CN108531556A - The kit and its application method of multiple pathogens are detected based on micro-fluidic chip - Google Patents
The kit and its application method of multiple pathogens are detected based on micro-fluidic chip Download PDFInfo
- Publication number
- CN108531556A CN108531556A CN201810180333.5A CN201810180333A CN108531556A CN 108531556 A CN108531556 A CN 108531556A CN 201810180333 A CN201810180333 A CN 201810180333A CN 108531556 A CN108531556 A CN 108531556A
- Authority
- CN
- China
- Prior art keywords
- micro
- pneumoniae
- detection
- kit
- mycoplasma pneumoniae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Abstract
The invention discloses a kind of kit and its application method detecting multiple pathogens based on micro-fluidic chip, which includes the micro-fluidic nucleic acid detection chip of more flux, prepackage dry powder detection reagent and the positive quality control product of active control flow path；The prepackage dry powder detection reagent contains the primer and Taqman fluorescence probe of mycoplasma pneumoniae, chlamydia pneumoniae and the specific and conserved sequence of legionella pneumophilia.The kit of the present invention using microfluidic chip technology, after sample-adding all operations all completed by instrument, easy to operate, speed is fast, can complete to detect in 30~60min, and will not pollute；Using Taqman fluorescence probe round pcrs, it is detected for mycoplasma pneumoniae, chlamydia pneumoniae and legionella pneumophilia, design primer and the sequence of probe are all very conservative in mycoplasma pneumoniae, chlamydia pneumoniae and the gene of legionella pneumophilia, high specificity, and testing result can be obtained in 2 hours, sensitivity is up to 10copies/ μ L.
Description
Technical field
The present invention relates to molecular biology fields, and in particular to a kind of detection mycoplasma pneumoniae based on micro-fluidic chip,
The kit and its application method of chlamydia pneumoniae and legionella pneumophilia.
Background technology
Mycoplasma pneumoniae (Mycoplasma pneumoniae, MP), chlamydia pneumoniae (Chlamydia pneumoniae,
CP) and legionella pneumophilia (Legionella pneumoniae, LP) infection is the important infectious diseases in the whole world, can be in each year
Age group children fall ill, most commonly seen with respiratory tract infection, and infection site can run through entire respiratory tract, and have certain infection
Property.MP, CP, LP are the common pathogenic bacteria of child acute upper respiratory tract infection, and cause the main disease of community acquired pneumonia
Opportunistic pathogen.Mycoplasma pneumoniae pneumonia, Chlamydia Pneumoniae and legionella pneumophila pneumonia caused by three kinds of pathogens are atypia lung
Inflammation has limitation without specificity, pathogen detection in terms of symptom, sign and auxiliary examination, is easy to mistaken diagnosis, utilizes molecular engineering
It can quickly and accurately be diagnosed, to cooperation correctly treatment, reduce the abuse of antibacterials.By these three pathogen
Caused respiratory tract infection proportion is higher, and the mixed infection of three is also increased, while detecting, quickly detecting three kinds
The product of pathogen increasingly has demand.It can be reached to the fast of three kinds of pathogen using multiple fluorescence PCR molecular diagnostic techniques
The synchronous detection of speed has very important meaning to clinic early diagnosis.
Mycoplasma pneumoniae is acellular wall, and the minimum that energy self-replacation is lived on one's own life between virus and bacterium is micro-
Biology, Gram-negative.MP can cause Eaton agent pneumonia, the infection of the upper respiratory tract, bronchitis, lung abscess, immunity
The diseases such as hemolytic anemia, meningoencephalitis, myocarditis, pericarditis, ephritis, community acquired pneumonia.MP has very strong infectiousness,
Mainly by mouth, nasal discharge in the form of aerosol particles by respiratory infectious, incubation period is longer, distributed there are whole year,
Autumn and winter feature occurred frequently, can a small range it is popular, cause group contagion, such as kindergarten, school, kinsfolk's cross-infection
Deng.The positive rate of document report reaches 15%~35%, in addition, 15%~20% community acquired pneumonia is by pneumonia branch
It is even more to account for 20% or so in community-acquired pneumonia in children caused by substance.
Chlamydia pneumoniae is the pathogen of the exclusive cytozoicus between virus and bacterium, raw in host cell
Long, breeding and formation inclusion body.It as the routes of infection and MP is propagated between people-people by respiratory secretions, is sealed half
Small range prevalence may be present in closed loop border.It is divided into 3 TWAR, koala and horse biovarieties, representative strains according to science of heredity and biology
It is a kind of common human airway pathogenic bacteria for TW-183T (ATCC VR 2282T).CP can cause acute respiratory sense
Such as pharyngitis, laryngitis, nasosinusitis tympanitis, bronchitis and pneumonia are contaminated, most common with pneumonia, bronchitis is taken second place；It can be with
Cause the diseases such as myocarditis, endocarditis, artery sclerosis and coronary heart disease, iritis, hepatitis, meningitis and arthritis.Incubation period
It about 10 days, can infect throughout the year, prevalence can be in that sporadic or outburst spreads through sex intercourse, especially in space relative closure, people
The public place that clustering collection is more, air less circulates, the positive rate 5%~20% of document report.Current diagnosis master
Lean on the detection of the separation and serology antibody of pathogen, but the time is long, complicated for operation, and fluorescent PCR detection can be used for it is acute
Infect And Diagnose and special population epidemiological study.
Legionella pneumophilia is the pathogen for causing legionaires' disease, is the facultative intracellular parasitism of human monocyte and macrophage
Bacterium is gram-Negative bacillus, is a kind of water source microorganism, has 15 serotypes by legionella pneumophilia, has pathogenic.Its
Middle I types are most usually shown in that the légionaires' disease of estimation 70%~90% is caused by I type legionella pneumophilias in people's Legionnaires Pneumonia
's.Initial symptoms be it is slight cough, be uncomfortable, DOMS, low-heat or also some symptoms of digestive tract, with common cold and
Flu symptom is similar, so being difficult clinically diagnosis；Later stage symptom is the performance of high fever, lower respiratory tract infection and pneumonia, x-ray
Apparent pulmonary lesion is can see, some patientss may occur in which complication, such as pericarditis, myocarditis, endocarditis, acute kidney function
Energy failure, shock etc..2~10 days incubation periods, legionella pneumophilia from potable water system, air conditioning cooling water, shower nozzle water etc. with
Crowd's close contact water body causes serious lung inflammation-légionaires' disease, makes in the form of an aerosol through respiratory infectious to people
It is the important Different high risk sites for propagating Legionella pneumophila infection with the public place of central air-conditioning.Epidemic peak is summer and autumn, is distributed
There are generation, men and women's disease rates 2 in case whole year：1.It is low that this disease takes place mostly in cellular immune function, such as diabetes, pernicious
Tumour, organ transplant, liver renal failure person.The positive rate 3%~9% of document report, 10%~25% in exposed population group's industry.
Micro-fluidic chip (microfluidics) or chip lab (Lab-on-a-Chip) refer to biology and changing
It sample preparation involved in fields, biology and the chemical reaction such as learns, the basic operation units such as separation, detection or is integrated into substantially
On the chip of one piece several square centimeters (or even smaller), to complete different biological or chemical reaction process, and to its product
A kind of technology analyzed.It is suitable in this engineering philosophy various until organic and inorganic small molecule from nucleic acid, protein
Reaction, separation and the detection of different type molecule.Micro-fluidic chip have liquid flowing controllable, consumption sample and reagent it is few,
The features such as improving to analyze speed tenfold hundreds of times, it can carry out a samples up to a hundred within a few minutes or even shorter time
While analyze, and can with the pretreatment of canbe used on line sample and analysis overall process.
Being directed to mycoplasma pneumoniae, chlamydia pneumoniae and the detection method of legionella pneumophilia currently on the market mainly has fluorescence
PCR methods, immunization and bacterial cultivation, wherein cultivation account for more than half, followed by immunization, Molecular Detection method proportion
At least.Fluorescent PCR method, by fluorescence signal, is monitored in real time to PCR processes, qualitatively or quantitatively during PCR amplification
Testing goal gene；Immunization is that specific binding occurs come testing goal albumen by antigen-antibody；Cultivation is cause of disease
Body is cultivated on defined medium, then carries out observation analysis to the result of generation.It is registered on the market to have individual event/two
Detection kit, but without simultaneously detect three kinds of pathogens product.
At present on the market temporarily without utilization fluorescence quantitative PCR method detection mycoplasma pneumoniae, chlamydia pneumoniae and legionella pneumophilia
Similar kit, but have these three pathogen individual events or the multinomial detection fluorescence quantitative PCR method comprising these three pathogen
The technical solution of kit discloses, and can be used as with reference to being compared, composition generally comprise salt ion buffer solution, enzyme, primer,
Probe, quality-control product are in charge of are stored at -20 DEG C in liquid form, and when use needs to melt multitube reagent, according to certain ratio
Example is mixed, and is configured to detection reaction solution, sample nucleic acid is then added, is put into fluorescence quantitative PCR instrument and is detected, finally
Testing result is analyzed according to amplification curve.
Immunization detection reagent is directed to the specific antibody that pathogen in sample causes body to generate, the detection of antibody
Have window phase, be easy to fail to pinpoint a disease in diagnosis at the initial stage of a disease, and sensitivity, specificity it is relatively low, sample is easy to pollute and interfering substance is more, concentration
It all be easy to cause result misjudgement when excessively high or too low, needs repetition detection, check that can just make a definite diagnosis, the confidence level of detection is poor；
It is taken generally at one day or more using cultivation detection, culture effect is poor, and many pathogen can not cultivate, when being delayed optimal treatment
Machine.
Although there are common fluorescence PCR detection reagent preferable sensitivity and specificity, kit to be generally more
Pipe liquid reagent is constituted, and usually needs to be stored in -20 DEG C of environment, needing proportionally to mix each pipe reagent in operation makes
With, there is higher requirement for preserving traffic condition, operating method etc., it is easy to cause to examine because preserving improper and operation error
It is insincere to survey result.Simultaneously because there are many subtype category of influenza A virus and influenza B virus, detection kit is general
It is directed to influenza A virus and the most commonly seen hypotype of influenza B virus, it, may sometimes because of the variation of virus stain
The case where will produce missing inspection.Result after being detected due to fluorescence quantitative PCR instrument needs professional to analyze amplification curve, has
When have human error generation.Finally, because the lifting speed of fluorescence quantitative PCR instrument is slower, detection time is generally 1~2
A hour takes longer.
In addition, mycoplasma pneumoniae, chlamydia pneumoniae and the mixed infection of legionella pneumophilia are increased, and three's infection is drawn
The pneumonia risen, without specificity, is easy to mistaken diagnosis, list is detected on the market for such case in terms of symptom, sign and auxiliary examination
The demand that the product of item pathogen cannot be satisfied quickly detection, distinguish three kinds of pathogen.
Invention content
The technical problem to be solved by the present invention is to provide one kind and can while quickly detect mycoplasma pneumoniae, chlamydia pneumoniae
With detection mycoplasma pneumoniae, chlamydia pneumoniae and the legionella pneumophilia based on micro-fluidic chip of three kinds of pathogen of legionella pneumophilia
Kit.
In order to solve the above technical problems, the technical solution adopted by the present invention is, it should the detection pneumonia based on micro-fluidic chip
Mycoplasma, chlamydia pneumoniae and the kit of legionella pneumophilia include the micro-fluidic detection of nucleic acids of more flux of active control flow path
Chip, prepackage dry powder detection reagent and positive quality control product；It is former that the prepackage dry powder detection reagent contains mycoplasma pneumoniae, pneumonia clothing
The primer and Taqman fluorescence probe of the specific and conserved sequence of body and legionella pneumophilia；
Wherein, the primer sequence of specific and conserved sequence is：Mycoplasma pneumoniae, SEQ ID NO.1 and SEQ ID NO.2；
Chlamydia pneumoniae, SEQ ID NO.4 and SEQ ID NO.5；
Legionella pneumophilia, SEQ ID NO.7 and SEQ ID NO.8；
Specificity T aqman probe sequences are：
Mycoplasma pneumoniae, SEQ ID NO.3；
Chlamydia pneumoniae, SEQ ID NO.6；
Legionella pneumophilia, SEQ ID NO.9.
The kit of above-mentioned technical proposal can carry out quick and precisely mycoplasma pneumoniae, chlamydia pneumoniae and legionella pneumophilia
Detection, can be easy to be easy-to-use in various environment, ensures timeliness, specificity and the sensitivity of detection；For mycoplasma pneumoniae, lung
Specific primer probe is designed on scorching Chlamydia and the respective conserved sequence of legionella pneumophilia, and mark fluorescent is believed on probe
Number, it can detect simultaneously and distinguish mycoplasma pneumoniae, chlamydia pneumoniae and legionella pneumophilia；Due to using micro-fluidic chip into
Row amplification, increases the specific surface area of reaction intracavity liquid, and heat transfer is faster, and reagent can be made rapidly to carry out heating and cooling, and
Leaking chemical pollution can be avoided by the seal of instrument and chip cooperation control reaction solution；Detection reagent is dry powder-shaped in kit
State is preinstalled with detection mycoplasma pneumoniae, chlamydia pneumoniae and thermophilic respectively in advance in the micro-fluidic chip in different reaction chambers
The detection reagent dry powder of lung Legionella can preserve under 4 DEG C of low temperature or room temperature, and when use only needs that the sample of nucleic acid extracted is added
Machine testing can be gone up, solves the problems, such as Cord blood and using cumbersome；The kit of the present invention is using micro-fluidic
Chip technology, after sample-adding all operations all completed by instrument, easy to operate, speed is fast, can complete to detect in 30~60min,
And it will not pollute；Using Taqman fluorescence probe round pcrs, for mycoplasma pneumoniae, chlamydia pneumoniae and Shi Fei legions
Bacterium is detected, the sequence of design primer and probe in mycoplasma pneumoniae, chlamydia pneumoniae and the gene of legionella pneumophilia all
It is very conservative, high specificity, and testing result can be obtained in 2 hours, sensitivity is up to 10copies/ μ L.
Wherein, SEQ ID NO.1：CAGCTCAGTCGAATCGCA；
SEQ ID NO.2：CACATCAATCGACTCGCAG；
SEQ ID NO.3：GTCTGTAGAGAGGCTCTACGGC；
SEQ ID NO.4：GACTTGAGCTAGCACA；
SEQ ID NO.5：CTGATGCCTGTCTACGA；
SEQ ID NO.6：CTGTCTGACTGATCATCGTCCTCATC；
SEQ ID NO.7：CAGCGCTAGCTGCAATCC；
SEQ ID NO.8：GCTAGCTGGCTACTGAGC；
SEQ ID NO.9：CGTCCTAGACTAGCGTTCAATACAG；
Preferably, the prepackage dry powder detection reagent further include have PCR buffer solutions, trehalose, bovine serum albumin(BSA),
DATP, dUTP, dCTP, dGTP, MgCl2, HotStart Taq enzymes, reverse transcriptase and UNG enzymes.
UNG enzymes/anti-pollution systems of dUTP are used, the pollution interference that previous PCR reaction product is brought can be reduced；It will reverse
Record enzyme is used in mixed way with HotStart Taq enzymes, is first carried out process of reverse-transcription and is synthesized cDNA, then carry out PCR amplification, does not add
Random primer, one step of process is added to complete, without uncapping, laboratory operating procedures can be reduced, save the time, while also avoiding out
The sample contamination that lid operation may be brought.
Used probe be fluorescent marker TaqMan probe, probe both ends distinguish mark fluorescent reporter group (R) and
The acid of few core former times of fluorescent quenching group (Q).When probe is complete, i.e. stochastic regime and when without PCR product hybridized state reports base
The fluorescence that group sends out is quenched group absorptions；In fluorescent PCR amplification procedure, when special PCR product and TaqMan probe are sent out
Simultaneously also probe cleavage, reporter group is released 5 ' end 5 prime excision enzyme activities of HotStart Taq enzymes when raw hybridization reaction
The fluorimeter that can be built in instrument of fluorescence detect；PCR often pass through one cycle, fluorescence signal also and
Target fragment is the same, and there are one the process that sync index increases, the power of fluorescence signal just represents the copy number of template ribonucleic acid
How much.Therefore the present invention cannot be only used for simple qualitative detection, also can be used as the quantitative detection of sample concrete content.
Preferably, final concentration of 100~1000nM of the primer in amplification system；The probe is in amplification system
Final concentration of 50~500nM；Final concentration of 1%~10%w/v of the trehalose in amplification system；The ox blood is pure
Final concentration of 0.1%~5%w/v of the albumen in amplification system；The HotStart Taq enzymes, reverse transcriptase, UNG enzymes are expanding
Final concentration in increasing system is 0.5U~5U；The final concentration of described dATP, dUTP, dCTP, dGTP in amplification system is
0.1mM~2mM；The MgCl2Final concentration of 1.5mM~10mM in amplification system.
Wherein, M=mol/L is concentration unit；W/v is mass volume ratio；In addition, the concentration of enzyme is in a reactant
1U in system.
Preferably, mycoplasma pneumoniae, chlamydia pneumoniae and the amplification of legionella pneumophilia base are contained in the positive quality control product
Because of the plasmid of sequence.
Preferably, the micro-fluidic nucleic acid detection chip of more flux of the active control flow path has micro-fluidic runner, including
One goes out sample sprue and several decimated streams roads；Each decimated streams road split settings, each decimated streams road correspond to a reaction
Chamber, the reagent of the energy each reaction chamber of decile.
Preferably, the preparation method of the prepackage dry powder detection reagent is：
(1) prepared detection reagent solution is dispensed into single part in PCR pipe, 8h is frozen under the conditions of being put into -80 DEG C
More than；
(2) detection reagent frozen is put into vacuum freeze drier, set freeze dryer program as：
- 50 DEG C, 1h, 1 atmospheric pressure；
- 40 DEG C, 5h, ＜ 10Pa；
- 10 DEG C, 2h, ＜ 10Pa；
0 DEG C, 2h, ＜ 10Pa；
30 DEG C, 5h, ＜ 10Pa；
(3) after the completion of dry, reagent, as dry powder are taken out.
It uses the above method by detection reagent processing for dry powder, can be mounted in micro-fluidic chip in advance, it can be low at 4 DEG C
Is preserved 1 year or more under temperature or room temperature, does not influence detection result, when use, which only needs to be added sample, can go up machine testing, it is convenient easily
With.
Preferably, the prepackage dry powder detection reagent is the pre- micro-fluidic nucleic acid of more flux mounted in the active control flow path
In detection chip.
The invention solves another technical problem be to provide a kind of application method using aforementioned agents box, this method
Include the following steps：
(1) sample DNA/RNA is extracted 200 μ L of template altogether to be added in the well of micro-fluidic nucleic acid detection chip, is covered
It is loaded port lid, is put into micro-fluidic chip detector and detects；
(2) condition of pcr amplification reaction is：
92~97 DEG C of 1~10min of pre-degeneration；
92~97 DEG C of 5~10s of denaturation, 58~62 DEG C of annealing extend 15~30s, 30~45 cycles；
(3) availability deciding：
Negative control hole is the blank well for not adding primed probe, and testing result should be negative, and Positive control wells detect
For the positive, otherwise experiment is considered as invalid；
(4) result interpretation：
It is provided according to the detection signal of corresponding reaction chamber as a result, directly judging mycoplasma pneumoniae, chlamydia pneumoniae and thermophilic
The yin and yang attribute result of lung Legionella.
The present invention has the advantage that compared with common fluorescent PCR methods, immunization and bacterial cultivation etc.：
1. high specificity：The primed probe of the present invention is directed to mycoplasma pneumoniae, chlamydia pneumoniae and the spy of legionella pneumophilia
Anisotropic conservative region sequence design, high specificity.
2. sensibility is high：The present invention can detect the objective gene sequence of 10copies/ μ L concentration.
3. being easy to preserve：The present invention's pre-installs powdered reagent in micro-fluidic chip, and it is convenient to preserve.
4. parting detects：Mycoplasma pneumoniae, chlamydia pneumoniae and legionella pneumophilia are distinguished in a chip.
5. pollution-free：Detection process is " locked in " operation, greatly reduces the possibility of pollution and result error.
6. easy to operate quick：Without preparing detection reagent, it is only necessary to which sample-adding is primary, you can upper machine testing, from specimen transfer
It can be completed within 2 hours to obtaining a result.
7. result interpretation is clear, objective；If desired can also quantitative analysis be carried out to result.
8. safety：Do not include poisonous and harmful substance in whole system, the post-processing of PCR product is not necessarily to, to operator and ring
Border is all non-hazardous.
Specific implementation mode
Embodiment 1：The detection mycoplasma pneumoniae based on micro-fluidic chip, chlamydia pneumoniae and Shi Fei legions of the present embodiment
The kit of bacterium includes the micro-fluidic nucleic acid detection chip of more flux, prepackage dry powder detection reagent and the positive of active control flow path
Quality-control product；The prepackage dry powder detection reagent contains mycoplasma pneumoniae, chlamydia pneumoniae and the specific conservative of legionella pneumophilia
The primer and Taqman fluorescence probe of sequence；The micro-fluidic nucleic acid detection chip of more flux of active control flow path has miniflow flow control
Road, including one go out sample sprue and several decimated streams roads；Each decimated streams road split settings, each decimated streams road correspond to one
A reaction chamber, the reagent of the energy each reaction chamber of decile；
Wherein, the primer sequence of specific and conserved sequence is：Mycoplasma pneumoniae, SEQ ID NO.1 and SEQ ID NO.2；
Chlamydia pneumoniae, SEQ ID NO.4 and SEQ ID NO.5；
Legionella pneumophilia, SEQ ID NO.7 and SEQ ID NO.8；
Specificity T aqman probe sequences are：
Mycoplasma pneumoniae, SEQ ID NO.3；
Chlamydia pneumoniae, SEQ ID NO.6；
Legionella pneumophilia, SEQ ID NO.9.
The prepackage dry powder detection reagent further include have PCR buffer solutions, trehalose, bovine serum albumin(BSA), dATP, dUTP,
DCTP, dGTP, MgCl2, HotStart Taq enzymes, reverse transcriptase and UNG enzymes.
Detection mycoplasma pneumoniae, chlamydia pneumoniae and the dry powder detection reagent of legionella pneumophilia are preloaded onto micro-fluidic nucleic acid inspection
It surveys in the different reaction chamber of chip；
Dry powder is made by drying process in detection reagent, can be pre-installed in micro-fluidic chip；
Specifically the preparation method of prepackage dry powder detection reagent is：
(1) prepared detection reagent solution is dispensed into single part in PCR pipe, 8h is frozen under the conditions of being put into -80 DEG C
More than；
(2) detection reagent frozen is put into vacuum freeze drier, set freeze dryer program as：
- 50 DEG C, 1h, 1 atmospheric pressure；
- 40 DEG C, 5h, ＜ 10Pa；
- 10 DEG C, 2h, ＜ 10Pa；
0 DEG C, 2h, ＜ 10Pa；
30 DEG C, 5h, ＜ 10Pa；
(3) after the completion of dry, reagent, as dry powder are taken out.
The prepackage dry powder detection reagent prepared is the micro-fluidic nucleic acid inspection of pre- more flux mounted in the active control flow path
It surveys in chip.
In this embodiment, the primer of mycoplasma pneumoniae, chlamydia pneumoniae and the specific and conserved sequence of legionella pneumophilia exists
Final concentration in amplification system is preferably 100nM；Mycoplasma pneumoniae, chlamydia pneumoniae and the specific conservative of legionella pneumophilia sequence
Final concentration of the Taqman fluorescence probe of row in amplification system is preferably 50nM；Final concentration of the trehalose in amplification system is excellent
It is selected as 1%w/v；Final concentration of the bovine serum albumin(BSA) in amplification system is preferably 0.2%w/v；HotStart Taq enzymes reverse
It records the final concentration of enzyme, UNG enzymes in amplification system and is both preferably 1U；The end of dATP, dUTP, dCTP, dGTP in amplification system
Concentration is both preferably 0.5mM；MgCl2Final concentration in amplification system is preferably 5.5mM；Contain pneumonia branch in positive quality control product
The plasmid of substance, chlamydia pneumoniae and the amplification gene of legionella pneumophilia sequence；
The operation of kit and result judgement：
(1) sample DNA/RNA 200 μ L of template (from extracting in the sputum, Nasopharyngeal swabs equal samples of people) are extracted altogether to be added
In the well of micro-fluidic nucleic acid detection chip, sample-adding port lid is covered, is put into micro-fluidic chip detector and detects；
(2) condition of pcr amplification reaction is：
95 DEG C of pre-degeneration 2min；
95 DEG C of denaturation 10s, 58 DEG C of annealing extend 30s, 40 cycles；
The condition of above-mentioned pcr amplification reaction can also be selected in this way：92~97 DEG C of 1~10min of pre-degeneration；92~97
DEG C denaturation 5~10s, 58~62 DEG C annealing extend 15~30s, 30~45 cycle；
(3) availability deciding：
Negative control hole is the blank well for not adding primed probe, and testing result should be negative, and Positive control wells detect
For the positive, otherwise experiment is considered as invalid；
(4) result interpretation：
The data of No. 1 reaction chamber correspond to mycoplasma pneumoniae, and the data of No. 2 reaction chambers correspond to chlamydia pneumoniae, No. 3 reaction chambers
Data correspond to legionella pneumophilia, the fluorescence intensity level of corresponding reaction chamber can be carried out data processing by instrument software, directly be sentenced
Disconnected mycoplasma pneumoniae, chlamydia pneumoniae and the yin and yang attribute of legionella pneumophilia result.
Embodiment 2：
With the detection mycoplasma pneumoniae based on micro-fluidic chip of the present invention, the reagent of chlamydia pneumoniae and legionella pneumophilia
Box detects 4 samples, and number 1~4 contains pathogen nucleic acid.No. 1 sample contains mycoplasma pneumoniae nucleic acid, and No. 2 samples contain lung
Scorching Chlamydia nucleic acid, No. 3 samples contain legionella pneumophilia nucleic acid, and No. 4 samples only have the nucleic acid of normal person, are free of mycoplasma pneumoniae
Or the nucleic acid of chlamydia pneumoniae or legionella pneumophilia.It is detected operation according to 1 identical method of embodiment, testing result is shown in Table
1。
Table 1：
| Sample number into spectrum | No. 1 | No. 2 | No. 3 | No. 4 |
| No. 1 reaction chamber | + | - | - | - |
| No. 2 reaction chambers | - | + | - | - |
| No. 3 reaction chambers | - | - | + | - |
Testing result shows that this kit is used in micro-fluidic chip detection and can accurately detect and distinguish pneumonia branch original
Body, chlamydia pneumoniae and Legionella pneumophila infection.
The basic principles and main features and advantage of the present invention have been shown and described above.The technical staff of the industry should
Understand, the present invention is not limited to the above embodiments, and the above embodiments and description only describe the originals of the present invention
Reason, without departing from the spirit and scope of the present invention, various changes and improvements may be made to the invention, such as primer is expanding
Final concentration in system is selected within the scope of 100~1000nM, and final concentration of the probe in amplification system is in 50~500nM
It is selected in range, final concentration of the trehalose in amplification system is selected in 1%~10% range, bovine serum albumin
The final concentration in amplification system is selected in 0.1%~5% range in vain, HotStart Taq enzymes, reverse transcriptase, UNG
Final concentration of the enzyme in amplification system is selected within the scope of 0.5U~5U, and dATP, dUTP, dCTP, dGTP are in amplification body
Final concentration in system is selected within the scope of 0.1mM~2mM, MgCl2Final concentration in amplification system 1.5mM~
It is selected within the scope of 10mM, these changes and improvements all fall within the protetion scope of the claimed invention.It is claimed
Range is defined by the appending claims and its equivalent thereof.
Sequence table
<110>The Nanjing bio tech ltd Lan Yu
<120>The kit and its application method of multiple pathogens are detected based on micro-fluidic chip
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213>The primer sequence of specific and conserved sequence is：Mycoplasma pneumoniae (Mycoplasma pneumoniae)
<400> 1
cagctcagtc gaatcgca 18
<210> 2
<211> 19
<212> DNA
<213>The primer sequence of specific and conserved sequence is：Mycoplasma pneumoniae (Mycoplasma pneumoniae)
<400> 2
cacatcaatc gactcgcag 19
<210> 3
<211> 22
<212> DNA
<213>Specificity T aqman probe sequences are：Mycoplasma pneumoniae (Mycoplasma pneumoniae)
<400> 3
gtctgtagag aggctctacg gc 22
<210> 4
<211> 16
<212> DNA
<213>The primer sequence of specific and conserved sequence is：Chlamydia pneumoniae (Chlamydia pneumoniae)
<400> 4
gacttgagct agcaca 16
<210> 5
<211> 17
<212> DNA
<213>The primer sequence of specific and conserved sequence is：Chlamydia pneumoniae (Chlamydia pneumoniae)
<400> 5
ctgatgcctg tctacga 17
<210> 6
<211> 26
<212> DNA
<213>Specificity T aqman probe sequences are：Chlamydia pneumoniae (Chlamydia pneumoniae)
<400> 6
ctgtctgact gatcatcgtc ctcatc 26
<210> 7
<211> 18
<212> DNA
<213>The primer sequence of specific and conserved sequence is：Legionella pneumophilia (Legionella pneumophila)
<400> 7
cagcgctagc tgcaatcc 18
<210> 8
<211> 18
<212> DNA
<213>The primer sequence of specific and conserved sequence is：Legionella pneumophilia (Legionella pneumophila)
<400> 8
gctagctggc tactgagc 18
<210> 9
<211> 25
<212> DNA
<213>Specificity T aqman probe sequences are：Legionella pneumophilia (Legionella pneumophila)
<400> 9
cgtcctagac tagcgttcaa tacag 25
Claims (8)
1. the kit of a kind of detection mycoplasma pneumoniae based on micro-fluidic chip, chlamydia pneumoniae and legionella pneumophilia, special
Sign is that the kit includes the micro-fluidic nucleic acid detection chip of more flux of active control flow path, prepackage dry powder detection reagent
And positive quality control product；The prepackage dry powder detection reagent contains the special of mycoplasma pneumoniae, chlamydia pneumoniae and legionella pneumophilia
The primer and Taqman fluorescence probe of property conserved sequence；
Wherein, the primer sequence of specific and conserved sequence is：
Mycoplasma pneumoniae, SEQ ID NO.1 and SEQ ID NO.2；
Chlamydia pneumoniae, SEQ ID NO.4 and SEQ ID NO.5；
Legionella pneumophilia, SEQ ID NO.7 and SEQ ID NO.8；
Specificity T aqman probe sequences are：Mycoplasma pneumoniae, SEQ ID NO.3；
Chlamydia pneumoniae, SEQ ID NO.6；
Legionella pneumophilia, SEQ ID NO.9.
2. detection mycoplasma pneumoniae, chlamydia pneumoniae and Shi Fei legions according to claim 1 based on micro-fluidic chip
The kit of bacterium, which is characterized in that the prepackage dry powder detection reagent further includes having PCR buffer solutions, trehalose, bovine serum albumin
In vain, dATP, dUTP, dCTP, dGTP, MgCl2, HotStart Taq enzymes, reverse transcriptase and UNG enzymes.
3. detection mycoplasma pneumoniae, chlamydia pneumoniae and Shi Fei legions according to claim 2 based on micro-fluidic chip
The kit of bacterium, which is characterized in that final concentration of 100~1000nM of the primer in amplification system；The probe is expanding
Final concentration of 50~500nM in increasing system；Final concentration of 1%~10%w/v of the trehalose in amplification system；It is described
Final concentration of 0.1%~5%w/v of the bovine serum albumin(BSA) in amplification system；The HotStart Taq enzymes, reverse transcriptase,
Final concentration of 0.5U~5U of the UNG enzymes in amplification system；The end of described dATP, dUTP, dCTP, dGTP in amplification system is dense
Degree is 0.1mM~2mM；The MgCl2Final concentration of 1.5mM~10mM in amplification system.
4. detection mycoplasma pneumoniae, chlamydia pneumoniae and Shi Fei legions according to claim 1 based on micro-fluidic chip
The kit of bacterium, which is characterized in that contain mycoplasma pneumoniae, chlamydia pneumoniae and legionella pneumophilia in the positive quality control product
The plasmid of amplification gene sequence.
5. detection mycoplasma pneumoniae, chlamydia pneumoniae and Shi Fei legions according to claim 1 based on micro-fluidic chip
The kit of bacterium, which is characterized in that the micro-fluidic nucleic acid detection chip of more flux of the active control flow path has miniflow flow control
Road, including one go out sample sprue and several decimated streams roads；Each decimated streams road split settings, each decimated streams road correspond to one
A reaction chamber, the reagent of the energy each reaction chamber of decile.
6. according to detection mycoplasma pneumoniae of the claim 1-5 any one of them based on micro-fluidic chip, chlamydia pneumoniae and
The kit of legionella pneumophilia, which is characterized in that it is described prepackage dry powder detection reagent preparation method be：
(1) prepared detection reagent solution is dispensed into single part in PCR pipe, 8h or more is frozen under the conditions of being put into -80 DEG C；
(2) detection reagent frozen is put into vacuum freeze drier, set freeze dryer program as：
- 50 DEG C, 1h, 1 atmospheric pressure；
- 40 DEG C, 5h, ＜ 10Pa；
- 10 DEG C, 2h, ＜ 10Pa；
0 DEG C, 2h, ＜ 10Pa；
30 DEG C, 5h, ＜ 10Pa；
(3) after the completion of dry, reagent, as dry powder are taken out.
7. detection mycoplasma pneumoniae, chlamydia pneumoniae and Shi Fei legions according to claim 6 based on micro-fluidic chip
The kit of bacterium, which is characterized in that the prepackage dry powder detection reagent is that pre- more flux mounted in the active control flow path are micro-
In flow control nucleic acid detection chip.
8. a kind of application method using claim 1-7 any one of them kits, this approach includes the following steps：
(1) sample DNA/RNA is extracted 200 μ L of template altogether to be added in the well of micro-fluidic nucleic acid detection chip, covers sample-adding
Port lid is put into micro-fluidic chip detector and detects；
(2) condition of pcr amplification reaction is：
92~97 DEG C of 1~10min of pre-degeneration；
92~97 DEG C of 5~10s of denaturation, 58~62 DEG C of annealing extend 15~30s, 30~45 cycles；
(3) availability deciding：
Negative control hole is the blank well for not adding primed probe, and testing result should be negative, and Positive control wells detect as sun
Property, otherwise experiment is considered as invalid；
(4) result interpretation：
It is provided according to the detection signal of corresponding reaction chamber as a result, directly judging mycoplasma pneumoniae, chlamydia pneumoniae and Shi Fei armies
The yin and yang attribute result of group bacterium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810180333.5A CN108531556A (en) | 2018-03-05 | 2018-03-05 | The kit and its application method of multiple pathogens are detected based on micro-fluidic chip |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810180333.5A CN108531556A (en) | 2018-03-05 | 2018-03-05 | The kit and its application method of multiple pathogens are detected based on micro-fluidic chip |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108531556A true CN108531556A (en) | 2018-09-14 |
Family
ID=63485549
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810180333.5A Pending CN108531556A (en) | 2018-03-05 | 2018-03-05 | The kit and its application method of multiple pathogens are detected based on micro-fluidic chip |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108531556A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109321636A (en) * | 2018-10-09 | 2019-02-12 | 中国农业大学 | A kind of chip and application for the detection of Chlamydia species specificity |
| CN109988869A (en) * | 2019-04-23 | 2019-07-09 | 深圳市亚辉龙生物科技股份有限公司 | Nucleic acid compositions, detection unit, micro-fluidic chip and detection device |
| CN116287356A (en) * | 2023-05-16 | 2023-06-23 | 中国医学科学院北京协和医院 | Primer probe composition and kit for detecting multiple respiratory tract pathogenic bacteria and drug resistance genes |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105567802A (en) * | 2015-12-07 | 2016-05-11 | 江苏和创生物科技有限公司 | Fluorescence PCR (polymerase chain reaction) detection kit for Chlamydia pneumoniae |
| CN105624285A (en) * | 2015-12-07 | 2016-06-01 | 江苏和创生物科技有限公司 | Mycoplasma pneumoniae fluorescent PCR detection reagent kit |
| CN105624286A (en) * | 2015-12-07 | 2016-06-01 | 江苏和创生物科技有限公司 | Legionella pneumophila fluorescence PCR detection kit |
| CN107603866A (en) * | 2017-08-07 | 2018-01-19 | 南京岚煜生物科技有限公司 | Detect the micro-fluidic chip kit and its application method of 10 kinds of respiratory tract infection pathogen |
-
2018
- 2018-03-05 CN CN201810180333.5A patent/CN108531556A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105567802A (en) * | 2015-12-07 | 2016-05-11 | 江苏和创生物科技有限公司 | Fluorescence PCR (polymerase chain reaction) detection kit for Chlamydia pneumoniae |
| CN105624285A (en) * | 2015-12-07 | 2016-06-01 | 江苏和创生物科技有限公司 | Mycoplasma pneumoniae fluorescent PCR detection reagent kit |
| CN105624286A (en) * | 2015-12-07 | 2016-06-01 | 江苏和创生物科技有限公司 | Legionella pneumophila fluorescence PCR detection kit |
| CN107603866A (en) * | 2017-08-07 | 2018-01-19 | 南京岚煜生物科技有限公司 | Detect the micro-fluidic chip kit and its application method of 10 kinds of respiratory tract infection pathogen |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109321636A (en) * | 2018-10-09 | 2019-02-12 | 中国农业大学 | A kind of chip and application for the detection of Chlamydia species specificity |
| CN109988869A (en) * | 2019-04-23 | 2019-07-09 | 深圳市亚辉龙生物科技股份有限公司 | Nucleic acid compositions, detection unit, micro-fluidic chip and detection device |
| CN109988869B (en) * | 2019-04-23 | 2023-08-11 | 深圳市亚辉龙生物科技股份有限公司 | Nucleic acid composition, detection unit, microfluidic chip and detection device |
| CN116287356A (en) * | 2023-05-16 | 2023-06-23 | 中国医学科学院北京协和医院 | Primer probe composition and kit for detecting multiple respiratory tract pathogenic bacteria and drug resistance genes |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105734168B (en) | A kind of 12 kinds of Respirovirus nucleic acid multiple PCR detection kits | |
| CN107365876A (en) | For detecting the kit and its application method of 10 respiratory tract infection pathogen | |
| Lowe et al. | PCR-based Methodologies Used to Detect and Differentiate the Burkholderia pseudomallei complex: B. pseudomallei, B. mallei, and B. thailandensis | |
| CN103074451B (en) | Kit for synchronously detecting twenty-two respiratory tract pathogens and detection method of kit | |
| CN108531556A (en) | The kit and its application method of multiple pathogens are detected based on micro-fluidic chip | |
| CN110408725A (en) | Kit for respiratory pathogen Multiple detection | |
| CN110331232A (en) | A kind of respiratory pathogen multiple nucleic acid detection kit | |
| CN108048584A (en) | The brucellar probe of RAA Fluorometric assays and kit | |
| CN110273026A (en) | Respiratory tract infection Multiple detection kit and detection method | |
| CN107619850A (en) | A kind of method of the quantitative detection vibrio alginolyticus based on aptamer | |
| CN101429539B (en) | Reagent kit for real time fluorescence quantitative PCR detection of bacillus pyocyaneus | |
| CN106987626A (en) | For a variety of fungies of quick detection and identify primer and probe and its application of strain | |
| Tian et al. | A LAMP-based microfluidic module for rapid detection of pathogen in cryptococcal meningitis | |
| CN108277291A (en) | Kit and its application method for detecting multiple pathogens | |
| CN108411039A (en) | Kit and its application method based on micro-fluidic chip detection Respiratory Syncytial Virus(RSV) A, Type B | |
| CN108546786A (en) | Kit and its application method for detecting rhinovirus, Respiratory Syncytial Virus(RSV) and parainfluenza virus | |
| CN101736078A (en) | Method for detecting viable bacteria of Mycobacterium tuberculosis through isothermal amplification of nucleic acid and kit | |
| CN108559790A (en) | The kit and its application method of three kinds of respiratory pathogens are detected based on micro-fluidic chip | |
| CN104342487B (en) | Mycoplasma nucleic acid constant-temperature amplification method | |
| CN102978282B (en) | Typhoid fever salmonella and salmonella paratyphi fluorescent quantitative polymerase chain reaction (PCR) detection kit and application thereof | |
| CN103773884B (en) | For detecting the primer sets of Chlamydia pneumoniae 98KDa MOMP gene and probe and application thereof | |
| CN112301159A (en) | RDA method and kit for rapidly detecting influenza B virus | |
| CN103146841B (en) | Kit capable of synchronously detecting eighteen kinds of fever with eruption pathogens and detection method thereof | |
| CN102337352B (en) | Kit for detecting multiple influenza viruses by polymerase chain reaction (PCR) microarray | |
| CN112210624A (en) | LAMP primer and kit for efficient triple detection of three pathogens of Chinese softshell turtles |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180914 |
|
| RJ01 | Rejection of invention patent application after publication |