NL2032806A - Loop-mediated isothermal amplification (lamp) primer set, kit and lamp microfluidic chip for detecting actinobacillus pleuropneumoniae - Google Patents
Loop-mediated isothermal amplification (lamp) primer set, kit and lamp microfluidic chip for detecting actinobacillus pleuropneumoniae Download PDFInfo
- Publication number
- NL2032806A NL2032806A NL2032806A NL2032806A NL2032806A NL 2032806 A NL2032806 A NL 2032806A NL 2032806 A NL2032806 A NL 2032806A NL 2032806 A NL2032806 A NL 2032806A NL 2032806 A NL2032806 A NL 2032806A
- Authority
- NL
- Netherlands
- Prior art keywords
- lamp
- primer
- microfluidic chip
- primer set
- pleuropneumoniae
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present disclosure belongs to the technical field of disease detection, and relates to a loop—mediated isothermal amplification (LAMP) primer set, a kit and a LAMP microfluidic chip for detecting A. pleuropneumoniae. The present disclosure provides the LAMP primer set for detecting A. pleuropneumoniae, and the LAMP primer set includes an outer primer pair and an inner primer pair. In the present disclosure, an APX' IV' gene sequence with high specificity is selected as a target gene detected in the present application to design a high—specificity and high—sensitivity 10 primer set for a microfluidic chip technology. The LAMP primer set has excellent specificity and, does not generate cross reaction with other pathogenic bacteria of pigs, and has a limit of detection (LOD) of 1.17 pg/uL.
Description
LOOP-MEDIATED ISOTHERMAL AMPLIFICATION (LAMP) PRIMER SET, KIT AND
LAMP MICROFLUIDIC CHIP FOR DETECTING ACTINOBACILLUS
PLEUROPNEUMONIAE
The present disclosure belongs to the technical field of dis- ease detection, and particularly relates to a loop-mediated iso- thermal amplification (LAMP) primer set, a kit and a LAMP micro- fluidic chip for detecting Actinobacillus pleuropneumoniae (A. pleuropneumoniae) .
A. pleuropneumoniae is a Gram-negative bacterium with poly- typism such as small rod shape or small spherical shape. Since it was first discovered in 1957, it has presented a pandemic trend.
At present, detection methods for A. pleuropneumoniae include serology, molecular biology, and the like, but they all have cer- tain limitations, such as the cumbersome detection methods that are difficult to operate, or the shortcomings of poor sensitivity and specificity.
To solve the above problems, the present disclosure provides a LAMP primer set, a kit and a LAMP microfluidic chip for detect- ing A. pleuropneumoniae. The LAMP primer set provided by the pre- sent disclosure has the advantages of high sensitivity and strong specificity, and can effectively improve the detection efficiency of A. pleuropneumoniae in combination with a microfluidic chip and a LAMP technology.
To achieve the above objective, the present disclosure pro- vides the following technical solutions:
A LAMP primer set for detecting A. pleuropneumoniae is pro- vided, where the LAMP primer set includes an outer primer pair and an inner primer pair;
The outer primer pair includes a primer F3 and a primer B3,
the primer F3 has a nucleotide sequence shown in SEQ ID NO: 1, and the primer B3 has a nucleotide sequence shown in SEQ ID NO: 2;
The inner primer pair includes a primer FIP and a primer BIP, the primer FIP has a nucleotide sequence shown in SEQ ID NO: 3, and the primer BIP has a nucleotide sequence shown in SEQ ID NO: 4.
The present disclosure further provides a kit for detecting
A. pleuropneumoniae. The kit includes the foregoing LAMP primer set and a reaction buffer.
Preferably, the reaction buffer includes a 10xThermoPol Reac- tion Buffer, dNTP Mix, MgSO:, BSA-A, Bst DNA Polymerase, and a flu- orescent dye.
The present disclosure further provides a LAMP microfluidic chip for detecting A. pleuropneumoniae, and the LAMP microfluidic chip includes the foregoing LAMP primer set, a reaction buffer, and a microfluidic chip.
Preferably, a molar ratio of an outer primer pair to an inner primer pair in the LAMP primer set may be 1:8.
Preferably, the reaction buffer includes a 10xThermoPol Reac- tion Buffer, dNTP Mix, MgSO, BSA-A, Bst DNA Polymerase, and a flu- orescent dye.
The present disclosure provides the LAMP primer set for de- tecting A. pleuropneumoniae, and the LAMP primer set includes an outer primer pair (a primer F3 and a primer B3) and an inner pri- mer pair (a primer FIP and a primer BIP}. In the present disclo- sure, an APX IV gene sequence (AF0219%919) with high specificity is selected as a target gene detected in the present application to design a high-specificity and high-sensitivity primer set for a microfluidic chip technology. The LAMP primer set provided by the present disclosure has excellent specificity and does not generate cross reaction with other pathogenic bacteria of pigs, and has a limit of detection (LOD) of 1.17 pg/uL, with excellent sensitivi- ty. The LAMP primer set uses the microfluidic chip technology in clinical sample detection, realizing real-time detection of A. pleuropneumoniae, overcoming the defects of time consumption and labor consumption of previous detection on the A. pleuropneumoni- ae, improving the specificity and sensitivity of the detection,
and shortening a detection cycle. The technical support provided by this detection method can be used in the detection, diagnosis and monitoring of A. pleuropneumoniae, which is more meaningful for primary level detection technology and application.
FIG. 1 is a schematic diagram of the structure of a microflu- idic chip used in an example of the present disclosure;
FIG. 2 illustrates the test results when a LAMP microfluidic chip provided by an example of the present disclosure is used to detect the specificity for A. pleuropneumoniae;
FIG. 3 illustrates the test results when the LAMP microfluid- ic chip provided by an example of the present disclosure is used to detect the sensitivity for A. pleuropneumoniae;
FIG. 4 illustrates the results when a LAMP microfluidic chip provided by an example of the present disclosure is used to detect clinical disease material samples.
The present disclosure provides a LAMP primer set for detect- ing A. pleuropneumoniae, and the LAMP primer set includes an outer primer pair and an inner primer pair; the outer primer pair includes a primer F3 and a primer B3, the primer F3 has a nucleotide sequence shown in SEQ ID NO: 1, and the primer B3 has a nucleotide sequence shown in SEQ ID NO: 2; the inner primer pair includes a primer FIP and a primer BIP, the primer FIP has a nucleotide sequence shown in SEQ ID NO: 3, and the primer BIP has a nucleotide sequence shown in SEQ ID NO: 4. In the present disclosure, the SEQ ID NO: 1 is shown as
CCCTTAGCCCCTTACACTA; the SEQ ID NO: 2 is shown as CGCTTAG-
GATCCGCCTTA; the SEQ ID NO: 3 is shown as CACCACCGA-
GAAACAAATCCTCGGCGTGGTTTATGTCACC; the SEQ ID NO: 4 is shown as AG-
GCGATACAATTGAAGACGCCGGTACCCCTTTTTCTCAC. The LAMP primer set pro- vided by the present disclosure has high specificity and high sen- sitivity.
The present disclosure further provides a kit for detecting
A. pleuropneumoniae. The kit includes the foregoing LAMP primer set and a reaction buffer. In the present disclosure, the reaction buffer preferably includes a 10xThermoPol Reaction Buffer, dNTP
Mix, MgS0:, BSA-A, Bst DNA Polymerase, and a fluorescent dye.
The present disclosure further provides a LAMP microfluidic chip for detecting A. pleuropneumoniae, and the LAMP microfluidic chip includes the foregoing LAMP primer set, a reaction buffer, and a microfluidic chip. The microfluidic chip used in the present disclosure may preferably be a CD-shaped microfluidic chip, and further preferably a microfluidic chip shown in FIG. 1. The micro- fluidic chip used in the experiment of the present disclosure is a 4 x 8 microfluidic chip produced by Shanghai Igenetec Diagnostics
Co., Ltd.; the microfluidic chip may preferably include 4 test zones; each of the test zone may preferably include a sample hole, a vent hole, a reaction cell, a ball valve, and a waste reservoir; the test zones may preferably include 8 reaction cells. The pre- sent disclosure provides a real-time detection technology combin- ing the microfluidic chip with a LAMP technology, which can estab- lish an efficient, rapid, sensitive and specific real-time detec- tion technology, and provides more significance in the detection of A. pleuropneumoniae and a basis for boosting the rapid detec- tion of pathogenic bacteria.
In the present disclosure, in the LAMP primer set of the LAMP microfluidic chip, a molar ratio of the outer primer pair and the inner primer pair may preferably be 1:8; the reaction buffer may preferably include a 10xThermoPol Reaction Buffer, dNTP Mix, MgSO,
BSA-A, Bst DNA Polymerase, and a fluorescent dye. The LAMP micro- fluidic chip provided by the present disclosure selects a specific reaction buffer that can effectively improve the detection effi- ciency of the LAMP microfluidic chip.
After the LAMP primer set is obtained in the present disclo- sure, the LAMP primer set may preferably be coated onto the reac- tion cells of the microfluidic chip to obtain a microfluidic chip coated with the LAMP primer set. In the present disclosure, the outer primer pair and the inner primer pair in the LAMP primer set may preferably be mixed in a molar ratio of 1:8 and added to the reaction cells of the microfluidic chip; after the LAMP primer set is added to the reaction cells, it may be preferable to conduct vacuum heating and drying, compressing, film sealing and molding treatment, so that the LAMP primer set is coated onto the reaction cells.
After the microfluidic chip coated with the LAMP primer set 5 is obtained, an unknown sample may preferably be coated onto an injection zone of the microfluidic chip for amplification. In the present disclosure, reagents required for the detection may pref- erably be mixed to obtain a mixture before coating the unknown sample, and the mixture is uniformly mixed with nucleic acids of the unknown sample, and added to the injection zone of the micro- fluidic chip coated with the LAMP primer set. After film sealing and coating, the microfluidic chip is placed in a detection device for real-time amplification.
After the amplification is completed, in the present disclo- sure, a fluorescence intensity-time curve may preferably be plot- ted based on the amplification trend in each reaction cell through the change of the fluorescence value, so as to determine whether a sample in each amplification reaction well is negative or posi- tive, namely, the unknown sample shows an S-shaped curve, and a blank control shows no amplification curve. Thus, it is determined that the unknown sample is positive for A. pleuropneumoniae.
To further illustrate the present disclosure, the LAMP primer set, the kit and the LAMP microfluidic chip for detecting A. pleu- ropneumoniae provided by the present disclosure will be described in detail with reference to the accompanying drawings and exam- ples, but they cannot be construed as limiting the protection scope of the present disclosure.
Example 1
Preparation of a LAMP primer set for detecting A. pleuropneu- moniae by microfluidic chip technology
The design and synthesis steps of the LAMP primer set were as follows:
An APX IV gene sequence (AF021919) of a toxin specific for A. pleuropneumoniae was selected as a target gene to be detected, and a LAMP primer set was designed. The primer set was composed of outer primers F3/B3 and inner primers FIP/BIP, among which the F3 has a nucleotide sequence shown in SEQ ID NO: 1, the B3 has a nu-
cleotide sequence shown in SEQ ID NO: 2, the FIP has a nucleotide sequence shown in SEQ ID NO: 3, and the BIP has a nucleotide se- quence shown in SEQ ID NO: 4.
F3: CCCTTAGCCCCTTACACTA, SEQ ID NO: 1;
B3: CGCTTAGGATCCGCCTTA, SEQ ID NO: 2;
FIP: CACCACCGAGAAACAAATCCTCGGCGTGGSTTTATGTCACC, SEQ ID NO: 3;
BIP: AGGCGATACAATTGAAGACGCCGGTACCCCTTTTTCTCTCAC, SEQ ID NO: 4.
Example 2
Structure of a centrifugal microfluidic chip
A microfluidic chip shown in FIG. 1 was used in the present disclosure. This microfluidic chip was a 4 x 8 CD-shaped microflu- idic chip, produced by Shanghai Igenetec Diagnostics Co., Ltd., namely, each microfluidic chip included 4 test zones, and each re- action monitoring zone included 8 reaction cells. Each test zone included a sample hole (1), a ball valve (2), a reaction cell (3), a vent hele (4), and a waste reservoir (5) which were connected in sequence. The sample was added to a reaction zone through an arc- shaped channel and the sample hole (1), and was connected with the vent hole (4) and the waste reservoir (5) through an arc-shaped channel. Each reaction zone was provided with 8 amplification re- action cells (3). Among them, the main function of the sample hole {1) was to add an amplification buffer, and the reaction buffer was evenly dispensed through the reaction cells (3) to perform the
LAMP reaction. The ball valve (2) had a blocking effect on the re- action buffer, thereby controlling the flow of the reaction buffer in the microfluidic chip.
Example 3
Preparation of a LAMP microfluidic chip for detecting A. pleuropneumoniae by microfluidic chip technology
In the LAMP primer set for detecting A. pleuropneumoniae pro- vided in Example 1, the outer primers F3/B3 and the inner primers
FIP/BIP were prepared in a molar ratio of 1:8, and the initial primer concentration was 10 uM. After formulation, the final inner primer concentration was 1.6 pM and the final outer primer concen- tration was 0.2 uM.
The reaction buffer (isothermal amplification premix) includ-
ed a 10xThermoPol Reaction Buffer, dNTP Mix, MgS0:, BSA-A, Bst DNA
Polymerase, and a fluorescent dye (SYTO™9).
The reaction system of the LAMP microfluidic chip is shown in
Table 1.
Table 1 The reaction system of the LAMP microfluidic chip
Component Volume Final concentration “10xThermoPol Buffer ~~ 25u 1x
MgSO, {100 mM) 1,5 HL 6 mM
Bst DNA Polymerase Large Fragment pul 320 U/mL dNTP Mix (10 mM) 35 uL 1.4 mM 10% BSA-A 3ul - syto™9 0.5 pul -
Template DNA 2ul -
SW Water To 25 pL - ~ Example 4
Sample preparation and application method of the LAMP detec- tion method for A. pleuropneumoniae (1) Extraction of unknown samples: In accordance with the ex- traction kit produced by TIANGEN, target and non-target bacterial genomes were extracted from the pure culture of A. pleuropneumoni- ae to obtain unknown samples. (2) Coating of the LAMP primer set: The LAMP primer set for detecting A. pleuropneumoniae provided in Example 1 was mixed in the molar ratio provided in Example 3 to obtain a composition of the LAMP primer set, and the composition of the LAMP primer set was mixed well with trehalose. The final inner primer concentra- tion in the prepared coating mixture was 1.6 pM, the final outer primer concentration was 0.2 uM, and the mass percentage content of the trehalose was 0.5%.
Each test zone was provided with a reaction cell for A. pleu- ropneumoniae. The coating mixture was added to the reaction cell of the microfluidic chip, and the microfluidic chip containing the coating mixture was placed and dried in a 25°C vacuum drying oven, followed by pressing, film sealing, stamping and compaction; the
LAMP primer set was coated onto the reaction cell.
(3) LAMP reaction: After the reaction buffer was mixed, it was mixed well with the unknown sample obtained in step (1), and the resulting mixture was added to the sample hole of the LAMP mi- crofluidic chip obtained in step (2) and placed in a fluorescence acquisition centrifuge (Shanghai Igenetec Diagnostics Co., Ltd.; model: IGene TechnoTM SC-MA2000). Short spin was conducted at 1,500 rpm/min for 15 s to mix the sample and reagents well, and the resulting mixture was centrifuged at 4,500 rpm/min for 30 s to make the sample and reagents flow into the reaction cell under the action of centrifugal force. Finally, the temperature was set to 63°C and the reaction time was set to 60 min for LAMP. (4) Determination of amplification results: After the ampli- fication, the negativity or positivity of the sample was deter- mined according to the fluorescence amplification curve corre- sponding to each reaction cell on the display of the instrument.
If the fluorescence amplification curve corresponding to the un- known sample is S-shaped on the display, the unknown sample will be determined to be an A. pleuropneumoniae-positive sample; other- wise, the unknown sample will be a negative sample.
Example 5
The specificity test of microfluidic chip combined with LAMP to A. pleuropneumoniae (APP)
The method described in Example 4 was used for detection. The unknown samples included genomic DNAs of Haemophilus parasuis (HPS), Salmonella choleraesuis (Sal), Bordetella bronchiseptica (Bb), Pasteurella multocida (Pm), Streptococcus suis (SS), Erysip- elothrix rhusiopathiae (ER), extraintestinal pathogenic Escherich- ia coli (ExPEC), and Staphylococcus aureus (all the above patho- gens were conventional strains purchased by those skilled in the art); using the genomic DNAs of the above-mentioned pathogens as negative controls and ultrapure water without any genome as a blank control, the specific amplification reaction for the LAMP detection method was conducted. The detection results are shown in
FIG. 2 (which, from top to bottom in FIG. 2, were A. pleuropneu- moniae (APP), HPS, Sal, Bb, Pm, SS, ER, EXPEC, S. aureus and blank control, successively).
From FIG. 2, the method for detecting A. pleuropneumoniae by combining the microfluidic chip technology with the LAMP technolo- gy established by the present disclosure does not cross-react with other porcine pathogens, indicating that it has excellent detec- tion specificity.
Example 6
The sensitivity test of microfluidic chip combined with LAMP to A. pleuropneumoniae
The method described in Example 4 was used for detection. The genomic DNA of the A. pleuropneumoniae-positive sample was gradi- ently diluted 10-fold as a template for microfluidic chip technol- ogy combined with LAMP detection. A total of eight gradients (1.17 x 10° ng/pL to 1.17 x 10% ng/uL) and one blank control were set.
The detection results are shown in FIG. 3 (which, from top to bot- tom in FIG. 3, were 1.17 x 10° ng/pL, 1.17 x 10: ng/pL, 1.17 x 10° ng/pL, 1.17 = 10% ng/uL, 1.17 = 10% ng/pL, 1.17 x 107% ng/pL, 1.17 x 10° ng/uL, 1.17 x 107° ng/pL, and the blank control group in se- quence) .
According to FIG. 3, it can be seen that the limit of detec- tion of the detection method using microfluidic chip technology combined with LAMP technology is 1.17 pg/uL (namely 1.17 x 10° ng/pL) .
Example 7
Detection of A. pleuropneumoniae clinical samples by micro- fluidic chip combined with LAMP detection
The method described in Example 4 and the conventional PCR technology were used for detection. Bacterial samples isolated from 120 clinical samples were enriched, and the genomes were ex- tracted and amplified for detection. The detection results of the microfluidic chip combined with LAMP technology and PCR technology are shown in Table 2.
Table 2 Comparison of the results of the microfluidic chip combined with LAMP technology and PCR technology on the detection of clinical samples
Microfluidic chip-LAMP Detection PCR Detection
Type —_— —_—
Positive Negative rate (%) Positive Negative rate (%)
APP 4 116 33 4 116 3.3 © From Table 2, among the 120 clinical samples detected in this experiment, 4 samples are positive for A. pleuropneumoniae, and the detection rate is 3.3%. Compared with the detection result of
PCR, it can be known that the accuracy of the detection method provided by the present disclosure is as high as 100%.
Detection primers of different pathogens designed by the mi- crofluidic chip combined with the LAMP technology (including the
LAMP primer set provided by the present disclosure) detect A. pleuropneumoniae. The detection results are shown in FIG. 4. FIG. 4 shows, from top to bottom, APP, HPS, Sal, Bb, Pm, SS, and ER in sequence.
It can be seen from FIG. 4 that the LAMP primer set for de- tecting A. pleuropneumoniae provided by the present disclosure can accurately detect A. pleuropneumoniae.
The above examples show that the primer set of the microflu- idic chip-LAMP technology for detecting A. pleuropneumoniae pro- vided by the present disclosure can detect A. pleuropneumoniae in real time, thereby making up for the disadvantages of time consum- ing and inapplicability at the grassroots level present in the ex- isting detection technology of A. pleuropneumoniae, improving the sensitivity and specificity of the detection, and shortening the detection cycle of pathogenic bacteria. Meanwhile, the method for determining the detection result through the amplification curve can meet the requirements of visualization, so that the present disclosure has the characteristics of simple and quick operation in scientific exploration and production practice, as well as the advantages of on-site real-time detection. It can also be deter- mined that the detection method of A. pleuropneumoniae by the mi- crofluidic chip technology combined with the LAMP technology es- tablished by the present disclosure is clinically practical.
Although the present disclosure has been disclosed as above in preferred examples, it is not intended to limit the present disclosure. Those skilled in the art can make various alterations and modifications without departing from the spirit and scope of the present disclosure. Therefore, the protection scope of the present disclosure should be subject to the protection scope de- fined by the claims.
Sequence Listing Information:
DTD Version: V1 3
File Name: HKJP20220602378-Sequence Listing.xml
Software Name: WIPO Sequence
Software Version: 2.0.0
Production Date: 2022-07-29
General Information:
Current application / Applicant file reference:
HKJP20220602378
Earliest priority application / IP Office: CN
Earliest priority application / Application number: 202111036574 .0
Earliest priority application / Filing date: 2021-09-03
Applicant name: Anhui Agricultural University
Applicant name / Language: en
Invention title: LOOP-MEDIATED ISOTHERMAL AMPLIFICATION (LAMP)
PRIMER SET, KIT AND LAMP MICROFLUIDIC CHIP FOR DETECTING ACTINOBA-
CILLUS PLEUROPNEUMONIAE ( en )
Sequence Total Quantity: 4
Sequences:
Sequence Number (ID): 1
Length: 19
Molecule Type: DNA
Features Location/Qualifiers: - source, 1..19 > PCR primers, fwd name:F3, fwd seq:cccttagccccttacacta, rev name:B3, rev seq:cgctta ggatccgcctta > mol type, other DNA > note, primer F3 > organism, synthetic construct
Residues: cccttagccc cttacacta 19
Sequence Number (ID): 2
Length: 18
Molecule Type: DNA
Features Location/Qualifiers: - source, 1..18 > PCR primers, fwd name:F3, fwd seg:cccttagccccttacacta, rev name:B3, rev seq:cgctta ggatccgcctta > mol type, other DNA > note, primer B3 > organism, synthetic construct
Residues: cgcttaggat ccgcctta 18
Sequence Number (ID): 3
Length: 40
Molecule Type: DNA
Features Location/Qualifiers: - source, 1..40 > PCR primers, fwd name:FIP, fwd seq:caccaccgagaaacaaatcctcggcgtggtttatgtcacc,rev_ name :BIP, rev seq:aggcgatacaattgaagacgccggtacceccttttteteteac > mol type, other DNA > note, primer FIP > organism, synthetic construct
Residues: caccaccgag aaacaaatcc tcggcgtggt ttatgtcacc 40
Sequence Number (ID): 4
Length: 42
Molecule Type: DNA
Features Location/Qualifiers: - source, 1..42 > PCR primers, fwd name:FIP, fwd seq:caccaccgagaaacaaatcctcggcgtggtttatgtcacc,rev_ name :BIP, rev sed:aggcgatacaattgaagacgccggtaccceccttttteteteac > mol type, other DNA > note, primer BIP > organism, synthetic construct
Residues:
aggcgataca attgaagacg ccggtacccc tttttetectc ac 42
END.
i Pym) versicn="L. ON enoodling=tUTFE-8 Tn 2 <!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing 1.3//EN" "ST26Sequencelisting V1 3.dtd"> 3 <3T26%squencelisting dudVersion=svi_an f11aName="0RIPAQIZCHQZITE ~Jaguance
Listing. sl? soitwaraName="WIP0 Seguence® softwareVerslon=v2.0.0V oroductionDate="2022-0T 28% > & <ApplicantFileReference>HKJP20220602378/ApprlicantFileReference»> <EariiestpriorityAppiicationidgentification»> a <IPOfficeCoderCN4/IPOfficelode> 7 <ApplicelticnNumberTezi>202111036574 .0/ApplicelionNumberTezt> © <PilingDare>2021-09-03/FilingDate»> 9 </BarliestPricorityApplicationidentification>
LD <ApplicantName lengvagefode="enY>Anhui Agricultural University</ApplicentName> dd <InventlonTitle languagelode="en">LOOP-MEDIATED ISOTHERMAL AMPLIFICATION (LAMP)
PRIMER SET, KIT AND LAMP MICROFLUIDIC CHIP FOR DETECTING ACTINOBACILLUS
PLEUROPNEUMONIAE/TnventionTitie»>
Le <SequsnceTotalQuaniity>rd</SeguenceTotalduanLiLy> 13 “<SequenceData seguanoelhNumbag="1%> 14 <INSDSeq>
Ls <IN3DSeq length»19</INSDSeq length> ia ZINSDSegq molitypes>DNAC/INSDSeq moltyper> i <IN3DSeq divisior>PAT</INSDIeqg division» 13 <INSDSeq feature-table>
Le <INSDFeature> <INSDFeature kKey>source</TNISDFeaturs Key zl <INSDFeature location>l..19</IN3DFeature location» 22 <INSDhFeature quels» 22 <INSDQualifier> 24 <IN3DQualifier name>PCR primers</INSDQualifier name> <INSDQualifier valuerfwd name:F3,fwd seg:cccttagccccttacac ta, rev name:B3,rev seqg:cgcttaggatccgcctta</INSDQualifier v alue>r 28 </INSDOualifier> 27 <INSDOQualifier» 28 <IN3DQualifier namedmol type</INSDQualifisr name> 23 <INSDUvaelifier valuerother DNA</INSDGualifier value> </INSDQuali fier» - u 3 <INSDQuaiifler id="g2">
SE <INSDQualifier namernote</INSDQualifiesr name> 33 <INSDQualiflisr value>primer F3</INSDQualifier value» 34 </INSDOualifier> 25 <INSDOualifier id=Ygli©™> 24 <IN3DQualifier namerorganism</INSDQualifiesr name> 37 <INSDQualifier valuersynthetic construct</INSDQuallifier value» </INSDQualifier> 3% </INSDFeature quals> </IN3DFaature> u 41 “/INSDSeqg fesature-table> 42 <INSDSeq sequencercccttagecccttacacta</INSDSeg sequence 43 <JINgDseqy 7 44 </SeguencaData> 4% <SequenceData zaquencalDNumben=n2n> †<INSDSeq> 47 <INSDSeq length>18</INSD5eq length» 4ö <INSDSeq moltype>DNA</INSDSeg moltype> 4% <INSDSeq divislion»PAT</INSDSeqg division» 54 <INSDSeg feature~tablex bi <INSDFeature> b2 <IN3DFeature key>source</IN3DFeature key> 573 <IN3DFeature location>»l..18</INSDFeaturs locations 54 <INSDFsature qualsg>
LE <INSDuuelifier>
LE CINSDQualifisr name>PCR primers</INSDQualifisr name> <INSDQualifier value>fwd name:F3,fwd seg:cccttagccccttacac ta, rev name:B3, rev seq:cgcttaggatcecgectta«</INSDQualifier v aluer u u 58 </INSDQuali fier» 53 <INSDOualifier> eee <INSDQualifier name>mol type“/IN5DQualifier name>
Gl <INSDQualifisr valuerother DNA</INSDQualifier value»
GZ </INSDOualifier> az <INSDOualifier id="qd4"> ad <IN3DQualifier name>note</INSDQualifier name> ah <INSDQualifier value primer B3-/INSDGualifier value» a6 </INSDQuali fier» 67 <INSDQuaiifier id="g3"> dg <INSDQualifier namerorganism</INSDQualifier name>
SS <INSDgQualifier value>synthetic construct“/INSDGualifier value» 70 </INSDOualifier> jj </IN3DFeature guals> 72 </INSDFeaturer u bE </INSDSegy featurs-table>
FA <INSDSeq sequence>cgettaggatecegectta</INSDSeq sequence» ir </INSDSeg> 75 </SequenceData> 77 “<SequenceData segusnceliNumec=N3"> 78 <INSDSeqg> i3 <IN3DSeq length»40</INSDSeq length> dn ZINSDSegq moltype>DNA</INSDSeg moltyper>
Sl <INSDSeag divisior>PAT</INSDIeqg division»
BE <INSDSeq feature-table> 55 <iINSDFeature>
Gd <INSDFeaturs keyrsource</INSDFeaturs Key» 35 <INSDFeature location>l..40</IN3DFeature location» ga <INSDhFeature quels» 27 <INSDQualifier> a8 <IN3DQualifier name>PCR primers</INSDQualifier name> <INSDQualifier valuerfwd name:FIP,fwd seq:caccaccgagaaacaa atcctcggegtggtttatgtcacc ‚rev name:BIP,rev seq:aggcgatacaat tgaagacgceggtacccetttttetetcae</INSDgualifier value» </INSDOualifier> 31 <INSDOQualifier» 32 <IN3DQualifier name>mol type“/INSDQualifier name> 32 <INSDQualifier value>other DNA</IN3DGualifier value>
G4 </INSDQuali fier»
Sn <INSDQualiifier id="g6">
Gf <INSDOQualifier namernote</INSDQualifiesr name>
OF <INSDQualiflisr value>primer FIP</INSDQualifisr value» 38 </INSDOualifier> 33 <INSDOualifier id="q5"> 140 <IN3DQualifier namerorganism</INSDQualifiesr name> 10d <INSDQualifier valuersynthetic construct</INSDQuallifier value» 102 </INSDQualifier>
LOS </INSDFeature quals> 104 </IN3DFeature> u 105 “/INSDSeqg fesature-table> <INSDSeq sequencs>caccaccgagaaacaaatccteggegtggtttatgteace</INSDSeg sequen cE
LO </INSDSeg> 108 </Zequencebatar
RE <Sequencebata seguenasibNumbar=ngys
LIE <INSDieg> ill <INSDSeq length>42</IN3DSeq Length> iië <INSDSeq moltype>DNA</INSDSeq moltype> iia <IN3DSeq division»PAT</INSD3eq division» 114 <INSDSeq feature-table>
Lis <INSDFeabture> ie <INSDFeature key>source</INIDFeature key>
LL? <INSDFeature location>l..42</INSDFeature location>
Lig <INSDFeaturs quals> u
LLS <INSDQualifier»> ian <INSDQualifier name>PCR primers</iNSDQualifier name> <INSDQualifier value>fwd name:FIP,fwd seq:caccaccgagaaacaa atcctcggegtggtttatgtcacc ‚rev name:BIP,rev seq:aggcgatacaat tgaagacgceggtacccctttttetetcae/INSEQualifier value»
LEL «</INSDOQualifier»>
Las <IN3DQualifiers
Lad <INSDQualifier name>mol type</INSDQualifier name> 125 <INSDOualifier wvalue>other DNA</INSDCualifier value» 128 </INSDQualifier> u 127 <INSDQualifier 1d=VgRu> 128 <IN3DQualifier name>note</INSDQualifier name>
Lan <INSDQualifier valuedprimer BIP</INSDOualifier value»
TRO </INSDOualifier> sl <INSDQualifler iaQ=’g7"> 13% <INSDQualifier name>organism</INSDQualifier name> 132 <IN3DQualifier value>synthetic construct</INSDQualifier value» 134 </INSDOQuali fier 135 </INSDFesature duals» 138 <{INSDFearure>
L37 </INSDSeg feature-tabler>
RE
<INSDSeq seyusncevaggcgatacaattgaagacgccggtacccetttttetctcae/INSDSeg zegu ence> u u i28 </INSDSeg> 140 </SeguencaData>
Lal </ST26SeguencelListing>
Claims (6)
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111036574.0A CN113684288A (en) | 2021-09-03 | 2021-09-03 | LAMP primer group, kit and LAMP microfluidic chip for detecting porcine actinobacillus pleuropneumoniae |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| NL2032806A true NL2032806A (en) | 2023-03-10 |
| NL2032806B1 NL2032806B1 (en) | 2023-03-27 |
Family
ID=78585451
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| NL2032806A NL2032806B1 (en) | 2021-09-03 | 2022-08-18 | Loop-mediated isothermal amplification (lamp) primer set, kit and lamp microfluidic chip for detecting actinobacillus pleuropneumoniae |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN113684288A (en) |
| NL (1) | NL2032806B1 (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104630361A (en) * | 2015-02-04 | 2015-05-20 | 重庆出入境检验检疫局检验检疫技术中心 | Rapid APP (actinobacillus pleuropneumoniae) isothermal amplification detection primers, kit and detecting method |
| CN111575394A (en) * | 2020-06-02 | 2020-08-25 | 厦门银祥集团有限公司 | LAMP (loop-mediated isothermal amplification) detection kit for actinobacillus pleuropneumoniae |
| CN112176102A (en) * | 2020-09-08 | 2021-01-05 | 华南农业大学 | Kit for detecting porcine pseudorabies virus by combining centrifugal microfluidic chip with loop-mediated isothermal amplification technology |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100567504C (en) * | 2008-09-09 | 2009-12-09 | 中国农业大学 | A kind of actinobacillus pleuropneumoniae detection kit and application thereof |
-
2021
- 2021-09-03 CN CN202111036574.0A patent/CN113684288A/en active Pending
-
2022
- 2022-08-18 NL NL2032806A patent/NL2032806B1/en active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104630361A (en) * | 2015-02-04 | 2015-05-20 | 重庆出入境检验检疫局检验检疫技术中心 | Rapid APP (actinobacillus pleuropneumoniae) isothermal amplification detection primers, kit and detecting method |
| CN111575394A (en) * | 2020-06-02 | 2020-08-25 | 厦门银祥集团有限公司 | LAMP (loop-mediated isothermal amplification) detection kit for actinobacillus pleuropneumoniae |
| CN112176102A (en) * | 2020-09-08 | 2021-01-05 | 华南农业大学 | Kit for detecting porcine pseudorabies virus by combining centrifugal microfluidic chip with loop-mediated isothermal amplification technology |
Also Published As
| Publication number | Publication date |
|---|---|
| NL2032806B1 (en) | 2023-03-27 |
| CN113684288A (en) | 2021-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113637781B (en) | LAMP primer group for detecting swine susceptibility related pathogenic bacteria, kit and LAMP chip based on LAMP primer group and application | |
| Skow et al. | Species-level identification of staphylococcal isolates by real-time PCR and melt curve analysis | |
| Viscidi et al. | Molecular diagnosis of infectious diseases by nucleic acid hybridization | |
| Inglis et al. | Rapid genotypic confirmation of methicillin resistance | |
| CN110804669A (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for mycoplasma pneumoniae and application thereof | |
| CN110791592A (en) | Primer and kit for rapidly detecting African swine fever virus | |
| EP3902929A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| NL2032806B1 (en) | Loop-mediated isothermal amplification (lamp) primer set, kit and lamp microfluidic chip for detecting actinobacillus pleuropneumoniae | |
| CN112538537A (en) | High-flux microfluidic LAMP chip for detecting livestock respiratory pathogens and detection method | |
| CN103937884A (en) | Loop-mediated isothermal amplification kit for detecting mycobacterium tuberculosis and application method of kit | |
| CN109504746A (en) | A kind of kit and its application for miRNA detection | |
| CN108531556A (en) | The kit and its application method of multiple pathogens are detected based on micro-fluidic chip | |
| RU2621864C1 (en) | Method for brucellosis pathogen species identification by pcr method with hybridization-fluorescent results accounting in real time | |
| CN116790772A (en) | Multiplex PCR primer group for detecting porcine respiratory tract pathogen and application thereof | |
| CN113881788B (en) | Kit for identifying saliva and vaginal secretion based on microbial markers and application of kit | |
| CN111849966B (en) | Constant temperature detection method for identifying lactobacillus brevis and special primer and kit thereof | |
| KR20200004944A (en) | Marker for specifically detecting and selecting Lactobacillus plantarum subsp. plantarum and method for analyzing Lactobacillus plantarum subsp. plantarum using the same | |
| Poppert et al. | Accelerated identification of Staphylococcus aureus from blood cultures by a modified fluorescence in situ hybridization procedure | |
| CN113373263A (en) | Primer and kit for detecting LSDV (localized surface plasmon resonance) | |
| CN116334254B (en) | Novel Pasteurella multocida nucleic acid detection kit and non-diagnostic detection method thereof | |
| Chen et al. | Novel detection of norovirus and double Clostridium difficile in a closed cartridge system | |
| CN110512017B (en) | Mouse corynebacterium fluorescent quantitative PCR detection kit and primer | |
| CN105154570B (en) | A kind of test kit for diagnosing colpitic gardnerella vaginalis | |
| CN110273015B (en) | LAMP technology-based visual detection method for mycobacterium kansasii | |
| CN114736976B (en) | Special primer and kit for identifying lactobacillus casei |