NL2033043B1 - Primer probe set, kit and application of multiplex fluorescent pcr detection of goose astrovirus with different genotypes - Google Patents

Abstract

Disclosed is a primer probe set, a kit and an application of multiplex fluorescent PCR detection of goose astrovirus with different genotypes, and relates to the technical field of molecular biology: the primer probe set includes primer pairs and probes for detecting GoAstV-1 and GoAstV-2; the primer pair for detecting GoAstV-1 is shown in SEQ ID NO.1-2, and the probe is shown in SEQ ID No.3; the primer pair for detecting GoAstV-2 is shown in SEQ ID NO. 4-5, and the probe is shown in SEQ ID NO. 6. The primer probe set of the invention realizes real-time fluorescence quantitative PCR detection of different genotypes of GoAstV TaqMan. The detection method has good specificity, sensitivity and repeatability, and provides technical support for clinical diagnosis, viral load measurement and epidemiological investigation of GoAstV.

Description

PRIMER PROBE SET, KIT AND APPLICATION OF MULTIPLEX FLUORESCENT PCR

DETECTION OF GOOSE ASTROVIRUS WITH DIFFERENT GENOTYPES

TECHNICAL FIELD

The invention relates to the technical field of molecular biology, and in particular to a primer probe set, a kit and an application of multiplex fluorescent PCR detection of goose astrovirus with different genotypes.

BACKGROUND

Goose astrovirus disease is a fatal infectious disease caused by goose astrovirus (GoAstV) infection, and characterized by joint and visceral gout of many breeds of geese. The highest infection rate and death rate of infected geese reach 80% and 50% respectively, causing huge economic losses to the goose industry. GoAstV mainly infects goslings less than 3 weeks old, causing a large amount of urate deposition on the surface of heart, liver, kidney and joint cavity. In addition, GoAstV also infects chickens, ducks and other poultry, and that indicates that GoAstV has the possibility of cross-species transmission, bringing new challenges to the prevention and control of the disease.

GoAstV belongs to the astrovirus genus of the astroviridae family and is a single stranded positive stranded RNA virus without envelope. According to the different hosts of astrovirus infection, it is divided into two genera: mamastrovirus (MAstV) and avastrovirus (AAstV). At present, the ninth report of the International Committee on Taxonomy of Viruses divides the

AAstV genus into three groups, namely, avastrovirus group 1 (AAstV-1), avastrovirus group 2 (AAstV-2) and avastrovirus group 3 (AAstV-3). GoAstV belongs to AAstV-1 and is a new type of astrovirus. The first GoAstV whole genome sequence was reported by Zhang Dabing in 2017 and named FLX. Since then, several whole genome sequences of GoAstV strains have been reported successively, such as GD, SDPY, HN1G, SD01, GsFJ02, etc. Genetic evolution analysis shows that all known GoAstV sequences belong to two different phylogenetic branches. According to the genetic evolution relationship, GoAstV is divided into two types: FLX type strain is named GoAstV-1, and SD01 type strain is named GoAstV-2, also called new

GoAstV. Because GoAstV-1 strain lacks a cell culture system suitable for proliferation, it is difficult to isolate and culture GoAstV-1 strain, and its pathogenicity is difficult to verify. The first goose origin astrovirus strain (SD-01} was isolated by Zhang Qingshui and others in 2018.

Subsequently, several GoAstV-2 strains were successfully isolated, such as SDPY, GD, CXZ18 and so on.

The laboratory diagnosis methods of GoAstV mainly include virus isolation and identification, electron microscope observation and molecular biology methods. The isolation and identification of virus is a traditional detection method of GoAstV. This method mainly involves inoculation of goose embryo or chicken liver cancer cells. Generally, it needs to be passed to about 3 generations before goose embryo death or obvious lesions appear, and it is time-consuming. Electron microscopy is one of the early detection methods of astrovirus.

However, Yuan et al. failed to observe the specific morphology of astrovirus by using ultra-thin sections of goose liver. Therefore, this method has certain defects. The molecular biological detection methods of GoAstV mainly include RT-PCR, fluorescent quantitative RT-PCR, RT-

LAMP, etc. RT-PCR directly detects GoAstV in goose diseased tissues with high sensitivity and specificity. The diagnosis of GoAstV-1 mainly focuses on the preparation of polyclonal antibody.

Liu Li et al. expressed the structural protein ORF2 of GoAstV-1 by using the prokaryotic expression system and prepared its polyclonal antibody. However, there are few reports on the molecular biological diagnosis technology of GoAstV-1. At present, the diagnostic research on

GoAstV is mainly focused on GoAstV-2. Yu Mingxing et al. designed and screened specific amplification primers according to ORF2 Gene sequence. Through optimizing amplification conditions, RT-PCR method for detecting GoAstV-2 was established. The method has strong specificity and detection sensitivity of 62 fg/ ul. Zhang Yuxia et al. designed a set of specific

LAMP primers according to the conserved sequence of GoAstV ORF1b gene and established a

LAMP rapid detection method for GoAstV-2. The method has strong specificity and sensitivity of 1 ng/ul. RT-PCR and RT-LAMP do not detect GoAstV-2 quantitatively, so establishing a rapid, sensitive and specific fluorescent quantitative molecular diagnosis method is one of the main measures to effectively prevent and control the disease. At present, some researchers have established SYBR Green | real-time fluorescence quantitative PCR method. Yuan et al. have established GoAstV-2 real-time fluorescence quantitative PCR method. But compared with this method, TagMan probe fluorescence quantification has obvious advantages in absolute quantification of target genes. Su Shibo et al. have established GoAstV-2 TagMan fluorescence quantitative PCR detection method, and this method has strong specificity and detection limit of 1.5 x 10% copies/ ul.

At present, there are no treatment measures or vaccines for the disease, and the prevention and treatment focus on the detection and control of the epidemic. Therefore, itis particularly important to establish a rapid, accurate and time-saving detection method for epidemic prevention and control. TagMan fluorescent quantitative PCR has the advantages of strong specificity and high sensitivity, and has obvious advantages in absolute quantification of target genes. It has been widely used in clinical diagnosis of animal diseases and determination of viral load. According to the epidemiological investigation results, the mixed infection of

GoAstV-1 and GoAstV-2 is serious. Therefore, the present invention aims to establish a real- time fluorescent quantitative PCR method for GoAstV TagMan of different genotypes, and provide technical support for clinical diagnosis, viral load determination and epidemiological investigation of GoAstV. Multiplex fluorescent PCR detects more than two kinds of pathogens qualitatively and quantitatively at the same time, but it is difficult to realize, and is mainly reflected in the following aspects: (1) it is necessary to design conservative primers and probes for different viruses respectively; (2) each primer of multiplex PCR does not interfere with each other and each probe does not interfere with each other; (3) technical parameters such as gPCR amplification efficiency and detection sensitivity are not greatly affected by multiplex

PCR.

SUMMARY

The objective of the present invention is to provide a primer probe set, a kit and an application of multiplex fluorescent PCR detection of goose astrovirus with different genotypes, so as to solve the problems existing in the prior art. The primer probe set of the present invention realizes multiple fluorescence PCR detection of goose astrovirus with different genotypes, and the detection method has good specificity, sensitivity and repeatability.

To achieve the above purpose, the present invention provides the following solutions.

The invention provides a primer probe set of multiple fluorescence PCR detection of goose astrovirus with different genotypes, which includes primer pairs and probes for detecting

GoAstV-1 and GoAstV-2; the primer pair for detecting GoAstV-1 is shown in SEQ ID NO. 1-2, and the probe is shown in SEQ ID NO.3; the primer pair for detecting GoAstV-2 is shown in

SEQ ID NO.4-5, and the probe is shown in SEQ ID NO.6.

The invention also provides an application of the primer probe set in preparing a kit of multiple fluorescence PCR detection of goose astrovirus with different genotypes.

The invention also provides a kit of multiplex fluorescence PCR detection of goose astrovirus with different genotypes, which includes the primer probe set.

Further, the kit also includes standard plasmids of GoAstV-1 and GoAstV-2, wherein the standard plasmid of GoAstV-1 contains a sequence shown in SEQ ID NO.7; the standard plasmid of GoAstV-2 contains a sequence shown in SEQ ID NO.8.

Further, the reaction system of multiplex fluorescence PCR of the kit is as follows: 0.4 ul of 10 pmol/ul GoAstV-1 upstream primer, 0.4 pl of 10 pmol/ul GoAstV-1 downstream primer, 0.2 pl of 10 pmol/ul GoAstV-1 probe, 0.4 pl of 10 pmol/ul GoAstV-2 upstream primer, 0.4 pl of 10 pmol/pl GoAstV-2 downstream primer, 0.2 ul of 10 pmol/pl GoAstV-2 probe, 2 pl of Template, 10 pl of 2 x AceQ qPCR Probe Master Mix, 0.4 pl of 50 x ROX Reference Dye 2, 1 pl of 50 mmol/l MgCl. and 20 pl of ddH20.

Further, the reaction procedure of multiplex fluorescent PCR of the kit is: 95°C for 5 min; 95°C for 10 s, 60°C for 30 s, 40 cycles.

The invention discloses the following technical effects.

The invention provides a primer probe set of multiple fluorescence PCR detection of goose astrovirus with different genotypes. The primer probe set of the invention realizes real-time fluorescence quantitative PCR detection of different genotypes of GoAstV TagMan. The detection method has good specificity, sensitivity and repeatability, and provides technical support for clinical diagnosis, viral load measurement and epidemiological investigation of

GoAstV.

BRIEF DESCRIPTION OF THE FIGURES

In order to explain the embodiment of the invention or the technical scheme in the prior art more clearly, the drawings used in the embodiment will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the invention. For ordinary technicians in the field, other drawings can be obtained according to these drawings without making creative efforts.

Fig. 1 is an amplification curve of GoAstV-1 (primers and probes are shown in SEQ ID No. 1- 3); where, 1-9 represent 10'-10° DNA copy numbers/ul standard plasmid.

Fig. 2 is a standard curve of GoAstV-1.

Fig. 3 is an amplification curve of GoAstV-2 (primers and probes are shown in SEQ ID No. 4- 6); where, 1-9 represent 10°-10% DNA copy numbers/ul standard plasmid.

Fig. 4 is a standard curve of GoAstV-2.

Fig. 5 is a combined plot of standard curves of GoAstV-1 and GoAstV-2.

Fig. 6 is an amplification curve obtained by using the primers and probes shown in SEQ ID No. 9-14, wherein A is GoAstV-1; B is GoAstV-2.

Fig. 7 is a specificity test of multiplex fluorescent PCR; wherein, 1: GoAstV-1; 2: GoAstV-2; 3: goose parvovirus (GPV); 4: goose paramyxovirus (NDV); 5: avian reovirus (ARV); 6: negative control.

Fig. 8 is a sensitivity test of multiplex fluorescent PCR; where, 1-9 represent 10%-10° DNA copy numbers/ul standard plasmid; 10 represents a negative control; A is GoAstV-1; B is

GoAstV-2.

Fig. 9 is repeatability test results; where A is GoAstV-1, and B is GoAstV-2.

Fig. 10is a detection of GoAstV-1 and GoAstV-2 in clinical samples.

Fig. 11 is a detection of cytotoxic CT value of GoAstV-2.

DESCRIPTION OF THE INVEN TION

Various exemplary embodiments of the present invention will now be described in detail, which should not be regarded as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics and embodiments of the present invention.

It should be understood that the terms described in the present invention are only for describing specific embodiments, and are not intended to limit the present invention. In addition, as for the numerical range in the present invention, it should be understood that every intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Intermediate values within any stated value or stated range and every smaller range between any other stated value or intermediate values within the stated range are also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

Unless otherwise stated, all technical and scientific terms used herein have the same 5 meanings as commonly understood by those skilled in the art to which the present invention relates. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe methods and/or materials related to the documents. In case of conflict with any incorporated documents, the contents of this specification shall prevail.

Without departing from the scope or spirit of the invention, it is obvious to those skilled in the art that many modifications and changes can be made to the specific embodiments of the specification of the invention. Other embodiments derived from the description of the present invention will be apparent to the skilled person. The specification and examples of this application are only exemplary.

As used herein, the terms “including”, “comprising”, “having”, “containing”, etc. are all open terms, which mean including but not limited to.

Embodiment 1 1. Primer design method

Seven complete genome sequences of GoAstV-1 are found by searching NCBI nucleic acid database. The complete genome sequences are downloaded and compared with mafft software, and primers are designed according to the regions with higher homology. The

Accession No. of these 7 sequences are as follows:

OL782471.1, OL762472.1, OK571391.1, MH410610.1, MW340534.1, MW353015.1,

KY271027.1.

In the same way, 62 complete genome sequences of GoAstV-2 are found by searching

NCBI nucleic acid database. The complete genome sequences are downloaded and compared with mafft software, and primers are designed according to the regions with higher homology.

The Accession No. of these 62 sequences are as follows:

MZ576222.1, MW592379.1, OK571390.1, MW413813.1, MW592377.1, MW592378.1,

MZ367612.1, OK571389.1, MN307117.1, MN307119.1, MT708902.1, MN307120.1,

MN428645.1, MW345727.1, MN428642.1, MN127956.1, MN127957.1, MN127958.1,

MN127954.1, MN127955.1, MN127952.1, MN127953.1, OM273305.1, OM273308.1,

OM273304.1, OM273302.1, OM273303.1, MZ540211.1, MN175321.1, MN307116.1,

MN428643.1, MT934439.1, MT934438.1, MT934437.1, OM273308.1, OM273309.1,

OM273307.1, OM273310.1, MN307118.1, MN428644.1, MN428841.1, MN307114.1,

MN307115.1, MN894548.1, MK125058.1, MG934571.1, MN109955.1, MN109956.1,

MN103532.1, MN109957.1, MN127951.1, MN109954.1, MF772821.1, MN068024.1,

MNO068023.1, MH052598.1, MH807626.1, MN399857.1, MN809622.1, MN337323.1,

MN127959.1, KY807085.1.

The designed primer and probe sequences are shown in Table 1, and the multiplex RT- gPCR reaction systems are shown in Table 2.

Table 1 primer and probe sequences

Name Sequences (53)

GoAstV-1-1-F CCCTTGGAGCAGAGGAAGAA (SEQ ID NO. 1)

GoAstV-1-1-R CCTCCAAACCCTCAACTCCT (SEQ ID NO.2)

GoAstV-1-1-p FAM-TGCGGCATGCAAACGTCGCA (SEQ ID NO.3)

GoAstV-2-1-F TGGACCACCCGTTAATGACA (SEQ ID NO.4)

GoAstV-2-1-R TGCAGCTTTCTGATCCTCCA (SEQ ID NO.5)

GoAstV-2-1-p Cy5-ACAGACACACTCGACCGGAAGCA (SEQ ID NO.6)

GoAstV-1-2-F GAGAGGGACAAGATCTGGAA (SEQ ID NO.9)

GoAstV-1-2-R AAACTGGCGCTGGTGCGAA (SEQ ID NO.10)

GoAstV-1-2-p FAM-CCTACCTACGACTTTGAAACTGT (SEQ ID NO.11)

GoAstV-2-2-F AGTGGCTTTTTATTGGTTTGA (SEQ ID NO.12)

GoAstV-2-2-R TTGGGCAGGCCCGTGGTGTG (SEQ ID NO.13)

GoAstV-2-2-p Cy5-CATTAACCATTTATTGTGGCACAA (SEQ ID NO.14)

GoAstV-1-3-F TGGGTACAAATATATGAAGCC (SEQ ID NO.15)

GoAstV-1-3-R TTCCAACAATAGTGTTACCCT (SEQ ID NO. 16)

GoAstV-1-3-p FAM-TTTGGATGTTTGGATAATTGCA (SEQ ID NO.17)

GoAstV-2-3-F TCAGGGGTTGGCTTTCGGTTT (SEQ ID NO.18)

GoAstV-2-3-R TTGGATCAGTAATGCATTTA (SEQ ID NO.19)

GoAstV-2-3-p Cy5-ATACAATAGCGGTTATAAAGCTGCC (SEQ ID NO.20)

GoAstV-1-4-F GAATTACATCTGTACTGCAGG (SEQ ID NO.21)

GoAstV-1-4-R CAGGCTTGTCGGAATGCATC (SEQ ID NO.22)

GoAstV-1-4-p FAM-AGAAATTGTAAATGACTACCTTA (SEQ ID NO.23)

GoAstV-2-4-F TCACATGAAGCAATTCTCAAG (SEQ ID NO.24)

GoAstV-2-4-R ATGAGGAATATAATCATATGA (SEQ ID NO.25)

GoAstV-2-4-p Cy5-AACAAGTGTAAGAATTATGATGAGTA (SEQ ID NO.26)

Table 2 Multiple RT-qPCR reaction systems 20 pl Systems HI

GoAstV-1 upstream primer (10 04 pmol/l}

GoAstV-1 downstream primer (10 0.4 pmol/l)

GoAstV-1 probe (10 pmol/ul) 0.2

GoAstV-2 upstream primer (10 04 pmol/l)

GoAstV-2 downstream primer (10 04 pmol/l)

GoAstV-2 probe (10 pmol/l) 0.2

Template® 20 2 x AceQ qPCR Probe Master Mix 10.0 50 x ROX Reference Dye 2° 0.4

MgCl, (50 mmol/l) 1.0 ddH,O Making up to 20

Total system: 20 pl; a. 1 pl for each of the two templates, and b.

Dye 2 for ABI7500 instrument.

2. Reaction conditions of fluorescent quantitative PCR (see Table 3)

Table 3: Reaction conditions of fluorescent quantitative PCR

Stage 1 pre Reps: 1 95°C 5 min denaturation

Stage 2 Cyclic reaction Reps: 40 9e TOS 10 60°C 30s -— 3. Preparation of standard plasmid

According to the amplification regions of the primers in Table 1, and appropriately extending some sequences upstream and downstream, sending the target sequence to

Sangong Biotech (Shanghai) Co., Ltd. for full gene synthesis and plasmid construction.

The full-length fragment sequence of type 1 synthesis is as follows, wherein the bold parts are the upstream and downstream primer binding sequences, and the underlined part is the probe binding sequence:

ATCAACCCTTGGAGCAGAGGAAGAAATGCAACTGGTGCATGAACCCAAAACCGCATA

ACTATGCGGCATGCAAACGTCGCAATCAAAAATGTTTCTGTGTGTTTTGTGGGATTATGCAT

TCTGAGAATGAAGGGCATACACGCCCTGTGGAGTGTCCCAGTTGCAAGAAAGGCTTCAAA

GGAGTTGAGGGTTTGGAGGCACATGCGATT (SEQ ID NO.7).

The full-length fragment sequence of type 2 synthesis is as follows, wherein the bold parts are the upstream and downstream primer binding sequences, and the underlined part is the probe binding sequence:

AAGAGTAGCTGGACCACCCGTTAATGACAAAATGACTACCACAATAACACTTGGTCAA

ATCACTGGGAATTCAACAGACACACTCGACCGGAAGCATAAATACTTCACAAATCCACTCA

TGATGAAAAACCAGGAAAATGGGCAAACAGCAACCCCTCTAAGTATAAGGGCTTCACAATA

TAACTTGTGGAGGATCAGAAAGCTGCATATCCGC (SEQ ID NO.8).

Calculating the copy number of the plasmid by measuring the concentration of the plasmid after the plasmid is synthesized, and then diluting 10 times in turn to 10°-10' DNA copies/pl. 4. Multiplex fluorescence PCR (1) Establishment of multiplex PCR method

Various components are added according to the system in Table 2, fluorescence quantitative PCR are performed, and the reaction procedure is shown in Table 3. The template is 101-10° copies/uL standard plasmid. The standard curve is drawn according to the results, and the standard equation is obtained. Where, the primers and probes shown in SEQ ID No. 1-

SEQ ID No. 6 well realize multiplex PCR amplification. See Fig. 1 for type 1 amplification curve and Fig. 2 for type 1 standard curve; see Fig. 3 for type 2 amplification curve, FIG. 4 for type 2 standard curve, and see Fig. 5 for the combined drawing results of type 1 and type 2 standard curves.

Standard equation of GoAstV-1: Y = -3.54X + 40.568, R? = 0.999, Eff = 91.629.

Standard equation of GoAstV-2: Y = -3.36X + 39.471, R? = 0.998, Eff=98.439.

SEQ ID NO.9-14, SEQ ID NO.15-20 and SEQ ID NO.21-26 are failed primers and probes, wherein the amplification results using SEQ ID NO.9-14 are shown in Fig. 6. (2) Specificity test

The multiplex fluorescence quantitative PCR method established in step (1) is used to amplify GoAstV-1, GoAstV-2, GPV, NDV and ARV nucleic acids, and a negative control without template is set up to test the specificity of the established method.

The results of specificity test are shown in Fig. 7. The results show that five templates and one negative control are tested; except for GoAstV-1 and GoAstV-2, none of them are amplified, indicating that this method has good specificity. (3) Sensitivity test

Nine dilution standards (109-108) are selected as templates and negative controls with no templates added with water, and the fluorescence quantitative PCR amplification is carried out to determine the minimum detection amount of GoAstV-1 and GoAstV-2 by this method. At the same time, the sensitivity is compared by routine PCR.

The sensitivity test results are shown in Fig. 8, and 10'-108 standard samples in 9 dilutions have amplification curves. However, the template with 10° dilution, that is, the template with only one Copy slightly lifts after 38 cycles, indicating that the minimum detection amount of this method reaches below 10 copies/ul. (4) Repeatability test

Five standard samples of dilution (10*-10%) in (1) are selected for fluorescent quantitative

PCR reaction, the amplification is repeated for 3 times, and each dilution is subjected to 3 parallel tests under the same amplification conditions; the coefficient of variation is calculated to evaluate the repeatability of in-batch detection. The recombinant plasmids pMD-GoAstV-1 and pMD-GoAstV-2 are constructed from three positive samples from different areas. Fluorescence guantitative PCR detection is carried out after dilution, the coefficient of variation is calculated, and the repeatability of inter-batch detection is evaluated.

The repeatability test results are shown in Table 4 and Fig. 9. The variation coefficient of

GoAstV-1 is 0.123-1.015%. The variation coefficient of GoAstV-2 is 0.131-0.913%:; it shows that this method has good repeatability.

Table 4 Repeatability test of multiplex fluorescence PCR

Standard ee olasmid concentration/(DNA Average Standard Variation copies/pl) value x deviations coefficient/%CV © 1x108 26578 0.059 = 0220

GOASHV-1 1x107 22.984 0.112 0.486 1x108 19.086 0.023 0.123 1x105 16.173 0.164 1.015 1x10* 12.740 0.021 0.168 ~~ 1x1¢®* 25072 0.126 0501 1x107 21.292 0.028 0.131

GoAstV-2 1x108 18.341 0.061 0.331 1x105 15.364 0.140 0.913 1x10% 12.034 0.022 0.183

Embodiment 2 Detection of clinical samples 70 gosling gout samples from goose farms in Jiangxi province from 2020 to 2022 are detected by multiplex fluorescence quantitative PCR. The detection results of GoAstV-1 and

GoAstV-2 in clinical samples are shown in Fig. 10, and the detection results of CT value of

GoAstV-2 cytotoxicity are shown in Fig. 11.

The above-mentioned embodiments only describe the preferred mode of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, all kinds of modifications and improvements made by ordinary technicians in the field to the technical scheme of the present invention should fall within the protection scope determined by the claims of the present invention.

i xml versicn=Nl, ON encoding=TUTFE-8" 7 2 <!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing 1.3//EN" "ST265equenceListing V1 3.dtd"> 3 <ST26Sequencelisting drdversion="NVL 3% filsName="@Gooss Astrovirus NL Sequence listing. sal? softwaraNanme= WIPO Seguange” softwareVersion="2, iN oroductionDate="2022-08-18%> & <ApplicantFileReference>SHX-Goose Astrovirus NL-/ApplicantFileReference»> <EariiestpriorityAppiicationidgentification»> a <IPOfficeCoderCN4/IPOfficelode> 7 <ApplicealticnNumberTezi>202211031782.6</ApplicalionNumberText» © <PilingDare>2022-08-26-/FilingDate»> 9 </BarliestPricorityApplicationidentification>

LD <ApplicantName ianguagscode=M'enY>Institute of Animal Husbandry and Veterinary

Medicine, Jiangxi Academy of Agricultural Sciences</ApplicantNams>

LL <InventorName languagsCode="en">Haigin LI</InventorName>

LE <InventionTitle languagelodsa="an">PRIMER PROBE SET, KIT AND APPLICATION OF

MULTIPLEX FLUORESCENT PCR DETECTION OF GOOSE ASTROVIRUS WITH DIFFERENT

GENOTYPES</InvenitionTitle> 13 <Sequencelotaluantity>26</SeguenceTl otal Guantity> 14 <SequenceData sequence lDNumben="1F> ih <INSDSeq> ie <IN3DSeqy Leng:th>20</IN5DSeq length i <INSDSeq moltype>DNA</INSDSeg moltyper 1B <INSDSeg division>PAT</INShIeqg division» 1h <INSDSeq feature-table> zl <INZDFeature> 21 <INSDFeature key>sourcec/INSDFeature key» 22 <INSDFearure location>l..20</INSDFeature location» 23 <INSDFeature guals> 24 <INSDQualifier> 25 <INSDQualifier name>mol type</INSDQualiifier name> zE <INSDQualifier valuerother DNA</INSDQualifier value» 27 </INSDOualifiers 28 <INSDQualifler in="ge"> 23 <INSDQualifier name>organism</iNSDQualifier name> <IN3DQualifier value>synthetic construct</INSDoualifier value» 3 </INSDQuali fier» u 32 </INSDFearure quals> 33 </INSDFeature> 34 </INSDSeg feature-table> <INSDSeq sequence>cccttggagcagaggaagaa</INSDSeq sequence» 28 </INEDSey> 37 </SeguenceData> 38 <SeguenceData semuenceIDNumber="2n> 39 <INSDSeq> 40 <INSDSeq length>20</INSD3eq lengths 41 <INSDSeq molitype>DNA</IN3DSeq moltype> 4% <INSDSeq division>PAT</INSDSeq division» 43 <INSDSeq feature-iable> a4 <INSDFeaturer» 45 <IN3DFeature key>source</IiN3DFeature key» 48 <IN3DFeature lowation>l..20</INSDFeaturs location» 4% <INSDFeature guals> 45 <INSDOualifier>

A <INSDOQualifier name>mol type</INSDQualifier name>

Se <INSDQualifler valverother DNA</INSDQualifier value»

Si </INSDOualifier> 52 <INSDOQualifier id="q3"> 52 <IN3DQualifier namerorganism</INSDQualifiesr name> 54 <INSDQualifier valuersynthetic construct</INSDQuallifier value» 55 </INSDQualifier>

SE </INSDFeature quals> 57 </IN3DFeature> u 5a “/INSDSeqg fesature-table> 53 <IN3D3eq sequencercctccaaaccctcaacteet</INSD3ey sequence» ai </INSDSeg> al </SeguenceDa tax 2 <SequenceData zaquencalDNumben=n3n> 3 <INSDSeqr

G4 <INSDSeq length>20</INSD5eq length»

Gh <INSDSeq moltype>DNA</INSDSeg moltype> 55 <INSDSeq divislion»PAT</INSDSeqg division» av <INSDSeg feature~tablex 58 <INSDFeature> as <IN3DFeature key>source</IN3DFeature key>

FO <IN3DFeature location»l..20</INSDFeaturs locations dA <INSDFsature qualsg> qa <INSDuuelifier>

TE <INSDoualifier name>mol type“ /INSDQualifier name> 4 <INSDQualifisr value>other DNA</INSDQualifier valuer 75 </INSDOualifier> jd <INSDOualifier id="gàr>

Gi <IN3DQualifier name>organism</INSDQualifisr name> ia <INSDQualifier valuersynthetic construct</INSDQualifier valued

Fh </INSDOualifier>

GO </THSDFeaturs guals> ai </INSDFeature> 82 </IN3DSeqg feature-table> 82 <IN3D3eq sequence>tgeggcatgcaaacgtcgca</INSD5eq sequence £4 </TNSDSeg> 55 </SeguenceDala>

Be <Sequencebata zaguencalbDNumber=n4n> a7 <INS3DSeq>

Go <INSDSeq length>20</INSDSeq lengths 9 <INSDSeq moltype>DNA</INSDSea moliype> 34 <INSDSeq divislon»PAT</INSDSey division

BL <IN3D3eq feature-table> 82 <INSDFeatura> 33 <IN3DFeature key>source</IN3DFeature key»

G4 <INSDFeature location»l1..20</INSDFeature location>

G5 <INSDFeature quals> u

LE <IN3DQualifiers 27 <INSDQualifier name>mol type</INSDQualifier name> 38 <INSDOualifier valuesother DNA</INS3SDO0uelifier value» </INSDQualifier> u 1090 <INSDQualifisr id=Tgh®>

LOL <INSDQualifier namerorganism“/INSDQuali fier name>

LGE <INSDQualifier valuersynthetic construct</INSDQualifier values» 103 </INSDOualiLfier»> 104 </INSDFeaturs guals> 105 </TNSDFeaturer 104 </INBDSeq feature-table>

LO? ZINSDSeq seguencertggaccacccgttaatgaca-/INSDSey sequenaes 108 </INSDSeq> 10% </Zequencebatar

TA <Sequencebata seguenasibNumbar=nits 111 <IN3D3eq> ile “INSDSeq length>20</INSDSeq Length> ii <INSDSeq moltype>DNA</INSDSeq moltype> iië <IN3DSeq division»PAT</INSD3eq division»

RS <INSDSeq feature-table>

Lie <INSDFeabture>

LLT <INSDFeature key>source“/INSDFeature key>

LLS <INSDFeature location>l..20</INSDFeature location>

LLS <INSDFeaturs quals> u

LEE <INSDQualifier»> 121 <INSDQualifier name>mol type</iNSDQualifier name> 122 <INSDuuelifier value>other DNA</INSDOualifier valued ies </INSDQualifier> u 124 <INSDQualifler id='qgs"> 12% <INSDQualifier namerorganism</INSDQualiifier name>

Lae <INSDQualifier valuersynthetic construct“/INSDQualifien value» 127 </INSDQualifiers> ize </INSDFearure quals> i23 </INSDFeature> u 120 </INSDSeg features table» 130 <INSDSeg sequence>tgecagetttetgatecteca</INGDSey sequenced 132 </INSDSeg> 13% </SequenceData>

134 <SequernceData seguancaiDNunbhao="E% > 135 <INSDSeqg> ijs <INSDSeq length>23</INSDSeq length> ijd <INSDSeq moltype>DNA-/INSDSeg moltype> 128 ZINSDSeq division>PAT</INSDSeq division» 13% <INSDSeq feabure-table> 140 <INSDFeature>

HE <INSDFeature key>source</INSDFeature key> idd <INSDFeature location>l..23</INSDFeature locations 143 <INSDFealurse guals> id <INSDOQualifier» dh <IN3DQualifier namedmol type</INSDQualifisr name> ida <INSDQualifier value>other DNA</IN3DGualifier value> 147 </INSDQuali fier» 148 <INSDQuaiifiler id="g7"> 14% <INSDOQualifier namerorganism</INSDQualifier name> 130 <INSDQualiflsr value>synthetic construct /INSDQualifier value> 151 </INSDOualifier> 152 </IN3DFeature guala>

TA1 </INSDFeaturer u 154 </INSDSegy featurs-table> 15% <INSDSeq sequenceracagacacactcgaccggaagca</INSD3eq sequences aE </INSDSeg> 1a </SequenceData> iss “<SequenceData segusnceliNumec=MN}N> 153 <INSDSeqg> ian <INSDSeq length»209</INSDSeq length» iad ZINSDSegq molitypes>DNAC/INSDSeq moltyper> 182 <IN3DSeq divisior>PAT</INSDIeqg division» 183 <INSDSeq feature-table>

Led <INS3DFesature>

LEE <INSDFeaturs keyrsource</INSDFeaturs Key» 168 “INSDFeature lecation>l..209</INSDFsature location» av <INSDhFeature quels» ian <INSDQualifier> ins <IN3DQualifier name>mol type</INSDQualifisr name>

ERS <INSDQualifiler valuerother DNA</INGDGualifier value»

TE </INSDQualifier>»

LL <INSDQueiifier id="g8">

LIS <INSDoualifier namerorganism</INsSDQualifier name> ijd <INSDQualifier valus>synthetic construct /INSDGualifier value» ijs </INSDQualifier> u ia </INSDFeature guals> 1 </INSDFealure>

Lis </INSDSey feature-tabled <INSDSeq sequence>atcaacccttggagcagaggaagaaatgcaactggtgcatgaacccaaaaccgeat aactatgcggcatgcaaacgtcgcaatcaaaaatgtttctgtgtgttttgtgggattatgcattctgagaatga agggcatacacgccectgtggagtgtcccagttgcaagaaaggcttcaaaggagttgagggtttggaggcacatg cgatt-/INSD3eq seqience> 180 </INSDSeg>

LSL </SeguenceDala>

LB <Sequencebata zedquencelDNumser="8N>

TEs <INS3DSeq> 14 <INSDSeq length>214</INSDSeq length» 185 <INSDSeq moltype>DNA</INSDSea moliype> ia <INSDSeq divislon»PAT</INSDSey division ind <INSDSeq feature-table>

LEE <INSDFeature>

LS <IN3DFeature key>source</IN3DFeature key»

Led <INSDFeature location»1..214</INSDFeature location»

Lal <INSDFeature quals> u

LG <IN3DQualifiers

Lal <INSDQualifier name>mol type</INSDQualifier name> ind <INSDOualifier valuesother DNA</INS3SDO0uelifier value» 135 </INSDQualifier> u 13a <INSDQualiflisr id='g3">

Le <IN3DQualifier namerorganism“/INSDQuali fier name>

LSG <INSDQualifier valuersynthetic construct</INSDQualifier values»

LGG </INSDOualiLfier»> 200 </INSDFeaturs guals>

ZOL </INSDFeaturer 202 </INBDSeq feature-table> 202 <INSDSex seduenceraagagtagctggaccacccgttaatgacaaaatgactaccacaataacacttggtc aaatcactgggaattcaacagacacactcgaccggaagcataaatacttcacaaatccactcatgatgaaaaac caggaaaatgggcaaacagcaacccctctaagtataagggcttcacaatataacttgtggaggatcagaaagct gcatatceges/INSDSey sequence

Zid </INSDSeg> 205 </Seguencedata> 208 <SequenceData semiencelDNumber="S%> 207 <INSDSeq> 208 <IN3DSeqy Leng:th>20</IN5DSeq length 20% <INSDSeq moltype>DNA</INSDSeg moltype» 210 <INSDSeq division>PAT</INSDSeg division» “ii <INSDSeq feature-table>

Zld <INZDFeature> 213 <INSDFeature key>sourcec/INSDFeature key» 2lë <INSDFearure location>l..20</INSDFeature location» 215 <INSDFeature guals> 21a <INSDOualifien> 24 <INSDQualifier name>mol type</INSDQualiifier name>

ZL <INSDQualifier valuerother DNA</INSDQualifier value»

Le </INSDOualiLfier»>

Zi <INSDQualiifler id="g19'>

El <INSDQualifier name>organism</INSDQualifier name> 222 <IiNSDgualifier value>synthetic construct</INSDgualifier value» 223 </INSDQuali fier» u 224 </INSDFearure quals> 235 </INSDFeature>

ES </INSDSeg feature-table> nz <INSDSeq sequence>gagagggacaagatctggaa</INSDSeq sequence» 228 </INSDSeo> 225 </SeguenceData> 230 <SeguenceData soquencelDNunmbey="10"> 231 <INSDSedg> 23 <INSDSeq length>19</INSD3eq lengths 233 <INSDSeq molitype>DNA</IN3DSeq moltype> “Sá <INSDSeq division>PAT</INSDSeq divisicn> 235 <INSDSeq feature-iable> zie <INSDPFSsarure:» 227 <IN3DFeature key>source</IiN3DFeature key» 228 <IN3DFeature lowation>l..19</INSDFeaturs location» 238 <INSDFeature guals> 240 <INSDOualifier>

ZAL <INSDQualifier name>mol type</INSDQualifier name>

LAE <INSDQualifler valverother DNA</INSDQualifier value»

ZAG </INSDOualifier>

Ziad <INSDOualifier id="qLin> 245 <IN3DQualifier namerorganism</INSDQualifiesr name> 244 <INSDgvelifier valuersynthetic construct</INSDQuallifier value» 247 </INSDQualifier>

Z45 </INSDFeature quals> 246 </INSDFeatures

Zal “/INSDSeqg fesature-table> 251 <INSDSeq sequenceraaactggegetggtgegaa</INSDSeg sequence 252 </INSDSeq> 7 253 </SeguencaData> 254 <SequenceData seqvuenceIDNumber="iijx 25% <INSDSeq>

Zet <INSDSeq length>23</INSD5eq length» ae) <INSDSeq moltype>DNA</INSDSeg moltype> 258 <INSDSeq divislion»PAT</INSDSeqg division» 253 <INSDSeg Iearturertabie» 260 <INSDFsature> 268k <IN3DFeature key>source</IN3DFeature key> 282 <IN3DFeature location»l..23</INSDFeaturs locations 2873 <INSDFsature qualsg> 264 <INSDuuelifier> ges <INSDoualifier name>mol type“ /INSDQualifier name>

EASES <INSDQualifisr value>other DNA</INSDQualifier valuer 267 </INSDOualifier> 248 <INSDOualifier id="qgiar> 2689 <IN3DQualifier name>organism</INSDQualifisr name> 250 <INSDQualifier valuersynthetic construct</INSDQualifier valued

ZT «</INSDOQualifier»> wii </THSDFeaturs guals> 273 </INSDFeature> 27d </IN3DSeqg feature-table> 275 <IN3DBeq sequencs>cctacctacgactttgaaactgt</INSDE=g sequences 276 </INSDSeg> 277 </SeguenceDala> 278 <Sequencebata zaguenceIDNurbey="12Y>

Zij <INSDSeq> se <“INSDSeqg length>2l</INSDSeq Length> zel <INSDSeq moltype>DNA</INSDSea moliype> 282 <INSDSeq divislon»PAT</INSDSey division 282 <INSDSeq feature-table> 284 <INSDFeature> 285 <IN3DFeature key>source</IN3DFeature key» 28% <INSDFeature location»1..21</INSDFeature location> z57 <INSDFeature quals> u

Led <IN3DQualifiers

HER <INSDQualifier name>mol type</INSDQualifier name>

PCIE <INSDOualifier wvalue>other DNA</INSDCualifier value» 231 </INSDQualifier> u 252 <INSDOualifier ld="gij"> 2873 <IN3DQualifier namerorganism“/INSDQuali fier name> 294 <INSDQualifier valuersynthetic construct</INSDQualifier valued aes </INSDOualiLfier»> 2368 </INSDFeaturs duals? 257 </INSDFearure:»> 238 </INBDSeq feature-table> 23% <IN3DSeqg sequenzs>agtggetttttattggtttga-/INSDSeq sequencer 300 </INSDSeg> 301 </SegusnceData»>

SOE <SequenceData zegvencelnNumber="is*> 50% <INSDieg> 30d <INSDSeq length>20</IN3DSeq length» 205 <INSDSeq moltype>DNA</INSDSeq moltype> 208 <IN3DSeq division»PAT</INSD3eq division»

ZO <INSDSeq feature-table> 308 <INSDFeabture> 300 <INSDFeature key>source</INIDFeature key> <INSDFeature location>l..20</INSDFeature location>

SLL <INSDFeature qguals> u

ILE <INSDQualifier»> 313 <INSDQualifier name>mol type</iNSDQualifier name>

Sid <INSDuuelifier value>other DNA</INSDOualifier valued zis </INSDQualifier> u 31a <INSDQualifier id="gidnx> 3L7 <INSDQualifier namevorganism“/INSDQualifier name>

BLS <INSDQualifier valuersynthetic construct“/INSDQualifien valuex> 310 </INSDOualifier> 320 </IN3DFeature gualsd 221 </INSDFearure» zal </INSDSeg features table» 323 <INSDSeg seguence>rttgggcaggcccgtggtgtg/INSISeq sequenced 324 </INSDSeg>

Kes </Zequencebata>

S26 <SequenceData segueancelDNuagbhao="147> 327 <INSDSeg> 328 <INSDSeq length>24</INSDSeq length> 223 <INSDSeq moltype>DNA-/INSDSeg moltype> 230 ZINSDSeq division>PAT</INSDSeq division» 331 <INSDSeq feabure-table> 332 <INSDFeature> 333 <INSDFeature key>source</INSDFeature key> ssd <INSDFeature location»l..24</INSDFeature locations 335 <INSDFealurse guals> 238 <INSDOQualifier»

S37 <IN3DQualifier namedmol type</INSDQualifisr name> 238 <INSDQualifier value>other DNA</IN3DGualifier value> 338 </INSDQuali fier» 340 <INSDQuaiifier id="gijx> 34% <INSDOQualifier namerorganism</INSDQualifier name>

SAE <INSDgQualifier value>synthetic construct“/INSDGualifier value» 342 </INSDOualifier> 244 </IN3DFeature guala> 345 </INSDFeaturer u 348 </INSDSegy featurs-table> 347 <INSDSeq seguence>cattaaccatttattgtggcacaa</INSD3eq sequence» 343 </INSDSeg> 34% </SequenceData>

IEG <SequenceData segusnceliNumec=MNLS®> ani <INSDSeq> 252 <IN3DSeq length»21</INSDSeq length> 253 ZINSDSegq molitypes>DNAC/INSDSeq moltyper> 354 <IN3DSeq divisior>PAT</INSDIeqg division» 355 <INSDSeq feature-table> 356 <INSDFeature> 357 <INSDFeaturs keyrsource</INSDFeaturs Key»

ILE <INSDFeature location>l..21</IN3DFeature location» 353 <INSDhFeature quels» 280 <INSDQualifier> zel <IN3DQualifier name>mol type</INSDQualifisr name> 392 <INSDQualifiler valuerother DNA</INGDGualifier value» 363 <{INSDQualifier» 384 <INSDQualifier id="gióx> 385 CINSDQualifisr namerorganism</INsSDQualifier name> 368 <INSDQualifier valus>synthetic construct /INSDGualifier value 2657 </INSDQualifiers> u

Zan </INSDFeature guals> 38% </INSDFeacture> 7 370 </INSDSey feature-tabled

SUL <INSDSeg sequance>tgggtacaaatatatgaagee</INSDSeq sequence>

STE </INSDEagr

REN </SaquenceData> sid “SequenceData seguencellNumber="187> 275 <INSDSeg>

Zia <INSDSeg length>»21</INSDSeq length»

Zij <IN3DSeq moltype>DNA</INSDSeq moltyper 3B <INSDSeq division>PAT</INSDSeg division 3G <INSDSeq feature-table>

SHG <IN3DFeature> 381 <INSDFeaturs keyrsource</INSDFeaturs key» 282 <INSDFeature locaction»l1..21</INSDFeature location» 282 <INSDFeature guals> 283 <INSDOQualifier> 385 <INSDQualifier name>mol type“/INSDQuali fier name> 35E <INSDQualifier valuerother DNA</INSDQualifier value»

KW «</INSDOQualifier»> 385 <INSDQualifler ia=vgliv> 38% <INSDQualifier name>organism</INSDQualifier name>

San <IN3DQualifier value>synthetic construct</INSDQualifier value» 351 </INSDOQuali fier 382 </INSDFesature duals» 383 </INSDFeature> sad </INSDSeg feature-tabler> sen “INSDSeq sequsncerttecaacaatagtgttaccct</INSDSeq sequencer 344 </INSDSeg> 37 </Seguencedata> 238 <SequenceData seguencelDihumber="17"> 258 <INSDSeq> 400 <INSDSeq lengibh»22</INSDSeq length 401 <INSDSeq moltype>DNA</INSDSeg moltype»

AQ <INSDSeq division>PAT</INSDSeg division»

403 <INSDSeq feature-table> 404 <INZDFeature> 4045 <INSDFeature key>sourcec/INSDFeature key» 4408 <INSDFearure location>l..22</INSDFeature location» 407 <INSDFeature guals> 408 <INSDQualifier> 400 <INSDQualifier name>mol type</INSDQualiifier name> 410 <INSDQualifier valuerother DNA</INSDQualifier value» 411 </INSDOualifiers 41% <INSDQualiifler id="g18"> 4132 <INSDQualifier name>organism</iNSDQualifier name> did <IiNSDgualifier value>synthetic construct</INSDgualifier value» 415 </INSDQuali fier» u

ALE </INSDFeature quals> 417 </IN3DFeature> 414 </INSDSeg feature-table>

ALD “INSDSeq sequsncertttggatgtttggataattgca-/INSDSeq saquence> 420 </TNSDSeg> 421 </SeguenceData> 422 <SeguenceData soquencelDNunmbey="18"> 323 <INSDSedg> 424 <INSDSeq length>21</INSD3eq lengths

Azn <INSDSeq moltype>DNA</INSDSegq moltype> 426 <INSDSeq division>PAT</INSDSeq division» 4x7 <INSDSeq feature-iable> 428 <INSDFeaturer» 429 <IN3DFeature key>source</IiN3DFeature key» 420 <IN3DFeature lowation>l..21</INSDFeaturs location» 431 <INSDFeature guals>

ARE <INSDOualifier> 473% <INSDOQualifier name>mol type</INSDQualifier name> 434 <INSDQualifler valverother DNA</INSDQualifier value» 435 </INSDOualifier> 4348 <INSDQualifier id="qg18"> 457 <IN3DQualifier namerorganism</INSDQualifiesr name> 428 <INSDQualifier valuersynthetic construct</INSDQuallifier value» 438 </INSDQualifier> 440 </INSDFeature quals> 441 </IN&DFeaturer 447% “/INSDSeqg fesature-table> 442 <IN3D3eq seguencertecaggggttggettteggttt«/INSDSeq sequencer $44 <JINgDseqy u 445 </SeguencaData> 448 <SequenceData zaquencalDNumber=n"318"> 447 <INSDSeqd»> 445 <INSDSeq length>20</INSD5eq length» 44% <INSDSeq moltype>DNA</INSDSeg moltype> 450 <INSDSeq divislion»PAT</INSDSeqg division» 451 <INSDSeg feature~tablex 452 <INSDFeature> 453 <IN3DFeature key>source</IN3DFeature key> 454 <IN3DFeature location»l..20</INSDFeaturs locations 45% <INSDFsature qualsg> 458 <INSDuuelifier> 457 <INSDoualifier name>mol type“ /INSDQualifier name> 458 <INSDQualifisr value>other DNA</INSDQualifier valuer 453 </INSDOualifier> dán <INSDOualifier id="gq20%> dal <IN3DQualifier name>organism</INSDQualifisr name> jen <INSDQualifier valuevsynthetic construct</INSDQualifier valued 483 </INSDOualifier> 484 </THSDFeaturs guals> 465 </INSDFeature> 464 </IN3DSeqg feature-table> 467 <IN3D3eq sequencerttggatcagtaatgecattta</INSD3eq sequences 448 </TNSDSeg> 469 </Seguencehata 470 <Sequencebata zaguencesIDNurber="20">

AT <INS3DSeq>

Aid <“INSDSeqg length>25</INSDSeq Length> 473 <INSDSeq moltype>DNA</INSDSea moliype> 474 <INSDSeq divislon»PAT</INSDSey division 475 <INSDSeq feature-table> 47a <INSDFeature> 477 <IN3DFeature key>source</IN3DFeature key» 478 <INSDFeature location»1..25</INSDFeature location> 470 <INSDFeature quals> u

A&D <IN3DQualifiers 451 <INSDQualifier name>mol type</INSDQualifier name> 482 <INSDOualifier wvalue>other DNA</INSDCualifier value» 482 </INSDQualifier> u 484 <INSDOualifier Ld=YgRin> 385 <INSDQualifier namerorganism“/INSDQuali fier name> 454 <INSDQualifier valuersynthetic construct</INSDQualifier values» 457 </INSDOualifiers

AS </INSDFeaturs duals? 483 </TNSDFeaturer 4348 </INBDSeq feature-table> 431 ZINSDSeq sequencsratacaatageggttataaagetgee-/INSDSeq sequence 482 </INSDSeq> 4953 </SegusnceData»> 464 <SequenceData seguengsiiNuombar="aivs 445 AINSDSeq 498 <INSDSeq length>21</IN3DSeq length» 457 <INSDSeq moltype>DNA</INSDSeq moltype> 438 <IN3DSeq division»PAT</INSD3eq division» 339 <INSDSeq fearure-tabier

DOO <INSDFeabture>

SOL <INSDFeature key>source“/INSDFeature key>

DOE <INSDFeature location>l..21</INSDFeature location>

S03 <INSDFeature qguals> u

L504 <INSDQualifier»> 305 <INSDQualifier name>mol type</iNSDQualifier name> 508 <INSDuuelifier value>other DNA</INSDOualifier valued 50 </INSDQualifisr> u 508 <INSDQualifier id='"g22"x> 308 <INSDQualifier namevorganism“/INSDQualifier name>

SLO <INSDQualifier valuersynthetic construct“/INSDQualifien valuex>

Si: </INSDOualifier> 512 </IN3DFeature gualsd

Zi </INSDFeature> u

Hid </INSDSeg features table» 51% <IN3DSeqy sequence>gaattacatetgtactgeagg</IN3LSeqy sequenca>

SiG </INSDSeg> 517 </Zequencebata>

LLG <SequenceData seguoancelDNungbhao="2237>

Sis <INSDSeg> 520 <INSDSeq length>20</INSDSeq length>

Sel <INSDSeq moltype>DNA-/INSDSeg moltype> biz ZINSDSeq division>PAT</INSDSeq division» 523 <INSDSeq feabure-table>

S24 <INSDFeature>

DES <INSDFeature key>source</INSDFeature keys

LEG <INSDFeature location>l..20</INSDFeature locations nz <INSDFealurse guals>

S378 <INSDOQualifier» 5749 <IN3DQualifier namedmol type</INSDQualifisr name> 5380 <INSDUvaelifier valuerother DNA</INSDGualifier value> 53 </INSDOuali fier» u

DBE <INSDQuaiifier id='"g23"x> 23 <INSDOQualifier namerorganism</INSDQualifier name>

S54 <INSDQualiflsr value>synthetic construct /INSDQualifier value> 535 </INSDOualifier> 524 </INBDFeature gvals> 527 </THSDFeatura>

B38 </INSDSegy featurs-table> 330 <INSDSeq segquencercaggecttgtecggaatgcate/INSDSeq sequence 240 </INSDSeg>

TAL </SequenceData>

DAT <SequenceData seguanoellNumbeg="23%> 5423 <INSDSeqg> odd <IN3DSeq length»23</INSDSeq length» 545 ZINSDSegq molitypes>DNAC/INSDSeq moltyper>

Hag <IN3DSeq divisior>PAT</INSDIeqg division» 547 <INSDSeq feature-table>

EE <INSDFeature>

DAG <INSDFeaturs keyrsource</INSDFeaturs Key»

SEG <INSDFeature location>l..23</IN3DFeature location»

SDi <INSDhFeature quels» 352 <INSDQualifier> 553 <IN3DQualifier name>mol type</INSDQualifisr name> 554 <INSDGualifier valuerother DNA /INSDGuelifier value» 355 </INSDQualifier» u

S56 <INSDQualifier id="g24"x>

S57 CINSDQualifisr namerorganism</INsSDQualifier name>

L358 <INSDQualifier valus>synthetic construct /INSDGualifier value 553 </INSDQualifier> u 580 </INSDFeature guals> 561 </INSDFeatures 562 </INSDSeu feature-table>

DOS <INSDSeg sequencevagaaattgtaaatgactacctta-/INSD3eqg sequences

LGA </IN3SDSaq>

SED </SaquenceData> 558 “SequenceData seguencellNunber="247> 367 <INSDSeg> bas <INSDSeg length>»21</INSDSeq length> 53% <IN3DSeq moltype>DNA</INSDSeq moltyper 570 <INSDSeq division>PAT</INSDSeg division

SJL <INSDSeq feature-table>

Did <INSDFeature>

SN <INSDFeaturs keyrsource</INSDFeaturs key» 57d <INSDFeature locaction»l1..21</INSDFeature location» 375 <INSDFeature guals> 57a <INSDOQualifier> <IN3DQualifier name>mol type“/INSDQuali fier name>

SEE <INSDQualifier valuerother DNA</INSDQualifier value»

SG «</INSDOQualifier»>

Sa <INSDQualifler ia="g45>

Ssi “INSDoualifier name>organism</INSDQualifier name>

S82 <IN3DQualifier value>synthetic construct /INSDQualifier values 583 </INSDOQuali fier u

DS </INSDFesature duals» 585 </INSDFeature>

SEG </INSDSeg feature-tabhle> na <INSDSeq sequance>tcacatgaagecaattetecaag</INSDSeq sequencer

LEH </INSDSeg> 583 </Seguencedata> 530 <SequenceData seguencelDihuumber="28">

SBL <INSDSeq>

DSE <INSDSeq Length>2l1</IN5DSeq length 383 <INSDSeq moltype>DNA</INSDSeg moltype» 284 <INSDSeq division>PAT</INSDSeg division»

Den <INSDSeq feature-table>

SOG <INZDFeature> 557 <INSDFeature key>sourcec/INSDFeature key» 538 <INSDFearure location>l..21</INSDFeature location» 539 <INSDFeature guals> aod <INSDOualifier>

SOL <INSDQualifier name>mol type“/INSDQualifier name>

SoL <INSDQualifier valuerother DNA</INSDQualifier value»

C03 </INSDOualifiers

G04 <INSDQualiifler id=vgde™>

S05 <INSDQualifier name>organism</iNSDQualifier name> aia <IN3DQualifier value>synthetic construct</INSDoualifier value» aay </INSDQuali fier» u

S05 </INSDFeature qguals» 505 </IN3DFeature>

CLG </INSDSeg feature-table>

GLi “INSDSeq sequenceratgaggaatataatcatatga</INSDSeq sequences sle </INSDSeo> 412 </SeguenceData> ald <SeguenceData soquencelDNunmber="28"> ais <INSDSedg> olé <INSDSeq lengih>26</IN3D53eq lengths

GL <INSDSeq molitype>DNA</IN3DSeq moltype>

CLG <INSDSeq division>PAT</INSDSeq division»

GLD <INSDSeq [eatureriabie>

Sz <INSDPFSsarure:»

GEL <IN3DFeature keyrsource</INSDFeature key>

R22 <IN3DFeature lowation>l..26</INSDFeaturs location» 8273 <INSDFeature guals>

Sod <INSDOualifier>

GES <INSDOQualifier name>mol type</INSDQualifier name>

SEE <INSDgualifier valuerother DNA</INSDQualifier value»

CET </INSDQualifiers> 528 <INSDOQualifier id="qg27n>

AEB <IN3DQualifier namevorganism“/INSDQualifier name> ali <INSDQualifier valuersynthetic construct</INSDQuallifier value» 831 </INSDQualifier>

GSE </INSDFeature quals>

E33 </INSDFeatures

G34 </INSDSeg feature-iablex> 535 <INSDSeg segquenceraacaagtgtaagaattatgatgagta</INSDSeyg sequences 428 </INSDSegqs u ani </SeguencaData> 838 </5T263eguencalisting> os

Claims (6)

CONCLUSIONS 1. A primer probe set for multiple fluorescence PCR detection of goose astrovirus of different genotypes, comprising set of primer pairs and probes for the detection of GoAstV-1 and GoAstV-2, where — the primer pair for the detection of GoAstV-1 is shown in SEQ ID NO.1 - 2, and the probe is shown in SEQ ID NO. 3; — the primer pair for the detection of GoAstV-2 is shown in SEQ ID NO. 4-5, and the probe is shown in SEQ ID NO. 6. A use of the primer-probe set according to claim 1 in the preparation of a composite set for multiple fluorescence PCR detection of goose astrovirus with different genotypes. A composite set for multiple fluorescence PCR detection of goose astrovirus with different genotypes, which set comprises the primer-probe set according to claim 1. The composite kit for multiple fluorescence PCR detection of goose astrovirus having different genotypes according to claim 3, further comprising standard plasmids of GoAstV-1 and GoAstV-2, wherein - the standard plasmid of GoAstV-1 is the one specified in SEQ ID NO. sequence shown in Figure 7; — the GoAstV-2 standard plasmid denoted in SEQ ID NO. 8 contains the sequence shown. The composite set for multiple fluorescence PCR detection of goose astrovirus having different genotypes according to claim 3, wherein the reaction system of the multiple fluorescence PCR of the composite set is as follows: 0.4 µl 10 pmol/l GoAstV-1 upstream primer, 0.4 µl 10 pmol/µl GoAstV-1 downstream primer, 0.2 µl 10 pmol/l GoAstV-1 probe, 0.4 µl 10 pmol/l GoAstV-2 upstream primer, 0. 4 µl 10 pmol /l GoAstV-2 downstream primer, 0.2 µl 10 pmol/µl GoAstV-2 probe, 2 µl template, 10 µl 2 x AceQ qPCR Probe Master Mix, 0.4 µl 50 x ROX Reference Dye 2, 1 µl 50 mmol/ 1 MgCl2 and 20 µl ddH:20. The composite set for multiple fluorescence PCR detection of goose astrovirus having different genotypes according to claim 3, wherein the reaction procedure of the multiple fluorescence PCR of the composite set is: 95°C for 5 min; 95°C for 10 s, 60°C for 30 s, 40 cycles.