CA2043516A1 - Recombinant dna and process for the production of chimeric antibodies - Google Patents
Recombinant dna and process for the production of chimeric antibodiesInfo
- Publication number
- CA2043516A1 CA2043516A1 CA002043516A CA2043516A CA2043516A1 CA 2043516 A1 CA2043516 A1 CA 2043516A1 CA 002043516 A CA002043516 A CA 002043516A CA 2043516 A CA2043516 A CA 2043516A CA 2043516 A1 CA2043516 A1 CA 2043516A1
- Authority
- CA
- Canada
- Prior art keywords
- sequence
- recombinant dna
- human
- antibody
- codes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/46—Hybrid immunoglobulins
- C07K16/461—Igs containing Ig-regions, -domains or -residues form different species
- C07K16/462—Igs containing a variable region (Fv) from one specie and a constant region (Fc) from another
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2866—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
A b s t r a c t A recombinant DNA which codes for the light or heavy chain of an antibody whose constant regions are of human origin and whose variable regions are of non-human origin, and which has in the direction of transcription (a) a cDNA sequence which codes for the variable, non-human region, including the region J and, if desired, D, (b) an intron sequence which has a splice donor site at its 5' end and is composed of a non-human intron partial sequence at the 5' end and a human intron partial sequence at the 3' end and (c) a genomic DNA sequence coding for the human constant region.
Description
~3~
-~ D e s c r i p t i o n The invention concerns recombinant DNA which codes for ; the light or heavy chain of an antibody whose constant regions are of human origin and whose variable regions are of non-human origin, expression vectors containing such a recombinant DNA, as well as processes for the production of the recombinant DNA or the expression vectors and finally processes for the production of the chimeric antibody.
The use of antibodies in therapy is becoming increasingly important. Thus for example antibodies against the interleukin 2 (IL-2) receptor are of great therapeutic interest as immunosuppressants. The in vivo effectiveness of such antibodies could be demonstrated in a series of experimental animal models. Examples of this are described for heart and skin transplantation in the mouse by Kirkman ~t al., Transplantation Proceedings 19 (1987) 618-690 and T. Diamantstein et al., Transplantation Reviews 1 (1987), 177-196, for heart transplantation in the rat by J.W. Kupiec-Weglinski et al., Proc. Natl. Acad. Sci. USA 83 (1986) 2624, for the transplantation of islets of Langerhans in the rat by Hahn et al., Diabetologia 30 (1987), 40 and for kidney transplantation in primates by T. Diamantstein et al., Transplantation Reviews 1 (1987) 177-196. The successful preventive application of rat antibodies a~ainst the IL
-~ D e s c r i p t i o n The invention concerns recombinant DNA which codes for ; the light or heavy chain of an antibody whose constant regions are of human origin and whose variable regions are of non-human origin, expression vectors containing such a recombinant DNA, as well as processes for the production of the recombinant DNA or the expression vectors and finally processes for the production of the chimeric antibody.
The use of antibodies in therapy is becoming increasingly important. Thus for example antibodies against the interleukin 2 (IL-2) receptor are of great therapeutic interest as immunosuppressants. The in vivo effectiveness of such antibodies could be demonstrated in a series of experimental animal models. Examples of this are described for heart and skin transplantation in the mouse by Kirkman ~t al., Transplantation Proceedings 19 (1987) 618-690 and T. Diamantstein et al., Transplantation Reviews 1 (1987), 177-196, for heart transplantation in the rat by J.W. Kupiec-Weglinski et al., Proc. Natl. Acad. Sci. USA 83 (1986) 2624, for the transplantation of islets of Langerhans in the rat by Hahn et al., Diabetologia 30 (1987), 40 and for kidney transplantation in primates by T. Diamantstein et al., Transplantation Reviews 1 (1987) 177-196. The successful preventive application of rat antibodies a~ainst the IL
2 receptor in kidney transplantations has also been described for humans (J.P. Soulillou et al., J. of Autoimmunity 1 (1988) 655-661; D. Cantarovitch et al., Am. J. of Kidney Disease 11 (1988) 101-106).
- 2 ~
A disadvantage is, however, that mouse and rat antibodies are potent immunogens after injection into the blood of humans which can lead to neutralization of the therapeutic activity. There is therefore a great interest in the availability of hybrid mouse/human antibodies or humanized antibodies which promise to have a substantially reduced or even eliminated immunogenicity in humans (S.L. Morrison et al., Proc.
Natl. Acad. Sci. USA 81 (1984) 6851-6855; P.T. Jones et al., Nature 321 (1986) 522-525).
Such hybrid antibodies have up to now mainly been produced by genetic engineering in which corresponding cDNAs are fused and expressed in suitable host cells.
However, a drawback of this is that the cDNAs coding for the hybrid antibodies are poorly expressed. In another production method, in order to construct such antibodies the genes for the light and heavy chain are usually first isolated from a phage library and characterized.
Afterwards the genomic DNA of the VJ region or the VDJ
region is fused by genetic engineering to the corresponding genomic DNA of the constant regions of the light and heavy human chains ( cf. for this S.L.
Morrison et al., Proc. Natl. Acad. Sci. USA 81 (1984) 6851-6855; S.H. Boulianne et al., Nature 312 (1984) 641-646; L.K. Sun et al., Proc. Natl. Acad. Sci. USA 84 (1987) 214-218; Y. Nishimura et al., Cancer Res. 47 (1987) 999-1005; B.A. Brown et al., Cancer Res. ~7 (1987) 3577-3583).
Since as a rule 106 plaques have to be examined in order to find a gene with a copy number of 1, this second type of procedure is extremely laborious. Moreover the characterization of the genomic isolates (restriction mapping, differentiation of the gene structure in ~J ~ ? ,) ~ ~j somatic and germ line cells, differentiation between abberantly and correctly rearranged genes) is extremely time-consuming.
The object of the present invention was therefore to facilitate the production oP chimeric antibodies.
This object is achieved according to the present invention by a recombinant DNA which codes for the light or heavy chain of an antibody whose constant regions are of human origin and whose variable regions are of non-human origin, which is characterized in that it contains in the direction o~ transcription (a) a cDNA sequence which codes for the variable non-human region, including the region J and, if desired, D, (b) an intron sequence which has a splice donor site at its 5' end and is composed of a non-human intron partial sequence at the 5' end and a human intron partial sequence at the 3' end and (c) a genomic DNA sequence coding for the human constant region.
The light and heavy chains for chimeric antibodies having the desired specificity can be produced in a surprisingly high yield with the aid of the recombinant DNA. In this connection an additional special advantage is that the easily obtainable cDNA sequence for the variable region of desired specificity (cDNA for antibody genes is easy to isolate since the corresponding mRNA is present in hybridoma cells as a large proportion of the total mRNA) can be connected via the intron sequence with an already subcloned genomic DNA segment which codes for the appropriate human constant regions and thus has a wide spectrum of applicability. Thus the invention offers the opportunity to easily produce recombinant DNA molecules which each have the DNA sequence encoding the correspondiny specificity.
The cDNA sequence a) of the recombinant DNA according to the present invention includes the V and the J region for a light chain and in addition the D region between V
and J for a heavy chain. In -the recombinant DNA according to ~he present inve~tion, containiny component a), b), and c), intron sequences are present on all si-tes where introns are present in the native antibody gene, except for the introns in the signal sequence of the light and heavy chains. The expression of the recombinant DNA
according to the present invention, in suitable host cells, leads to a much higher expression of the desired antibody in comparison to processes which have been known up to now for the production of chimeric antibodies using cDN~ expression.
In a preferred embodiment of the invention the sequence a) as well as the non-human intron partial sequence of b) are of murine origin and the non-human intron partial sequence of b) is preferably 15 to 20 nucleotides long.
In a particularly preferred embodiment the non-human intron partial sequence of b) is a part of the intron sequence which naturally follows the sequence a) i.e. in the genomic DNA. However, within the scope of the invention other non-human intron sequences can also be used, preferably however of the same species and if possible also derived from a gene encoding the light or heavy chain of an antibody.
-- 5 -- f~
In a further preferred embodiment of the invention the splice donor site in b) has the sequence GT.
According to the present invention a branch site is preferably located in the human part of the intron sequence which can e.g. correspond to one of the known sequences such as those described by Sharp, P.A., Science 235 (1987) 766-771. The branch site can, however, also be located in the murine part of the intron.
A promoter sequence is preferably also added to the 5' end of the recombinant DNA under the control of which the sequences coding for the antibody chains can be expressed. The promoters which naturally, i.e. as in the genome, exert control over the corresponding sequences of the recombinant DNA can e.g. be used for this.
However, preferably promoters are used which enable an increased, and if desired regulatable, expression. Such promoters are known to on~ skilled in the art. In a particularly preferred embodiment the recombinant DNA
has the promoter of the cytomegalo-virus.
In addition a further preferred embodiment of the invention is a recombinant DNA whose sequence a) codes for the variable region of the light or heavy chain of an antibody capable of specific binding to the interleukin 2 receptor. In addition the human sequence c) of the recombinant DNA according to the present invention coding for a heavy chain preferably codes for the constant region of the heavy chain of a human antibody of the IgG type.
Such recombinant DNAs are contained in the plasmids pKchim. and p ~chim. whereby the plasmid pKchim.
conta.ins a DN~ sequence coding for the light chain, i.e.
kappa chain and the plasmid p ~chim. carries a recombinant DNA coding for a heavy chain of the~ type which together code for an antibody of the IgG type whose specificity is directed against the alpha chain of the human interleukin 2 receptor.
The invention also provides an expression vector which contains one of the recombinant DNAs according to the present invention as well as all necessary elements for the expression of this recombinant DNA. The elements which are necessary for this or which are preferably used are promoters, regulatory sequences and suchlike.
Expression vectors are well-known to one skilled in the -~
art and are described for example in more detail by E.L.
Winnacker in "From Genes To Clones", 1987, Verlag Chemie, Weinheim. With the expression vectors accord~ng to the present invention it is possible to incorporate a recombinant DNA according to the present invention into suitable host cells and to express it there.
Particularly preferred expression vectors which contain recombinant DNA according to the present invention and which are also the subject matter of the invention are the already mentioned plasmids pKchim. and p ~chim.
The invention in addition provides a process for the production of a recombinant DNA according to the present invention in which polyA~ RNA is isolated from a hybridoma cell line secreting an antibody of the desired specificity, a cDNA library of this hybridoma cell line is prepared in suitable vectors and examined for clones which contain the cDNA for antibody chains by hybridization with oligonucleotides which are 7 ~ ~ r ~
complementary to the DNA coding for the constant part of the antibody, the V, J, and if desired D, sequences are isolated, a splice donor site, a part of an antibody intron sequence of non-human origin and a restriction cleavage site adjacent to the respective J domain in the direction oi transcription are introduced by site-directed mutagenesis and the DNA obtained is ligated with a genomic DNA sequence which codes for the constant region of the light or heavy chain of a human antibody and has a part of a corresponding human intron sequence at its 5' end.
The isolation of the polyA+ RNA, cDNA synthesis, as well as the establishment of a cDNA library are carried out according to known methods such as those described e.g.
in Maniatis et al., Molecular Cloning: a Laboratory Manual, 1982, Cold Spring Harbor. The selection of cDNA
clones coding for antibody chains is also carried out in a known manner, i.e. by examining for clones which hybridize with an oligonucleotide which is complementary to a DNA which codes for the constant region of an antibody which is derived from the same hybridoma cell species.
The site-directed mutagenesis for the introduction o a splice donor sita and a unique restriction enzyme cleavage site is also well-known and is carried out according to the method which was described by Morinaga et al., Bio/Technology 2 (1984) 636-639.
In a preferred embodiment of the invention a mouse or rat hybridoma cell is used. The establishment of hybridoma cells which secrete antibodies of the desired specificity is carried out according to the method which was first described by ~ohler and Milstein (Nature 2S6 ~3, ? ) ~ i, (1975), 495) and which was subsequently developed further. These techniques are very familiar to one skilled in the art. In the process according to the present invention it is particularly preferable to use a mouse hybridoma cell which secretes antibodies directed against the alpha chain of the human interleukin 2 receptor.
For the introduction of the non-human intron partial sequence, a 15 to 20 base pair sequence is preferably used. In this case it is particularl~ preferably to use the partial intron sequence which ~ollows in the authentic gene. In addition it is preferred to introduce the nucleotide sequence GT as splice donor site.
Finally it is preferred according to the present invention to use a human genomic DNA whose intron partial sequence contains a branch site.
In order to obtain a recombinant DNA which can be expressed well, a promoter sequence is preferably placed in front of the DNA sequence which is finally obtained or the manipulations which are necessary for the process according to the present invention are carried out from the beginning in a vector which contains a promoter in a suitable position. In this connection it is particularly preferable to use the promoter of the cytomegalo-virus genome.
In yet another preferred embodiment of the invention a human genomic DNA sequence which codes for the constant region of the light or heavy chain of an antibody of the IgG type is used for the construction of a recombinant DNA coding for a light or heavy chain.
2 J ~
The invention also provides a process for the construction of an expression vector according to the present invention in which a recombinant DNA according to the present invention is inserted into a suitable vector for the expression of a foreign gene. As already set forth above such vectors are known to one skilled in the art and contain all necessary components such as e.g. polylinker for inserting the recombinant DNA, antibiotic resistance genes in order to select colonies which contain the recombinant DNA, an origin of replication, regulatory elements, a promoter, if the recombinant DNA does not already have one, as well as, if desixed, further components such as e.g. suppressor genes for selection of colonies carrying plasmid DNA.
The invention in turn also provides a process for the production of a chimeric antibody whose variable regions are of non-human origin and whose constant regions are of human origin in which in this case one each of an expression vector which contains a recombinant DNA
according to the present invention which codes for the light chain and an expression vector which contains a recombinant DNA according to the present invention which codes for the heavy chain of the antibody are introduced into suitable host cells, stable transformants are isolated and the antibodies are isolated from the culture supernatant of the cells according to known methods. In this process a non-producer hybridoma cell is preferably used as the host cell, the cell line Sp2/0-Agl4 (ATCC CRL 8922) is particularly preferred. In the process according to the present invention it is preferable to carry out an electroporation (Nucl. Acids Res. 15 (1987), 1311-1326, ~io Techniques 6 (1988), 742-751) in order to introduce the vectors into the hos~
cells, if desired with linearized DNA molecules.
However, other processes known to one skilled in the art can also be used for the transfection of the host cells.
The process according to the present invention enables antibodies to be produced in a simple manner with a variety of specificities. These antibodies are not immunogenic or only very weakly immunogenic when applied therapeutically in humans since the constant regions are of human origin. Nowadays there are relatively simple methods to produce e.g. mouse hybridoma cells which se~rete antibodies of a desired specificity and to isolated cDNA from them, this cDNA can ba easily introduced into previously prepared vectors according to the process according to the present invention which each contain the genomic human part for the constant regions of the light or heavy chainO Thus it is possible to obtain chimeric antibodies of the desired specificity in each case by simple ligation of the desired cDNA
frag~ent into the appropriately prepared vectors and expression of recombinant DNA on both vectors in a host cell. The production of chimeric antibodies is not only much more simple than with the methods known hitherto but the yields are also greatly increased.
The invention therefore also provides the chimeric antibodies M~B 179, MAB 215 and MAB 447 whose sequences for the light and heavy chains are shown in the sequence protocols SEQ ID NO:1 to 6 (the sequences of the variable regions are shown~ the sequences of the constant regions are known and described e.g. in Sequences of proteins of immunological interest; E.
Kabat, T. Wu, M. Reid-Miller, H. Perry and K. Gottesman, US Department of ~ealth and Human Services, 1987, p.
282-325) and whose production is described in the examples. All three antibodies are specific for the alpha chain of the human IL 2 receptor.
The invention is elucidated further by the following examples in conjunction with the sequence protocols and figures.
EQ ID NO.:1 shows the DNA and amino acid sequence of the variable region as well as the beginning of the constant region of the light chain of MAB 179, EQ ID NO.:2 shows the DNA and amino acid sequence of the variable region as well as the beginning of the constant region of the light chain of MAB 447 EQ ID No.:3 shows the DNA and amino acid sequence of the variable region as well as the beginning of the constant region of the light chain of MAB 215, EQ ID NO.:4 to 6 show the sequences of the respective variable regions of their corresponding heavy chains;
ig. 1 shows diagrammatically the isolation of a murine cDNA fragment coding for the variable region of the light immunoglobulin chain and the procedure for the site-directed mutagenesis;
- 12 - ~7 J' '. . ~
ig. 2a shows the insertion of the variable murine region of the light immunoglobulin chain into an expression vector;
ig. 2b shows diagrammatically the assembly of the murine and human antibody coding sequences for the light chain;
ig. 3 and 4a as well as 4b show a diagram of the same process for the DNA of the heavy immunoglobulin chains.
x a m p l_e Cloninq and sequence analysis of the light and heavy chains of MABl79 447 and 215 RNA was prepared from the hybridoma lines which secrete the monoclonal antibodies 179, 447 or 215 (Cleary, et al.: Cell 44 (1986) 97-106~ and polyA+RNA was isolated from it (Maniatis, T., et al., Molecular Cloning: A
Laboratory Manual, (Cold Spring Harbor Lab., Cold Spring Harbor, NY, 1982) using an oligo-dT cellulose column (Collaborative Research, Bedford, MA). A cDNA library was constructed for each hybridoma cell line with a cDNA
cloning kit from Pharmacia according to the instructions of the manufacturer (analogous to Gubler, U. and Hoffman, G.J.: Gene (1983) 25, 263). This cDNA library comprised about 10000 recombinants for each hybridoma line.
The following primer was use~ to screen for clones of the kappa chain:
5'CCCGACTACGACGT3' The following primer was used to screen for clones ofthe ~ chain (~1 and ~b):
5'CAGATAGGTGACCGG3' All the heavy chains of mouse immunoglobulin genes are detected with this prlmer tSablitzky, F. and Rajewski, K.: EMB0 J. 3 (19~4) 3005-3012).
The cDNA library was established in the vector pT7T318U
(Pharmacia). By this means it was possible to regain the insertions as EcoRI fragments. By analysis with restriction endonucleases it was found that clones of complete length were obtained for the heavy and light chains of MAB179, 447 and 215. The relevant regions were subcloned in M13 vectors and sequenced ~Sanger, F., et al.: Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467).
The sequences of the variable regions are shown in the sequence protocols SEQ ID NO:l to NO:6. In this case it can be seen that MAB179 and 447 use the same VL and VH
segments for the light and the heavy chains.
Both kappa chains use the Jl region and have identical nucleotides at the VJ junctions which indicates that the VJ region of both kappa genes has the same origin. Both ~1 chains have the same D region, the same J region (JH3) and an identical VDJ recombination from which it can be deduced that both VDJ regions of the ~1 genes have the same origin.
The comparison of the amino acid sequences of the light chains shows 3 amino acid substitutions in the V regions of the kappa cDNA of MAB179 and MAB447. The substitutions are as follows:(Ser to Thr, amino acid 20), (Arg to Lys, amino acid 45), (Lys to Asn, amino acid 53).
Thus, 98 ~ of the amino acids of the VJ region of MAB179 and 447 are identical.
There are 6 amino acid substitutions in the V regions of the ~1 cDNA of MA~179 and M~B447. The substitutions are as follows: (Val to Ala, amino acid 23; Gly to Ser, amino acid 56; Ile to Val, amino acid 58; Thr to Arg, amino acid 63; Lys to Arg, amino acid 65; Gln to Glu, amino acid 82).
Thus, 94 % of the amino acids of the VJ regions of MAB179 and 447 are identical.
The data suggest that the differences in the amino acid sequences of MAB179 and MAB447 are due to somatic mutations.
The initiation codon (Met) = start of the signal sequence is shown in the sequence protocols for kappa and ~1 cDNA of MAB179 and 447. The J or DJ regions are also shown as well as the beginning of each of the constant regions.
The sequences of the variable regions for the kappa and the ~2b chain of the non-inhibitory (with respect to IL 2 binding) antibody MAB215 are shown in SEQ ID NO:3 and NO:6.
The J4 region is used for the kappa chain. A V segment is used which greatly differs from that of the light chains of MAB179 and 447, since only 51 ~ of the amino acids are identical compared to the V segment of 179~
The sequence of the ~2b chain is shown in SEQ ID NO:6.
A V segment is used which clearly differs from that of the heavy chain of the clones MAB179 and MAB447. The D
region (comprising seven amino acids) as well as the J
region (JH3) and the beginning of the constant region are shown. Only 57 % of amino acids are identical compared to the V segment of the heavy chain of the clone MAB179.
Example 2:
Chimeri~atlon of the l~ chain of MAB179 and construction of an expression vector for the chimerized li~ht chain a) Introduction of splice donor, intron and NotI
- sequences downstream of the VJl region of the kappa -chain of MAB179 (Fig. 1).
The cDNA for the light chain of the murine MAB 179 was subcloned into pUC18 (Yanisch-P~erron, C., et al.: Gene 33 (1985) 103-109) as an EcoRI-HpaI
fragment giving rise to plasmid pUCk. According to Fig. 1, the fragment may then be cut out from this vector as an EcoRI-BamHI fragment, using a BamHI
site in the pUC18 polylinker. An Eco-RI-NotI
fragment which can be cloned (and is portable) via EcoRI and NotI ends is produced by mutagenesis.
This fragment contains the VJl region and is followed by 20 nucleotide intron sequences starting with the splice donor sequence GT of the genomic J1 segment of the mouse kappa chain (Max, E.E., et al., J. Biol. Chem. 256 (1981) 5116-5220) and a recognition sequence (GCGGCCGC) for the restriction endonuclease NotI. The mutagenesis procedure (see above) is carried out according to Morinaga, et al.
(Bio/Technology 2 (1984) 636-639).
- 16 ~
Sequence of the oligonucleotide used for mutagenesis:
splice donor sequence L/ .
5'GCA~TC~AAC ~ AAGTAGAATCCAAAGTCT GCGGCCGC GGGCTGATGCT 3' J~ Jl intron NotI mouse kappa constant region Two fragments were isolated from pUCk for the heteroduplex formation.
Fragment A: pUCk was cleaved with the restriction enzymes EcoRI and BamHI, both fragments were separated by agarose gel-electrophoresis and the large EcoRI-BamHI fragment was isolated from the gel. This fragment contains no mouse kappa sequences.
Fragment B: pUCk was treated with NaeI (unique cleavage site in the pUC part), the 5' phosphate residues were removed by treatment with alkaline phosphatase and subsequently the fragment was purified twice on a 0~7 % agarose gel.
Fragment A, fragment B (500 fmol each) and the oligonucleotide ~80 fmol) were mixed for heteroduplex formation and incubated at lOO~C for three minutes with 50 mmol/l NaCl, 10 mmol/l Tris-HCl, pH 7.5/ 10 mmol/l MgSO4 and subsequently transferred onto ice. Afterwards the DNA was renatured (20 min at 60C). For the repair r ~ 17 --synthesis the reaction mixture was adiusted to:
deoxynucleoside triphosphate (0.25 mmol/l), ATP
(1 mmol/l), NaCl (100 mmol/l), Tris-HCl pH 7.5 (6.5 mmoltl), MgC12 (8 mmol/l), ~-mercaptoethanol (1 mmol/l), Xlenow fragment of the DNA polymerase from E. coli (0.125 U/~l preparation) and T4 ligase (0.1 U/~1 preparation) and incubated at 16C for 4 hours. Afterwards E. coli HB101 was transformed with the reaction mixture and colonies were selected on agar plates containing ampicillin (50 ~g/ml). Those colonies in whose plasmid DNA the above mentioned oligonucleotide was incorporated could be identified with the aid of the colony hybridization technique (Maniatis et al~: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 1982). The characterization was first carried out by analysis with restriction endonucleases. Subsequently the desired change in the sequence was confirmed by sequencing (Sanger, F., et al.: Proc. Natl. Acad.
Sci. USA 74 (1977) 5463-5467).
b) Construction of an expression vector for the chimerized kappa chain of MAB179 (Fig. 2a and 2b).
pcDNA1 (Invitrogen, San Diego; Aruffo, A. and Seed, B. (1987) Proc. Natl. Acad. Sci. USA 84 8573-8577) served as the starting plasmidO It contains the promoter of the human cytomegalo-virus, promoters of the phages T7 and SP6, a polylinker, splice and polyadenylation sequences from SV40, a supF tRNA
for the selection as well as 1'origins of replication" from M13, ColE1, SV40 and polyoma. For cloning reasons the Nd~I site shown is converted into a PvuI site (= pcDNA1-PvuI) by ligation of a corresponding linker. The latter plasmid was cleaved with EcoRI and NotI in the polylinker and the EcoRX-NotI fragment of the DNA obtained according to (a) (ca 400 bp) containing the VJ1 region and intron sequences of ~Bl79 kappa was ligated into the vector. The ligation mixture was transfected into the E. coli strain MC1061/P3 (Aruffo, A. and Seed, B.: Proc. Natl. Acad. Sci.
USA 84 (1987) 8573-8577); Seed, B.: Nucl. Acids Res. 11 (1983) 2327-2445) and ampicillin-resistant colonies were isolated on agar plates. The plasmid formed is denoted pcDN~c. pcDNAk was then cleaved with PvuI and NotI and the shorter fragment was isolated on a low-melting agarose gel.
The plasmid plO195 (constructed according to EP-A O 378 175,July 18, l990; Kaluza e~ al.) was also cleaved with NotI and PvuI and the larger fragment (Fig. 2b) was isolated on a low-melting agarose gel. plOl95 contains intron sequences of the mouse for the kappa chain as well as coding and non-coding re~ions of the constant human kappa region.
Both the fragments of pcDNAk and plO195 were ligated with T4 ligase, transfected into MC1061/P3 and ampicillin-resistant colonies were isolated.
The plasmid formed is denoted pKchim. The hybrid gene (VJ1 mouse Ckappa-human) is expressed under the control of the human CMV promoter (c~tomegalo-virus)~ An expression cassette for the phosphotransferase neo (inserted into pKchim. from plO195) allows selection of G418 resistant colonies after transfection into mammalian cells (Southern, P. and Berg, P.: J. Mol. Appl. Genet. 1 (1982) 327-341).
1 9 ~
Example 3 Chimerization of the heavy chain of MAB179 and construction of an expression vector for the chimerized heavy chain.
a) Introduction of splice donor, intron and NotI
sequences into the VDJ3 region of the ~1 chain of MAB179 (Fig. 3).
The cDNA for the ~1 chain (5' untranslated region and coding region upstream of the BamHI site in the constant region) was subcloned as an EcoRI-Bam~I
fragment into pUC18 = plasmid pUC~1 (Yanisch-Perron, C., et al.~ Gene 33 (1985) 103-109).
A portable EcoRI-NotI fragment is prepared by mutagenesis which contains the VDJ3 region of the mouse ~1 chain followed by 20 nucleotide intron sequences starting with the splice donor sequence GT of the genomic J3 segment of the mouse ~1 chain (Sa~ano, et al., Nature 286 (1980) 676-682). This is followed by a recognition sequence (GCGGCCGC) for the restriction endonuclease NotI. The mutagenesis was carried out according to Morinaga et al. (Bio/Technology 2 (1984) 536-639). The sequence of the oligonucleotide used for mutagenesis:
splice donor sequence 5' GTCTCTGCAG GTGAGTCCTAACTTCTCCCA GCGGCCGC TGCCTGGTCA 3' J3 J3 intron NotI mouse ~1 constant region Two frayments were isolated from pUC~1 for heteroduplex formation.
Fragment C: pUC~1 was cleaved with the restriction enzymes EcoRI and BamHI, the two fraqments were separated by gel electrophoresis (1 % agarose gel) and the large EcoRI-BamHI fragment was isolated from the gel. This fragment contains no mouse ~1 sequences.
Fragment D: pUC~1 was cleaved with NaeI (unique cleavage site in the pUC part), the 5' phosphate residues were removed by treatment with alkaline phosphatase and subsequently the fragment was purified twice on a 0.7 % agarose gel. After mixing the fragments C and D (500 fmol each) and the oligonucleotide (80 fmol), the mutagenesis was carried out as described in Example 2. Those colonies in whose plasmid DNA the oligonucleotide described above was incorporated could be ;dentified with the aid of the colony h~bridization technique (Maniatis, et al: Molecular Cloning. A
Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring ~arbor, NY 1982). The characterization was first carried out with restriction endonucleases. Subsequently the desired change in the sequence was confirmed by sequencing (Sanger, ~ ~ ~ ' C~ ~ ' ,? ':>
F., et al.: Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467). Fig. 3 shows diagrammatically the isolation of the desired EcoRI-NotI fragment.
b) Construction of the expression vector for the chimerized ~1 chain of MAB179 tFig. 4a and 4b). The unique NdeI site in the vector pcDNAl (Invitrogen, San Diego; Aruffo, A. and Seed, B. (19~7) Proc.
Natl. Acad. Sci. USA 84, 8573-8577) was converted into a PvuI site by insertion of a corresponding linker. The plasmid which formed is denoted pcDNA1-PvuI.
pcDNAl~PvuI cleaved with EcoRI and NotI and the EcoRI-NotI fragment of pUC~1 Mut (with VDJ3 and intron sequences of ~1) described in Fig. 3 were linked by ligation. The plasmid formed is designated pcDNA~1.
The plasmid pll201 (constructed according to EP-A 0 378 175) is cleaved with NotI and BamHI, the protruding ends filled in with Klenow, ligated with NotI linkers, cleaved again with NotI and the fragment shown in Fig. 4b is isolated on a low-melting agarose gel. This fragment contains intron sequences of the heavy chains of the mouse, intron sequences of the human heavy chains as well as the genomic equivalent of the constant region of the human ~1 gene. This fragment was ligated into the unique NotI site of the vector pcDNA~1. Tha correct orientation was determined by cleavage with restriction endonucleases. The expression vector which formed for the chimerized ~1 chain of MAB179 is denoted p ~chim. Chimerized chains of other isotypes (such as e.g. ~, ~2, ~3, ~4, ~ 2,~ , ~) ~ 'J , ~ . i ,, ~' ,C 13 can also be constructed according to this principle.
Examele 4:
Establishment of permanent cell lines of non-producer hybrid_ma lines by electroporation wlth expression plasmids for the chimerized chains of MAB179.
The plasmids pKchim. and p~1 chim. were mixed in equal amounts and transfected by electroporation into the immunoglobulin non-producer hybridoma line Sp2/0-Agl4 (ATCC CRL 8923) (Ochi, A., et al., Proc. Natl. Acad.
Sci. USA 80 (1983) 6351-6355). All other non-immunoglobulin-producer hybridoma cell lines such as e.g. P3X63-Ag8.653 (ATCC CRL 8375) are also suitable.
Both plasmids were linearized with the restriction endonuclease PvuI before transfection. The electroporation was carried out as described in Nucleic Acids Res. 15 (1987) 1311-1326 or Bio Techniques 6 tl988) 742-751. After centrifugation, the cells were washed with cold HeBS buffer (20 mmol/l HEPES, pH 7.05, 137 mmol/l NaCl, 5 mmol/l KCl, 0.7 mmol/l Na2HPO4, 6 mmol/l dextrose), resuspended with HeBS buffer, adjusted to a concentration of 106 cells/ml and placed on ice. After the addition of plasmid the cells were pulsed (conditions: capacity 500 ~F and voltage range between 240 and 280 V, or 200 to 240 V at 160 ~F). After pulsing, the cells were kept on ice for about 10 minutes and subsequently incubated at 37C in medium I (RPMI
1640, 10 % foetal calf serum, 2 mmol/l glutamine, 1 mmol/l sodium pyruvate, 0.1 mmol/l non-essential amino acids). The medium was changed 30 h after the transfection and incubated with medium I + 800 ~g/ml ~418 after plating 103 cells per well in 96 well microtitre plates. 10 microtitre plates (96 wells each) were prepared. 7~10 days after plating, G418 resistant colonies could be identified in the wells. Their culture supernatants were tested for reconstituted cnimerized MAB179 as described in the following example. The best producers were propagated in mass culture in medium I.
Example 5 Detection of reconstituted antibodies aqainst the human IL-2 receptor Firstly a microtitre plate is coated with polyclonal antibodies against human Fc~. For this the wells of a microtitre plate are incubated overnight at 4C or for 1 hour at room temperature with 200 ~l corresponding to 2.5 ~g of a polyclonal antibody against human Fc~(IgG) in 0.2 mol/l carbonate/bicarbonate, pH 9.5. After aspirating the wells they were incubated for 30 min to 1 h at room temperature with 300 ~l 50 mmol/l HEPE~, 0.15 mol/l NaCl/1 % Crotein C, pH 7Ø Subsequently 200 ~l calibration sample or culture supernatant of transfected cells was added and incubated for 1 h at room temperature while shaking (500 rpm) or for 90 min at room temperature without shaking. The calibration curve was established with a model chimeric antibody (produced by chemically cross-linking a human IgG MAB
and Fab fragments of MAB173). After aspirating the wells they were each washed twice with 300 ~l IB = incubation buffer (50 mmol/l HEPES, pH 7.0, 0.15 mol/l NaCl, 0.2 mol/l di-sodium tartrate, 1 % Crotein C, 0.75 % PEG
40000 (Serva), 0.5 % Pluronic F68*(Boehringer Mannheim), 0.01 % phenol). Afterwards 200 ~l of a solution of IL-2 receptor-POD-antibody conjugate complex was added (as described below) and incubated for 1 h at room temperature while shaking (500 rpm) or for 90 min at room temperature without shaking. The preformed complex * trade mark consists of soluble interleukin 2 receptor and POD-labelled Fab fragments of the IL-2 receptor MAB215.
Formation of the complex solution: 20 ~1 of the POD-labelled Fab fragments of MAB 215 (150 U/ml) + 19.5 ml incubation buffer (IB) (see above) + 3 ml soluble IL-2 receptor standard (6400 U/ml; units defined via standard of T-cell Sciences). The soluble IL-2 receptor was obtained from culture supernatants of a recombinant mouse fibroblast cell line d~scribed by Shimizu et al.
(Mol. Biol. Med. 3 (1986) 509-520).
After carrying out the incubation the wells were rinsed three times with the wash buffer described above and subsequently the POD activity was determined with ABTS
solution [2,2'-azino-di-3-ethylbenzthiazoline-sulphonate] + H2O2 after incubating for 45-60 min at room temperature by reading the absorbance at 405 nm in an ELISA reader. Clones with high expression (up to 10 ~g/ml) were determined using this method.
-- 2 5 ~ s i SEQ ID NO: 1 (light chain clone 179) TYPE OF SEQUENCE: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 432 base pairs HARACTERISTICS: aa -20 (Met): start of the signal sequence aa 1 (Asp): beginning of the V region from aa 96 (Arg) to aa 107 (Lys): ~1 region fro~ aa 108 (Arg): beginning of the C region ATG ATG GTC CTT GCT CAG TTT CTT GCA TTC TTG TTG CTT TGG TTT CC~ 48 rlet tlet Val Leu Ala Gln Phe I,eu Ala Phe Leu Leu Leu Tr~ Phe Pro Gly Ala Arg Cys Asp Ile Leu Met Thr Gln Ser Pro Ser Ser Met Ser Val Ser Leu Gly Asp Thr Val Ser Ile Thr Cys His Ala Ser Gln Gly Ile Arg Ser Asn Ile Val Trp Leu Gln Gln Lys Pro Gly Lys Ser Phe ~0 Arg Gly Leu Ile Tyr His Gly Thr Lys Leu Glu Asp Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Ala Asp Tyr Ser Leu Thr Ile Ser AGC CTG GAA TCT GAA GAT TTT GCA GAC l`AT TAT TGT GTA CAG TAT GCT 336 Ser Leu Glu Ser Glu Asp Phe Ala Asp Tyr Tyr Cys Val Gln Tyr Ala go Gln Phe Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln - 26 ,f, ~ -SE~ ID NO: 2 (light chain clone 447) TYPE OF SEQUENC~: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 432 base pairs HARACTERISTICS: aa -20 (Met): start of the signal sequence aa 1 (Asp): beginning of the V region from aa 96 (Arg) to aa 107 (Lys): Jl region from aa 108 (Arg): beginning of the C region ~let Met Val Leu Ala Gln Phe Leu Ala Phe Leu Leu Leu Trp Phe Pro Gly Ala Arg Cys Asp Ile Leu Met Thr Gln Ser Pro Ser Ser Met Ser GTT TCT CTG GGA G~C ACA GTC ACC ATC ACT TGC CAT GCA AGT CAG GGC 144 'Jal Ser Leu Gly Asp Thr Val Thr Ile Thr Cys His Ala Ser Gln Gly Ile Arg Ser Asn Ile Val Trp Leu Gln Gln Lys Pro Gly Lys Ser Phe Lys Gly Leu Ile Tyr His Gly Thr Asn Leu Glu Asp Gly Val Pro Ser CGG TTC AGT GGC AGT GG~ TCT GGA GCA G~T TAT TCT CTC ACC ~TC AGC 288 Arg Phe Ser G~y Ser Gly Ser Gly Ala Ase ~yr Ser Le~ ~hr ~1e Ser Ser Leu Glu Ser Glu Asp Phe Ala Asp Tyr Tyr Cys Val Gln Tyr Ala Gln Phe Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg GCT GAT GCT GC~ CCA ACT GTA TCC ATC TTC CCA CCA TCC AGT GAG CAG ~32 Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln ~ ; c. ,-j.
SEQ ID NO: 3 (light chain clone 215) TYPE OF SEQUENC2: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 435 ~ase pairs HARACTERISTICS: aa -22 (Met): start of the signal seq~ence aa 1 (Lys): beginning of the V region from aa 95 (Phe) to aa 106 (Lys): J4 region from aa 107 (Arg): beginning of the C region ~2et Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser Val Ile Met Ser Arg Gly Lys Ile Val Leu Ser Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Ile Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Gln Ala Thr Ser Asn Leu Ala Phe Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp go AGT AGT AAC CCA TTC ACG TTC GGC TCG GGG AC~ AAG TTG GAA ATG AAA 384 Ser Ser Asn Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Met Lys Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu 110 llS 120 Gln 2 8 -~ r SEQ ID NO: 4 (heavy chain clone 179) TYPE OF SEQUENC~: Nucleotide with corresponding prctein LENGTH OF SEQUENCE: 531 base pairs CHARACTERISTICS: aa -19 (Met): start of the signal sequence aa 1 (Asp): ~eginning of the V region fro~ aa 99 (Asp) to aa 102 (Asn): D region from aa 103 (Trp) to aa 113 (Ala): J3 region fro~ aa 114 (Ala): beginninq of the C region ATG GAC TCC AGG CTC AAT TTA GTT TTC CTT GTC CTT ATT TTA ~AA GGT 48 ~let Asp Ser Arg Leu Asn Leu Val Phe Leu Val Leu Ile Leu Lvs Gly Val Gln Cys Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln CC~ GGA GGG TCC CGG AAA CTC TCC TGT GTT GCC TCT GGA TTC ACT TTC 194 Pro Gly Gly Ser Ar~ Lys Leu Ser Cys Val Ala Ser Gly Phe Thr Phe Ser Thr Phe Gly Met His Trp Val Arg Gln Ala Pro Glu Lys Gly Leu Glu Trp Val Ala Tyr Ile Ser Ser Gly Ser Gly Thr Ile Tyr Tyr Ala Asp Thr Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Pro Lys Asn Thr Leu Phe Leu Gln Met Thr Ser Leu Arg Ser Glu Asp Thr Ala Met 8~ go Tyr Tyr Cys Ala Arg Asp Trp Met Asn Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr Yro Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu GTC AAG GGC TAT TTC CCT GAG CCA GTG ACA GTG ACC TGG AAC TCT GG~ 528 Val ~ys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser 2 9 ~ ~ r SEQ ID NO: 5 (heavy chain clone 447) TYPE OF SEQUENCE: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 531 base pairs HARACTERISTICS: aa -19 (Met): start of the signal sequence aa 1 (Asp): beginning of the V region from aa 99 (Asp) to aa 102 (Asn): D region fro~ aa 103 (Trp) to aa 113 (Thr): J3 region from aa 114 (Ala): beginning of the C region ~let Asp Ser Arg Leu Asn Leu Val Phe Leu Val Leu Ile Leu Lys Gly Val Gln Cys Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln CCT GG~ GGG TCC CGG AAA CTC TCC TGT GCA GCC TCT GGA TTC ACT TTC 144 Pro Gly Gly Ser Arg Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe lS 20 25 AGT ACC TTT GGA ATG CAC TGG GTT CGT CAG GCT CCA G~G AAG GGG CTG 192 Ser Thr Phe Gly Met His Trp Val Arg Gln Ala Pro Glu Lys Gly Leu Glu Trp Val Ala Tyr Ile Ser Ser Gly Ser Ser Thr Val Tyr Tyr Ala GAC AGA GTG AGG GGC CGA TTC ACC ATC TCC AGA GAC AAT CCC AAG ~AC 288 Asp Arg Val Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Pro Lys Asn 7;
Thr Leu Phe Leu Glu Met Thr Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys Ala Arg Asp Trp Met Asn Trp Gly Gln Gly Thr Leu Val Thr Val Ser Thr Ala Lys Thr Thr Pro Pro Ser Val Tyx Pro Leu Ala CCT GGA TCT GCT GCC CAA ACT AAC TCC ATG GTG ACC CTG GG~ TGC CTG 480 Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu GTC AAG GGC TAT TTC CCT GAG CCA GTG ACA GTG ACC TGG AAC TCT GG~ 528 Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser - 30 - ~ i3 ~EQ ID NO: 6 ~heavy chain clone 215) TYPE OF SEQUENCE: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 549 base pairs CHARACTERISTICS: aa -19 (Met): start of the signal sequence aa 1 (Gln): beginning of the V reqion -from aa 98 (Thr) to aa 104 (Ser): D region from aa 105 (Trp): to aa 119 (Ala): J3 region from aa 120 (Ala): beginning of the C reqion ~TG GCT GTG CTG GGG CTG CTT CTC TGC CTG GTG ~CT TTC CCA AGC TGT 48 ,let Ala Val Leu Gly Leu Leu Leu Cys Leu Val Thr Phe Pro Ser Cys -15 -lQ -5 Val Pro Ser Gln Val Gln Leu Lys Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu lS 20 25 Ser Thr Tyr Ser Val Tyr Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Ser Asp Gly Ser Thr Thr Tyr Asn Ser ACT CTC AAA TCC AGA CTG ACC ATC AGC AAG GAC ~AC TCC AAG AGT CAA 288 Thr Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Asn Ser Lys Ser Gln GTT TTC TTA AAA GTG AAC AGT CTC CAA ACT G~T GAC ACA GCC ATG TAC 336 Val Phe Leu Lys Val Asn Ser Leu Gln Thr Asp A5p Thr Ala Met Tyr Tyr Cys Ala Arg Thr Tyr Gly Tyr Asp Gly Ser Trp Leu Ala Tyr Trp lQ0 105 GGC CAA GGG ACT CTG GTC ACT GTC TCT GC~ GCC AAA ACA ACA CCC CCA 432 Gly Gln Gly Thr Leu Val Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Cys Gly Asp Thr Thr Gly Ser Ser Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Ser Val Thr Val Thr Trp Asn Ser Gly Ser
- 2 ~
A disadvantage is, however, that mouse and rat antibodies are potent immunogens after injection into the blood of humans which can lead to neutralization of the therapeutic activity. There is therefore a great interest in the availability of hybrid mouse/human antibodies or humanized antibodies which promise to have a substantially reduced or even eliminated immunogenicity in humans (S.L. Morrison et al., Proc.
Natl. Acad. Sci. USA 81 (1984) 6851-6855; P.T. Jones et al., Nature 321 (1986) 522-525).
Such hybrid antibodies have up to now mainly been produced by genetic engineering in which corresponding cDNAs are fused and expressed in suitable host cells.
However, a drawback of this is that the cDNAs coding for the hybrid antibodies are poorly expressed. In another production method, in order to construct such antibodies the genes for the light and heavy chain are usually first isolated from a phage library and characterized.
Afterwards the genomic DNA of the VJ region or the VDJ
region is fused by genetic engineering to the corresponding genomic DNA of the constant regions of the light and heavy human chains ( cf. for this S.L.
Morrison et al., Proc. Natl. Acad. Sci. USA 81 (1984) 6851-6855; S.H. Boulianne et al., Nature 312 (1984) 641-646; L.K. Sun et al., Proc. Natl. Acad. Sci. USA 84 (1987) 214-218; Y. Nishimura et al., Cancer Res. 47 (1987) 999-1005; B.A. Brown et al., Cancer Res. ~7 (1987) 3577-3583).
Since as a rule 106 plaques have to be examined in order to find a gene with a copy number of 1, this second type of procedure is extremely laborious. Moreover the characterization of the genomic isolates (restriction mapping, differentiation of the gene structure in ~J ~ ? ,) ~ ~j somatic and germ line cells, differentiation between abberantly and correctly rearranged genes) is extremely time-consuming.
The object of the present invention was therefore to facilitate the production oP chimeric antibodies.
This object is achieved according to the present invention by a recombinant DNA which codes for the light or heavy chain of an antibody whose constant regions are of human origin and whose variable regions are of non-human origin, which is characterized in that it contains in the direction o~ transcription (a) a cDNA sequence which codes for the variable non-human region, including the region J and, if desired, D, (b) an intron sequence which has a splice donor site at its 5' end and is composed of a non-human intron partial sequence at the 5' end and a human intron partial sequence at the 3' end and (c) a genomic DNA sequence coding for the human constant region.
The light and heavy chains for chimeric antibodies having the desired specificity can be produced in a surprisingly high yield with the aid of the recombinant DNA. In this connection an additional special advantage is that the easily obtainable cDNA sequence for the variable region of desired specificity (cDNA for antibody genes is easy to isolate since the corresponding mRNA is present in hybridoma cells as a large proportion of the total mRNA) can be connected via the intron sequence with an already subcloned genomic DNA segment which codes for the appropriate human constant regions and thus has a wide spectrum of applicability. Thus the invention offers the opportunity to easily produce recombinant DNA molecules which each have the DNA sequence encoding the correspondiny specificity.
The cDNA sequence a) of the recombinant DNA according to the present invention includes the V and the J region for a light chain and in addition the D region between V
and J for a heavy chain. In -the recombinant DNA according to ~he present inve~tion, containiny component a), b), and c), intron sequences are present on all si-tes where introns are present in the native antibody gene, except for the introns in the signal sequence of the light and heavy chains. The expression of the recombinant DNA
according to the present invention, in suitable host cells, leads to a much higher expression of the desired antibody in comparison to processes which have been known up to now for the production of chimeric antibodies using cDN~ expression.
In a preferred embodiment of the invention the sequence a) as well as the non-human intron partial sequence of b) are of murine origin and the non-human intron partial sequence of b) is preferably 15 to 20 nucleotides long.
In a particularly preferred embodiment the non-human intron partial sequence of b) is a part of the intron sequence which naturally follows the sequence a) i.e. in the genomic DNA. However, within the scope of the invention other non-human intron sequences can also be used, preferably however of the same species and if possible also derived from a gene encoding the light or heavy chain of an antibody.
-- 5 -- f~
In a further preferred embodiment of the invention the splice donor site in b) has the sequence GT.
According to the present invention a branch site is preferably located in the human part of the intron sequence which can e.g. correspond to one of the known sequences such as those described by Sharp, P.A., Science 235 (1987) 766-771. The branch site can, however, also be located in the murine part of the intron.
A promoter sequence is preferably also added to the 5' end of the recombinant DNA under the control of which the sequences coding for the antibody chains can be expressed. The promoters which naturally, i.e. as in the genome, exert control over the corresponding sequences of the recombinant DNA can e.g. be used for this.
However, preferably promoters are used which enable an increased, and if desired regulatable, expression. Such promoters are known to on~ skilled in the art. In a particularly preferred embodiment the recombinant DNA
has the promoter of the cytomegalo-virus.
In addition a further preferred embodiment of the invention is a recombinant DNA whose sequence a) codes for the variable region of the light or heavy chain of an antibody capable of specific binding to the interleukin 2 receptor. In addition the human sequence c) of the recombinant DNA according to the present invention coding for a heavy chain preferably codes for the constant region of the heavy chain of a human antibody of the IgG type.
Such recombinant DNAs are contained in the plasmids pKchim. and p ~chim. whereby the plasmid pKchim.
conta.ins a DN~ sequence coding for the light chain, i.e.
kappa chain and the plasmid p ~chim. carries a recombinant DNA coding for a heavy chain of the~ type which together code for an antibody of the IgG type whose specificity is directed against the alpha chain of the human interleukin 2 receptor.
The invention also provides an expression vector which contains one of the recombinant DNAs according to the present invention as well as all necessary elements for the expression of this recombinant DNA. The elements which are necessary for this or which are preferably used are promoters, regulatory sequences and suchlike.
Expression vectors are well-known to one skilled in the -~
art and are described for example in more detail by E.L.
Winnacker in "From Genes To Clones", 1987, Verlag Chemie, Weinheim. With the expression vectors accord~ng to the present invention it is possible to incorporate a recombinant DNA according to the present invention into suitable host cells and to express it there.
Particularly preferred expression vectors which contain recombinant DNA according to the present invention and which are also the subject matter of the invention are the already mentioned plasmids pKchim. and p ~chim.
The invention in addition provides a process for the production of a recombinant DNA according to the present invention in which polyA~ RNA is isolated from a hybridoma cell line secreting an antibody of the desired specificity, a cDNA library of this hybridoma cell line is prepared in suitable vectors and examined for clones which contain the cDNA for antibody chains by hybridization with oligonucleotides which are 7 ~ ~ r ~
complementary to the DNA coding for the constant part of the antibody, the V, J, and if desired D, sequences are isolated, a splice donor site, a part of an antibody intron sequence of non-human origin and a restriction cleavage site adjacent to the respective J domain in the direction oi transcription are introduced by site-directed mutagenesis and the DNA obtained is ligated with a genomic DNA sequence which codes for the constant region of the light or heavy chain of a human antibody and has a part of a corresponding human intron sequence at its 5' end.
The isolation of the polyA+ RNA, cDNA synthesis, as well as the establishment of a cDNA library are carried out according to known methods such as those described e.g.
in Maniatis et al., Molecular Cloning: a Laboratory Manual, 1982, Cold Spring Harbor. The selection of cDNA
clones coding for antibody chains is also carried out in a known manner, i.e. by examining for clones which hybridize with an oligonucleotide which is complementary to a DNA which codes for the constant region of an antibody which is derived from the same hybridoma cell species.
The site-directed mutagenesis for the introduction o a splice donor sita and a unique restriction enzyme cleavage site is also well-known and is carried out according to the method which was described by Morinaga et al., Bio/Technology 2 (1984) 636-639.
In a preferred embodiment of the invention a mouse or rat hybridoma cell is used. The establishment of hybridoma cells which secrete antibodies of the desired specificity is carried out according to the method which was first described by ~ohler and Milstein (Nature 2S6 ~3, ? ) ~ i, (1975), 495) and which was subsequently developed further. These techniques are very familiar to one skilled in the art. In the process according to the present invention it is particularly preferable to use a mouse hybridoma cell which secretes antibodies directed against the alpha chain of the human interleukin 2 receptor.
For the introduction of the non-human intron partial sequence, a 15 to 20 base pair sequence is preferably used. In this case it is particularl~ preferably to use the partial intron sequence which ~ollows in the authentic gene. In addition it is preferred to introduce the nucleotide sequence GT as splice donor site.
Finally it is preferred according to the present invention to use a human genomic DNA whose intron partial sequence contains a branch site.
In order to obtain a recombinant DNA which can be expressed well, a promoter sequence is preferably placed in front of the DNA sequence which is finally obtained or the manipulations which are necessary for the process according to the present invention are carried out from the beginning in a vector which contains a promoter in a suitable position. In this connection it is particularly preferable to use the promoter of the cytomegalo-virus genome.
In yet another preferred embodiment of the invention a human genomic DNA sequence which codes for the constant region of the light or heavy chain of an antibody of the IgG type is used for the construction of a recombinant DNA coding for a light or heavy chain.
2 J ~
The invention also provides a process for the construction of an expression vector according to the present invention in which a recombinant DNA according to the present invention is inserted into a suitable vector for the expression of a foreign gene. As already set forth above such vectors are known to one skilled in the art and contain all necessary components such as e.g. polylinker for inserting the recombinant DNA, antibiotic resistance genes in order to select colonies which contain the recombinant DNA, an origin of replication, regulatory elements, a promoter, if the recombinant DNA does not already have one, as well as, if desixed, further components such as e.g. suppressor genes for selection of colonies carrying plasmid DNA.
The invention in turn also provides a process for the production of a chimeric antibody whose variable regions are of non-human origin and whose constant regions are of human origin in which in this case one each of an expression vector which contains a recombinant DNA
according to the present invention which codes for the light chain and an expression vector which contains a recombinant DNA according to the present invention which codes for the heavy chain of the antibody are introduced into suitable host cells, stable transformants are isolated and the antibodies are isolated from the culture supernatant of the cells according to known methods. In this process a non-producer hybridoma cell is preferably used as the host cell, the cell line Sp2/0-Agl4 (ATCC CRL 8922) is particularly preferred. In the process according to the present invention it is preferable to carry out an electroporation (Nucl. Acids Res. 15 (1987), 1311-1326, ~io Techniques 6 (1988), 742-751) in order to introduce the vectors into the hos~
cells, if desired with linearized DNA molecules.
However, other processes known to one skilled in the art can also be used for the transfection of the host cells.
The process according to the present invention enables antibodies to be produced in a simple manner with a variety of specificities. These antibodies are not immunogenic or only very weakly immunogenic when applied therapeutically in humans since the constant regions are of human origin. Nowadays there are relatively simple methods to produce e.g. mouse hybridoma cells which se~rete antibodies of a desired specificity and to isolated cDNA from them, this cDNA can ba easily introduced into previously prepared vectors according to the process according to the present invention which each contain the genomic human part for the constant regions of the light or heavy chainO Thus it is possible to obtain chimeric antibodies of the desired specificity in each case by simple ligation of the desired cDNA
frag~ent into the appropriately prepared vectors and expression of recombinant DNA on both vectors in a host cell. The production of chimeric antibodies is not only much more simple than with the methods known hitherto but the yields are also greatly increased.
The invention therefore also provides the chimeric antibodies M~B 179, MAB 215 and MAB 447 whose sequences for the light and heavy chains are shown in the sequence protocols SEQ ID NO:1 to 6 (the sequences of the variable regions are shown~ the sequences of the constant regions are known and described e.g. in Sequences of proteins of immunological interest; E.
Kabat, T. Wu, M. Reid-Miller, H. Perry and K. Gottesman, US Department of ~ealth and Human Services, 1987, p.
282-325) and whose production is described in the examples. All three antibodies are specific for the alpha chain of the human IL 2 receptor.
The invention is elucidated further by the following examples in conjunction with the sequence protocols and figures.
EQ ID NO.:1 shows the DNA and amino acid sequence of the variable region as well as the beginning of the constant region of the light chain of MAB 179, EQ ID NO.:2 shows the DNA and amino acid sequence of the variable region as well as the beginning of the constant region of the light chain of MAB 447 EQ ID No.:3 shows the DNA and amino acid sequence of the variable region as well as the beginning of the constant region of the light chain of MAB 215, EQ ID NO.:4 to 6 show the sequences of the respective variable regions of their corresponding heavy chains;
ig. 1 shows diagrammatically the isolation of a murine cDNA fragment coding for the variable region of the light immunoglobulin chain and the procedure for the site-directed mutagenesis;
- 12 - ~7 J' '. . ~
ig. 2a shows the insertion of the variable murine region of the light immunoglobulin chain into an expression vector;
ig. 2b shows diagrammatically the assembly of the murine and human antibody coding sequences for the light chain;
ig. 3 and 4a as well as 4b show a diagram of the same process for the DNA of the heavy immunoglobulin chains.
x a m p l_e Cloninq and sequence analysis of the light and heavy chains of MABl79 447 and 215 RNA was prepared from the hybridoma lines which secrete the monoclonal antibodies 179, 447 or 215 (Cleary, et al.: Cell 44 (1986) 97-106~ and polyA+RNA was isolated from it (Maniatis, T., et al., Molecular Cloning: A
Laboratory Manual, (Cold Spring Harbor Lab., Cold Spring Harbor, NY, 1982) using an oligo-dT cellulose column (Collaborative Research, Bedford, MA). A cDNA library was constructed for each hybridoma cell line with a cDNA
cloning kit from Pharmacia according to the instructions of the manufacturer (analogous to Gubler, U. and Hoffman, G.J.: Gene (1983) 25, 263). This cDNA library comprised about 10000 recombinants for each hybridoma line.
The following primer was use~ to screen for clones of the kappa chain:
5'CCCGACTACGACGT3' The following primer was used to screen for clones ofthe ~ chain (~1 and ~b):
5'CAGATAGGTGACCGG3' All the heavy chains of mouse immunoglobulin genes are detected with this prlmer tSablitzky, F. and Rajewski, K.: EMB0 J. 3 (19~4) 3005-3012).
The cDNA library was established in the vector pT7T318U
(Pharmacia). By this means it was possible to regain the insertions as EcoRI fragments. By analysis with restriction endonucleases it was found that clones of complete length were obtained for the heavy and light chains of MAB179, 447 and 215. The relevant regions were subcloned in M13 vectors and sequenced ~Sanger, F., et al.: Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467).
The sequences of the variable regions are shown in the sequence protocols SEQ ID NO:l to NO:6. In this case it can be seen that MAB179 and 447 use the same VL and VH
segments for the light and the heavy chains.
Both kappa chains use the Jl region and have identical nucleotides at the VJ junctions which indicates that the VJ region of both kappa genes has the same origin. Both ~1 chains have the same D region, the same J region (JH3) and an identical VDJ recombination from which it can be deduced that both VDJ regions of the ~1 genes have the same origin.
The comparison of the amino acid sequences of the light chains shows 3 amino acid substitutions in the V regions of the kappa cDNA of MAB179 and MAB447. The substitutions are as follows:(Ser to Thr, amino acid 20), (Arg to Lys, amino acid 45), (Lys to Asn, amino acid 53).
Thus, 98 ~ of the amino acids of the VJ region of MAB179 and 447 are identical.
There are 6 amino acid substitutions in the V regions of the ~1 cDNA of MA~179 and M~B447. The substitutions are as follows: (Val to Ala, amino acid 23; Gly to Ser, amino acid 56; Ile to Val, amino acid 58; Thr to Arg, amino acid 63; Lys to Arg, amino acid 65; Gln to Glu, amino acid 82).
Thus, 94 % of the amino acids of the VJ regions of MAB179 and 447 are identical.
The data suggest that the differences in the amino acid sequences of MAB179 and MAB447 are due to somatic mutations.
The initiation codon (Met) = start of the signal sequence is shown in the sequence protocols for kappa and ~1 cDNA of MAB179 and 447. The J or DJ regions are also shown as well as the beginning of each of the constant regions.
The sequences of the variable regions for the kappa and the ~2b chain of the non-inhibitory (with respect to IL 2 binding) antibody MAB215 are shown in SEQ ID NO:3 and NO:6.
The J4 region is used for the kappa chain. A V segment is used which greatly differs from that of the light chains of MAB179 and 447, since only 51 ~ of the amino acids are identical compared to the V segment of 179~
The sequence of the ~2b chain is shown in SEQ ID NO:6.
A V segment is used which clearly differs from that of the heavy chain of the clones MAB179 and MAB447. The D
region (comprising seven amino acids) as well as the J
region (JH3) and the beginning of the constant region are shown. Only 57 % of amino acids are identical compared to the V segment of the heavy chain of the clone MAB179.
Example 2:
Chimeri~atlon of the l~ chain of MAB179 and construction of an expression vector for the chimerized li~ht chain a) Introduction of splice donor, intron and NotI
- sequences downstream of the VJl region of the kappa -chain of MAB179 (Fig. 1).
The cDNA for the light chain of the murine MAB 179 was subcloned into pUC18 (Yanisch-P~erron, C., et al.: Gene 33 (1985) 103-109) as an EcoRI-HpaI
fragment giving rise to plasmid pUCk. According to Fig. 1, the fragment may then be cut out from this vector as an EcoRI-BamHI fragment, using a BamHI
site in the pUC18 polylinker. An Eco-RI-NotI
fragment which can be cloned (and is portable) via EcoRI and NotI ends is produced by mutagenesis.
This fragment contains the VJl region and is followed by 20 nucleotide intron sequences starting with the splice donor sequence GT of the genomic J1 segment of the mouse kappa chain (Max, E.E., et al., J. Biol. Chem. 256 (1981) 5116-5220) and a recognition sequence (GCGGCCGC) for the restriction endonuclease NotI. The mutagenesis procedure (see above) is carried out according to Morinaga, et al.
(Bio/Technology 2 (1984) 636-639).
- 16 ~
Sequence of the oligonucleotide used for mutagenesis:
splice donor sequence L/ .
5'GCA~TC~AAC ~ AAGTAGAATCCAAAGTCT GCGGCCGC GGGCTGATGCT 3' J~ Jl intron NotI mouse kappa constant region Two fragments were isolated from pUCk for the heteroduplex formation.
Fragment A: pUCk was cleaved with the restriction enzymes EcoRI and BamHI, both fragments were separated by agarose gel-electrophoresis and the large EcoRI-BamHI fragment was isolated from the gel. This fragment contains no mouse kappa sequences.
Fragment B: pUCk was treated with NaeI (unique cleavage site in the pUC part), the 5' phosphate residues were removed by treatment with alkaline phosphatase and subsequently the fragment was purified twice on a 0~7 % agarose gel.
Fragment A, fragment B (500 fmol each) and the oligonucleotide ~80 fmol) were mixed for heteroduplex formation and incubated at lOO~C for three minutes with 50 mmol/l NaCl, 10 mmol/l Tris-HCl, pH 7.5/ 10 mmol/l MgSO4 and subsequently transferred onto ice. Afterwards the DNA was renatured (20 min at 60C). For the repair r ~ 17 --synthesis the reaction mixture was adiusted to:
deoxynucleoside triphosphate (0.25 mmol/l), ATP
(1 mmol/l), NaCl (100 mmol/l), Tris-HCl pH 7.5 (6.5 mmoltl), MgC12 (8 mmol/l), ~-mercaptoethanol (1 mmol/l), Xlenow fragment of the DNA polymerase from E. coli (0.125 U/~l preparation) and T4 ligase (0.1 U/~1 preparation) and incubated at 16C for 4 hours. Afterwards E. coli HB101 was transformed with the reaction mixture and colonies were selected on agar plates containing ampicillin (50 ~g/ml). Those colonies in whose plasmid DNA the above mentioned oligonucleotide was incorporated could be identified with the aid of the colony hybridization technique (Maniatis et al~: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 1982). The characterization was first carried out by analysis with restriction endonucleases. Subsequently the desired change in the sequence was confirmed by sequencing (Sanger, F., et al.: Proc. Natl. Acad.
Sci. USA 74 (1977) 5463-5467).
b) Construction of an expression vector for the chimerized kappa chain of MAB179 (Fig. 2a and 2b).
pcDNA1 (Invitrogen, San Diego; Aruffo, A. and Seed, B. (1987) Proc. Natl. Acad. Sci. USA 84 8573-8577) served as the starting plasmidO It contains the promoter of the human cytomegalo-virus, promoters of the phages T7 and SP6, a polylinker, splice and polyadenylation sequences from SV40, a supF tRNA
for the selection as well as 1'origins of replication" from M13, ColE1, SV40 and polyoma. For cloning reasons the Nd~I site shown is converted into a PvuI site (= pcDNA1-PvuI) by ligation of a corresponding linker. The latter plasmid was cleaved with EcoRI and NotI in the polylinker and the EcoRX-NotI fragment of the DNA obtained according to (a) (ca 400 bp) containing the VJ1 region and intron sequences of ~Bl79 kappa was ligated into the vector. The ligation mixture was transfected into the E. coli strain MC1061/P3 (Aruffo, A. and Seed, B.: Proc. Natl. Acad. Sci.
USA 84 (1987) 8573-8577); Seed, B.: Nucl. Acids Res. 11 (1983) 2327-2445) and ampicillin-resistant colonies were isolated on agar plates. The plasmid formed is denoted pcDN~c. pcDNAk was then cleaved with PvuI and NotI and the shorter fragment was isolated on a low-melting agarose gel.
The plasmid plO195 (constructed according to EP-A O 378 175,July 18, l990; Kaluza e~ al.) was also cleaved with NotI and PvuI and the larger fragment (Fig. 2b) was isolated on a low-melting agarose gel. plOl95 contains intron sequences of the mouse for the kappa chain as well as coding and non-coding re~ions of the constant human kappa region.
Both the fragments of pcDNAk and plO195 were ligated with T4 ligase, transfected into MC1061/P3 and ampicillin-resistant colonies were isolated.
The plasmid formed is denoted pKchim. The hybrid gene (VJ1 mouse Ckappa-human) is expressed under the control of the human CMV promoter (c~tomegalo-virus)~ An expression cassette for the phosphotransferase neo (inserted into pKchim. from plO195) allows selection of G418 resistant colonies after transfection into mammalian cells (Southern, P. and Berg, P.: J. Mol. Appl. Genet. 1 (1982) 327-341).
1 9 ~
Example 3 Chimerization of the heavy chain of MAB179 and construction of an expression vector for the chimerized heavy chain.
a) Introduction of splice donor, intron and NotI
sequences into the VDJ3 region of the ~1 chain of MAB179 (Fig. 3).
The cDNA for the ~1 chain (5' untranslated region and coding region upstream of the BamHI site in the constant region) was subcloned as an EcoRI-Bam~I
fragment into pUC18 = plasmid pUC~1 (Yanisch-Perron, C., et al.~ Gene 33 (1985) 103-109).
A portable EcoRI-NotI fragment is prepared by mutagenesis which contains the VDJ3 region of the mouse ~1 chain followed by 20 nucleotide intron sequences starting with the splice donor sequence GT of the genomic J3 segment of the mouse ~1 chain (Sa~ano, et al., Nature 286 (1980) 676-682). This is followed by a recognition sequence (GCGGCCGC) for the restriction endonuclease NotI. The mutagenesis was carried out according to Morinaga et al. (Bio/Technology 2 (1984) 536-639). The sequence of the oligonucleotide used for mutagenesis:
splice donor sequence 5' GTCTCTGCAG GTGAGTCCTAACTTCTCCCA GCGGCCGC TGCCTGGTCA 3' J3 J3 intron NotI mouse ~1 constant region Two frayments were isolated from pUC~1 for heteroduplex formation.
Fragment C: pUC~1 was cleaved with the restriction enzymes EcoRI and BamHI, the two fraqments were separated by gel electrophoresis (1 % agarose gel) and the large EcoRI-BamHI fragment was isolated from the gel. This fragment contains no mouse ~1 sequences.
Fragment D: pUC~1 was cleaved with NaeI (unique cleavage site in the pUC part), the 5' phosphate residues were removed by treatment with alkaline phosphatase and subsequently the fragment was purified twice on a 0.7 % agarose gel. After mixing the fragments C and D (500 fmol each) and the oligonucleotide (80 fmol), the mutagenesis was carried out as described in Example 2. Those colonies in whose plasmid DNA the oligonucleotide described above was incorporated could be ;dentified with the aid of the colony h~bridization technique (Maniatis, et al: Molecular Cloning. A
Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring ~arbor, NY 1982). The characterization was first carried out with restriction endonucleases. Subsequently the desired change in the sequence was confirmed by sequencing (Sanger, ~ ~ ~ ' C~ ~ ' ,? ':>
F., et al.: Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467). Fig. 3 shows diagrammatically the isolation of the desired EcoRI-NotI fragment.
b) Construction of the expression vector for the chimerized ~1 chain of MAB179 tFig. 4a and 4b). The unique NdeI site in the vector pcDNAl (Invitrogen, San Diego; Aruffo, A. and Seed, B. (19~7) Proc.
Natl. Acad. Sci. USA 84, 8573-8577) was converted into a PvuI site by insertion of a corresponding linker. The plasmid which formed is denoted pcDNA1-PvuI.
pcDNAl~PvuI cleaved with EcoRI and NotI and the EcoRI-NotI fragment of pUC~1 Mut (with VDJ3 and intron sequences of ~1) described in Fig. 3 were linked by ligation. The plasmid formed is designated pcDNA~1.
The plasmid pll201 (constructed according to EP-A 0 378 175) is cleaved with NotI and BamHI, the protruding ends filled in with Klenow, ligated with NotI linkers, cleaved again with NotI and the fragment shown in Fig. 4b is isolated on a low-melting agarose gel. This fragment contains intron sequences of the heavy chains of the mouse, intron sequences of the human heavy chains as well as the genomic equivalent of the constant region of the human ~1 gene. This fragment was ligated into the unique NotI site of the vector pcDNA~1. Tha correct orientation was determined by cleavage with restriction endonucleases. The expression vector which formed for the chimerized ~1 chain of MAB179 is denoted p ~chim. Chimerized chains of other isotypes (such as e.g. ~, ~2, ~3, ~4, ~ 2,~ , ~) ~ 'J , ~ . i ,, ~' ,C 13 can also be constructed according to this principle.
Examele 4:
Establishment of permanent cell lines of non-producer hybrid_ma lines by electroporation wlth expression plasmids for the chimerized chains of MAB179.
The plasmids pKchim. and p~1 chim. were mixed in equal amounts and transfected by electroporation into the immunoglobulin non-producer hybridoma line Sp2/0-Agl4 (ATCC CRL 8923) (Ochi, A., et al., Proc. Natl. Acad.
Sci. USA 80 (1983) 6351-6355). All other non-immunoglobulin-producer hybridoma cell lines such as e.g. P3X63-Ag8.653 (ATCC CRL 8375) are also suitable.
Both plasmids were linearized with the restriction endonuclease PvuI before transfection. The electroporation was carried out as described in Nucleic Acids Res. 15 (1987) 1311-1326 or Bio Techniques 6 tl988) 742-751. After centrifugation, the cells were washed with cold HeBS buffer (20 mmol/l HEPES, pH 7.05, 137 mmol/l NaCl, 5 mmol/l KCl, 0.7 mmol/l Na2HPO4, 6 mmol/l dextrose), resuspended with HeBS buffer, adjusted to a concentration of 106 cells/ml and placed on ice. After the addition of plasmid the cells were pulsed (conditions: capacity 500 ~F and voltage range between 240 and 280 V, or 200 to 240 V at 160 ~F). After pulsing, the cells were kept on ice for about 10 minutes and subsequently incubated at 37C in medium I (RPMI
1640, 10 % foetal calf serum, 2 mmol/l glutamine, 1 mmol/l sodium pyruvate, 0.1 mmol/l non-essential amino acids). The medium was changed 30 h after the transfection and incubated with medium I + 800 ~g/ml ~418 after plating 103 cells per well in 96 well microtitre plates. 10 microtitre plates (96 wells each) were prepared. 7~10 days after plating, G418 resistant colonies could be identified in the wells. Their culture supernatants were tested for reconstituted cnimerized MAB179 as described in the following example. The best producers were propagated in mass culture in medium I.
Example 5 Detection of reconstituted antibodies aqainst the human IL-2 receptor Firstly a microtitre plate is coated with polyclonal antibodies against human Fc~. For this the wells of a microtitre plate are incubated overnight at 4C or for 1 hour at room temperature with 200 ~l corresponding to 2.5 ~g of a polyclonal antibody against human Fc~(IgG) in 0.2 mol/l carbonate/bicarbonate, pH 9.5. After aspirating the wells they were incubated for 30 min to 1 h at room temperature with 300 ~l 50 mmol/l HEPE~, 0.15 mol/l NaCl/1 % Crotein C, pH 7Ø Subsequently 200 ~l calibration sample or culture supernatant of transfected cells was added and incubated for 1 h at room temperature while shaking (500 rpm) or for 90 min at room temperature without shaking. The calibration curve was established with a model chimeric antibody (produced by chemically cross-linking a human IgG MAB
and Fab fragments of MAB173). After aspirating the wells they were each washed twice with 300 ~l IB = incubation buffer (50 mmol/l HEPES, pH 7.0, 0.15 mol/l NaCl, 0.2 mol/l di-sodium tartrate, 1 % Crotein C, 0.75 % PEG
40000 (Serva), 0.5 % Pluronic F68*(Boehringer Mannheim), 0.01 % phenol). Afterwards 200 ~l of a solution of IL-2 receptor-POD-antibody conjugate complex was added (as described below) and incubated for 1 h at room temperature while shaking (500 rpm) or for 90 min at room temperature without shaking. The preformed complex * trade mark consists of soluble interleukin 2 receptor and POD-labelled Fab fragments of the IL-2 receptor MAB215.
Formation of the complex solution: 20 ~1 of the POD-labelled Fab fragments of MAB 215 (150 U/ml) + 19.5 ml incubation buffer (IB) (see above) + 3 ml soluble IL-2 receptor standard (6400 U/ml; units defined via standard of T-cell Sciences). The soluble IL-2 receptor was obtained from culture supernatants of a recombinant mouse fibroblast cell line d~scribed by Shimizu et al.
(Mol. Biol. Med. 3 (1986) 509-520).
After carrying out the incubation the wells were rinsed three times with the wash buffer described above and subsequently the POD activity was determined with ABTS
solution [2,2'-azino-di-3-ethylbenzthiazoline-sulphonate] + H2O2 after incubating for 45-60 min at room temperature by reading the absorbance at 405 nm in an ELISA reader. Clones with high expression (up to 10 ~g/ml) were determined using this method.
-- 2 5 ~ s i SEQ ID NO: 1 (light chain clone 179) TYPE OF SEQUENCE: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 432 base pairs HARACTERISTICS: aa -20 (Met): start of the signal sequence aa 1 (Asp): beginning of the V region from aa 96 (Arg) to aa 107 (Lys): ~1 region fro~ aa 108 (Arg): beginning of the C region ATG ATG GTC CTT GCT CAG TTT CTT GCA TTC TTG TTG CTT TGG TTT CC~ 48 rlet tlet Val Leu Ala Gln Phe I,eu Ala Phe Leu Leu Leu Tr~ Phe Pro Gly Ala Arg Cys Asp Ile Leu Met Thr Gln Ser Pro Ser Ser Met Ser Val Ser Leu Gly Asp Thr Val Ser Ile Thr Cys His Ala Ser Gln Gly Ile Arg Ser Asn Ile Val Trp Leu Gln Gln Lys Pro Gly Lys Ser Phe ~0 Arg Gly Leu Ile Tyr His Gly Thr Lys Leu Glu Asp Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Ala Asp Tyr Ser Leu Thr Ile Ser AGC CTG GAA TCT GAA GAT TTT GCA GAC l`AT TAT TGT GTA CAG TAT GCT 336 Ser Leu Glu Ser Glu Asp Phe Ala Asp Tyr Tyr Cys Val Gln Tyr Ala go Gln Phe Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln - 26 ,f, ~ -SE~ ID NO: 2 (light chain clone 447) TYPE OF SEQUENC~: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 432 base pairs HARACTERISTICS: aa -20 (Met): start of the signal sequence aa 1 (Asp): beginning of the V region from aa 96 (Arg) to aa 107 (Lys): Jl region from aa 108 (Arg): beginning of the C region ~let Met Val Leu Ala Gln Phe Leu Ala Phe Leu Leu Leu Trp Phe Pro Gly Ala Arg Cys Asp Ile Leu Met Thr Gln Ser Pro Ser Ser Met Ser GTT TCT CTG GGA G~C ACA GTC ACC ATC ACT TGC CAT GCA AGT CAG GGC 144 'Jal Ser Leu Gly Asp Thr Val Thr Ile Thr Cys His Ala Ser Gln Gly Ile Arg Ser Asn Ile Val Trp Leu Gln Gln Lys Pro Gly Lys Ser Phe Lys Gly Leu Ile Tyr His Gly Thr Asn Leu Glu Asp Gly Val Pro Ser CGG TTC AGT GGC AGT GG~ TCT GGA GCA G~T TAT TCT CTC ACC ~TC AGC 288 Arg Phe Ser G~y Ser Gly Ser Gly Ala Ase ~yr Ser Le~ ~hr ~1e Ser Ser Leu Glu Ser Glu Asp Phe Ala Asp Tyr Tyr Cys Val Gln Tyr Ala Gln Phe Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg GCT GAT GCT GC~ CCA ACT GTA TCC ATC TTC CCA CCA TCC AGT GAG CAG ~32 Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln ~ ; c. ,-j.
SEQ ID NO: 3 (light chain clone 215) TYPE OF SEQUENC2: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 435 ~ase pairs HARACTERISTICS: aa -22 (Met): start of the signal seq~ence aa 1 (Lys): beginning of the V region from aa 95 (Phe) to aa 106 (Lys): J4 region from aa 107 (Arg): beginning of the C region ~2et Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser Val Ile Met Ser Arg Gly Lys Ile Val Leu Ser Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Ile Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Gln Ala Thr Ser Asn Leu Ala Phe Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp go AGT AGT AAC CCA TTC ACG TTC GGC TCG GGG AC~ AAG TTG GAA ATG AAA 384 Ser Ser Asn Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Met Lys Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu 110 llS 120 Gln 2 8 -~ r SEQ ID NO: 4 (heavy chain clone 179) TYPE OF SEQUENC~: Nucleotide with corresponding prctein LENGTH OF SEQUENCE: 531 base pairs CHARACTERISTICS: aa -19 (Met): start of the signal sequence aa 1 (Asp): ~eginning of the V region fro~ aa 99 (Asp) to aa 102 (Asn): D region from aa 103 (Trp) to aa 113 (Ala): J3 region fro~ aa 114 (Ala): beginninq of the C region ATG GAC TCC AGG CTC AAT TTA GTT TTC CTT GTC CTT ATT TTA ~AA GGT 48 ~let Asp Ser Arg Leu Asn Leu Val Phe Leu Val Leu Ile Leu Lvs Gly Val Gln Cys Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln CC~ GGA GGG TCC CGG AAA CTC TCC TGT GTT GCC TCT GGA TTC ACT TTC 194 Pro Gly Gly Ser Ar~ Lys Leu Ser Cys Val Ala Ser Gly Phe Thr Phe Ser Thr Phe Gly Met His Trp Val Arg Gln Ala Pro Glu Lys Gly Leu Glu Trp Val Ala Tyr Ile Ser Ser Gly Ser Gly Thr Ile Tyr Tyr Ala Asp Thr Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Pro Lys Asn Thr Leu Phe Leu Gln Met Thr Ser Leu Arg Ser Glu Asp Thr Ala Met 8~ go Tyr Tyr Cys Ala Arg Asp Trp Met Asn Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr Yro Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu GTC AAG GGC TAT TTC CCT GAG CCA GTG ACA GTG ACC TGG AAC TCT GG~ 528 Val ~ys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser 2 9 ~ ~ r SEQ ID NO: 5 (heavy chain clone 447) TYPE OF SEQUENCE: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 531 base pairs HARACTERISTICS: aa -19 (Met): start of the signal sequence aa 1 (Asp): beginning of the V region from aa 99 (Asp) to aa 102 (Asn): D region fro~ aa 103 (Trp) to aa 113 (Thr): J3 region from aa 114 (Ala): beginning of the C region ~let Asp Ser Arg Leu Asn Leu Val Phe Leu Val Leu Ile Leu Lys Gly Val Gln Cys Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln CCT GG~ GGG TCC CGG AAA CTC TCC TGT GCA GCC TCT GGA TTC ACT TTC 144 Pro Gly Gly Ser Arg Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe lS 20 25 AGT ACC TTT GGA ATG CAC TGG GTT CGT CAG GCT CCA G~G AAG GGG CTG 192 Ser Thr Phe Gly Met His Trp Val Arg Gln Ala Pro Glu Lys Gly Leu Glu Trp Val Ala Tyr Ile Ser Ser Gly Ser Ser Thr Val Tyr Tyr Ala GAC AGA GTG AGG GGC CGA TTC ACC ATC TCC AGA GAC AAT CCC AAG ~AC 288 Asp Arg Val Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Pro Lys Asn 7;
Thr Leu Phe Leu Glu Met Thr Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys Ala Arg Asp Trp Met Asn Trp Gly Gln Gly Thr Leu Val Thr Val Ser Thr Ala Lys Thr Thr Pro Pro Ser Val Tyx Pro Leu Ala CCT GGA TCT GCT GCC CAA ACT AAC TCC ATG GTG ACC CTG GG~ TGC CTG 480 Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu GTC AAG GGC TAT TTC CCT GAG CCA GTG ACA GTG ACC TGG AAC TCT GG~ 528 Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser - 30 - ~ i3 ~EQ ID NO: 6 ~heavy chain clone 215) TYPE OF SEQUENCE: Nucleotide with corresponding protein LENGTH OF SEQUENCE: 549 base pairs CHARACTERISTICS: aa -19 (Met): start of the signal sequence aa 1 (Gln): beginning of the V reqion -from aa 98 (Thr) to aa 104 (Ser): D region from aa 105 (Trp): to aa 119 (Ala): J3 region from aa 120 (Ala): beginning of the C reqion ~TG GCT GTG CTG GGG CTG CTT CTC TGC CTG GTG ~CT TTC CCA AGC TGT 48 ,let Ala Val Leu Gly Leu Leu Leu Cys Leu Val Thr Phe Pro Ser Cys -15 -lQ -5 Val Pro Ser Gln Val Gln Leu Lys Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu lS 20 25 Ser Thr Tyr Ser Val Tyr Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Ser Asp Gly Ser Thr Thr Tyr Asn Ser ACT CTC AAA TCC AGA CTG ACC ATC AGC AAG GAC ~AC TCC AAG AGT CAA 288 Thr Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Asn Ser Lys Ser Gln GTT TTC TTA AAA GTG AAC AGT CTC CAA ACT G~T GAC ACA GCC ATG TAC 336 Val Phe Leu Lys Val Asn Ser Leu Gln Thr Asp A5p Thr Ala Met Tyr Tyr Cys Ala Arg Thr Tyr Gly Tyr Asp Gly Ser Trp Leu Ala Tyr Trp lQ0 105 GGC CAA GGG ACT CTG GTC ACT GTC TCT GC~ GCC AAA ACA ACA CCC CCA 432 Gly Gln Gly Thr Leu Val Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Cys Gly Asp Thr Thr Gly Ser Ser Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Ser Val Thr Val Thr Trp Asn Ser Gly Ser
Claims (54)
1. Recombinant DNA which codes for the light or heavy chain of an antibody whose constant regions are of human origin and whose variable regions are of non-human origin, wherein said DNA contains in the direction of transcription (a) a cDNA sequence which codes for the variable, non-human region, including one of region J
or region J and region D
(b) an intron sequence which has a splice donor site at its 5' end and is composed of a non-human intron partial sequence at the 5' end and a human intron partial sequence a the 3' end and (c) a genomic DNA sequence coding for the human constant region.
or region J and region D
(b) an intron sequence which has a splice donor site at its 5' end and is composed of a non-human intron partial sequence at the 5' end and a human intron partial sequence a the 3' end and (c) a genomic DNA sequence coding for the human constant region.
2. Recombinant DNA as claimed in claim 1, wherein the sequence (a) and the non-human intron partial sequence of (b) are of murine origin.
3. Recombinant DNA as claimed in claim 1, wherein the non-human intron partial sequence of (b) corresponds to the intron sequence which naturally follows the sequence (a).
4. Recombinant DNA as claimed in claim 2, wherein the non-human intron partial sequence of (b) corresponds to the intron sequence which naturally follows the sequence (a).
5. Recombinant DNA as claimed in claim 1, wherein the non-human intron partial sequence of (b) is 15 to 20 base pairs long.
6. Recombinant DNA as claimed in claim 2, wherein the non-human intron partial sequence of (b) is 15 to 20 base pairs long.
7. Recombinant DNA as claimed in claim 1, 2, 3, 4, 5 or 6, wherein the splice donor site in (b) has the sequence 5'-GT-3'.
8. Recombinant DNA as claimed in claim 1, 2, 3, 4, 5 or 6, wherein the human intron partial sequence of (b) has a branch site.
9. Recombinant DNA as claimed in claim 7, wherein the human intron partial sequence of (b) has a branch site.
10. Recombinant DNA as claimed in claim 1, 2, 3, 4, 5, 6 or 9, wherein it has in addition a promoter under the control of which the sequences coding for the antibody chains can be expressed.
11. Recombinant DNA as claimed in claim 7, wherein it has in addition a promoter under the control of which the sequences coding for the antibody chains can be expressed.
12. Recombinant DNA as claimed in claim 8, wherein it has in addition a promoter under the control of which the sequences coding for the antibody chains can be expressed.
13. Recombinant DNA as claimed in claim 10, wherein it has the promoter of cytomegalo-virus.
14. Recombinant DNA as claimed in claim 11, wherein it has the promoter of cytomegalo-virus.
15. Recombinant DNA as claimed in claim 12, wherein it has the promoter of cytomegalo-virus.
16. Recombinant DNA as claimed in claim 1, 2, 3, 4, 5, 6, 9, 11, 12, 13, 14, or 15, wherein the sequence (a) codes for the variable region of the light or heavy chain of an antibody which is capable of specifically binding to human interleukin 2 receptor.
17. Recombinant DNA as claimed in claim 7, wherein the sequence (a) codes for the variable region of the light or heavy chain of an antibody which is capable of specifically binding to human interleukin 2 raceptor.
18. Recombinant DNA as claimed in claim 8, wherein the sequence (a) codes for the variable region of the light or heavy chain of an antibody which is capable of specifically binding to human interleukin 2 receptor.
19. Recombinant DNA as claimed in claim 10, wherein the sequence (a) codes for the variable region of the light or heavy chain of an antibody which is capable of specifically binding to human interleukin 2 receptor.
20. Recombinant DNA as claimed in claim 1, 2, 3, 4, 5, 6, 9, 11, 12, 13, 14, 15, 17, 18 or 19, wherein the sequence (c) codes for the constant region of the light or heavy chain of a human antibody of IgG type.
21. Recombinant DNA as claimed in claim 7, wherein the sequence (c) codes for the constant region of the light or heavy chain of a human antibody of IgG type.
22. Recombinant DNA as claimed in clairn 8, wherein the sequence (c) codes for the constant region of the light or heavy chain of a human antibody of IgG type.
23. Recombinant DNA as claimed in claim 10, wherein the sequence (c) codes for the constant region of the light or heavy chain of a human antibody of IgG type.
24. Recombinant DNA as claimed in claim 16, wherein the sequence (c) codes for the constant region of the light or heavy chain of a human antibody of IgG type.
25. Expression vector containing a recombinant DNA as claimed in claim 1, 2, 3, 4, 5, 6, 9, 11, 12, 13, 14, 15, 17, 18, 19, 21, 22, 23 or 24.
26. Expression vector containing a recombinant DNA as claimed in claim 7.
27. Expression vector containing a recombinant DNA as claimed in claim 8.
28. Expression vector containing a recombinant DNA as claimed in claim 10.
29. Expression vector containing a recombinant DNA as clalmed in claim 16.
30. Expression vector containing a recombinant DNA as claimed in claim 20.
31. Plasmid pK chim.
32. Plasmid p.gamma. chim.
33. Process for the production of a recombinant DNA as claimed in claim 1, wherein:
(a) polyA+-RNA is isolated from a hybridoma cell line secreting an antibody of desired specificity, (b) a cDNA library of said hybridoma cell line is prepared in vectors and examined for clones which contain a cDNA for antibody chains by hybridization with oligonucleotides which are complementary to the DNA coding for the constant region of the antibody, V, J, or V, J and D, (c) sequences are isolated, (d) a splice donor site, a part of an antibody intron sequence of non-human origin and a restriction cleavage site adjacent to the respective J region, in the direction of transcription are introduced by site-directed mutagenesis, and (e) the DNA obtained is ligated with a genomic DNA sequence which codes for the constant region of the light or heavy chain of a human antibody and has part of a corresponding human intron sequence at its 5' end.
(a) polyA+-RNA is isolated from a hybridoma cell line secreting an antibody of desired specificity, (b) a cDNA library of said hybridoma cell line is prepared in vectors and examined for clones which contain a cDNA for antibody chains by hybridization with oligonucleotides which are complementary to the DNA coding for the constant region of the antibody, V, J, or V, J and D, (c) sequences are isolated, (d) a splice donor site, a part of an antibody intron sequence of non-human origin and a restriction cleavage site adjacent to the respective J region, in the direction of transcription are introduced by site-directed mutagenesis, and (e) the DNA obtained is ligated with a genomic DNA sequence which codes for the constant region of the light or heavy chain of a human antibody and has part of a corresponding human intron sequence at its 5' end.
34. Process as claimed in claim 33, wherein a mouse or rat hybridoma cell line is used.
35. Process as claimed in claim 34, wherein a mouse hybridoma cell is used which secretes anti-bodies directed against human interleukin 2 receptor.
36. Process as claimed in claim 33, wherein a 15 to 20 bp long antibody intron sequence of non-human origin is introduced.
37. Process as claimed in claim 33, wherein a part of an authentic adjacent intron of the genomic DNA sequence of non-human origin is introduced.
38. Process as claimed in claim 33, wherein a nucleotide sequence GT is introduced as the splice donor site.
39. Process as claimed in claim 33, wherein a human intron DNA with a branch-site is used.
40. Process as claimed in claim 33, wherein a promoter sequence is added to the 5' end of the DNA
sequence which is finally obtained, or manipulation is carried out in a vector which contains a promoter.
sequence which is finally obtained, or manipulation is carried out in a vector which contains a promoter.
41. Process as claimed in claim 40, wherein said promoter is a cytomegalo-virus genome promoter.
42. Process as claimed in claim 33, wherein a human genomic DNA sequence is used which codes for the constant region of the light or heavy chain of an antibody of IgG type.
43. Process for producing an expression vector, wherein a recombinant DNA as claimed in claim 1, 2, 3, 4, 5, 6, 9, 11, 12, 13, 14, 15, 17, 18, 19, 21, 22, 23 or 24, or produced as claimed in claim 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42, is inserted into a vector, with said vector permitting expression of a foreign gene.
44. Process for producing a chimeric antibody whose variable regions are of non-human ori.gin and whose constant regions are of human origin, wherein one each of an expression vector which contains a recombinant DNA as claimed in claim 1, 2, 3, 4, 5, 6, 9, 11, 12, 13, 14, 15, 17, 18, 19, 21, 22, 23 or 24, or which is produced as claimed in claim 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42, that codes for the light chain and an expression vector which contains a recombinant DNA as claimed in claim 1, 2, 3, 4, 5, 6, 9, 11, 12, 13, 14, 15, 17, 18, 19, 21, 22, 23 or 24, or which is produced as claimed in claim 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42, that codes for the heavy chain of the antibody, are introduced into a host cell, stable transformants are isolated and the antibody is isolated from a culture supernatant of said transformants.
45. Process for producing a chimeric antibody as claimed in claim 44, wherein said host cell is a non-producer hybridoma cell.
46. Process as claimed in claim 44, wherein said host cell is cell line Sp2/0-Ag14 (ATCC CRL 8922).
47. Process as claimed in claim 44, wherein vectors pK chim. and p.gamma. chim. are introduced into said host cell.
48. Process as claimed in claim 45 or 46, wherein vectors pK chim. and p.gamma. chim. are introduced into said host cell.
49. Process as claimed in claim 44, wherein the vectors are transfected by electroporation.
50. Process as claimed in claim 45, 46 or 47, wherein the vectors are transfected by electroporation.
51. Process as claimed in claim 48, wherein the vectors are transfected by electroporation.
52. Chimeric antibody MAB 179.
53. Chimeric antibody MAB 215.
54. Chimeric antibody MAB 447.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DEP4018442.0 | 1990-06-08 | ||
| DE4018442A DE4018442A1 (en) | 1990-06-08 | 1990-06-08 | RECOMBINANT DNA AND METHOD FOR PRODUCING CHIMERIC ANTIBODIES |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2043516A1 true CA2043516A1 (en) | 1991-12-09 |
Family
ID=6408075
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002043516A Abandoned CA2043516A1 (en) | 1990-06-08 | 1991-05-29 | Recombinant dna and process for the production of chimeric antibodies |
Country Status (15)
| Country | Link |
|---|---|
| EP (1) | EP0460674A3 (en) |
| JP (1) | JPH04330286A (en) |
| KR (1) | KR920000922A (en) |
| AU (1) | AU629752B2 (en) |
| CA (1) | CA2043516A1 (en) |
| CS (1) | CS175691A3 (en) |
| DE (1) | DE4018442A1 (en) |
| FI (1) | FI912763A (en) |
| HU (1) | HUT58795A (en) |
| IE (1) | IE911808A1 (en) |
| IL (1) | IL98403A0 (en) |
| NO (1) | NO912192L (en) |
| NZ (1) | NZ238383A (en) |
| PT (1) | PT97916A (en) |
| ZA (1) | ZA914363B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5709860A (en) * | 1991-07-25 | 1998-01-20 | Idec Pharmaceuticals Corporation | Induction of cytotoxic T-lymphocyte responses |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0173494A3 (en) * | 1984-08-27 | 1987-11-25 | The Board Of Trustees Of The Leland Stanford Junior University | Chimeric receptors by dna splicing and expression |
| KR900700134A (en) * | 1988-04-15 | 1990-08-11 | 원본미기재 | IL-2 Receptor-Specific Chimeric Antibodies |
-
1990
- 1990-06-08 DE DE4018442A patent/DE4018442A1/en not_active Withdrawn
-
1991
- 1991-05-27 IE IE180891A patent/IE911808A1/en unknown
- 1991-05-29 CA CA002043516A patent/CA2043516A1/en not_active Abandoned
- 1991-06-04 NZ NZ238383A patent/NZ238383A/en unknown
- 1991-06-06 EP EP19910109303 patent/EP0460674A3/en not_active Withdrawn
- 1991-06-06 IL IL98403A patent/IL98403A0/en unknown
- 1991-06-07 JP JP3136065A patent/JPH04330286A/en active Pending
- 1991-06-07 FI FI912763A patent/FI912763A/en not_active Application Discontinuation
- 1991-06-07 NO NO91912192A patent/NO912192L/en unknown
- 1991-06-07 AU AU78243/91A patent/AU629752B2/en not_active Ceased
- 1991-06-07 CS CS911756A patent/CS175691A3/en unknown
- 1991-06-07 PT PT97916A patent/PT97916A/en not_active Application Discontinuation
- 1991-06-07 HU HU911919A patent/HUT58795A/en unknown
- 1991-06-07 ZA ZA914363A patent/ZA914363B/en unknown
- 1991-06-08 KR KR1019910009468A patent/KR920000922A/en not_active Application Discontinuation
Also Published As
| Publication number | Publication date |
|---|---|
| IE911808A1 (en) | 1991-12-18 |
| EP0460674A2 (en) | 1991-12-11 |
| CS175691A3 (en) | 1992-01-15 |
| HUT58795A (en) | 1992-03-30 |
| NZ238383A (en) | 1993-10-26 |
| HU911919D0 (en) | 1991-12-30 |
| EP0460674A3 (en) | 1992-08-19 |
| AU629752B2 (en) | 1992-10-08 |
| ZA914363B (en) | 1992-03-25 |
| AU7824391A (en) | 1991-12-12 |
| FI912763A (en) | 1991-12-09 |
| IL98403A0 (en) | 1992-07-15 |
| DE4018442A1 (en) | 1991-12-12 |
| JPH04330286A (en) | 1992-11-18 |
| KR920000922A (en) | 1992-01-29 |
| NO912192L (en) | 1991-12-09 |
| NO912192D0 (en) | 1991-06-07 |
| PT97916A (en) | 1992-03-31 |
| FI912763A0 (en) | 1991-06-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gillies et al. | High-level expression of chimeric antibodies using adapted cDNA variable region cassettes | |
| US7053202B2 (en) | Immunoglobulin DNA cassette molecules, monobody constructs, methods of production, and methods of use therefor | |
| Queen et al. | A humanized antibody that binds to the interleukin 2 receptor. | |
| Ruberti et al. | The use of the RACE method to clone hybridoma cDNA when V region primers fail | |
| KR100249937B1 (en) | Reshaped human antibody to human interleukin-6 receptor | |
| US5225539A (en) | Recombinant altered antibodies and methods of making altered antibodies | |
| CA2130436C (en) | Cloning and expression of humanized monoclonal antibodies against human interleukin-4 | |
| Sharon et al. | Recurrent somatic mutations in mouse antibodies to p-azophenylarsonate increase affinity for hapten. | |
| KR100191152B1 (en) | Cd4 specific recombinant antibody | |
| JP3854306B2 (en) | Humanized and chimeric monoclonal antibodies | |
| US5891996A (en) | Humanized and chimeric monoclonal antibodies that recognize epidermal growth factor receptor (EGF-R); diagnostic and therapeutic use | |
| JP3081641B2 (en) | Preparation of antibodies | |
| AU641907B2 (en) | An expression system for production of chimeric monoclonal antibodies | |
| US20090220520A1 (en) | Recombinant method for the production of a monoclonal antibody to CD52 for the treatment of chronic lymphocytic leukemia | |
| Sharpe et al. | Lack of somatic mutation in a χ light chain transgene | |
| CN109776677B (en) | Humanized anti-IL-13 antibody and preparation method and application thereof | |
| JPH07165799A (en) | Polypeptide having amino acid sequence related to antihuman highly affinitive ige receptor monoclonal antibody and dna fragment capable of coding the same | |
| Akamizu et al. | Molecular analysis of stimulatory anti-thyrotropin receptor antibodies (TSAbs) involved in Graves' disease. Isolation and reconstruction of antibody genes, and production of monoclonal TSAbs. | |
| CN113260861B (en) | Method for selecting biological binding molecules | |
| JPH0746998A (en) | Reconstituted human antibody against human interleukin-6 | |
| CA2043516A1 (en) | Recombinant dna and process for the production of chimeric antibodies | |
| JPH07203974A (en) | Gene fragment of antibody recognizing cancer-specific mucin | |
| Khamlichi et al. | The effect of intron sequences on expression levels of Ig cDNAs | |
| JP2843674B2 (en) | Cloning and expression of a humanized monoclonal antibody against human interleukin-4 | |
| Wright et al. | Production of genetically engineered antibodies in myeloma cells: Design, expression, and applications |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Discontinued |