NL9100132A

NL9100132A - METHOD FOR DETECTING DNA SEQUENCE VARIATION.

Info

Publication number: NL9100132A
Application number: NL9100132A
Authority: NL
Original assignee: Ingeny Bv
Priority date: 1991-01-25
Filing date: 1991-01-25
Publication date: 1992-08-17
Also published as: WO1992013101A1; EP0559841A1

Description

Werkwijze voor het detecteren van DNA sequentievariatieMethod for detecting DNA sequence variation

De uitvinding heeft betrekking op een werkwijze voor het detecteren van genetische variatie door DNA fragmenten, afgeleid van een te onderzoeken DNA monster, aan een tweedimensionale elektroforetische scheiding te onderwerpen waarbij de fragmenten in de ene dimensie op basis van verschillen in lengte en in de andere dimensie op basis van verschillen in basevolgorde worden gescheiden, het resulterende scheidingspatroon over te brengen naar een membraan filter en het overgebrachte scheidingspatroon aan een hybridisatie analyse te onderwerpen onder toepassing van een of meerdere DNA of RNA probes.The invention relates to a method for detecting genetic variation by subjecting DNA fragments, derived from a DNA sample to be examined, to a two-dimensional electrophoretic separation in which the fragments in one dimension are based on differences in length and in the other dimension. based on differences in base order, transfer the resulting separation pattern to a membrane filter and subject the transferred separation pattern to a hybridization analysis using one or more DNA or RNA probes.

Zo'n methode vindt toepassing in het gebied van de zg. DNA diagnostiek, d.w.z. het gebruik van methoden om genetische variatie aan te tonen op die plaatsen welke een indicatie kunnen zijn voor bepaalde eigenschappen, zoals de vatbaarheid voor bepaalde ziektes en andere medisch en economisch belangrijke karakteristieken. Onder genetische variatie verstaat men verschillen tussen individuen in de basepaarvolgorde van hun DNA.Such a method finds application in the field of so-called DNA diagnostics, ie the use of methods to demonstrate genetic variation in those places that may indicate certain properties, such as susceptibility to certain diseases and other medical and economic important characteristics. Genetic variation refers to differences between individuals in the base pair order of their DNA.

Genetische variatie kan op verschillende manieren worden gedetecteerd. Een bekende manier is d.m.v. hybridisatie analyse na elektroforetische scheiding van DNA fragmenten, verkregen na behandeling van genomisch DNA met een restrictieenzym (Southern blot hybridisatieanalyse; Southern, 1975). Hybridisatie met een specifiek gelabeld DNA fragment (probe) resulteert in een of meer selecte banden. Elke band vertegenwoordigt een DNA fragment dat hybridiseert met de gebruikte probe. De positie van de banden is een maat voor de grootte van de DNA fragmenten die zij vertegenwoordigen. Indien voor een bepaalde probe de positie van de ermee gegenereerde banden per individu varieert als gevolg van deleties, inserties en/of de aan- of afwezigheid van een herkenningsplaats voor het gebruikte restrictieenzym, spreekt men van een restrictie-fragment-lengte-polymorfisme (RFLP). Uit ervaring weten we dat sommige stukken in het genoom (het totaal aan erfelijke informatie) van mensen, dieren of planten veel polymorfer zijn dan andere stukken. Probes voor zulke stukken kunnen uiterst nuttig zijn als merkers voor bepaalde erfelijke eigenschappen. Zo is bijvoorbeeld in een humane familie, waarin een bepaalde erfelijke ziekte voorkomt, de overerving van de ziekte samen met een variant van een polymorfe DNA sequentie een aanwijzing dat het defecte gen, betrokken bij de ziekte, daar dichtbij gelegen is; er is sprake van genetische koppeling. De desbetreffende variant van de polymorfe DNA sequentie kan dan als diagnostische merker dienen voor de desbetreffende ziekte. Tevens kan dan met behulp van de merker het ziektegen geïsoleerd worden.Genetic variation can be detected in different ways. A well-known way is by hybridization analysis after electrophoretic separation of DNA fragments obtained after treatment of genomic DNA with a restriction enzyme (Southern blot hybridization analysis; Southern, 1975). Hybridization with a specifically labeled DNA fragment (probe) results in one or more select bands. Each band represents a DNA fragment that hybridizes to the probe used. The position of the bands is a measure of the size of the DNA fragments they represent. If for a particular probe the position of the bands generated with it varies per individual due to deletions, insertions and / or the presence or absence of a recognition site for the restriction enzyme used, this is called a restriction fragment-length polymorphism (RFLP ). We know from experience that some pieces in the genome (the total hereditary information) of humans, animals or plants are much more polymorphic than other pieces. Probes for such pieces can be extremely useful as markers for certain hereditary traits. For example, in a human family in which a certain hereditary disease occurs, the inheritance of the disease together with a variant of a polymorphic DNA sequence is an indication that the defective gene involved in the disease is nearby; there is genetic coupling. The relevant variant of the polymorphic DNA sequence can then serve as a diagnostic marker for the relevant disease. The disease gene can also be isolated with the aid of the marker.

Probes die polymorfe DNA sequenties detecteren, kunnen op vergelijkbare wijze gebruikt worden bij plantenveredeling en bij het fokken van vee en andere economisch belangrijke dieren. Immers, indien bekend is dat een bepaalde DNA variant altijd overerft samen met een bepaalde eigenschap, dan kan het al of niet hebben van die eigenschap vroegtijdig worden vastgesteld, hetgeen in de veredeling van groot belang is omdat op deze wijze het generatieinterval wordt vermeden (dit principe noemt men "Marker Assisted Selection").Probes that detect polymorphic DNA sequences can be used in a similar way in plant breeding and in the breeding of livestock and other economically important animals. After all, if it is known that a certain DNA variant always inherits together with a certain property, then whether or not that property can be determined early, which is of great importance in breeding because in this way the generation interval is avoided (this principle is called "Marker Assisted Selection").

Teneinde zoveel mogelijk erfelijke eigenschappen te koppelen aan polymorfe merkers is het uiteraard van belang enige informatie te hebben over de locatie van die merkers, zowel ten opzichte van elkaar als voor wat betreft hun precieze plaats op de chromosomen. Indien voor de mens en een aantal belangrijke plante- en diersoorten genetische merkerkaarten ter beschikking zouden staan, met een merker voor elke ca. 2 miljoen baseparen, zou het koppelen van merkers aan erfelijke eigenschappen een routineaangelegenheid zijn. Dergelijke kaarten zijn er echter nog niet; de kaarten die er zijn, zijn onvolledig en/of bestaan voor een groot deel uit merkers die niet altijd even informatief zijn, d.w.z. niet erg polymorf (zie bijvoorbeeld Donis-Keller et al., 1987). Zelfs met zo’n nauwkeurige kaart zal het bovendien nog altijd veel werk kosten om een bepaald erfelijk kenmerk aan een bepaalde merker te koppelen omdat elke merker apart moet worden onderzocht op koppeling met een bepaald kenmerk.In order to link as many hereditary traits as possible to polymorphic markers, it is of course important to have some information about the location of those markers, both with respect to each other and with regard to their precise position on the chromosomes. If genetic marker maps were available for humans and a number of important plant and animal species, with a marker for every approximately 2 million base pairs, linking markers to hereditary traits would be a routine matter. However, there are no such cards yet; the maps out there are incomplete and / or largely composed of markers that are not always as informative, i.e., not very polymorphic (see, for example, Donis-Keller et al., 1987). Moreover, even with such an accurate map it will still take a lot of work to link a certain hereditary characteristic to a certain marker because each marker has to be examined separately for coupling with a certain characteristic.

Aangezien het humane genoom ca. 3 miljard baseparen groot is, houdt dit voor deze species bijvoorbeeld in dat, elke keer dat men een erfelijke eigenschap in kaart wil brengen, zo'n 1500 merkers getest zouden moeten worden.Since the human genome is approximately 3 billion base pairs in size, this means that for this species, for example, every time one wants to map a hereditary trait, about 1500 markers should be tested.

Recent is door ons een methode voorgesteld met behulp waarvan een groot aantal hyperpolymorfe DNA plaatsen tegelijk kan worden geanalyseerd door middel van een elektroforetische scheiding in twee dimensies, gevolgd door overbrenging van het scheidingspatroon naar membraanfilters en hybridisatie met zg. minisatelliet core probes (ΕΡ-Α-0 349 024; Uitterlinden et al., 1989; Uitterlinden en Vijg, 1989). Bij deze elektroforetische scheiding van DNA fragmenten in twee dimensies werd gebruik gemaakt van een eerder ontwikkeld systeem waarbij scheiding op grootte wordt gevolgd door scheiding op basis van basepaar-samenstelling, loodrecht op de richting van de eerste scheiding (Fischer en Lerman, 1979). Scheiding op basis van basepaar-samenstelling werd door Fischer en Lerman gerealiseerd door gebruik te maken van zg. denaturerende gradiënten (Fischer en Lerman, 1979; Fischer en Lerman, 1983). Daarbij migreert het dubbelstrengig DNA in een elektrisch veld in een gel (bijv. een polyacrylamidegel) waarin tevoren een gradiënt van denaturans (een mengsel van ureum en formamide) is aangebracht. De DNA fragmenten ontmoeten tijdens hun migratie een steeds hogere concentratie van het denaturans en zullen tenslotte op een bepaald punt in de gradiënt uitsmelten. Dit punt is sterk afhankelijk van de basepaarsamenstelling van het DNA fragment (zie Lerman et al., 1984). Door ons is aangetoond dat scheiding van DNA fragmenten (o.a. verkregen door restrictieenzym-digestie van humaan DNA) in twee dimensies op basis van bovengenoemd principe, gevolgd door overbrenging van het scheidingspatroon naar membraanfilters en hybridisatie met GC-rijke minisatelliet core probes, tot een patroon leidt waarin, afhankelijk van de gebruikte probe, 300-700 DNA plaatsen als vlekken kunnen worden onderscheiden (zie Figuur 1). Uit onze gegevens blijkt dat ca. 20% van deze plaatsen tot het hyperpolymorfe type behoort dat zo karakteristiek is voor VNTR-type (variable number of tandem repeats) loci. Dit betekent dat op deze wijze ca. 60-140 allelen en daarmee 30-70 hyperpolymorfe loei tegelijkertijd gescreend kunnen worden. Herhybridisatie met andere GC-rijke core probes resulteert in vergelijkbare patronen waarin de meeste vlekken zullen corresponderen met andere plaatsen in het genoom dan de plaatsen welke met de eerste probe werden gedetecteerd. M.a.w. de verschillende core probes detecteren verschillende groepen loei, hoewel enige overlap aantoonbaar is (gemiddeld 10-15%).We recently proposed a method that allows a large number of hyperpolymorphic DNA sites to be analyzed simultaneously by means of an electrophoretic separation in two dimensions, followed by transfer of the separation pattern to membrane filters and hybridization with so-called minisatellite core probes (ΕΡ-Α -0 349 024; Uitterlinden et al., 1989; Uitterlinden and Vijg, 1989). This electrophoretic separation of DNA fragments into two dimensions utilized a previously developed system in which size separation is followed by base pair composition separation, perpendicular to the direction of the first separation (Fischer and Lerman, 1979). Separation based on base pair composition was accomplished by Fischer and Lerman using so-called denaturing gradients (Fischer and Lerman, 1979; Fischer and Lerman, 1983). The double-stranded DNA migrates in an electric field in a gel (e.g. a polyacrylamide gel) in which a gradient of denaturans (a mixture of urea and formamide) has previously been applied. The DNA fragments encounter an increasingly higher concentration of the denaturant during their migration and will eventually melt at some point in the gradient. This point is highly dependent on the base pair composition of the DNA fragment (see Lerman et al., 1984). We have shown that separation of DNA fragments (including obtained by restriction enzyme digestion of human DNA) in two dimensions based on the above principle, followed by transfer of the separation pattern to membrane filters and hybridization with GC-rich minisatellite core probes, to a pattern in which, depending on the probe used, 300-700 DNA sites can be distinguished as spots (see Figure 1). Our data shows that approximately 20% of these sites belong to the hyperpolymorphic type that is so characteristic of VNTR type (variable number of tandem repeats) loci. This means that in this way approximately 60-140 alleles and thus 30-70 hyperpolymorphic loci can be screened simultaneously. Re-hybridization with other GC-rich core probes results in similar patterns in which most spots will correspond to sites in the genome other than those detected with the first probe. In other words the different core probes detect different groups of loci, although some overlap is demonstrable (on average 10-15%).

Met behulp van bovenbesproken methode (2-D DNA typering) kunnen dus in korte tijd een groot aantal hyperpolymorfe loei in een genoom worden gescreend, hetgeen de mogelijkheid verschaft erfelijke kenmerken snel in kaart te brengen. Als zodanig is het systeem een stap voorwaarts ten opzichte van de bijna klassiek te noemen Southern hybridisatie analyse.Using the method discussed above (2-D DNA typing), a large number of hyperpolymorphic loci can be screened in a genome in a short time, which makes it possible to quickly identify hereditary characteristics. As such, the system is a step forward from the almost classic Southern hybridization analysis.

Het kwam ons voor dat 2-D DNA typering als efficient meetsysteem in genetische studies nog aanzienlijk zou kunnen worden verfijnd en meer specifiek zou kunnen worden toegepast indien de volgende nadelen zouden kunnen worden opgeheven: (1) De door de core probes gedetecteerde sequenties zijn onregelmatig verspreid in het genoom. Bijvoorbeeld minisatelliet VNTR-type sequenties komen bij de mens veel vaker voor aan de telomeren (uiteinden van de chromosomen) dan elders (Royle et al., 1989). Voor andere VNTR-type sequenties is hier niet veel van bekend en ook in andere diersoorten dan de mens en bij planten bestaat slechts weinig informatie omtrent het voorkomen en de verdeling van VNTR-type sequenties.It occurred to us that 2-D DNA typing as an efficient measurement system in genetic studies could still be refined considerably and applied more specifically if the following disadvantages could be removed: (1) The sequences detected by the core probes are irregular spread in the genome. For example, mini-satellite VNTR-type sequences are much more common in telomeres (ends of the chromosomes) in humans than elsewhere (Royle et al., 1989). Not much is known about this for other VNTR type sequences, and also in animal species other than humans and plants there is little information about the occurrence and distribution of VNTR type sequences.

(2) De 2-D DNA typeringsmethode is aspecifiek; het gebied in het genoom dat met bepaalde core probes wordt bestreken is niet a priori bekend. Het is daarom noodzakelijk om van elke vlek de genomische locatie vast te stellen. Hoewel tijdrovend, is dit zeker wel haalbaar en gezien het veelvuldig voorkomen van VNTR-type sequenties mag verondersteld worden dat met een juiste combinatie van core probes en een goede strategie voor het localiseren van de vlekken er uiteindelijk wel een fijnmazige genoomkaart valt te construeren (zie ook EP-A-0 349 024). De tijd die daarmee gepaard zal moeten gaan, blijft echter aanzienlijk.(2) The 2-D DNA typing method is non-specific; the region in the genome covered by certain core probes is not known a priori. It is therefore necessary to determine the genomic location of each spot. Although time consuming, this is certainly feasible and given the frequent occurrence of VNTR-type sequences, it can be assumed that with a correct combination of core probes and a good strategy for localizing the spots, a fine-grained genome map can ultimately be constructed (see also EP-A-0 349 024). However, the time that will have to go with it remains significant.

(3) Een derde punt betreft het feit dat slechts 20-30% van de door de core probes gedetecteerde sequenties polymorf en dus nuttig voor de analyse is. M.a.w. de meerderheid van de vlekken is onbruikbaar voor het karteren en neemt slechts ruimte in het scheidingspatroon in.(3) A third point concerns the fact that only 20-30% of the sequences detected by the core probes are polymorphic and thus useful for the analysis. In other words the majority of the spots are unusable for mapping and only take up space in the separation pattern.

Het zou daarom veel beter zijn gebruik te maken van sequenties die ten minste om de ca. 2 miljoen baseparen eenmaal voorkomen, vrijwel altijd polymorf zijn en gelijkelijk over het genoom zijn verdeeld. Een sequentie met deze eigenschappen is bijvoorbeeld het repeterend element Alu. Eerder is door ons echter al aangetoond dat hybridisatie van een twee-dimensionaal scheidingspatroon van zoogdier DNA met Alu als probe resulteert in een ongestruktureerde smeer zonder duidelijke vlekken. Dit werd verklaard, enerzijds door het grote aantal Alu kopieën per genoom (ca. 700.000; voor een beschouwing over de verdeling van Alu en andere repeats over het genoom, zie Schmid en Jelinek, 1982; Korenberg en Rykowski, 1988; Moyzis et al., 1989), en anderzijds door het niet bijzonder GC-rijke karakter van Alu. Dit laatste is in tegenstelling tot de met de GC-rijke core probes gedetecteerde sequenties die op basis van hun GC-rijke karakter als "clamp" (i.e. highest melting domain) fungeren tijdens de scheiding in de denaturerende gradiënt (2e dimensie' scheiding) hetgeen resulteert in een focussering als spot van dit soort sequenties in de tweede dimensie. Aangezien de naast de VNTR liggende sequenties van locus tot locus zullen verschillen en bovendien als lowest melting domain fungeren, zullen de resulterende spots goed gescheiden kunnen worden. Echter, veel van de DNA fragmenten die Alu bevatten zullen ongeveer tegelijk uitsmelten en zodoende aanleiding geven tot clustering in de gel (voor een uitgebreide beschouwing hieromtrent, zie EP-A-0 349 024 en Uitterlinden en Vijg, 1989). Het komt er dus op neer dat het aantal Alu fragmenten per genoom te groot is voor gebruik als merkers en hun uitsmeltkarakteris-tieken niet erg geschikt zijn voor het bij 2-D DNA typering gebruikte gelscheidingssysteem. Een en ander staat het gebruik in hybridisatieexperimenten van Alu repeats als "ankerpunten" voor een tweedimensionale screening van het genoom in de weg.It would therefore be much better to use sequences that occur at least every about 2 million base pairs, are almost always polymorphic, and are evenly distributed across the genome. For example, a sequence with these properties is the repetitive element Alu. However, it has previously been demonstrated by us that hybridization of a two-dimensional separation pattern of mammalian DNA with Alu as a probe results in an unstructured smear without obvious spots. This was explained on the one hand by the large number of Alu copies per genome (approx. 700,000; for a consideration of the distribution of Alu and other repeats across the genome, see Schmid and Jelinek, 1982; Korenberg and Rykowski, 1988; Moyzis et al. , 1989), and on the other hand due to the not particularly GC-rich character of Alu. The latter is in contrast to the sequences detected with the GC-rich core probes, which on the basis of their GC-rich character function as "clamp" (ie highest melting domain) during the separation in the denaturing gradient (2nd dimension 'separation), which results in spot focusing of this kind of sequences in the second dimension. Since the sequences adjacent to the VNTR will differ from locus to locus and, moreover, act as the lowest melting domain, the resulting spots can be separated well. However, many of the DNA fragments containing Alu will melt approximately at the same time and thus give rise to clustering in the gel (for a detailed consideration of this, see EP-A-0 349 024 and Uitterlinden and Vijg, 1989). So the bottom line is that the number of Alu fragments per genome is too large for use as markers and their fusion characteristics are not very suitable for the gel separation system used in 2-D DNA typing. This prevents the use in hybridization experiments of Alu repeats as "anchor points" for two-dimensional screening of the genome.

Het feit dat Alu zo frequent in het genoom voorkomt (gemiddeld om de 4000 baseparen), maakt het echter mogelijk om zg. inter-Alu gebieden te onderscheiden en direkt met behulp van de polymerase chain reaction (PCR) te isoleren. Recentelijk is door Nelson et al. (1989) aangetoond dat inter-Alu gebieden met behulp van PCR kunnen worden vermenigvuldigd door gebruik te maken van primers die speciek zijn voor Alu. Bijvoorbeeld kunnen onder toepassing van primer TC65 in principe van het humane genoom alle gebieden die gelegen zijn tussen 2 in omgekeerde oriëntatie liggende Alu kopieën worden vermenigvuldigd. In Figuur 2 is een schematisch overzicht van deze methode te zien en in Figuur 3 staat een overzicht van de bindingsplaatsen op de Alu repeat van de in Tabel 1 opgesomde geschikte Alu-specifieke primers.However, the fact that Alu is so frequent in the genome (on average every 4000 base pairs) makes it possible to distinguish so-called inter-Alu regions and isolate them directly using the polymerase chain reaction (PCR). Recently, Nelson et al. (1989) have shown that inter-Alu regions can be multiplied by PCR using primers specific for Alu. For example, using primer TC65, in principle, of the human genome, all regions located between 2 Alu copies in inverse orientation can be multiplied. Figure 2 shows a schematic overview of this method and Figure 3 shows the binding sites on the Alu repeat of the appropriate Alu-specific primers listed in Table 1.

TABEL 1: herkomst en sequentie van inter-Alu specifieke primers Nelson et al., 1989: TC 65 (559) 5'-AAGTCGCGGCCGCTTGCAGTGAGCCGAGAT-3' 517 51-CGACCTCGAGATCT(C/T)(A/G)GCTCACTGCAA-31 P. de Jong, persoonlijke mededeling: PD J3 3 51-GCCTCCCAAAGTGCTGGGATTACAGGCGTGAGCCA-3' PDJ34 5'-TGAGCCGAGATCGCGCCA(T/C)TGCACTCCAGCCTGGG3’ niet gepubliceerd: PDJ33A 51-GGATCCGCCTCCCAAAGTGCTGGGATTACAGG-3* PDJ3 4A 5'-GAATTCTGAGCCGAGATCGCGCCACTGC-3'TABLE 1: Origin and Sequence of Inter-Alu Specific Primers Nelson et al., 1989: TC 65 (559) 5'-AAGTCGCGGCCGCTTGCAGTGAGCCGAGAT-3 '517 51-CGACCTCGAGATCT (C / T) (A / G) GCTCACTGCAA-31 P. de Jong, personal communication: PD J3 3 51-GCCTCCCAAAGTGCTGGGATTACAGGCGTGAGCCA-3 'PDJ34 5'-TGAGCCGAGATCGCGCCA (T / C) TGCACTCCAGCCTGGGCCCGGGAGTGCTCCAGGGGCCTCCCAAAGTCCTCCCAAAGTGCTCCAGAGCCTCCCAAAGTCCTCCCAAAGTCT

Cotter et al., 1990: PRIM IV 5’-CAGAATTCGCGACAGAGCGAGACTCCGTCTC-3'Cotter et al., 1990: PRIM IV 5'-CAGAATTCGCGACAGAGCGAGACTCCGTCTC-3 '

De uitvinding verschaft nu een werkwijze voor het detecteren van genetische variatie door DNA fragmenten, afgeleid van een te onderzoeken DNA monster, aan een tweedimensionale elektroforetische scheiding te onderwerpen waarbij de fragmenten in de ene dimensie op basis van verschillen in lengte en in de andere dimensie op basis van verschillen in basevolgorde worden gescheiden, het resulterende scheidingspatroon over te brengen naar een membraan filter en het overgebrachte scheidingspatroon aan een hybridisatie analyse te onderwerpen onder toepassing van een of meerdere DNA of RNA probes, welke werkwijze gekenmerkt wordt doordat men DNA fragmenten gebruikt die bestaan uit inter-repeat sequenties die op basis van het te onderzoeken DNA zijn gegenereerd door middel van een polymerase chain reaction (PCR) met repeat-specifieke primer(s).The invention now provides a method for detecting genetic variation by subjecting DNA fragments, derived from a DNA sample to be examined, to a two-dimensional electrophoretic separation in which the fragments in one dimension are based on differences in length and in the other dimension. based on differences in base order, transfer the resulting separation pattern to a membrane filter and subject the transferred separation pattern to a hybridization analysis using one or more DNA or RNA probes, which method is characterized by using DNA fragments that exist from inter-repeat sequences generated from the DNA to be tested by a polymerase chain reaction (PCR) with repeat-specific primer (s).

Een zeer belangrijke voorkeursuitvoeringsvorm van de uitvinding wordt gekenmerkt doordat men in de hybridisatie analyse als probe gebruik maakt van een of meer inter-repeat sequenties die door middel van een PCR met repeat-specifieke primer(s), uitgevoerd aan subgenomisch DNA, bijvoorbeeld DNA van één chromosoom of een deel daarvan, zijn gegenereerd.A very important preferred embodiment of the invention is characterized in that in the hybridization analysis the probe uses one or more inter-repeat sequences which, by means of a PCR with repeat-specific primer (s), is performed on subgenomic DNA, for example DNA of one chromosome, or part thereof, have been generated.

Aldus maakt de uitvinding het mogelijk om genetische variatie op specifieke chromosomen of gedeeltes daarvan te detecteren, gebruik makend van een selectieve vermenigvuldiging van dubbelstrengs DNA op bepaalde plaatsen, ten minste om de 2 miljoen baseparen, een elektroforetische scheiding van de vermenigvuldigingsprodukten in twee dimensies, overbrenging van het scheidingspatroon naar een membraanfilter, gevolgd door een hybridisatie met gelabelde DNA-fragmenten die afkomstig kunnen zijn van (a) gekloneerd DNA, zoals cosmide- en YAC (yeast artificial chromosome) klonen, of (b) chromosomen of gedeeltes daarvan zoals verkregen na flow-sortering van chromosomen of zoals die aanwezig zijn in een humaan-hamster somatische cel hybride.Thus, the invention makes it possible to detect genetic variation on specific chromosomes or parts thereof, using a selective multiplication of double-stranded DNA at certain locations, at least every 2 million base pairs, an electrophoretic separation of the multiplication products in two dimensions, transmission from the separation pattern to a membrane filter, followed by a hybridization with labeled DNA fragments that may be from (a) cloned DNA, such as cosmid and YAC (yeast artificial chromosome) clones, or (b) chromosomes or portions thereof as obtained after flow sorting of chromosomes or as present in a human hamster somatic cell hybrid.

Het te onderzoeken DNA zal meestal bestaan uit het DNA van een volledig genoom van een dier of plant, waarbij de belangrijkste toepassingen humaan DNA zullen betreffen.The DNA to be investigated will usually consist of the DNA of an entire genome of an animal or plant, the main applications of which will concern human DNA.

In plaats van totaal humaan DNA kan men ook uitgaan van DNA afkomstig van een bepaald humaan chromosoom of een gedeelte daarvan. Individuele chromosomen kan men verkrijgen d.m.v. flow sortering, maar dit resulteert meestal niet in een volkomen zuivere chromosoompopulatie. Een andere, vaker toegepaste methode is om uit te gaan van zg. hybride cellijnen. Daarbij wordt bijvoorbeeld een humane cellijn gefuseerd met een hamster cellijn. Meestal zullen dan na de fusie van de kernen de humane chromosomen vrijwel allemaal worden verwijderd. Hierdoor is het betrekkelijk gemakkelijk mens-hamster hybride cellijnen te verkrijgen met slechts één humaan chromosoom of een gedeelte daarvan. Door nu uit te gaan van DNA dat afkomstig is van een mens-hamster hybride cellijn, kan men in principe alle inter-Alu gebieden die gelegen zijn op een bepaald humaan chromosoom of een stuk daarvan selektief vermenigvuldigen. Een en ander is uitgebreid beschreven door Nelson et al. (1989) . Het belang van deze procedure heeft betrekking op de nieuwe mogelijkheden die ze verschaft tot het verkrijgen van DNA fragmenten uit bepaalde gedefiniëerde gedeeltes van het genoom. Deze DNA fragmenten kunnen vervolgens gebruikt worden als probes en/of geanalyseerd worden. Een en ander is expliciet door Nelson et al. (1989) vermeld (zie ook Ledbetter et al., 1990a en b; Lichter et al., 1990).Instead of total human DNA, one can also start from DNA originating from a certain human chromosome or a part thereof. Individual chromosomes can be obtained by means of flow sorting, but this usually does not result in a completely pure chromosome population. Another, more often used method is to start from so-called hybrid cell lines. For example, a human cell line is fused with a hamster cell line. Usually, after the fusion of the nuclei, almost all human chromosomes will be removed. This makes it relatively easy to obtain human-hamster hybrid cell lines with only one human chromosome or part thereof. In principle, by starting from DNA originating from a human-hamster hybrid cell line, one can multiply all inter-Alu regions located on a certain human chromosome or a part thereof. All this has been described in detail by Nelson et al. (1989). The importance of this procedure relates to the new possibilities it provides for obtaining DNA fragments from certain defined parts of the genome. These DNA fragments can then be used as probes and / or analyzed. All this has been explicitly stated by Nelson et al. (1989) (see also Ledbetter et al., 1990a and b; Lichter et al., 1990).

Het kwam ons voor dat inter-Alu PCR, gekoppeld aan 2-D DNA typering, gebruikt zou kunnen worden voor genoom scanning op een wijze die in ten minste twee opzichten superieur is aan de eerder beschreven genetische analyse met een elektroforetische scheiding van restrictiefragmenten in twee dimensies en een hybridisatie met GC-rijke minisatelliet core probes.It occurred to us that inter-Alu PCR, coupled with 2-D DNA typing, could be used for genome scanning in a way superior to the previously described genetic analysis with an electrophoretic separation of restriction fragments in two ways. dimensions and a hybridization with GC-rich mini-satellite core probes.

(1) Ten eerste zijn Alu, en dus ook inter-Alu, sequenties veel regelmatiger door het genoom verspreid dan minisatelliet-type sequenties (de kans dat uit een genoomfragment van 2 miljoen baseparen niet ten minste 1 inter-Alu fragment kan worden geïsoleerd middels PCR is zeer gering); de mogelijk ongunstige uitsmelteigenschappen van de Alu repeat zelf in denaturerende gradiënten speelt geen rol omdat we hier voor het merendeel te maken hebben met inter-Alu gebieden waarbij doorgaans slechts een klein gedeelte van de Alu sequentie zelf wordt meegenomen.(1) First, Alu, and therefore inter-Alu, sequences are much more distributed throughout the genome than mini-satellite type sequences (the probability that at least 1 inter-Alu fragment cannot be isolated from a 2 million base pair genome fragment by PCR is very low); the possibly unfavorable smelter properties of the Alu repeat itself in denaturing gradients does not matter because we are dealing here for the most part with inter-Alu areas where usually only a small part of the Alu sequence itself is included.

(2) In de tweede plaats maakt de inter-Alu methode het mogelijk om, na een twee-dimensionale scheiding van de fragmenten die zijn gegenereerd met totaal genomisch DNA als substraat, bepaalde specifieke gebieden te herkennen door hybridisatie met een probe-mengsel bestaande uit inter-Alu PCR produkten welke afkomstig zijn van een specifiek chromosoom (verkregen via flow-sortering of als hybride cellijn) of een deel daarvan, bijv. in de vorm van cosmide- of YAC klonen.(2) Secondly, the inter-Alu method allows, after a two-dimensional separation of the fragments generated with total genomic DNA as substrate, to recognize certain specific regions by hybridization with a probe mixture consisting of inter-Alu PCR products derived from a specific chromosome (obtained through flow sorting or as a hybrid cell line) or part thereof, eg in the form of cosmid or YAC clones.

Omdat bekend is dat de 3' uiteinden van Alu sequenties een AT-rijk VNTR type polymorfisme kunnen hebben (Economou et al., 1990; Epstein et al., 1990; Zuliani en Hobbs, 1990) kunnen verschillende allelen van een "inter-Alu" locus op een isotherm in de denaturerende gradiënt dimensie op lengte van elkaar worden onderscheiden. Zodoende kan een 2-D scheidingspatroon van inter-Alu PCR produkten afkomstig van totaal genomisch DNA van verschillende individuen direkt informatie verschaffen omtrent genetische verschillen en overeenkomsten, en wel specifiek voor bepaalde chromosomen of delen daarvan, afhankelijk van het gebruikte probe-mengsel. Als probemengsels kunnen bijvoorbeeld dienen inter-Alu produkten afkomstig uit mens-hamster hybride cellijnen die een of meerdere chromosomen van de mens bevatten, of delen daarvan. De desbetreffende DNAs kunnen worden gelabeld en vervolgens gebruikt als hybridisatieprobe voor de analyse van 2-D scheidingspatronen van inter-Alu PCR produkten (wegens gebrek aan homologie zal het hamster DNA niet binden). Dit zal resulteren in een individu-specifiek vlekkenpatroon, waarbij elke vlek in principe een variant is van een inter-Alu DNA fragment dat gelocaliseerd is in het gebied dat wordt gespecificeerd door het humane chromosoom (of deel daarvan) aanwezig in de hybride cellijn.Since it is known that the 3 'ends of Alu sequences may have an AT-rich VNTR type polymorphism (Economou et al., 1990; Epstein et al., 1990; Zuliani and Hobbs, 1990), different alleles of an "inter-Alu "locus on an isotherm in the denaturing gradient dimension by length are distinguished from each other. Thus, a 2-D separation pattern of inter-Alu PCR products from total genomic DNA from different individuals can directly provide information on genetic differences and similarities, specific for certain chromosomes or parts thereof, depending on the probe mixture used. Inter alu products from human-hamster hybrid cell lines containing one or more human chromosomes, or parts thereof, can be used as probe mixtures. The appropriate DNAs can be labeled and then used as a hybridization probe for the analysis of 2-D separation patterns of inter-Alu PCR products (due to lack of homology, the hamster DNA will not bind). This will result in an individual-specific staining pattern, each stain being in principle a variant of an inter-Alu DNA fragment located in the region specified by the human chromosome (or part thereof) contained in the hybrid cell line.

Tevens kunnen als probemengsels inter-Alu produkten van YAC- en cosmideklonen worden gebruikt, afkomstig uit referentie-bibliotheken, met als voordeel dat een direct verband kan worden gelegd tussen de fysische kaart (= de plaats in de sequentie volgorde) en de genetische kaart van het genoom (=de plaats op een van de chromosomen zoals bepaald door koppelingsonderzoek) .Also, as probe mixtures, inter-Alu products of YAC and cosmid clones can be used, originating from reference libraries, with the advantage that a direct connection can be made between the physical map (= the place in the sequence order) and the genetic map of the genome (= the position on one of the chromosomes as determined by coupling research).

Het voor de probe gebruikte label is op zichzelf niet kritisch en alle voor DNA of RNA probes bekende labels kunnen worden toegepast. Zo is bijvoorbeeld mogelijk dat de probe die in de hybridisatie analyse wordt toegepast, gelabeld is met een radioisotoop zoals 32P en 35S, met een hapteen zoals biotine en digoxigenine, met een fluorescente stof of met een combinatie van dergelijke labels.The label used for the probe is not critical per se and any labels known for DNA or RNA probes can be used. For example, it is possible that the probe used in the hybridization analysis is labeled with a radioisotope such as 32P and 35S, with a hapten such as biotin and digoxigenin, with a fluorescent substance, or with a combination of such labels.

De hierboven beschreven methode kan worden toegepast bij de bepaling van genetische variatie in elke dier- of plante- soort, mits individuele chromosomen of delen daarvan beschikbaar zijn, bijv. in de vorm van geflowsorteerde chromosomen, hybride cellijnen (het DNA van de andere species mag dan geen homologie hebben met de "Alu-achtige" priming sites in DNA van de te onderzoeken species) en cosmide- of YAC klonen.The method described above can be used in the determination of genetic variation in any animal or plant species, provided that individual chromosomes or parts thereof are available, e.g. in the form of flow-sorted chromosomes, hybrid cell lines (the DNA of the other species may then have no homology to the "Alu-like" priming sites in DNA of the species to be tested) and cosmid or YAC clones.

De methode is ook niet beperkt tot de Alu of Alu-achtige repeat familie maar kan tevens worden toegepast op andere humane repeat families, zoals de Kpn familie (zie Ledbetter et al., 1990a; zie verder Tabel 2 voor een overzicht van Kpn specifieke primers en Figuur 4 voor een schematisch overzicht van de opbouw van Kpn repeats en de bindingsplaatsen van de Kpn primers) of repeat families waarvan de localisatie beperkt is tot bijv. de centromeren of de telomeren (zelfs van bepaalde chromosomen; zie Tabel 3 voor een overzicht van primers die specifiek zijn voor een centromeer repeat op chromosoom 21; zie Devilee et al., 1988) en op repeat families in andere dier- en plantesoorten. Bovendien is het natuurlijk mogelijk combinaties van repeats te gebruiken zodat inter-repeat gebieden kunnen worden gedetecteerd die ingesloten liggen tussen bijvoorbeeld een Alu aan de ene kant en een Kpn aan de andere kant.The method is also not limited to the Alu or Alu-like repeat family, but can also be applied to other human repeat families, such as the Kpn family (see Ledbetter et al., 1990a; see Table 2 for an overview of Kpn specific primers). and Figure 4 for a schematic overview of the structure of Kpn repeats and the binding sites of the Kpn primers) or repeat families, the localization of which is limited to e.g. the centromers or the telomeres (even of certain chromosomes; see Table 3 for an overview of primers specific for a centromere repeat on chromosome 21; see Devilee et al., 1988) and on repeat families in other animal and plant species. In addition, it is of course possible to use combinations of repeats so that inter-repeat areas can be detected that are enclosed between, for example, an Alu on one side and a Kpn on the other side.

TABEL 2: herkomst en sequentie van Kpn/LINE specifieke primers Niet gepubliceerd:TABLE 2: Origin and sequence of Kpn / LINE specific primers Not published:

KpnA 5'-CGCGGGCGGCCGC-CCTAATGCTAGATGACGAGTTAGTGGG-3'KpnA 5'-CGCGGGCGGCCGC-CCTAATGCTAGATGACGAGTTAGTGGG-3 '

KpnB 5'-CGCGGGCGGCCGC-GGGTGCAGCACACCAACATGGC-3'KpnB 5'-CGCGGGCGGCCGC-GGGTGCAGCACACCAACATGGC-3 '

KpnBl 5'-CGCGGGCGGCCGC-GGGTGCAGCACACAAC-3'KpnBl 5'-CGCGGGCGGCCGC-GGGTGCAGCACACAAC-3 '

KpnC 5'-CGCGGGCGGCCGC—GGCACATGTATACATATGTAACAAACCTGC—3*KpnC 5'-CGCGGGCGGCCGC — GGCACATGTATACATATGTAACAAACCTGC — 3 *

KpnC1 5'-CGCGGGCGGCCGC-CATGGCACATGTATAC-31KpnC1 5'-CGCGGGCGGCCGC-CATGGCACATGTATAC-31

KpnD 5 *-CGCGGGCGGCCGC-GCACGTTGTGCACATGTACCCTAGAACTTAA-3*KpnD 5 * -CGCGGGCGGCCGC-GCACGTTGTGCACATGTACCCTAGAACTTAA-3 *

Ledbetter et al., 1990a:Ledbetter et al., 1990a:

LlHs 5'-CATGGCACATGTATACATATGTAAC(A/T)AACC-3' TABEL 3: herkomst en sequentie van humaan chromosoom 21 centromeer-specifieke LI.26 primers Niet gepubliceerd: L1265a 51-CGCGGGCGGCCGC-CATTCTCAAGAAACTGCTTTGTGATG-3' L1265b 51-CGCGGGCGGCCGC-CATCAGAAAGCAGTTTCTTGAGAATG-31 L12 63 5'-CGCGGGCGGCCGC-CATTCTCAAGAAACTGCTTTGTGATA-3’ L126W 5 *-CGCGGGCGGCCGC-CATTCTCAAGAACT(T/G)GTT(T/C) (G/C)TGATG-31 L1263' 5'-CGCGGGCGGCCGC-GGA(G/T)(C/T)GCTTTGACGATTTCG-3' L126N 51-CGCGGGCGGCCGC-GACAGAAGCATTCTCAGAAAC-3’LlHs 5'-CATGGCACATGTATACATATGTAAC (A / T) AACC-3 'TABLE 3: Origin and sequence of human chromosome 21-specific centromere LI.26 primers Unpublished: L1265a 51-CGCGGGCGGCCGC-CATTCTCAAGAAACTGCTTTGTGATG-3' 51-L1265b CGCGGGCGGCCGC-CATCAGAAAGCAGTTTCTTGAGAATG- 31 L12 63 5'-CGCGGGCGGCCGC-CATTCTCAAGAAACTGCTTTGTGATA-3 'L126W 5 * -CGCGGGCGGCCGC-CATTCTCAAGAACT (T / G) GTT (T / C) (G / C) TGATG-31 L1263' 5'-CGCGGG ) (C / T) GCTTTGACGATTTCG-3 'L126N 51-CGCGGGCGGCCGC-GACAGAAGCATTCTCAGAAAC-3'

De uitvinding kan worden toegepast in de genetische diagnostiek, waarbij de opsporing van DNA merker probes voor erfelijke kenmerken centraal staat. Dit is het geval in de medische diagnostiek waarbij de methode kan worden gebruikt om in korte tijd een groot aantal polymorfe plaatsen in een tevoren gedefiniëerd gebied binnen een chromosoom te screenen op individuele verschillen, welke informatie direkt kan worden gebruikt voor de verkrijging van een merker voor een erfelijk kenmerk, zoals bijvoorbeeld een erfelijke ziekte. Blijkt een bepaalde variant van een inter-Alu gebied bijv. steeds over te erven samen met een bepaald erfelijk kenmerk, dan is het mogelijk het desbetreffende DNA fragment uit het hybridisatie-membraan te isoleren middels PCR. Het desbetreffende fragment kan vervolgens in detail worden gelocaliseerd. Een alternatief is het tevoren localiseren van alle vlekken (inter-Alu varianten) die men in een 2-D chromosoom-specifieke DNA-scan aan kan treffen en deze te herleiden tot een bepaalde recombinant DNA kloon in één van de voor publiek toegankelijke referentie-bibliotheken. De vorming van zo'n database van polymorfe DNA sequenties als vlekken in een 2-D scheidingspatroon is op een uitgebreide wijze besproken in Uitterlinden en Vijg, 1989 en EP-A-0 3'49 024.The invention can be applied in genetic diagnostics, in which the detection of DNA marker probes for hereditary characteristics is central. This is the case in medical diagnostics where the method can be used to quickly screen a large number of polymorphic sites in a predefined region within a chromosome for individual differences, which information can be used directly to obtain a marker for a hereditary characteristic, such as a hereditary disease. If, for example, it appears that a certain variant of an inter-Alu region is always inherited together with a certain hereditary characteristic, it is possible to isolate the relevant DNA fragment from the hybridization membrane by means of PCR. The relevant fragment can then be located in detail. An alternative is to localize all stains (inter-Alu variants) that can be found in a 2-D chromosome-specific DNA scan and to trace them back to a specific recombinant DNA clone in one of the publicly accessible reference cells. libraries. The formation of such a database of polymorphic DNA sequences as spots in a 2-D separation pattern has been extensively discussed in Uitterlinden and Vijg, 1989 and EP-A-0 3'49 024.

De uitvinding heeft dus betrekking op het volgende: 1. Elektroforetische scheiding in 2 dimensies (d.w.z. grootte en basepaarsamenstelling) van inter-repeat PCR produkten verkregen uit totaal genomisch DNA van een mens, dier of plant m.b.v. een of meerdere primers specifiek voor een of meerdere repeterende sequenties.Thus, the invention relates to the following: 1. Electrophoretic separation in 2 dimensions (i.e. size and base pair composition) of inter-repeat PCR products obtained from total genomic DNA of a human, animal or plant by means of one or more primers specific for one or more repetitive sequences.

2. Hybridisatie van het scheidingspatroon verkregen onder 1 met een probe-mengsel bestaande uit inter-repeat PCR fragmenten verkregen van (1) gezuiverde chromosomen, of delen daarvan, van het organisme dat bestudeerd wordt, en/of (2) genomisch DNA afkomstig van somatische celhybriden met daarin als complement het chromosoom of de chromosomen, of gedeelten daarvan, van het organisme dat bestudeerd wordt, en/of (3) cosmide- en/of YAC klonen.2. Hybridization of the separation pattern obtained under 1 with a probe mixture consisting of inter-repeat PCR fragments obtained from (1) purified chromosomes, or parts thereof, of the organism under study, and / or (2) genomic DNA from somatic cell hybrids complementing the chromosome or chromosomes, or parts thereof, of the organism under study, and / or (3) cosmid and / or YAC clones.

De uitvinding kan worden geïllustreerd aan de hand van de volgende experimenten.The invention can be illustrated by the following experiments.

Experiment 1Experiment 1

Met als substraat een aantal genomische DNA monsters van verschillende herkomst werd een PCR reactie uitgevoerd, gebruik makend van PCR primer TC65. De primer werd gesynthetiseerd op een Gene Assembler Plus (Pharmacia, Zweden) en werd direct na de deprotectie-isolatiestap gebruikt zonder verdere opzuivering. De sequentie van deze primer, bestaande uit 30 nucleotiden, is 5'-AAGTCGCGGCCGCTTGCAGTGAGCCGAGAT-3' (zie ook Nelson et al., 1989). De PCR reacties werden uitgevoerd in een totaal volume van 50 μΐ (microliter) met daarin 400 ng genomisch DNA, 1 μΜ primer TC65, 50 mM KC1, 10 mM Tris.HCl pH 8.0, 1.5 mM MgCl2/ 200 μΜ dATP, 200 μΜ dTTP, 200 μΜ dCTP, 200 μΜ dGTP en 1 unit Taq polymerase (Gibco-BRL, Bethesda, Maryland, USA). Gebruikmakend van een geautomatiseerde "thermal cycler" (BIOMED, Duitsland) werden in totaal 30 cycli doorlopen waarbij een cyclus bestond uit achtereenvolgens 2 min denaturatie bij 95°C, 1 min annealing bij 60°C, en 4 min extensie bij 72°C. De eerste denaturatie stap werd met 5 min verlengd en de laatste extensie stap werd met 4 min verlengd. De gebruikte genomische DNA monsters waren Chinese Hamster Ovary (CHO) totaal genomisch DNA en Hela humaan totaal genomisch DNA, en CHO-humaan somatische celhybriden genomisch DNA van de volgende cellijnen: 643C-13, 21q+, R2-10W, ACEM, 2Fur-l, 7253X-6, en 153E7b (zie Gardiner et al., 1990). In Figuur 5A is het humane chromosoom 21 complement van deze hybriden weergegeven. Na afloop van de reactie werd 25 μΐ van het reactiemengsel op een 1 mm dikke 5% polyacrylamide (PAA) gel (acrylamide : bisacrylamide = 37:1) geëlektroforeerd, gebruik makend van een gelapparaat zoals beschreven in Fischer en Lerman, 1979. De elektroforese (2 uur en 250 Volt) vond plaats in lxTAE (40 mM Tris.HCl pH 7.4, 20 mM Na-acetaat, 1 mM Na-EDTA) bij 50°C. Na afloop werd het scheidingspatroon zichtbaar gemaakt door kleuring met ethidiumbromide (0.1 μg per ml) en ontkleuring in water gedurende 30 min. Uit Figuur 5B blijkt dat de TC65 PCR reactie specifiek is voor humaan DNA aangezien geen kleuring optreedt in de laan met PCR produkten van totaal genomisch hamster DNA. In de laan met totaal genomisch humaan DNA is een smeer te zien met een enkele band erin. Dit is te wijten aan het zeer grote aantal verschillende inter-Alu produkten afkomstig van alle humane chromosomen tezamen. In de lanen met de CHO-mens celhybriden zijn echter discrete banden te zien. Aangezien deze hybriden alleen het humane chromosoom 21 hebben, moeten deze banden afkomstig zijn van inter-Alu gebieden op het humane chromosoom 21. De bandenpatronen verschillen onderling hetgeen een afspiegeling is van de verschillende stukken van chromosoom 21 die de desbetreffende cellijn heeft (zie Fig. 5A). Op deze wijze kunnen specifieke banden als afkomstig uit specifieke gebieden op het chromosoom worden geïdentificeerd.Using a number of genomic DNA samples from different origins as a substrate, a PCR reaction was performed using PCR primer TC65. The primer was synthesized on a Gene Assembler Plus (Pharmacia, Sweden) and used immediately after the deprotection isolation step without further purification. The sequence of this primer, consisting of 30 nucleotides, is 5'-AAGTCGCGGCCGCTTGCAGTGAGCCGAGAT-3 '(see also Nelson et al., 1989). The PCR reactions were performed in a total volume of 50 μΐ (microliters) containing 400 ng genomic DNA, 1 μΜ primer TC65, 50 mM KC1, 10 mM Tris.HCl pH 8.0, 1.5 mM MgCl2 / 200 μΜ dATTP, 200 μΜ dTTP , 200 μΜ dCTP, 200 μΜ dGTP and 1 unit Taq polymerase (Gibco-BRL, Bethesda, Maryland, USA). Using an automated "thermal cycler" (BIOMED, Germany), a total of 30 cycles were run, one cycle of consecutive 2 min denaturation at 95 ° C, 1 min annealing at 60 ° C, and 4 min extension at 72 ° C. The first denaturation step was extended by 5 min and the last extension step was extended by 4 min. Genomic DNA samples used were Chinese Hamster Ovary (CHO) total genomic DNA and Hela human total genomic DNA, and CHO human somatic cell hybrids genomic DNA from the following cell lines: 643C-13, 21q +, R2-10W, ACEM, 2Fur-1 , 7253X-6, and 153E7b (see Gardiner et al., 1990). Figure 5A shows the human chromosome 21 complement of these hybrids. At the conclusion of the reaction, 25 μΐ of the reaction mixture was electrophoresed on a 1 mm thick 5% polyacrylamide (PAA) gel (acrylamide: bisacrylamide = 37: 1) using a gel device as described in Fischer and Lerman, 1979. The electrophoresis (2 hours and 250 Volts) was done in 1xTAE (40mM Tris.HCl pH 7.4, 20mM Na Acetate, 1mM Na-EDTA) at 50 ° C. Afterwards, the separation pattern was visualized by staining with ethidium bromide (0.1 μg per ml) and decolorization in water for 30 min. Figure 5B shows that the TC65 PCR reaction is specific for human DNA as no staining occurs in the lane with PCR products from total genomic hamster DNA. In the avenue of total genomic human DNA, a smear with a single band can be seen. This is due to the very large number of different inter-Alu products from all human chromosomes combined. However, discrete bands can be seen in the avenues with the CHO-human cell hybrids. Since these hybrids have only human chromosome 21, these bands must come from inter-Alu regions on the human chromosome 21. The band patterns differ from each other, reflecting the different stretches of chromosome 21 that the cell line has (see Fig. 5A). In this way, specific bands as coming from specific regions on the chromosome can be identified.

Experiment 2Experiment 2

Zoals beschreven onder experiment 1 werd een TC65 PCR reactie uitgevoerd, waarbij nu als substraat genomisch DNA van de cellijn 7253X6 werd vergeleken met Hela humaan genomisch DNA. Na de PCR reactie werd 25 μΐ van beide reaktieprodukten gescheiden op een PAA gel zoals boven beschreven. Na kleuring van dit 1-D scheidingspatroon werden de fragmenten met een lengte gelegen tussen 10 kilobaseparen (kb) en 600 baseparen (bp) als laantjes uitgesneden en opgebracht op een 2-D PAA gel. De 2-D gel was een 1 mm dikke 6% PAA gel (zie boven) die een 10-75% lineaire gradiënt bevatte van de denaturantia ureum en formamide (100 % denaturantia komt overeen met 7.0 M ureum, 40% formamide) parallel aan de richting van de electroforese. De gels werden bereid door de twee oplossingen met de twee uiterste denaturantia concentraties, welke het traject van de gradiënt bepalen, te mengen in een gradiënt mixer (Gibco-BRL) hierbij gebruik makend van een peristaltische pomp (LKB, Zweden). De electroforese voor de tweede dimensie scheiding werd uitgevoerd bij 55°C in lxTAE, gedurende 12 uur. Na afloop van de scheiding werd de 2-D gel gekleurd zoals boven beschreven (zie Figuur 6). Het scheidingspatroon van 7253X6 toont aan dat de TC65 inter-Alu PCR fragmenten focusseren als spots in de 2-D gel. Op de plaats waar de TC65 inter-Alu PCR produkten van totaal genomisch humaan Hela DNA zich bevinden is niets op gel te zien omdat de concentratie van individuele PCR fragmenten te laag is om met ethidiumbromide kleuring aan te tonen.As described under experiment 1, a TC65 PCR reaction was performed, now comparing genomic DNA of the cell line 7253X6 as Hela human genomic DNA as substrate. After the PCR reaction, 25 µl of both reaction products were separated on a PAA gel as described above. After staining this 1-D separation pattern, the fragments of length between 10 kilobase pairs (kb) and 600 base pairs (bp) were cut in lanes and applied to a 2-D PAA gel. The 2-D gel was a 1 mm thick 6% PAA gel (see above) containing a 10-75% linear gradient of the denaturants urea and formamide (100% denaturants corresponds to 7.0 M urea, 40% formamide) parallel to the direction of electrophoresis. The gels were prepared by mixing the two solutions with the two extreme denaturant concentrations, which determine the range of the gradient, in a gradient mixer (Gibco-BRL) using a peristaltic pump (LKB, Sweden). The electrophoresis for the second dimension separation was performed at 55 ° C in 1xTAE, for 12 hours. At the end of the separation, the 2-D gel was stained as described above (see Figure 6). The 7253X6 separation pattern shows that the TC65 inter-Alu PCR fragments focus as spots in the 2-D gel. At the site where the TC65 inter-Alu PCR products of total genomic human Hela DNA are located, nothing is seen on gel because the concentration of individual PCR fragments is too low to be shown by ethidium bromide staining.

Om deze fragmenten zichtbaar te maken werd het 2-D scheidingspatroon overgebracht op een nylon membraan (Hybond N-plus, Amersham, UK) door middel van electroblotting tussen horizontale grafiet platen met de anode aan de bovenkant (zie ook Vijg en Uitterlinden, EP-A-0 349 024) . Hiertoe werd de 2-D gel eerst gedurende 4 min bestraald met UV licht van 302 nm (Transilluminator, UV products, CA, USA) . De gel werd op het nylon membraan gelegd en vervolgens tussen aan weerszijden drie Whatmann 3MM papierbladen gelegd die met lxTBE (89 mM Tris. boraat pH 8.0, 89 mM boorzuur, 2 mM Na-EDTA) verzadigd waren. Deze sandwich werd tussen de grafietplaten gelegd en de electro-blotprocedure werd 1 uur uitgevoerd waarbij de spanning opliep van 6 tot 28 Volt en de stroom constant op 400 mA werd gehouden. Na de electroblotting werd het nylon membraan op een blad Whatmann 3MM gelegd dat verzadigd was met 0.4 N natriumhydroxide en vervolgens 10 min in de 1 M Tris.HCl pH 8.0 gelegd voor de neutralisatie, om zodoende de DNA fragmenten op het membraan enkelstrengs te maken. Het membraan werd aan de lucht gedroogd en vervolgens met 302 nm UV bestraald om de DNA fragmenten aan het membraan te binden door cross-linking. Dit membraan werd vervolgens onderworpen aan hybridisatieanalyse waarbij als probe gebruikt werd 3 μΐ van het TC65 inter-Alu PCR mengsel verkregen met 7253X6 als substraat (en waarvan 25 μΐ in de eerste dimensie gescheiden werd op gel, zie Figuur 5 en 6). Deze fragmenten werden met a32P-dCTP gelabeld in de random prime labelling (Feinberg en Vogelstein, 1984). Voor gebruik in de hybridisatie werd dit gelabelde probe mengsel enkelstrengs gemaakt door het 5 min te laten koken en werd het vervolgens gepreïncubeerd met 200 μg gedeeltelijk afgebroken humaan DNA in een totaal volume van 1 ml gedurende 1 uur bij 65°C, om kruishybridisatie met de Alu repeats zelf te onderdrukken en alleen de inter-Alu sequenties te laten hybridiseren.To visualize these fragments, the 2-D separation pattern was transferred to a nylon membrane (Hybond N-plus, Amersham, UK) by electroblotting between horizontal graphite plates with the anode at the top (see also Vijg and Uitterlinden, EP- A-0 349 024). To this end, the 2-D gel was first irradiated with UV light of 302 nm for 4 min (Transilluminator, UV products, CA, USA). The gel was placed on the nylon membrane and then placed on either side of three Whatmann 3MM paper sheets saturated with 1xTBE (89 mM Tris. Borate pH 8.0, 89 mM boric acid, 2 mM Na-EDTA). This sandwich was placed between the graphite plates and the electro-blotting procedure was carried out for 1 hour with the voltage rising from 6 to 28 Volts and the current kept constant at 400 mA. After electroblotting, the nylon membrane was placed on a Whatmann 3MM sheet saturated with 0.4 N sodium hydroxide and then placed in the 1 M Tris.HCl pH 8.0 for 10 min for neutralization, so as to make the DNA fragments on the membrane single stranded. The membrane was air dried and then irradiated with 302 nm UV to bind the DNA fragments to the membrane by cross-linking. This membrane was then subjected to hybridization analysis using 3 μΐ of the TC65 inter-Alu PCR mixture obtained with 7253X6 as the substrate (and 25 μΐ of which were separated on gel in the first dimension, see Figures 5 and 6). These fragments were labeled with a32P-dCTP in the random prime labeling (Feinberg and Vogelstein, 1984). For use in the hybridization, this labeled probe mixture was made single stranded by boiling for 5 min and then incubated with 200 μg of partially degraded human DNA in a total volume of 1 ml for 1 hour at 65 ° C to cross hybridize with the Suppress Alu repeats yourself and only allow the inter-Alu sequences to hybridize.

Hybridisatieanalyse werd uitgevoerd in glazen buizen in een hybridisatie oven (GFL, Duitsland) bij 65°C. Het membraan werd eerst 15 min gepreïncubeerd in de hybridisatievloeistof die bestond uit 7 % SDS, 0.5 M Na-fosfaat pH 7.2, 1 mM Na-EDTA. Hierna werd de gelabelde en gepreïncubeerde 7253X6 TC65 inter-Alu probe erbij gedaan en vond de hybridisatiereaktie plaats gedurende 16 uur. Hierna werd het membraan achtereenvolgens gewassen in 2,5 x SSC/0.1 % SDS, 1 x SSC/0.1 % SDS, en 0,1 x SSC/0.1 % SDS (1 x SSC komt overeen met 150 mM NaCl en 15 mM Na-citraat) bij 65°C gedurende 30 min voor iedere wasstap. Aan het membraan werd vervolgens een Kodak XAR film blootgesteld gedurende 5 uur en daarna gedurende 48 uur bij -80°C. Figuur 7 toont dat na hybridisatie hetzelfde scheidingspatroon voor de 7253X6 TC65 inter-Alu PCR produkten wordt zichtbaar gemaakt als hetgeen we na ethidiumbromide kleuring zagen. Belangrijker is dat we op de plaats van de Hela TC65 inter-Alu produkten ook spots kunnen waarnemen. Dit toont aan dat het mogelijk is om in een inter-Alu PCR reaktie op totaal genomisch humaan Hela DNA bepaalde inter-Alu produkten zichtbaar te maken door middel van hybridisatie met gelabelde inter-Alu produkten. De plaats van de spots in het Hela patroon komt overeen met die in het 7253X6 patroon.Hybridization analysis was performed in glass tubes in a hybridization oven (GFL, Germany) at 65 ° C. The membrane was first incubated for 15 min in the hybridization fluid consisting of 7% SDS, 0.5 M Na phosphate pH 7.2, 1 mM Na-EDTA. After this, the labeled and pre-incubated 7253X6 TC65 inter-Alu probe was added and the hybridization reaction took place for 16 hours. After this, the membrane was successively washed in 2.5 x SSC / 0.1% SDS, 1 x SSC / 0.1% SDS, and 0.1 x SSC / 0.1% SDS (1 x SSC corresponds to 150 mM NaCl and 15 mM Na- citrate) at 65 ° C for 30 min for each wash step. A Kodak XAR film was then exposed to the membrane for 5 hours and then at -80 ° C for 48 hours. Figure 7 shows that after hybridization, the same separation pattern for the 7253X6 TC65 inter-Alu PCR products is visualized as what we saw after ethidium bromide staining. More importantly, we can also spot spots on the Hela TC65 inter-Alu products. This shows that it is possible to visualize certain inter-Alu products in an inter-Alu PCR reaction on total genomic human Hela DNA by hybridization with labeled inter-Alu products. The location of the spots in the Hela pattern corresponds to that in the 7253X6 pattern.

Experiment 3Experiment 3

De onder experiment 1 en 2 beschreven analyses zijn verricht met een primer (TC65) die specifiek is voor het 3’ uiteinde van de Alu repeat en die een inter-Alu produkt oplevert indien de flankerende Alu repeats in een bepaalde geïnverteerde oriëntatie gelegen zijn. Het is echter ook mogelijk een primer (517) te kiezen die specifiek is voor Alu en die inter-repeat PCR produkten oplevert indien de flankerende Alu repeats juist de omgekeerde oriëntatie hebben (zie tevens de Figuren 2 en 3). Verder zijn vergelijkbare PCR produkten te verkrijgen indien primers worden gekozen voor repeats zoals de Κρη I repeats (zie Tabel 3) . Deze hebben een soortgelijke verspreiding door het genoom en een vergelijkbaar kopie aantal. Met behulp van de beschreven Kpn primers in combinatie met de Alu primers werden PCR experimenten onder vergelijkbare condities verricht en werden eveneens bandenpatronen verkregen vergelijkbaar met die verkregen met de Alu primers alleen (zie de Figuren 8 en 9) .The analyzes described under Experiments 1 and 2 were performed with a primer (TC65) specific for the 3 'end of the Alu repeat and yielding an inter-Alu product if the flanking Alu repeats are in a certain inverted orientation. However, it is also possible to choose a primer (517) which is specific for Alu and which yields inter-repeat PCR products if the flanking Alu repeats have just the reverse orientation (see also Figures 2 and 3). Similar PCR products are also available if primers are chosen for repeats such as the Iρη I repeats (see Table 3). These have a similar distribution across the genome and a similar copy number. Using the described Kpn primers in combination with the Alu primers, PCR experiments were performed under similar conditions and band patterns similar to those obtained with the Alu primers alone were also obtained (see Figures 8 and 9).

Experiment 4Experiment 4

Naast primers specifiek voor repeats die verspreid door het genoom voorkomen, zijn inter-repeat primers te gebruiken die specifiek zijn voor in de centromeren gelegen repeats zoals de alphoïde satellite repeats (LI.26 en anderen). Indien deze primers in combinatie met Alu en/of Kpn primers gebruikt worden in soortgelijke experimenten als experimenten 1, 2 en 3, kunnen bandenpatronen worden verkregen (zie Figuur 9), vergelijkbaar met die welke in de Figuren 5 en 8 zijn getoond.In addition to primers specific to repeats occurring throughout the genome, inter-repeat primers specific to centromere repeats such as the alphoid satellite repeats (LI.26 and others) can be used. If these primers are used in combination with Alu and / or Kpn primers in experiments similar to Experiments 1, 2 and 3, band patterns can be obtained (see Figure 9), similar to those shown in Figures 5 and 8.

Bijschriften bij de FigurenCaptions to the Figures

Ficuur 1Bill 1

Tweedimensionaal scheidingspatroon, gegenereerd met behulp van minisatellite core probe 33.6 van humane HaelII DNA restrictiefragmenten afkomstig van een moeder (cirkel), vader (vierkant rechts) en hun zoon (vierkant midden).Two-dimensional separation pattern, generated using minisatellite core probe 33.6 from human HaelII DNA restriction fragments from a mother (circle), father (square right) and their son (square center).

Figuur 2Figure 2

Schematisch overzicht van het principe van de inter-Alu PCR amplificatie met behulp van primers TC65 en 517 (zie Nelson et al., 1989).Schematic overview of the principle of inter-Alu PCR amplification using primers TC65 and 517 (see Nelson et al., 1989).

Figuur 3Figure 3

Schematisch overzicht van de bindingsplaatsen van de Alu-specifieke primers op de Alu repeat.Schematic overview of the binding sites of the Alu-specific primers on the Alu repeat.

Figuur 4 A. Schematisch overzicht van de opbouw en kopieaantal in het humane genoom van Kpn/LINE repetitieve sequenties.Figure 4 A. Schematic overview of the structure and copy number in the human genome of Kpn / LINE repetitive sequences.

B. Schematisch overzicht van de bindingsplaatsen van de Kpn/LINE-specifieke PCR primers.B. Schematic overview of the binding sites of the Kpn / LINE-specific PCR primers.

Figuur 5 A. Schematisch overzicht van de samenstelling voor wat betreft de chromosoom 21 inhoud van humaan-hamster somatische cel hybriden gebruikt voor de inter-repeat PCR amplifikaties.Figure 5 A. Schematic overview of the composition for the chromosome 21 content of human hamster somatic cell hybrids used for the inter-repeat PCR amplifications.

B. Met ethidiumbromide aangekleurd ééndimensionaal scheidingspatroon van de PCR produkten, verkregen na een inter-Alu PCR amplifikatie met behulp van primer TC65 op de leden van het somatische hybriden panel getoond in 5A en op totaal hamster genomisch DNA en totaal humaan genomisch DNA.B. Ethidium bromide stained one-dimensional separation pattern of the PCR products obtained after an inter-Alu PCR amplification using primer TC65 on the members of the somatic hybrid panel shown in 5A and on total hamster genomic DNA and total human genomic DNA.

Eig.uur, 6Property time, 6

Met ethidiumbromide aangekleurd tweedimensionaal scheidingspatroon van inter-Alu PCR amplifikatie produkten, verkregen met primer TC65 uit de somatische cel hybride 72532X6.Ethidium bromide stained two-dimensional separation pattern of inter-Alu PCR amplification products obtained with primer TC65 from the somatic cell hybrid 72532X6.

Figuur 7Figure 7

Autoradiogrammen (A is de korte en B is de lange belichting) van een tweedimensionaal scheidingspatroon van inter-Alu PCR amplifikaties met primer TC65 van humaan totaal genomisch DNA (Hela) en van de somatische cel hybride 72532X6. Pijlen verwijzen naar spots in het Hela scheidingspatroon na de lange belichting die op eenzelfde plaats in het 72532X6 patroon te herkennen zijn.Autoradiograms (A is the short and B is the long exposure) of a two-dimensional separation pattern of inter-Alu PCR amplifications with primer TC65 of human total genomic DNA (Hela) and of the somatic cell hybrid 72532X6. Arrows refer to spots in the Hela separation pattern after the long exposure that can be recognized in the same place in the 72532X6 pattern.

Figuur 8Figure 8

Met ethidiumbromide aangekleurd ééndimensionaal scheidingspatroon van inter-repeat PCR amplifikatie produkten, verkregen met een combinatie van de Alu-specifieke primer TC65 met de Kpn-specifieke PCR primers KpnA, -B, -C, en -D met als substraat totaal hamster genomisch DNA en DNA uit de somatische celhybride 72532X6.One-dimensional separation pattern of inter-repeat PCR amplification products stained with ethidium bromide, obtained with a combination of the Alu-specific primer TC65 with the Kpn-specific PCR primers KpnA, -B, -C, and -D with substrate total hamster genomic DNA and DNA from the somatic cell hybrid 72532X6.

Figuur 9Figure 9

Met ethidiumbromide aangekleurd ééndimensionaal scheidingspatroon van inter-repeat PCR amplifikatie produkten, verkregen met de Alu-specifieke primers 517 en TC65 in combinatie met de Kpn-specifieke primers KpnA, -B, -C, en -D en in combinatie met de chromosoom 21-specifieke centromeerprimers 26.5B, 26W en 26.3 met als substraat totaal hamster genomisch DNA en DNA van de somatische celhybride 153E7b.One-dimensional separation pattern of inter-repeat PCR amplification products stained with ethidium bromide, obtained with the Alu-specific primers 517 and TC65 in combination with the Kpn-specific primers KpnA, -B, -C, and -D and in combination with the chromosome 21- specific centromere primers 26.5B, 26W and 26.3 with substrate total hamster genomic DNA and DNA of the somatic cell hybrid 153E7b.

REFERENTIESREFERENCES

Cotter, F.E., Hampton, G.M., Nasipuri, S., Bodmer, W.F., and Young, B.D. (1990) Genomics 7, 257-263.Cotter, F.E., Hampton, G.M., Nasipuri, S., Bodmer, W.F., and Young, B.D. (1990) Genomics 7, 257-263.

Devilee, P., Slagboom, P., Cornelisse, C.J., and Pearson, P.L. (1988) Nucl. Acids Res. 14, 2059-2073.Devilee, P., Slagboom, P., Cornelisse, C.J., and Pearson, P.L. (1988) Nucl. Acids Res. 14, 2059-2073.

Donis-Keller, H. et al. (1987) Cell 51, 319-337. Economou, E.P., Bergen, A.W., Warren, A.C., and Antonarakis, S.E. (1990) Proc. Natl. Acad. Sci. USA 87, 2951-2954.Donis-Keller, H. et al. (1987) Cell 51, 319-337. Economou, E.P., Bergen, A.W., Warren, A.C., and Antonarakis, S.E. (1990) Proc. Natl. Acad. Sci. USA 87, 2951-2954.

Epstein, N., Nahor, 0., and Silver, J. (1990) Nucl.Epstein, N., Nahor, 0., and Silver, J. (1990) Nucl.

Acids Res. 18, 4634.Acids Res. 18, 4634.

Feinberg, A.P., and Vogelstein, B. (1984) Anal. Biochem. 137, 266-267.Feinberg, A.P., and Vogelstein, B. (1984) Anal. Biochem. 137, 266-267.

Fischer, S.G., and Lerman, L.S. (1979) Cell 16, 191-200. Fischer, S.G., and Lerman, L.S. (1983) Proc. Natl. Acad. Sci. USA 80, 1579-1583.Fischer, S.G., and Lerman, L.S. (1979) Cell 16, 191-200. Fischer, S.G., and Lerman, L.S. (1983) Proc. Natl. Acad. Sci. USA 80, 1579-1583.

Gardiner, K. Horisberger, M., Kraus, J., Tantravahi, U., Korenberg, J., Rao, V., Reddy, S., and Patterson, D. (1990) EMBOGardiner, K. Horisberger, M., Kraus, J., Tantravahi, U., Korenberg, J., Rao, V., Reddy, S., and Patterson, D. (1990) EMBO

J. 9, 25-34.J. 9, 25-34.

Korenberg, J.R., and Rykowsky, M.C. (1988) Cell 53, 391- 400.Korenberg, J.R., and Rykowsky, M.C. (1988) Cell 53, 391-400.

Ledbetter, S.A., Nelson, D.L., Warren, S.T., and Ledbetter, D.H. (1990a) Genomics 6, 475-481.Ledbetter, S.A., Nelson, D.L., Warren, S.T., and Ledbetter, D.H. (1990a) Genomics 6, 475-481.

Ledbetter, S.A., Garcia-Heras, J., and Ledbetter, D.H. (1990b) Genomics 8, 614-622.Ledbetter, S.A., Garcia-Heras, J., and Ledbetter, D.H. (1990b) Genomics 8, 614-622.

Lengauer, C., Riethman, H., and Cremer, T. (1990) Hum. Genet. 86, 1—6.Lengauer, C., Riethman, H., and Cremer, T. (1990) Hum. Genet. 86, 1-6.

Lerman, L.S., Fischer, S.G., Hurley, I., Silverstein, K. , and Lumelsky, N. (1984) Ann. Rev. Biophys. Bioeng. 13, 399-423.Lerman, L.S., Fischer, S.G., Hurley, I., Silverstein, K., and Lumelsky, N. (1984) Ann. Rev. Biophys. Bioeng. 13, 399-423.

Lichter, P., Ledbetter, S.A., Ledbetter, D.H., and Ward, D.C. (1990) Proc. Natl. Acad. Sci. USA 87, 6634-6638.Lichter, P., Ledbetter, S.A., Ledbetter, D.H., and Ward, D.C. (1990) Proc. Natl. Acad. Sci. USA 87, 6634-6638.

Moyzis, R.K., Torney, D.C., Meyne, J., Buckingham, J.M., Wu, J.-R., Burks, C., Sirotkin, K.M., and Goad, W.B. (1989) Genomics 4, 273-289.Moyzis, R.K., Torney, D.C., Meyne, J., Buckingham, J.M., Wu, J.-R., Burks, C., Sirotkin, K.M., and Goad, W.B. (1989) Genomics 4, 273-289.

Nelson, D.L., Ledbetter, S.A., Corbo, L., Victoria, M.F., Ramirez-Solis, R., Webster, T.D., Ledbetter, D.H., and Caskey, C.T. (1989) Proc. Natl. Acad. Sci. USA 86, 6686-6690.Nelson, D.L., Ledbetter, S.A., Corbo, L., Victoria, M.F., Ramirez-Solis, R., Webster, T.D., Ledbetter, D.H., and Caskey, C.T. (1989) Proc. Natl. Acad. Sci. USA 86, 6686-6690.

Orita, M., Sekiya, T., and Hayashi, K. (1990) Genomics 8, 271-278.Orita, M., Sekiya, T., and Hayashi, K. (1990) Genomics 8, 271-278.

Royle, N.J., Clarkson, R.E., Wong, Z., and Jeffreys, A.J. (1989) Genomics 3, 352-360.Royle, N.J., Clarkson, R.E., Wong, Z., and Jeffreys, A.J. (1989) Genomics 3, 352-360.

Schmid, C.W., and Jelinek, W.R. (1982) Science 216, 1065-1070.Schmid, C.W., and Jelinek, W.R. (1982) Science 216, 1065-1070.

Southern, E.M. (1975) J. Mol. Biol. 98, 503-517. Uitterlinden, A.G., Slagboom, P.E., Knook, D.L., and Vijg, J. (1989) Proc.Natl.Acad.Sci.USA 86, 2742-2746.Southern, E.M. (1975) J. Mol. Biol. 98, 503-517. Uitterlinden, A.G., Slagboom, P.E., Knook, D.L., and Vijg, J. (1989) Proc.Natl.Acad.Sci.USA 86, 2742-2746.

Uitterlinden, A.G., and Vijg, J. (1989) TIBTECH 7, 336- 341.Uitterlinden, A.G., and Vijg, J. (1989) TIBTECH 7, 336- 341.

Zuliani, G., and Hobbs, H.H. (1990) Am. J. Hum. Genet. 46, 963-969.Zuliani, G., and Hobbs, H.H. (1990) Am. J. Hum. Genet. 46, 963-969.

Claims

A method for detecting genetic variation by subjecting DNA fragments, derived from a DNA sample to be examined, to a two-dimensional electrophoretic separation in which the fragments in one dimension are based on differences in length, and in the other dimension are based on differences in base order are separated, transferring the resulting separation pattern to a membrane filter and subjecting the transferred separation pattern to a hybridization analysis using one or more DNA or RNA probes, characterized in that DNA fragments consisting of inter -repeat sequences generated from the DNA to be tested by a polymerase chain reaction (PCR) with repeat-specific primer (s).

Method according to claim 1, characterized in that the hybridization analysis uses as probe one or more inter-repeat sequences which are performed on subgenomic DNA by means of a PCR with repeat-specific primer (s). DNA from one or part of a chromosome has been generated.

Method according to claim 2, characterized in that the subgenomic DNA is obtained from total genomic DNA by flow sorting.

Method according to claim 2, characterized in that the subgenomic DNA originates from a hybrid cell line.

Method according to claim 2, characterized in that the subgenomic DNA originates from a cosmid or yeast artificial chromosome (YAC) clone.

Method according to one or more of the preceding claims, characterized in that inter-Alu sequences generated by PCR with Alu-specific primer (s) are used.

A method according to claim 6, characterized in that the PCR uses Alu-specific primer (s) selected from the group consisting of TC65, 517, PDJ33, PDJ34, PDJ33A, PDJ34A and PRIM IV.

Method according to one or more of claims 1 to 5, characterized in that inter-Kpn sequences are generated which have been generated by means of a PCR with Kpn-specific primer (s).

Method according to claim 6, characterized in that the PCR uses Kpn-specific primer (s) selected from the group consisting of KpnA, KpnB, KpnBl, KpnC, KpnCl, KpnD and LIHs.

Method according to one or more of claims 1 to 5, characterized in that inter-repeat sequences between an Alu-repeat and a Kpn-repeat are used, which by means of a PCR with an Alu-specific and a Kpn-specific primer have been generated.

The method according to claim 10, characterized in that the PCR uses an Alu-specific primer selected from the group consisting of TC65, 517, PDJ33, PDJ34, PDJ33A ,. PDJ34A and PRIM IV, and a Kpn-specific primer selected from the group consisting of KpnA, KpnB, KpnBl, KpnC, KpnCl, KpnD and LIHs.

Method according to one or more of claims 1 to 5, characterized in that intercentromere repeat sequences are generated which have been generated by means of a PCR with centromere repeat specific primer (s).

13. A method according to claim 12, characterized in that the PCR uses a centromere repeat specific primer selected from the group consisting of L1265a, L1265b, L1263, L126W, L1263 'and L126N.

Method according to one or more of claims 1 to 5, characterized in that inter-telomeric repeat sequences are generated which are generated by means of a PCR with telomeric repeat-specific primer (s).

Method according to one or more of the preceding claims, characterized in that the probe used in the hybridization analysis is labeled with a radioisotope such as 32p and 35s, a hapten such as biotin and digoxigenin, and / or with a fluorescent dust.