells were transfected and plated into 5 96-well microtiter dishers under the indicated selection conditions. One 96 well microtiter dish was used each for HXM and HXM + histidinol selection. For histidinol selection alone two 96 well microtiter dishes were used. Clones are indicated as wells showing growth after 2 weeks in selection medium. Antibody producers are those wells positive by Elisa.

CHARACTERIZATION OF CHIMERIC AB: To characterize the assembly, secretion, and molecular weight of the immunoglobulin, cells were labeled with ³⁵S-Methionine and cytoplasmic lysates and secretions prepared. Antibody molecules were imunoprecipitated with polyclonal rabbit Ab against human Fc and Staphylococcus aureus protein A (IgGsorb, The Enzyme Center, Maldem, MA) and analyzed by SDS/PAGE with and without reduction of the disulfide bonds.

DISCUSSION: In initial experiments involving the production of engineered antibodies, variable (V) regions were obtained by genomic cloning in bacteriophage lambda. Alternatively, cDNAs produced by standard techniques were used. Both of these methods have certain significant disadvantages. Cloning into bacteriophage is time consuming and frequently poses significant technical problems. Further, cDNAs usually require extensive modification befor they can be inserted into expression plasmids. For thes reasons attention has increasingly focused on the use o polymerase chain reaction (PCR) based approaches to obtai variable regions for expression.

PCR based cloning is advantageous because it permits the use of degenerate oligomers as primers. Accordingly, variable regions can be cloned from antibody producing cell lines without any prior information about the amino acid or nucleic acid sequence of the antibody. Thus, this methodology is a powerful means for the production of many different proteins.

REFERENCES

1. Bruck, C, Co, M.S., Slauie, M. , Gaulton, G.N., Smith, T. , Fields, B.N., Mullins, J.I., Greene, M.I. Nucleic acid sequence of an internal image-bearing monoclonal anti-idiotype and its comparison to the sequence of the external antigen, Proc. Natl. Acad. Sci. U.S.A. 83:6578-6582, 1986.

2. Carroll, W.L., Mendel, E. , Levy, S. Hybridoma fusion cell lines contain an aberrant kappa transcript, Molec. Immunol. 25:991-995, 1988.

3. Chaudhary, V.H. , J.K. Batra, M.G. Galdo, M.C. Willingham, D.J. Fitzgerald, I. Pastan, A rapid method .of cloning functional variable-region antibody genes in Escherichia coli as single-chain immunotosins. Proc. Natl. Acad. Sci. USA 87:1066-1070, 1990.

4. Gillies, S.D., H. Dorai, J. Wesolowski, G. Majeau, D. Young, J. Boyd, J. Gardner, and K. James, Expression of human anti-tetanus toxoid antibody in transfected murine myeloma cells. Bio/Technology 7:799-804^', .1989.

5. Hartman, S.C. and R.C. Mulligan, Two dominant-acting selectable markers, for gene transfer studies in mammalian cells. Proc. Natl. Acad. Sci. USA 85:8047- 8051, 1988.

6. Jones, S.T., and M.M. Bendig, Rapid PCR-cloning of full length mouse immunoglobulin variable regions. Bio/Technology 9:88-90, 1991.

7. Kabat, E.A., Wu, T.T., Reid-Miller, M., Perry, H.M. , and Gottesman, K. Sequences of proteins of immunological interest, U.S. Dept. of Health and Human Services, 1987.

8. Kavaler, J., Caton, A.J., Staudt, L.M. , Schwartz, D. , Gerhard, W. A set of closely related antibodies dominates the primary antibody response to influenza hemoagglutinin.

9. Larrick, J.W., L. Darrelsson, CA. Brenner, E.F. Wallace, M. Abrahamson, K.E. Fry, and C.A.K. Borrelbaeck, Polymerase chain reaction using mixed primers: cloning of human monoclonal antibody variable region genes from single hybridoma cells. Bio/Technology 7:934-938, 1989.

10. Metzger, D.W., Naeve, C.W., van Cleave, V.H. Epitope mimicry by an anti-idiotype sequences in reverse orientation, Adv. in Expt. Med. and Biol. 251:187-190, 1989.

11. Orlandi, R. , Gussow, D.H. Jones, P.T. and G. Winters, Cloning immunoglobulin variable domains for expression by the polymerase chain reaction, Proc. Natl. Acad. Sci. USA 86:3833-3837, 1989.

12. Raychaudhuri, S., Kohler, H. , Saeki, Y. , and Chen, J-J. Potential role of anti-idiotype antibodies in active tumor immunotherapy, Crit, Revs, in Oncology/Hematology 9:109-124, 1989.

13. Potter, M. , Newell, J.B., Rudikoff, S., and Haber, E. Classification of mouse Vk groups based on the partial amino acid sequence to the first invariant tryptophan: impact of 14 new sequences from IgG myeloma proteins. Molec. Immunol. 19:1619-1630, 1982.

14. Walfield, A., Seising, E. , Arp, B., and Storb, U. Misalignment of V and J gene segments resulting in a nonfunctional immunoglobulin gene. Nucl. Acid. Res. 9:1101-1109, 1981.

15. Winter, E. , Radbruk, A., Krawinkel, U. Members of novel VH gene families are found in VDJ regions of polyclonally activated B lymphocytes, EMBO J. 4:2861- 2867, 1985.

16. Xiang, J. , Roder, J., and N. Hozumi, Production of murine V-human CrO chimeric anti-Tag72 antibody using V region cDNA amplified by PCR. Molecular Immunology 27:809-817, 1990.

Claims

What is claimed is:

1. An expression plasmid designated pAG4235 (ATCC No. 75038) or a derivative thereof capable of expressing a protein molecule.

2. A eucaryotic cell comprising the plasmid of claim 1.

3. A mammalian cell of claim 2.

4. A method for producing a protein molecule comprising culturing the cells of claim 2 so as to produce the protein and recovering the protein so produced.

5. The method of claim 4, wherein the protein molecule is a chimeric monoclonal antibody.

6. An expression plasmid designated pAG4270 (ATCC No. 75037) or a derivative thereof capable of expressing a protein.

7. A eucaryotic cell comprising the plasmid of claim 6.

8. A mammalian cell of claim 7.

9. A method for producing a protein molecule comprising culturing the cell of claim 6 so as to produce the protein molecule and recovering the protein molecule so produced.

10. The method of claim 9, wherein the protein molecule is a chimeric monoclonal antibody.

11. An expression plasmid designated pAH4604 (ATCC No. 75104) or a derivative thereof capable of expressing a protein molecule.

12. A eucaryotic cell comprising the plasmid of claim 11.

13. A mammalian cell of claim 12.

14. A method for producing a protein molecule comprising culturing the cell of claim 13 so as to produce the protein molecule and recovering the protein molecule so produced.

15. The method of claim 14, wherein the protein molecule is a chimeric monoclonal antibody.