CN110408725A - Kit for respiratory pathogen Multiple detection - Google Patents
Kit for respiratory pathogen Multiple detection Download PDFInfo
- Publication number
- CN110408725A CN110408725A CN201910535888.1A CN201910535888A CN110408725A CN 110408725 A CN110408725 A CN 110408725A CN 201910535888 A CN201910535888 A CN 201910535888A CN 110408725 A CN110408725 A CN 110408725A
- Authority
- CN
- China
- Prior art keywords
- primer
- probe
- seq
- kit
- primer pair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the kits for respiratory pathogen Multiple detection, specifically, the present invention has carried out design and experimental verification to multiple respiratory pathogen PCR amplification system, the multiple fluorescence PCR amplification system of detection various respiratory road pathogen is obtained, unitary system can detect 3 kinds of respiratory pathogens simultaneously.Kit of the invention has very high sensitivity and specificity, and kit through the invention can be realized to the quick detection and analysis of multiple respiratory pathogen in Nasopharyngeal swabs, bronchoalveolar lavage fluid, phlegm equal samples.
Description
Technical field
The invention belongs to field of biotechnology, specifically, the present invention relates to one kind to be used for the multiple inspection of respiratory pathogen
The kit of survey.
Background technique
Acute respiratory infection (acute respiratory tract infection, ARTI) is people in global range
One of most common communicable disease of class, disease incidence occupies the first place of acute infectious disease, and lower respiratory tract infection causes greatly every year on average
About 4,000 000 deaths.In the world, respiratory tract infection is the main reason for leading to 5 years old or less death of child.
Caused as ARTI-by bacterium and virus, wherein about 90% is caused by Respirovirus, but dead and severe case master
It will be as caused by bacterium infection.In face of the Complex Situation of current respiratory infectious disease prevention and treatment, reinforce infecting popular diseased plant disease epidemic situation
The monitoring of information can provide foundation to work out the prevention and control strategy of infectious disease；The clinically type of clear pathogen early, into
Targetedly anti-infective therapy is then the key link for controlling infection to row.
There are many Pathogen category for infecting respiratory system, at the same also because of the popular Pathogen categories of the difference in season not
Together.Causing infant the virus of acute respiratory infection occur is mainly influenza A virus (Influence A, IVA), B-mode stream
Influenza Virus (Influence B, IVB), Respiratory Syncytial Virus(RSV) (Respiratory Syncytial Virus, RSV) and adenopathy
Malicious (Adenovirus, ADV) etc.；Causing infant the bacterium of acute respiratory infection occur is chlamydia pneumoniae (Chlamydia
Pneumoniae, CP), mycoplasma pneumoniae (Mycoplasma pneumoniae, MP), streptococcus pneumonia (Streptococcus
Pneumoniae, SP), legionella pneumophilia (Legionella pneumophila, LP) and haemophilus influenzae
(Haemophilus influenzae, HI) etc..In crowd, especially in children, acute respiratory infection is often virus
With bacteria mixed infection or secondary infection or single and a variety of virus infections, with the sustainable development of the state of an illness, mixed infection at
For a kind of universal phenomenon.This increases difficulty for the detection of the infant state of an illness and the determination of pathogen.Therefore respiratory diseases are carried out
Substance Laboratory Monitoring carries out prediction and warning to respiratory infectious disease epidemic situation most possibly, to popular early in epidemic outbreak
Phase finds in time and takes quick counter-measure, reduces the influence to social and economic development.
The detection method of currently used detection respiratory pathogen: cultivation, Serologic detection, molecular Biological Detection
Method etc..
Cultivation is diagnosing bacterial infection and the most reliable method of virus infection, and the goldstandard of diagnosis.But it is this
Method is complicated, and cumbersome, the period is long, and sensitivity is low, and the requirement to sample is relatively high, and the result of false negative easily occurs.
Serologic detection is detected based on antigen-antibody reaction principle, and detection cycle is short, but specificity and sensitivity
It is low, easily occur false negative and false positive as a result, having certain limitation.
Therefore, it is high, easy to operate to be dedicated to developing accuracy by those skilled in the art, can detect various respiratory road disease simultaneously
The detection technique of substance, fast and accurately to detect respiratory pathogen epidemic situation.
Summary of the invention
The purpose of the present invention is to provide a kind of highly sensitive, easy to use for respiratory pathogen Multiple detection
Kit.
The first aspect of the present invention, provides a kind of PCR primer for respiratory pathogen Multiple detection to group, described
Primer pair group includes the first primer to collection, and the first primer includes: to collection
The first primer pair, the first primer is to including the forward primer as shown in SEQ ID NO.:11；With such as SEQ
Reverse primer shown in ID NO.:12；
Second primer pair, second primer pair include the forward primer as shown in SEQ ID NO.:14；With such as SEQ
Reverse primer shown in ID NO.:15；With
Third primer pair, the third primer pair include the forward primer as shown in SEQ ID NO.:17；With such as SEQ
Reverse primer shown in ID NO.:18.
In another preferred example, the primer pair group further includes the second primer pair collection, and the second primer pair collection includes:
4th primer pair, the 4th primer pair include the forward primer as shown in SEQ ID NO.:1；With such as SEQ ID
Reverse primer shown in NO.:2；
5th primer pair, the 5th primer pair include the forward primer as shown in SEQ ID NO.:4；With such as SEQ ID
Reverse primer shown in NO.:5.
6th primer pair, the 6th primer pair include the forward primer as shown in SEQ ID NO.:7；With such as SEQ ID
Reverse primer shown in NO.:8.
In another preferred example, the primer pair group further includes third primer pair collection, and the third primer pair collection includes:
7th primer pair, the 7th primer pair include the forward primer as shown in SEQ ID NO.:20；With such as SEQ
Reverse primer shown in ID NO.:21.
8th primer pair, the 8th primer pair include the forward primer as shown in SEQ ID NO.:23；With such as SEQ
Reverse primer shown in ID NO.:24.
9th primer pair, the 9th primer pair include the forward primer as shown in SEQ ID NO.:26；With such as SEQ
Reverse primer shown in ID NO.:27.
In another preferred example, the first primer optionally includes the tenth primer pair to collection.
In another preferred example, the second primer pair collection optionally includes the tenth primer pair.
In another preferred example, the third primer pair collection optionally includes the tenth primer pair.
The second aspect of the present invention provides a kind of probe groups for respiratory pathogen Multiple detection, the probe
Group includes: the first probe as shown in SEQ ID NO.:13.
In another preferred example, the probe groups further include: the second probe as shown in SEQ ID NO.:6.
In another preferred example, the probe groups further include: the third probe as shown in SEQ ID NO.:9.
In another preferred example, the probe groups further include: the 4th probe as shown in SEQ ID NO.:10.
In another preferred example, the probe groups further include: the 5th probe as shown in SEQ ID NO.:3.
In another preferred example, the probe groups further include: the 6th probe as shown in SEQ ID NO.:16.
In another preferred example, the probe groups further include: the 7th probe as shown in SEQ ID NO.:19.
In another preferred example, the probe groups further include: the 8th probe as shown in SEQ ID NO.:22.
In another preferred example, the probe groups further include: the 9th probe as shown in SEQ ID NO.:25.
In another preferred example, the probe groups further include: the tenth probe as shown in SEQ ID NO.:28.
In another preferred example, the probe groups further include: the 11st probe as shown in SEQ ID NO.:31.
The third aspect of the present invention provides a kind of kit for respiratory pathogen Multiple detection, the reagent
Box includes PCR primer described in first aspect present invention to group.
In another preferred example, the kit further includes probe groups described in second aspect of the present invention.
In another preferred example, the kit includes the first primer probe mixed liquor, the first primer probe mixing
Liquid includes:
The first primer to collection, and the first probe as shown in SEQ ID NO.:13, as shown in SEQ ID NO.:16
The second probe, the third probe as shown in SEQ ID NO.:19.
In another preferred example, the kit further includes the second primed probe mixed liquor, and second primed probe is mixed
Closing liquid includes:
The second primer pair collection, and the 4th probe as shown in SEQ ID NO.:3, as shown in SEQ ID NO.:6
5th probe, the 6th probe as shown in SEQ ID NO.:9, the 7th probe as shown in SEQ ID NO.:10.
In another preferred example, the kit further includes third primed probe mixed liquor, and the third primed probe is mixed
Closing liquid includes:
The third primer pair collection, and the 8th probe as shown in SEQ ID NO.:22, as shown in SEQ ID NO.:25
The 9th probe, the tenth probe as shown in SEQ ID NO.:28.
In another preferred example, the first primer probe mixed liquor optionally includes the 11st probe.
In another preferred example, the second primed probe mixed liquor optionally includes the 11st probe.
In another preferred example, the third primed probe mixed liquor optionally includes the 11st probe.
In another preferred example, the kit further includes the component of one or more independent packagings selected from the group below:
Tris-HCl, triphosphoric acid dezyribonucleoside, (NH4)2SO4、MgCl2, KCl, C-MMLV reverse transcriptase, RNA enzyme suppression
Preparation, hot start Taq polymerase.
In another preferred example, the kit further includes negative quality-control product.
In another preferred example, the kit further includes positive quality control product.
The fourth aspect of the present invention provides a kind of method for detecting respiratory pathogen, the method includes the steps:
(1) sample to be detected, the gene containing respiratory pathogen in the sample are provided；
(2) amplification reaction system is prepared, is carried out amplification reaction:
Wherein, the amplification reaction system include step (1) provide sample to be detected, described in first aspect present invention
Probe groups described in primer pair group and second aspect of the present invention.
In another preferred example, three reaction systems are prepared in the step (2), respectively include the first primer probe
Mixed liquor, the second primed probe mixed liquor and the third primed probe mixed liquor.
In another preferred example, the method is non-diagnostic purpose.
The fifth aspect of the present invention provides primer pair group and second aspect of the present invention described in first aspect present invention
The purposes of the probe groups is used to prepare detection kit, and the detection kit is for detecting respiratory pathogen.
It should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the invention and in below (eg embodiment) specifically
It can be combined with each other between each technical characteristic of description, to form a new or preferred technical solution.As space is limited, herein
No longer tire out one by one and states.
Detailed description of the invention
Fig. 1 shows the sensitivity technique result of swin flu.
Fig. 2 shows the sensitivity technique result of second stream
Fig. 3 shows Respiratory Syncytial Virus(RSV) A type sensitivity technique result.
Fig. 4 shows Respiratory Syncytial Virus(RSV) Type B sensitivity technique result.
Fig. 5 shows 1 type sensitivity technique result in adenovirus type.
Fig. 6 shows haemophilus influenzae sensitivity technique result.
Fig. 7 shows legionella pneumophilia sensitivity technique result.
Fig. 8 shows chlamydia pneumoniae sensitivity technique result.
Fig. 9 shows mycoplasma pneumoniae sensitivity technique result.
Figure 10 shows streptococcus pneumonia sensitivity technique result.
Figure 11 shows internal standard sensitivity technique result.
Figure 12 shows adenovirus testing result.
Figure 13 shows second stream testing result.
Figure 14 shows Respiratory Syncytial Virus(RSV) testing result.
Figure 15 shows swin flu testing result.
Figure 16 shows haemophilus influenzae testing result.
Figure 17 shows legionella pneumophilia testing result.
Figure 18 shows 1 amplification of swin flu primer pair.
Figure 19 shows 2 amplification of swin flu primer pair.
Figure 20 shows 3 amplification of swin flu primer pair.
Figure 21 shows 4 amplification of swin flu primer pair.
Figure 22 shows 5 amplification of swin flu primer pair.
Specific embodiment
The present inventor designs multiple respiratory pathogen PCR amplification system by extensive and in-depth research
And experimental verification.By furtheing investigate and testing repeatedly, the multiple fluorescence PCR amplification of detection various respiratory road pathogen is obtained
System can detect 9 kinds of respiratory pathogens simultaneously.Respiratory pathogen is divided into three groups of systems in the technology and carries out multi-fluorescence
PCR amplification, these three combinations, every kind of combination interfere with each other inhibition between capable of well solving multiple fluorescence PCR system primer
The biggest problem.Kit of the invention has very high sensitivity and specificity, and kit through the invention can be realized
To the quick detection and analysis of multiple respiratory pathogen in Nasopharyngeal swabs, blood, bronchoalveolar lavage fluid, phlegm equal samples.
Multiplex PCR
Multiple real time fluorescence PCR method is using a variety of fluorescent markers that can realize to more in the same reaction system
It is detected while grave illness substance, and high specificity, high sensitivity is simple and efficient to handle, and instrument is easy to popularize, and is easy to push away
It is wide to use.
Multiplex PCR (multiplex PCR), also known as Multiplex PCR or composite PCR, it is in same PCR reaction system
In add two pairs or more primers, while amplifying the PCR reaction of multiple nucleic acid fragments, reaction principle, reaction reagent and operation
Process is identical as general PCR.
The many because being known as of multi-PRC reaction are influenced, such as:
(1) reaction system is uneven, and the imbalance of reaction system leads to certain advantage primers in several wheels reaction of early period
And its template expands rapidly, obtains a large amount of amplified production, and these amplified productions are the good inhibition of archaeal dna polymerase simultaneously
Agent.So the polymerizing power of polymerase is by more more and more intense inhibition, therefore, at early period with a large amount of appearance of amplified production
In the primer and its template of disadvantage, at this moment just more it is difficult to react, it is very small to eventually lead to amplified production amount, so that it cannot
Detection.
(2) primer specificity, if primer and the non-target gene fragment binding force of other in system are stronger, purpose base
It is striven unexpectedly because combining the ability of primer just to will receive, so as to cause amplification efficiency decline.
(3) optimum annealing temperature is inconsistent, and multipair primer is placed into a system and is expanded, due to carrying out PCR reaction
Annealing temperature it is identical, it requires that the optimum annealing temperature of every pair of primers is close.
(4) primer dimer, including between primer dimer and primer itself be formed by hairpin structure, there are also a kind of
It is the aggressiveness that third party DNA is mediated, these dimers and non-specific primer is the same can all interfere primer and target binding site
Unexpectedly it strives, influences amplification efficiency.
Although above-mentioned be referred to the several factors for influencing amplification efficiency, more factors are unclear.Up to the present,
There are no the effective ways that one can clearly predict amplification efficiency.
Common virus: influenza A virus type, influenza B virus is selected from the relevant pathogen of respiratory tract infection
Type, Respiratory Syncytial Virus(RSV), adenovirus；Bacterium: mycoplasma pneumoniae, chlamydia pneumoniae, streptococcus pneumonia, legionella pneumophilia and stream
Haemophilus influenza is research object, devises primer and probe, then the primer and probe of design is in optimized selection and is verified,
The primer and probe sequence that can be used for multiplexed PCR amplification finally has been determined, has been developed on this basis for common breathing
The multiplex PCR Fluorometric assay kit of road pathogen detection.
As used herein, term " respiratory pathogen " includes 9 kinds of respiratory pathogens in this kit detection range:
Influenza A virus, influenza B virus, Respiratory Syncytial Virus(RSV), adenovirus, chlamydia pneumoniae, mycoplasma pneumoniae, pneumonia chain
Coccus, legionella pneumophilia, haemophilus influenzae.
The present inventor in the course of the research, to multiple respiratory pathogen PCR amplification primer design and test
Card.The result shows that detecting 9 kinds using multiple fluorescence PCR amplification system simultaneously due to the restricted tube body system of detection method and exhaling
The difficulty for inhaling road pathogen is very big.By furtheing investigate and testing repeatedly, respiratory pathogen is divided into three groups of bodies by the present inventor
System carries out multiple fluorescence PCR amplification, these three combinations, every kind of combination can well solve multiple fluorescence PCR system primer
Between interfere with each other the biggest problem of inhibition, while this kit can be improved the sensitivity of this kit detection using MGB probe
And specificity.
Therefore, kit provided by the invention includes that the first primer probe mixed liquor, second primed probe are mixed
Close liquid, and/or the third primed probe mixed liquor.
The first primer probe mixed liquor includes:
The first primer to collection, and the first probe as shown in SEQ ID NO.:3, as shown in SEQ ID NO.:6
Second probe, the third probe as shown in SEQ ID NO.:9, the 4th probe as shown in SEQ ID NO.:10.
The second primed probe mixed liquor includes:
The second primer pair collection, and the 5th probe as shown in SEQ ID NO.:13, as shown in SEQ ID NO.:16
The 6th probe, the 7th probe as shown in SEQ ID NO.:19.
The third primed probe mixed liquor includes:
The third primer pair collection, and the 8th probe as shown in SEQ ID NO.:22, as shown in SEQ ID NO.:25
The 9th probe, the tenth probe as shown in SEQ ID NO.:28.
This kit is related to a kind of multiplex PCR Fluorometric assay various respiratory road pathogen detection kit.This kit
With very high sensitivity and specificity, kit through the invention is realized to Nasopharyngeal swabs, blood, bronchoalveolar lavage fluid, phlegm
The quick detection and analysis of multiple respiratory pathogen in equal samples.
This kit detects above-mentioned several respiratory pathogens using multiplex PCR fluorescence probe method, selects each pathogen high
Spending conserved domain is to expand target segment, the multipair primer and probe of engineer, then it is in optimized selection and is verified, finally
Determine a kind of multiple respiratory pathogen detection kit comprising following primer and probe sequence.Each detailed primer sequence of pathogen
Column are shown in Table 1:
1 respiratory pathogen primer and probe sequence of table
In a preferred embodiment of the present invention, primer and probe is separately designed for different respiratory pathogens figures.
Wherein, F is forward primer, and R is reverse primer, and P is probe, and middle probe uses MGB probe, can be improved the Tm of probe
Value, while can be improved the sensitivity and specificity of kit detection.
In present aspect preferred embodiment, the Tm value of primer is at 50~60 DEG C, in conjunction with drawing forward or backwards for collocation
Object, avoids the generation of primer dimer, while selecting MGB probe, makes the Tm value of probe at 60~70 DEG C, avoids probe
Sequence is too long and the combination of other non-specific sequences, at the same also avoid the mutual row of probe at primer dimer and
Hairpin structure effectively improves the specificity and efficiency of PCR amplification.
In further preferred embodiment of the present invention, to reach testing goal, the probe of all respiratory pathogens
Have fluorescent reporter group and fluorescent quenching group, the fluorescence report base of influenza A virus, adenovirus and chlamydia pneumoniae
Group is selected from FAM,；Influenza B virus, haemophilus influenzae and mycoplasma pneumoniae fluorescent reporter group are selected from Texas Red,；It exhales
Inhaling road syncytial virus, legionella pneumophilia and streptococcic fluorescent reporter group CY5, the above fluorescent quenching group is MGB.
In addition to primer and probe above-mentioned, a kind of multiple respiratory pathogen detection kit, further includes Tris-
HCl (being purchased from Sigma company, article No.: T1503), triphosphoric acid dezyribonucleoside (have purchased from Pu Luomaige (Beijing) biotechnology
Limit company, article No.: U1515), (NH4)2SO4(being purchased from Sigma company, article No.: A4418), MgCl2(it is purchased from Sigma company, goods
Number: M2670), KCl (be purchased from Sigma company, article No.: P9541), C-MMLV reverse transcriptase be (from Zhongshan University up to peace gene stock
Part Co., Ltd, article No.: E0101), RNase inhibitor (be purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd, article No.:
SN251XS), hot start Taq polymerase (coming from Da'an Gene Company, Zhongshan University, article No.: E0201).
The concrete content of each component is as follows in the detection kit:
A kind of multiplex PCR Fluorometric assay respiratory pathogen provided by the invention, sequentially includes the following steps:
(1) sample to be tested RNA or DNA nucleic acid is extracted；
(2) using sample to be tested nucleic acid as template, it is configured to reaction system by the above component, carries out multiple fluorescence PCR reaction；
The PCR reaction condition are as follows: 50 DEG C 15 minutes, 95 DEG C initial denaturation 15 minutes, then press 94 DEG C 15 seconds → 55 DEG C 45
(the collecting fluorescence) second expands 45 circulations.
Main advantages of the present invention are:
(1) 3 kinds of common respiratory pathogens: adenovirus, legionella pneumophilia, haemophilus influenzae can be detected simultaneously；
(2) MGB probe is used, the specificity and sensitivity of testing result are improved；
(3) internal standard gene is added, reducing extraction problem leads to false positive, and joined yin and yang attribute quality-control product, can be to examination
The quality and environment of agent carry out control with the presence or absence of pollution, improve the accuracy of kit, as a result more true and reliable；
(4) easy to operate, high degree of automation.
The present invention by multiple fluorescence PCR method, establish for adenovirus, legionella pneumophilia, haemophilus influenzae it is multiple
Detection method establishes 9 kinds of common respiratory pathogens: influenza A virus, influenza B virus, breathing on this basis
Road syncytial virus, adenovirus, chlamydia pneumoniae, mycoplasma pneumoniae, streptococcus pneumonia, legionella pneumophilia, haemophilus influenzae
Rapid detection method.
Combined with specific embodiments below, the further old present invention in detail.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.The experimental method of detailed conditions is not specified in the following example, usually according to conventional strip
Part such as U.S. Sambrook.J etc. writes " Molecular Cloning: A Laboratory room guide " (Huang Peitang etc. is translated, Beijing: Science Press, 2002)
Described in condition, or according to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number be by weight
It calculates.Experimental material used in following embodiment and reagent can obtain unless otherwise instructed from commercially available channel.
Embodiment 1
1, materials and methods
1.1 analog sample
Virus liquid: influenza A virus, influenza B virus, Respiratory Syncytial Virus(RSV)；Plasmid: adenovirus, pneumonia clothing are former
Body, mycoplasma pneumoniae, streptococcus pneumonia, legionella pneumophilia, haemophilus influenzae, plasmid is by the raw limited public affairs of work bioengineering in Shanghai
Department's synthesis, virus liquid are prepared by Da'an Gene Company, Zhongshan University.
1.2 clinical sample
50 respiratory pathogen positive samples and 20 negative samples.
1.3 primer and probe
By having delivered respiratory pathogen associated nucleic acid sequence reported in the literature with domestic and international to Genebank database
Column carry out sequence alignment analysis, select no secondary structure and highly conserved section is expands target segment, engineer is multipair to draw
Object and probe.Primer and probe is synthesized by Shanghai Sheng Gong Biological Co., Ltd., and particular sequence feature and probe label are such as
It is upper described.
1.4RNA or DNA nucleic acid extraction
The nucleic acid extraction or purified reagent (paramagnetic particle method) using Da'an Gene Company, Zhongshan University's production are extracted,
It is operated by kit specification.Nucleic acid after extraction is placed in -20 DEG C of refrigerators.
The optimization of 1.5 multiple fluorescence PCR reaction systems
Multiple fluorescence PCR uses three pipes, 25 μ l reaction system, and wherein system 1 mainly includes MgCl2, KCl, C-MMLV are reversed
It records enzyme, RNase inhibitor, hot start Taq polymerase, 4 pairs of primers and 4 probes and 5ul expands template；System 2 mainly includes
MgCl2, KCl, C-MMLV reverse transcriptase, RNase inhibitor, hot start Taq polymerase, 4 pairs of primers and 4 probes and 5ul expand
Template；System 3 mainly includes MgCl2, KCl, C-MMLV reverse transcriptase, RNase inhibitor, hot start Taq polymerase, 4 pairs of primers and 4
Probe and 5ul expand template.Expanded using ABI 7500PCR instrument, amplification condition are as follows: 50 DEG C 15 minutes, 95 DEG C are pre-
Denaturation 15 minutes, then by 94 DEG C 15 seconds → 55 DEG C (collecting fluorescence) amplifications in 45 seconds, 45 circulations.
The optimization of system is tested, each pair of primer and probe same amount, using the positive nucleic acid of gradient dilution as template into
Row detects, the high primed probe pair of preliminary screening amplification efficiency under the conditions of substance；By the primed probe of screening to carrying out being in charge of group
It closes, whether test in every kind of combination has Competitive assays and non-specific amplification situation between primed probe pair；Select effect preferable
It is in charge of combination, primed probe dosage is optimized according to the height of fluorescent value and Ct value situation, is optimized using orthogonal experiment
The concentration of magnesium ion in Buffer, while optimizing the dosage of dNTP, thermal starting enzyme, CMMLV enzyme.
1.6 specificity and sensitivity determination
Using determining multiple respiratory pathogen system respectively to influenza A virus, influenza B virus, respiratory tract
Syncytial virus, adenovirus, chlamydia pneumoniae, mycoplasma pneumoniae, streptococcus pneumonia, legionella pneumophilia, haemophilus influenzae people
Nasopharyngeal swabs nucleic acid is detected, its specificity is evaluated.
Influenza A virus, influenza B virus, Respiratory Syncytial Virus(RSV), adenovirus, the pneumonia clothing of concentration will have been demarcated
Substance, mycoplasma pneumoniae, streptococcus pneumonia, legionella pneumophilia, people's Nasopharyngeal swabs nucleic acid progress gradient of haemophilus influenzae are dilute
It releases, detects its sensitivity.
The detection of 1.7 clinical samples
Using respiratory tract sick body original Multiple detection system established by the present invention, 50 unknown positive patient nucleic acid are carried out
Detection, and using the related substance respiratory pathogen PCR detection reagent of Da'an Gene Company, Zhongshan University's production
Box (such as IVA, IVB, LP, CP, MP) synchronizes detection, and carries out sequence verification to positive sample.
2 results
2.1 substance Fluorescence PCR systems
2.1.1 substance Fluorescence PCR system 1
2.1.2 substance Fluorescence PCR system 2
2.1.3 substance Fluorescence PCR system 3
2.1.4 substance Fluorescence PCR system 4
2.1.5 substance Fluorescence PCR system 5
2.1.6 substance Fluorescence PCR system 6
2.1.7 substance Fluorescence PCR system 7
2.1.8 substance Fluorescence PCR system 8
2.1.9 substance Fluorescence PCR system 9
2.1.10 substance Fluorescence PCR system 10
2.2 multiple fluorescence PCR systems
2.2.1 multiple fluorescence PCR system 1
2.2.2 multiple fluorescence PCR system 2
2.2.3 multiple fluorescence PCR system 3
2.3 specific test
It is former with influenza A virus, influenza B virus, Respiratory Syncytial Virus(RSV), adenovirus, chlamydia pneumoniae, pneumonia branch
Body, streptococcus pneumonia, legionella pneumophilia, haemophilus influenzae nucleic acid be positive template, with cytomegalovirus, herpe simplex disease
Malicious 1 type, human corona virus NL63, human bocavirus, Epstein-Barr virus, haemadsorption virus 2, metapneumovirus, enterovirus/rhinopathy
Poison, mycobacterium tuberculosis, Escherichia coli, pseudomonas aeruginosa nucleic acid are negative template, are tried through respiratory pathogen Multiple detection
Agent box detection, the results show that detection reagent can accurately detect influenza A virus, influenza B virus, respiratory syncystial
Virus, adenovirus, chlamydia pneumoniae, mycoplasma pneumoniae, streptococcus pneumonia, legionella pneumophilia, haemophilus influenzae nucleic acid, and
And do not occur false retrieval, situations such as missing inspection；And cytomegalovirus, herpes simplex virus type 1, human corona virus NL63, people's Bo Ka disease
Poison, Epstein-Barr virus, haemadsorption virus 2, metapneumovirus, enterovirus/rhinovirus nucleic acid etc. do not occur false positive results.
2.4 sensitivity test
Influenza A virus, influenza B virus, Respiratory Syncytial Virus(RSV), adenovirus, chlamydia pneumoniae, pneumonia branch is former
Body, streptococcus pneumonia, legionella pneumophilia, haemophilus influenzae nucleic acid carry out gradient dilution, concentration is 1 respectively ×
104Copies/mL, 1 × 103Copies/mL, 1 × 102Copies/mL, 5 × 10copies/mL are detected through fluorescent PCR, detection
As a result are as follows: concentration is 1 × 104Copies/mL and 1 × 103The positive rate of copies/mL is 100%；Concentration be 1 ×
102The positive rate of copies/mL is 95%, and the positive rate of 5 × 10copies/mL is 60%.Therefore, the sensitivity of this kit
It is 1 × 102copies/mL。
The detection of 2.5 clinical samples
Use respiratory pathogen multiple fluorescence PCR method established by the present invention to 50 respiratory tract infection clinical samples with
And 20 negative samples are detected, and glimmering using the correspondence type substance of Da'an Gene Company, Zhongshan University's production
Fluorescent Quantitative PCR detection kit carries out control verifying, as the result is shown in 50 respiratory tract infection clinical samples, quantitative fluorescent PCR
50 positives, positive rate 100%, 20 negative sample detections are detected with respiratory pathogen multiple fluorescence PCR method
It is feminine gender, two methods consistency is high, as a result has statistical significance.
Specific to different types, multiple fluorescence PCR method is compared with substance fluorescent PCR method, influenza A virus as the result is shown
21, influenza B virus 9, Respiratory Syncytial Virus(RSV) 5, adenovirus 8, mycoplasma pneumoniae 3, chlamydia pneumoniae 1,
Streptococcus pneumonia 1, legionella pneumophilia 1, haemophilus influenzae 1, do not occur missing inspection situation.
Comparative example 1
This kit other gene order various to respiratory pathogen carries out after going deep into comparing analysis, for each target
5 pairs or more primer and probes of sequence design, since the Competitive assays between multiple reaction system primer, primer specificity are poor
Different, annealing temperature is inconsistent and the reasons such as primer dimer, is difficult to obtain effective with multiple PCR amplification primer and probe
Sequence.The present inventor is in optimized selection and verifies through a large number of experiments, to the primer and probe of design, and finally having determined can
With the primer and probe sequence and combinations thereof for multiplexed PCR amplification.
Even if in the case where determining the primer pair and probe sequence that are directed to each target nucleic acid substantially, different primers pair
There is also significant ground differences for the effect of combination progress multiplex amplification.For example, in multiplexed PCR procedures, by above-mentioned multiple reaction body
It is that 1 and 2 kinds of reaction system of adenovirus and the primed probe of influenza A virus are exchanged, is then detected, other detections steps
Rapid and condition is the same as embodiment 1.
Specific test the result shows that, legionella pneumophilia and Respiratory Syncytial Virus(RSV) cannot detect, and adenovirus
Amplification curve is suppressed.1 testing result of reaction system such as Figure 12-14；2 testing result of reaction system such as Figure 15-17.
Sensitivity test the result shows that, concentration be 1 × 103The positive rate of copies/mL sample is only 70%, Flu-A
Virus and influenza B virus, haemophilus influenzae, adenovirus part type testing result is positive, legionella pneumophilia and respiratory tract
Syncytial virus, adenovirus part type testing result are negative.
2 specific amplification influenza A primers of comparative example and probe optimization
This kit has separately designed 5 pairs or more primer and probe sequences for each target sequence, this comparative example is with A type
For influenza virus, the undesirable primer and probe of part effect is illustrated.
The screening of influenza A primers probe, it is first glimmering with substance by designed influenza A primers and probe
Light PCR amplification screens the higher primer of amplification efficiency, and the primed probe filtered out is added to multiple fluorescence PCR method and is surveyed
Examination.
Influenza A primers probe sequence and screening:
To 5 groups of primer combination of probe, first with substance fluorescent PCR amplification screening primer amplification effect, substance testing result hair
Existing primed probe is to 2,4,5 amplification efficiencies low (as illustrated in figs. 18-22), and Ct value is rearward or glimmering compared with primed probe is to 1 and 3
Light value is low, and primed probe can substantially meet subsequent experimental requirement to 1 and 3, needs to be added to and be done in multiple fluorescence PCR method into one
Step card.
Primer pair 1,3 is added separately to expand in multiple fluorescence PCR system, testing result is as follows:
Primer pair 1:
2F-1:GAGTCTTCTAACCGAGGTCGAAAC (SEQ ID NO.:32)
2R-1:CAGAGGTGACAGGATTGGTCT (SEQ ID NO.:33)
Primer pair 2:
2F-2:GAGYCTTCTAACCGAGGTCGAAAC (SEQ ID NO.:34)
2R-2:CAGAGGTGACAGGATTGGTCT (SEQ ID NO.:35)
Primer pair 3:
2F-3:TATTGGTCTCAGGGAGCAAAAGCAG (SEQ ID NO.:36)
2R-3:GAAATCTCGGCTTTGAGGGGGCC (SEQ ID NO.:37)
Primer pair 4:
2F-4:TTGAAAAGAGGGCCTKCTACGG (SEQ ID NO.:38)
2R-4:GACAAAATGACCATCGTCAACATCCAC (SEQ ID NO.:39)
Primer pair 5:
2F-5:GCCTGAGTCTATGAGGGAAGARTATC (SEQ ID NO.:40)
2R-5:GCTCTATGYTGACAAAATGACCATCG (SEQ ID NO.:41)
Primer pair 1 is added to multiple fluorescence PCR system testing result: primer pair 1 expand it is low, may with other primer pairs it
Between have Competitive assays or have primer dimer that expansion efficiency is caused to be lower；
Primer pair 3 is added to multiple fluorescence PCR system testing result: each type amplification efficiency is constant, and fluorescent value and Ct
Value is all satisfied requirement；
Comprehensively consider from many aspects, final choice primer pair 3 is as influenza A virus in multiplex PCR fluorescent detection system
In primer, which by verifying repeatedly, is able to satisfy requirement.
All references mentioned in the present invention is incorporated herein by reference, independent just as each document
It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can
To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims
It encloses.
Sequence table
<110>Da'an Gene Company, Zhongshan University
<120>it is used for the kit of respiratory pathogen Multiple detection
<130> 000030
<160> 41
<170> PatentIn version 3.5
<210> 1
<211> 29
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 1
tattggtctc agggagcaaa agcaggtag 29
<210> 2
<211> 23
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 2
gaaatctcgg ctttgagggg gcc 23
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 3
cctcgctcac tgggcacggt 20
<210> 4
<211> 21
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 4
atggagaagg caaagcagaa c 21
<210> 5
<211> 22
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 5
ccattccaag gcrgagtcta gg 22
<210> 6
<211> 18
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 6
actgttggtt yggtggga 18
<210> 7
<211> 21
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 7
tggctcttag caaagtcaag t 21
<210> 8
<211> 22
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 8
tgcacatcat aattrggagt gt 22
<210> 9
<211> 22
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 9
atcaacttct atcatccagc aa 22
<210> 10
<211> 20
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 10
accatccaac ggagcacagg 20
<210> 11
<211> 20
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 11
ttgccaaagg accccatcca 20
<210> 12
<211> 20
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 12
agccactcct ccaactggtg 20
<210> 13
<211> 22
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 13
ttcttcccga tcggctcgca tc 22
<210> 14
<211> 16
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 14
ggtgccgatt tgggga 16
<210> 15
<211> 18
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 15
tgagcgccac tcatagcg 18
<210> 16
<211> 21
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 16
catgccttta gccattgctt c 21
<210> 17
<211> 18
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 17
ccagtaatgt cgtattta 18
<210> 18
<211> 19
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 18
gttcctctaa caacgatgc 19
<210> 19
<211> 18
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 19
tcagcaacag agtatccg 18
<210> 20
<211> 15
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 20
gcaaccgtac cgcca 15
<210> 21
<211> 16
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 21
tcagtcccac aaaccg 16
<210> 22
<211> 20
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 22
cgaactatcc gcccagttga 20
<210> 23
<211> 20
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 23
caaagtctgc gaccatcaat 20
<210> 24
<211> 22
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 24
tccaatgtat ggcactaaag ag 22
<210> 25
<211> 21
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 25
tgaatggcaa gtaggagcct c 21
<210> 26
<211> 21
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 26
caccttcttc gttgaaatag t 21
<210> 27
<211> 18
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 27
tggaggaagc acacagac 18
<210> 28
<211> 22
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 28
agccatttcg cctgagttgt cg 22
<210> 29
<211> 22
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 29
ctccgtacac tctcctaccc tc 22
<210> 30
<211> 18
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 30
acacctctgg atgccact 18
<210> 31
<211> 19
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 31
ccattgccag tccgccgtc 19
<210> 32
<211> 24
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 32
gagtcttcta accgaggtcg aaac 24
<210> 33
<211> 21
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 33
cagaggtgac aggattggtc t 21
<210> 34
<211> 24
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 34
gagycttcta accgaggtcg aaac 24
<210> 35
<211> 21
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 35
cagaggtgac aggattggtc t 21
<210> 36
<211> 25
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 36
tattggtctc agggagcaaa agcag 25
<210> 37
<211> 23
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 37
gaaatctcgg ctttgagggg gcc 23
<210> 38
<211> 22
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 38
ttgaaaagag ggcctkctac gg 22
<210> 39
<211> 27
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 39
gacaaaatga ccatcgtcaa catccac 27
<210> 40
<211> 26
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 40
gcctgagtct atgagggaag artatc 26
<210> 41
<211> 26
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 41
gctctatgyt gacaaaatga ccatcg 26
Claims (10)
1. a kind of PCR primer for respiratory pathogen Multiple detection is to group, which is characterized in that the primer pair group includes the
One primer pair collection, the first primer include: to collection
The first primer pair, the first primer is to including the forward primer as shown in SEQ ID NO.:11；With such as SEQ ID
Reverse primer shown in NO.:12；
Second primer pair, second primer pair include the forward primer as shown in SEQ ID NO.:14；With such as SEQ ID
Reverse primer shown in NO.:15；With
Third primer pair, the third primer pair include the forward primer as shown in SEQ ID NO.:17；With such as SEQ ID
Reverse primer shown in NO.:18.
2. a kind of probe groups for respiratory pathogen Multiple detection, which is characterized in that the probe groups include: such as SEQ ID
First probe shown in NO.:13, the second probe as shown in SEQ ID NO.:16 and as shown in SEQ ID NO.:19
Three probes.
3. a kind of primed probe mixed liquor, which is characterized in that the primed probe mixed liquor includes PCR described in claim 1
Primer pair group；With probe groups as claimed in claim 2.
4. a kind of kit for respiratory pathogen Multiple detection, which is characterized in that the kit includes claim 1
The PCR primer is to group.
5. kit as claimed in claim 5, which is characterized in that the kit further includes probe as claimed in claim 2
Group.
6. kit as claimed in claim 5, which is characterized in that the kit includes the first primer probe mixed liquor, institute
Stating the first primer probe mixed liquor includes:
The first primer to collection, and the first probe as shown in SEQ ID NO.:13, as shown in SEQ ID NO.:16
Two probes and the third probe as shown in SEQ ID NO.:19.
7. kit as claimed in claim 6, which is characterized in that the first primer probe mixed liquor further includes such as SEQ ID
11st probe shown in NO.:31.
8. kit as claimed in claim 5, which is characterized in that the kit further includes negative quality-control product；And/or it is positive
Quality-control product.
9. kit as claimed in claim 5, which is characterized in that the kit further includes selected from the group below one or more
The component of independent packaging:
Tris-HCl, triphosphoric acid dezyribonucleoside, (NH4)2SO4、MgCl2, KCl, C-MMLV reverse transcriptase, RNase inhibitor,
Hot start Taq polymerase.
10. a kind of method for detecting respiratory pathogen, which is characterized in that the method includes the steps:
(1) sample to be detected, the gene containing respiratory pathogen in the sample are provided；
(2) amplification reaction system is prepared, is carried out amplification reaction:
Wherein, the amplification reaction system include step (1) provide sample to be detected, primer pair group described in claim 1,
With probe groups as claimed in claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910535888.1A CN110408725B (en) | 2019-06-20 | 2019-06-20 | Kit for multiple detection of respiratory pathogens |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910535888.1A CN110408725B (en) | 2019-06-20 | 2019-06-20 | Kit for multiple detection of respiratory pathogens |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110408725A true CN110408725A (en) | 2019-11-05 |
| CN110408725B CN110408725B (en) | 2022-07-05 |
Family
ID=68359378
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910535888.1A Active CN110408725B (en) | 2019-06-20 | 2019-06-20 | Kit for multiple detection of respiratory pathogens |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110408725B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111705163A (en) * | 2020-05-28 | 2020-09-25 | 中山大学达安基因股份有限公司 | Novel coronavirus rapid detection kit based on thermal convection PCR |
| CN111944923A (en) * | 2020-07-15 | 2020-11-17 | 四川大学华西医院 | Multiplex fluorescence PCR kit for detecting respiratory pathogens, method and application |
| CN112063756A (en) * | 2020-09-17 | 2020-12-11 | 中山大学达安基因股份有限公司 | Method and kit for multiplex detection of respiratory virus nucleic acid |
| CN113430301A (en) * | 2021-06-09 | 2021-09-24 | 上海伯杰医疗科技有限公司 | Composition and kit for detecting respiratory pathogens and application of composition and kit |
| CN113862400A (en) * | 2021-12-01 | 2021-12-31 | 上海思路迪医学检验所有限公司 | Primer probe combination for detecting new coronavirus and pneumonia pathogenic bacteria and detection kit |
| CN114990261A (en) * | 2022-06-01 | 2022-09-02 | 昆明理工大学 | Multiplex qPCR detection reagent for detecting respiratory infectious disease pathogens |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011133433A2 (en) * | 2010-04-16 | 2011-10-27 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention | Real time pcr assay for detection of bacterial respiratory pathogens |
| CN107058622A (en) * | 2017-03-30 | 2017-08-18 | 德必碁生物科技（厦门）有限公司 | A kind of kit of multiple fluorescence PCR method joint-detection respiratory pathogen |
| EP3279337A1 (en) * | 2016-08-04 | 2018-02-07 | Servizo Galego de Saúde (SERGAS) | Use of short probes between 8 and 9 nucleotides in multiplex assays |
| CN109593886A (en) * | 2018-12-29 | 2019-04-09 | 中山大学达安基因股份有限公司 | A kind of hbv nucleic acid immue quantitative detection reagent box |
| CN109609692A (en) * | 2018-12-25 | 2019-04-12 | 北京卓诚惠生生物科技股份有限公司 | For detecting the nucleic acid reagent, kit, system and method for respiratory tract infection pathogen |
-
2019
- 2019-06-20 CN CN201910535888.1A patent/CN110408725B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011133433A2 (en) * | 2010-04-16 | 2011-10-27 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention | Real time pcr assay for detection of bacterial respiratory pathogens |
| EP3279337A1 (en) * | 2016-08-04 | 2018-02-07 | Servizo Galego de Saúde (SERGAS) | Use of short probes between 8 and 9 nucleotides in multiplex assays |
| CN107058622A (en) * | 2017-03-30 | 2017-08-18 | 德必碁生物科技（厦门）有限公司 | A kind of kit of multiple fluorescence PCR method joint-detection respiratory pathogen |
| CN109609692A (en) * | 2018-12-25 | 2019-04-12 | 北京卓诚惠生生物科技股份有限公司 | For detecting the nucleic acid reagent, kit, system and method for respiratory tract infection pathogen |
| CN109593886A (en) * | 2018-12-29 | 2019-04-09 | 中山大学达安基因股份有限公司 | A kind of hbv nucleic acid immue quantitative detection reagent box |
Non-Patent Citations (2)
| Title |
|---|
| KATE E. TEMPLETON ET AL.: ""Rapid and Sensitive Method Using Multiplex Real-Time PCR for Diagnosis of Infections by Influenza A and Influenza B Viruses,Respiratory Syncytial Virus, and Parainfluenza Viruses 1, 2, 3, and 4"", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| 姚亚萍等: ""呼吸道病原体多重实时荧光定量PCR的检测"", 《中华医院感染学杂志》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111705163A (en) * | 2020-05-28 | 2020-09-25 | 中山大学达安基因股份有限公司 | Novel coronavirus rapid detection kit based on thermal convection PCR |
| CN111944923A (en) * | 2020-07-15 | 2020-11-17 | 四川大学华西医院 | Multiplex fluorescence PCR kit for detecting respiratory pathogens, method and application |
| CN111944923B (en) * | 2020-07-15 | 2023-10-13 | 四川大学华西医院 | Multiplex fluorescence PCR kit, method and application for detecting respiratory pathogens |
| CN112063756A (en) * | 2020-09-17 | 2020-12-11 | 中山大学达安基因股份有限公司 | Method and kit for multiplex detection of respiratory virus nucleic acid |
| WO2022057060A1 (en) * | 2020-09-17 | 2022-03-24 | 广州达安基因股份有限公司 | Method and kit for multiple detection of respiratory virus nucleic acids |
| CN113430301A (en) * | 2021-06-09 | 2021-09-24 | 上海伯杰医疗科技有限公司 | Composition and kit for detecting respiratory pathogens and application of composition and kit |
| CN113430301B (en) * | 2021-06-09 | 2024-01-02 | 上海伯杰医疗科技有限公司 | Composition and kit for detecting respiratory tract pathogens and application of composition and kit |
| CN113862400A (en) * | 2021-12-01 | 2021-12-31 | 上海思路迪医学检验所有限公司 | Primer probe combination for detecting new coronavirus and pneumonia pathogenic bacteria and detection kit |
| CN114990261A (en) * | 2022-06-01 | 2022-09-02 | 昆明理工大学 | Multiplex qPCR detection reagent for detecting respiratory infectious disease pathogens |
| CN114990261B (en) * | 2022-06-01 | 2024-05-07 | 昆明理工大学 | Multiplex qPCR detection reagent for detecting respiratory tract infectious disease pathogens |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110408725B (en) | 2022-07-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110408725A (en) | Kit for respiratory pathogen Multiple detection | |
| CN110273026A (en) | Respiratory tract infection Multiple detection kit and detection method | |
| CN110331232A (en) | A kind of respiratory pathogen multiple nucleic acid detection kit | |
| CN105734168B (en) | A kind of 12 kinds of Respirovirus nucleic acid multiple PCR detection kits | |
| CN107630098B (en) | Fluorescent PCR detection architecture, kit and detection method for joint-detection various respiratory road bacterium | |
| Dumonceaux et al. | Multiplex detection of bacteria associated with normal microbiota and with bacterial vaginosis in vaginal swabs by use of oligonucleotide-coupled fluorescent microspheres | |
| CN105695631B (en) | Human immunodeficiency virus, hepatitis type B virus, Hepatitis C Virus Quick joint inspection kit and its preparation and application | |
| CN110499391A (en) | RPA primer, probe groups and kit for Respirovirus detection | |
| CN101948931A (en) | Single-tube multiplex fluorescence PCR (Polymerase Chain Reaction) detection method and kit for 1,2,3-type parainfluenza viruses | |
| CN101575640A (en) | Primer group for bovine tuberculosis mycobacterium detection, rapid detection method and detection kit | |
| CN111334611B (en) | Kit for detecting novel coronavirus (2019-nCoV) based on double amplification technology and application thereof | |
| CN111521781B (en) | Detection kit for SARS-CoV-2 nucleic acid of new coronary pneumonia virus and detection method thereof | |
| ITVT20110002A1 (en) | METHOD OF DETERMINING THE ORIGIN OF FLUIDS OR BIOLOGICAL TRACKS AND REAGENT KITS FOR THEIR IDENTIFICATION IN A SAMPLE. | |
| CN112779357B (en) | Human coronavirus nucleic acid multiple detection kit | |
| CN108277291A (en) | Kit and its application method for detecting multiple pathogens | |
| CN102367488A (en) | Enterovirus triple real-time fluorescent quantitative RT-PCR detection kit | |
| CN108531556A (en) | The kit and its application method of multiple pathogens are detected based on micro-fluidic chip | |
| CN103276099A (en) | Primer and kit for fluorescent quatititive PCR (polymerase chain reaction) detection of helicobacter pylori | |
| CN113481325A (en) | Method and kit for detecting novel coronavirus B.1.1.7 mutant strain | |
| CN110938708B (en) | Kit for detecting H7N9 avian influenza virus based on isothermal amplification technology and application thereof | |
| WO2023207909A1 (en) | Crispr-based nucleic acid detection kit and use thereof | |
| CN102337352B (en) | Kit for detecting multiple influenza viruses by polymerase chain reaction (PCR) microarray | |
| CN106916903A (en) | The real-time fluorescence RT PCR detection methods and kit of mycobacterium tuberculosis 85B mRNA | |
| CN114836580B (en) | Multiplex qPCR detection primer combination for respiratory tract infectious disease pathogens | |
| CN115838834A (en) | Human rhinovirus type A and type C detection system based on RT-RAA and CRISPR/Cas12a |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 510665 No. 19 incense Hill Road, hi tech Industrial Development Zone, Guangdong, Guangzhou Applicant after: Guangzhou Da'an gene Co.,Ltd. Address before: 510665 No. 19 incense Hill Road, hi tech Industrial Development Zone, Guangdong, Guangzhou Applicant before: DAAN GENE CO., LTD. OF SUN YAT-SEN University |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information |
Inventor after: Huang Taosheng Inventor after: Jiang Xiwen Inventor after: Li Xinyu Inventor after: Zheng Ruonan Inventor before: Jiang Xiwen Inventor before: Huang Taosheng Inventor before: Li Xinyu Inventor before: Zheng Ruonan |
|
| CB03 | Change of inventor or designer information |