NL2030101B1 - Optogenetic bone morphogenetic protein receptor (optobmpr) system and construction method and use thereof - Google Patents

Optogenetic bone morphogenetic protein receptor (optobmpr) system and construction method and use thereof Download PDF

Info

Publication number
NL2030101B1
NL2030101B1 NL2030101A NL2030101A NL2030101B1 NL 2030101 B1 NL2030101 B1 NL 2030101B1 NL 2030101 A NL2030101 A NL 2030101A NL 2030101 A NL2030101 A NL 2030101A NL 2030101 B1 NL2030101 B1 NL 2030101B1
Authority
NL
Netherlands
Prior art keywords
leu
glu
ala
lys
gly
Prior art date
Application number
NL2030101A
Other languages
Dutch (nl)
Inventor
Hu Wenzhi
Fu Xiaobing
Zhang Cuiping
Ma Kui
Original Assignee
Chinese Pla General Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chinese Pla General Hospital filed Critical Chinese Pla General Hospital
Priority to NL2030101A priority Critical patent/NL2030101B1/en
Application granted granted Critical
Publication of NL2030101B1 publication Critical patent/NL2030101B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11—Protein-serine/threonine kinases (2.7.11)
    • C12Y207/1103—Receptor protein serine/threonine kinase (2.7.11.30)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Botany (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present disclosure provides an optogenetic bone morphogenetic protein receptor (OptoBMPR) system and a preparation method and use thereof, belonging to the technical field of cell biology. The OptoBMPR system includes a first recombinant plasmid expressing a bone morphogenetic protein receptor type I (OptoBRl) and a second recombinant plasmid expressing a bone morphogenetic protein receptor type II (OptoBR2). In the present disclosure, the OptoBRl and the OptoBR2 are located in cell membrane and cytoplasm, respectively. Under the action of 460-nm blue light, the OptoBR2 of the cytoplasm specifically binds to the OptoBRl of the cell membrane, and phosphorylates an active site of the OptoBRl to activate downstream Smadl/5/8 signaling pathways, thereby precisely regulating BMP/ Smadl/ 5/ 8 signaling pathways.

Description

OPTOGENETIC BONE MORPHOGENETIC PROTEIN RECEPTOR
(OPTOBMPR) SYSTEM AND CONSTRUCTION METHOD AND USE
THEREOF
TECHNICAL FIELD
[01] The present disclosure relates to the technical field of cell biology, in particular to an optogenetic bone morphogenetic protein receptor (OptoBMPR) system and a preparation method and use thereof.
BACKGROUND ART
[02] BMP/Smadl/5/8 signaling pathways are important in various biological processes, and have specificity in time and space distribution to directly affect differentiation of stem cells and occurrence of tissues and organs. The BMP/Smad1/5/8 signaling pathways have great significance in researches of tissue engineering. However, due to the stability and diffusibility of bone morphogenetic proteins (BMPs), it is difficult for traditional research methods to accurately regulate the BMP/Smad1/5/8 signaling pathways in time and space dimensions.
SUMMARY
[03] In the present disclosure, an OptoBMPR system that can precisely regulate intracellular BMP/Smad1/5/8 signal pathways using 460-nm blue light is provided.
[04] In the present disclosure, a bone morphogenetic protein receptor type I (OptoBR1) and a bone morphogenetic protein receptor type II (OptoBR2) are located in cell membrane and cytoplasm, respectively. Under the action of 460-nm blue light, the
OptoBR2 of the cytoplasm specifically binds to the OptoBR1 of the cell membrane, and phosphorylates an active site of the OptoBR1 to activate downstream Smad1/5/8 signaling pathways, thereby precisely regulating BMP/Smad1/5/8 signaling pathways.
BRIEF DESCRIPTION OF THE DRAWINGS
[05] FIG. 1 is a mechanism of action of OptoBMPR types 1 and II of the present disclosure.
[06] FIG. 2-A shows that under dark conditions, OptoBR 1 labeled with a green fluorescent protein is anchored on cell membrane, and OptoBR2 labeled with a red fluorescent protein is distributed in cytoplasm; after 30 seconds of blue light stimulation, the OptoBR2 aggregates on the cell membrane and binds to the OptoBR1 anchored to the cell membrane; 15 minutes after being protected from light, the OptoBR2 redisperses into the cytoplasm.
[07] FIG. 2-B is an analysis result of fluorescence signal intensity near the cell membrane. It can be seen that a red fluorescence signal near the cell membrane is significantly enhanced under blue light stimulation.
[08] FIG. 3 is degree of phosphorylation of Smad1/5/8 signaling pathways under different stimulation conditions; where, FIG. 3-A indicates that under stimulation of different concentrations of bmp2, a phosphorylation intensity of the Smad 1/5/8 increases with an increase of bmp2 concentration; FIG. 3-B indicates that under different multiplicity of infection (MOI) infection conditions, a photoactivation intensity of the
Smad1/5/8 increases with an increase of MOI, and FIG. 3-C indicates that under different intensities of blue light stimulation, a phosphorylation intensity of the
Smadl/5/8 increases with an increase of radiation energy.
[09] FIG. 4 is an influence of blue light radiation (100 pW-cm™2) on cell viability.
DETAILED DESCRIPTION OF THE EMBODIMENTS
[10] Example 1 Construction of an OptoBR1/2 adenovirus vector, packaging of an adenovirus and cell infection
[11] 1. OptoBRI adenovirus vector construction: myristoylation sites (1-15) of human tyrosine receptor protein kinase Fyn, intracellular parts (177-532) of a bone morphogenetic protein receptor type la (Bmprla) of a mouse and a IN end (2-170,
CIBN) of an Arabidopsis cryptochrome binding protein were sequentially fused from an
N-terminal to a C-terminal, as shown in Table 1. Fusion fragments were chemically synthesized, and synthetic gene fragments were recombined into an Ad5/F35 adenovirus vector backbone pAV[Exp]/CMV>shuttle empty vector (Position: 1438-3063, Cyagen,
USA) using Gateway technology to construct a recombinant adenovirus vector pAd-Ex -OptoBR1.
[12] Table 1 OptoBRI protein and nucleic acid sequence
[13]
Fragment name (Uniprot ID, | Protein sequence Nucleic acid sequence positioning) rg EM nnee
MGCVOCKDKEATKLT atgggctgigtgcaatgiaaggataaagaagcaacaaaactgacg (P06241, 1-15)
KHYCKSISSRGRYNRDLEQDEA | aagcattattgtaagagtatctcaagcaggggicgttacaaccgtgatttggaacaggatgaage
FIPVGESLKDLIDQSQSSGSGSG | atttaticcagtaggagaatcattgaaagacctgattgaccagicccaaageictgggagtggate
LPLLVOQRTIAKQIQOMVRQVGK tggattgcctttattggticagcgaactattgccaaacagattcagalggticggcagsttggtaaa
GRYGEVWMGKWRGEKVAVK | ggccgctatggagaagtalggalgggtaaatggcgtgptgaaaaagtggctgtcaaagtglttiit
VFETTEEASWFRETEIYQTVLM | accactgaagaagciagctggittagagaaacagaaatclaccagacggtgtlaatgcgtcatga
RHENILGFIAADIKGTGSWTQL | aaatatacitggttitatagetgcagacattaaaggcactggticctggactcagctgtatttgattac
YLITDYHENGSLYDFLKCATLD | tgattaccatgaaaatggatctctctatgaclicctgaaatgtgccacactagacaccagagccct
Intracellular parts of | TRALLKLAYSAACGLCHLHTEI | actcaagttagcttattctgctgcitgiggictgigccacctccacacagaaattlatggtacccaag
Bmprla (P36895. | YGTQGKPAIAHRDLKSKNILIK | ggaagcctgcaattgcicatcgagacctgaagagcaaaaacatccttaftaagaaaaatggaagt 177-532) KNGSCCIADLGLAVKENSDTNE | tgctglattgctgacctgggcctagctgitaaattcaacagtgatacaaatgaagtigacalaccctt
VDIPLNTRVGTKRYMAPEVLD | gaataccagggtgggcaccaagcggtacatggctccagaagtgctggatgaaagcctgaataa
ESLNKNHFQPYIMADIYSFGLII | aaaccatttccagccctacatcatggctgacatclatagcittteggttgatcatitgggaaatggctc
WEMARRCITGGIVEEYQLPYY gtegtigtattacaggaggaatcgiggag gaatatcaattaccatattacaacatggtgeccagtg
NMVPSDPSYEDMREVVCVKRL | acccatcciatgaggacatgcgtgaggtigtetgtgtgaaacgcttgeggccaalcgtgtctaac
RPIVSNRWNSDECLRAVLKLM | cgctggaacagegatgaatgtcticgageagtittgaagetaatgicagaatgtiggacccataat
SECWAHNPASRLTALRIKKTLA | ccagcciccagactcacagetitgagaatcaagaagacactipcaaaaatggtigaalcecagg
KMVESQDVKI atgtaaagatl
NGAIGGDLLLNFPDMSVLERQ aatggagctalaggaggtgaccttitgcicaatittccigacatgtcggicciagagcgccaaagg
RAHLKYLNPTFDSPLAGFFADS | gcicacctcaagtacctcaatcccacctttgattctcctcicgccggcticttigccgattcttcaatg
SMITGGEMDSYLSTAGLNLPM | attaccggeggegagatggacagetatctticgactgecggttigaateticegatgatgtacggt
CIB1 N-terminal | MYGETTVEGDSRLSISPETTLG | gagacgacpgtggaaggtgattcaagactctcaatticgccggaaacgacgctigggactpga {Q8GY61, 2-170)2 TGNFKAAKFDTETKDCNEAAK | aatticaaggcagcgaaglitgatacagagactaaggaltglaatgaggcggcgaagaagaiga
KMTMNRDDLVEEGEEEKSKIT | cgatgaacagagatgacctagtagaagaaggagaagaagagaagtcgaaaataacagagca
EQNNGSTKSIKKMKHKAKKEE | aaacaatgggagcacaaaaagcatcaagaagalgaaacacaaagccaagaaagaagagaac
NNFSNDSSKVTKELEKTDYI aatttctctaalgaticatctaaagtgacgaapgaaliggagaaaacggatiatati
MGCVQCKDKEATKLTKHYCK | atgggctgigtgcaatgiaaggataaagaagcaacaaaactgacgaagcattat{gtaagagtat
SISSRGRYNRDLEQDEAFIPVGE | ctcaagcaggggicgtiacaaccgigatitggaacaggatgaagcatitaticcaglaggagaat
SLKDLIDQSQSSGSGSGLPLLV catigaaagacctgattgaccagicccaaagelctgggagiggatctggatigectitatiggitca
QRTIAKQIOMVROQVGKGRYGE | gcgaactatfgccaaacagaticagalggitcggcaggttggtaaaggccgctatpgagaagtat
VWMGKWRGEK VAVKVFEFTTE | ggatggptaaatggegtggtgaaanagtggctgtcaaagtgtttittaccactgaagaagetaget
EASWFRETEIYQTVLMRHENIL | ggtttagagaaacagaaaictaccagacggigtiaatgcgtcatgaaaatatactiggttttatage
OptoBR1 GFIAADIKGTGSWTOLYLITDY | tgcagacatiaaaggcactggttcctggactcagetgtatitgatiactgattaccatgaaaatgga
HENGSLYDFLKCATLDTRALL tctctctatgacttcctgaaalgtgccacactagacaccagagccctactcaagttagcttattctge
KLAYSAACGLCHLHTEIYGTQ tgctigtggtcigtgccacctccacacagaaalttatggtacccaagggaagcctgcaattgctca
GKPATAHRDLKSKNILIKKNGS tcgagacctgaagagcaaaaacatccltat{aagaaaaalggaagtigctelattgctgaccteg
CCIADLGLAVKFENSDTNEVDIP | gcctagctgltaaattcaacagtgatacaaatgaagtlgacatacccttgaataccagggigggca
LNTRVGTKRYMAPEVLDESLN | ccaagcggtacatggctccagaagtgetggatgaaagcctgaataaaaaccatitccagcccta
KNHFOPYIMADIYSFGLIJWEM | catcaiggctgacaictatagctitgptttgatcalttgggaaatggctcgicgtigtaitacaggag
ARRCITGGIVEEYQLPYYNMVP | gaalcgtggaggaatatcaattaccatatiacaacalgglgeccagigaceeatectatgaggac
SDPSYEDMREVVCVKRLRPIVS | atgcgtgaggttgigtgigtgaaacgcttgcggccaatcgtgtctaaccgctggaacagcgaiga
NRWNSDECLRAVLKLMSECW | atgicttcgagcagttitgaagctaatgtcagaatgitgggcccataatccagcctccagactcac
AHNPASRLTALRIKKTLAKMV | agcttigagaatcaagaagacacitgcaaaaatggttgaatcccaggalgtaaagattaatggag
ESQDVKINGAIGGDLLLNFPDM | ctataggaggtgaccittigctcaattitcctgacatgtcggtcctagagcgccaaagggcicacct
SVLERQRAHLKYLNPTFDSPLA | caagtacctcaatcccaccttigatictcctctegccggciticttigcceattcttcaalgatlaccgg
GFFADSSMITGGEMDSYLSTAG | cggcgagatggacagctatctttcgactgceggtitgaatcticcgatgatgtacggtgagacga
LNLPMMYGETTVEGDSRLSISP | cggtggaaggtgattcaagactctcaatttcgccggaaacgacgctigggactggaaatiicaag
ETTLGTGNFKAAKFDTETKDC gcagcgaagttigatacagagactaaggattptaalgaggcggcpaagaagatgacgatpaac
NEAAKKMTMNRDDLVEEGEE agagatgacctagiagaagaaggagaagaagagaagtcgaaaataacagagcaaaacaatg
EKSKITEQNNGSTKSIKKMKHK | ggagcacaaaaagcatcaagaagatgaaacacaaagccaagaaagaagagaacaattictcta
AKKEENNFSNDSSKVTKELEKT | atgattcatctaaagtgacgaaggaattggagaaaacggattalaitiaa
DYI
[14] Note: underlined parts are mutant amino acids to reduce the nuclear localization of the OptoBR 1.
[15] 2. OptoBR2 adenovirus vector construction: intracellular parts (162-513) of an activin receptor 2a (Acvrla) of a mouse and an N-terminal (2-498, PHR) of an
Arabidopsis cryptochrome were sequentially fused from an N-terminal to a C-terminal, as shown in Table 2. Fusion fragments were chemically synthesized, and synthetic gene fragments were recombined into an Ad5/F35 adenovirus vector backbone
PAV[Expl/CMV>shuttle empty vector (Position: 1438-3990, Cyagen, USA) using
Gateway technology to construct a recombinant adenovirus vector pAd-Ex -OptoBR2.
[16] Table 2 OptoBR2 protein and nucleic acid sequence
[17]
Fragment name (Uniprot ID. | Protein sequence Nucleic acid sequence positioning)
MRHHKMAYPPVLVPTQDPGPPP | atgagacatcacaagatg gectacccicetgtacttgticctactcaagacccaggaccaccccca
PSPLLGLKPLOLLEVKARGRFGC | ccttccccaltactagggitgaagccattgcagctgitagaagtgaaagcaaggggaagalttggtt
VWKAQLLNEYVAVKIFPIQDKQ | gtgtctggaaagcccagttgctcaatgaatatgtggcigtcaaaatatitccaatacaggacaaaca
SWONEYEVYSLPGMKHENILOFI | gicctggcagaatgaatatgaagtctatagictacciggaatgaagcatgagaacatactacagttc
Aen GAEKRGTSVDVDLWLITAFHEK | attggtgcagagaaaagaggcaccagtgtggatgtggacctgiggctaatcacagcatticatgaa cvrla / hd GSLSDFLKANVVSWNELCHIAET | aagggctcactgicagactttcttaaggctaatgtggtcicttggaatgaactitgtcatattgcagaa intracellular (P27038 MARGLAYLHEDIPGLKDGHKPA | accatggctagagpattggcatatttacatgaggatatacctggctiaaaagatggccacaagcctg paris 38. 162-513) ISHRDIKSKNVLLKNNLTACIADF | caatctctcacagggacatcaaaagtaaaaalgtgctgltgaaaaacaatctgacagcttgcattgct 2-513
GLALKFEAGKSAGDTHGOVGTR | gactttgggtiggccttaaagttcgaggctggcaagtctgcaggtgacacccatgggcaggitget
RYMAPEVLEGAINFORDAFLRID | acccggaggiatatggctccagaggtettggagegtectataaacttccaaagggacgcatttctg
MYAMGLVLWELASRCTAADGP | aggatagatatgtacgccatgggattagtcctatgggaatiggctictcgttgcactgctgcagatgg
VDEYMLPFEEEIGOHPSLEDMOE | acccgtagatgagtacalgttaccattigaggaagaaattggccagcatccatctcttgaagatatgc
VVVHKKKRPVLRDYWQKHAG aggaagttgltgigcataaaasaaagaggcecigtittaagagalitatiggeagaaacatgcaggaat
MAMLCETIEECWDHDAEARLSA | ggcaatgctcigtgaaacgalagaagaatgligggatcatgalgcagaagccaggttatcagctgg
GCVGERITQMORLTNITTEDIVT | atgtgtaggigaaagaattactcagatgcaaagactaacaaatatcattactacagaggacattgta
VVTMVTINVDEPPKESSL acagtggtcacaatggigacaaatgttgactitcctcccaaagaaictagtcta
KMDKKTIVWFRRDLRIEDNPAL | aagatggacaaaaagactatagtitggtitagaagagacctaaggatigaggataatcctgeatiag
AAAAHEGSVFPVFIWCPEEEGQF | cagcagctgcicacgaaggatctgtitticctgtcttcatttgg{gtcctgaagaagaaggacagttí
YPGRASRWWMKOSLAHLSQSL alcctggaagagcttcaagatggtggatgaaacaatcacttgctcacttatctcaatccitgaaggct
KALGSDLTLIKTHNTISAILDCIR citggatctgacctcacittaatcaaaacccacaacacgalttcagcgaicttggatigtaiccgcptt
VTGATKVVENHLYDPVSLVRDH | accggtgctacaaaagtcgtctitaaccacctctalgatcctgtitcgitagttcgggaccataccgta
TVKEKLVERGISVOSYNGDLLYE | aaggagaagctggtegaacgigggatctetgtgcaaagctacaalggagatciattgtatgaaccg
PWEIYCEKGKPFTSFNSYWKKCL | tgggagatatactgcgaaaagggcaaaccttitacgagtticaatlettactggaagaaatgcttaga
DMSIESVMLPPPWRLMPITAAAE | tatgtcgattgaatccgttatgcticctcciccttggcegttgatgccaataactgcagcggcigaag
AIWACSIEELGLENEAEKPSNAL cgatttgggeptalicgaligaagaactagggctggagaatgaggccgagaaaccgageaatgc
Cry ptochrome2 LTRAWSPGWSNADKLLNEFIEK gtigtlaactagagetiggictecaggatpgagcaatgelgataagtiactaaatgagitcatcgaga ‚ | QLIDYAKNSKKVVGNSTSLLSPY | agcagttgatagattatpcaaagaacageaagaaagligligggaatictacticactactttctecgt os LHFGEISVRHVFQCARMKOQIWA | atctccatticggggaaataagegicagacacgtittccagtgtgeccggatgaaacaaatiatatg
RDKNSEGEESADLFLRGIGLREY | ggcaagagataagaacagtgaaggagaagaaagtgcagatcttittctiaggggaalcggittaag 9%) SRYICFNFPFTHEQSLLSHLRFFP | agagtattcicggtatatatgittcaacttccegttiactcacgagcaategtigtigagicateticggt
WDADVDKFKAWROGRTGYPLV | tittcocttgggatgctgatgitgataagttcaaggcctggagacaaggcaggaccggttatccpttg
DAGMRELWATGWMHNRIRVIV | gtggatgccggaatgagagagcittgggclaccggatgpatgcataacagaataagagtgattett
SSFAVKFLLLPWKWGMKYFWD | tcaagctitgetgtgaagtttcttctccttccatggaaatggggaalgaagtatttctgggatacacttit
TLLDADLECDILGWOYISGSIPD ggatgctgatttegaatgtgacatcctiggciggcagtuatctcigggaglatccccgatggccac
GHELDRLDNPALQGAKYDPEGE | gagcttgatcgcttggacaatcccgcgttacaaggcgccaaatatgacccagaaggtgagtacat
YIRQWLPELARLPTEWIHHPWD aaggcaatggeticccgagctigcgagaitgccaactgaatggatccaicatccaigggac geicc
APLTVLKASGVELGTNYAKPIVD | tttaaccgtactcaaagcttctggigtggaacicggaacaaactatgcgaaacccattgtagacatc
IDTARELLAKAISRTREAQIMIGA | gacacagctcgtgagctactagctaaagctalttcaagaacccgtgaagcacagatcatgatcgga
A gcagca
MRHHKMAYPPVLVPTODPGPPP | atgagacatcacaagatg gectacccicetgtacttgticctactcaagacccaggaccaccccca
PSPLLGLKPLOLLEVKARGRFGC | ccttccccaltactagggitgaagccattgcagctgitagaagtgaaagcaaggggaagalttggtt
VWKAQLLNEYVAVKIFPIQDKQ | gtgtctggaaagcccagttgctcaatgaatatgtggcigtcaaaatatitccaatacaggacaaaca
SWONEYEVYSLPGMKHENILOFI | gicctggcagaatgaatatgaagtctatagictacciggaatgaagcatgagaacatactacagttc
GAEKRGTSVDVDLWLITAFHEK | attggtgcagagaaaagaggcaccagtgtggatgtggacctgiggctaatcacagcatticatgaa
GSLSDFLKANVVSWNELCHIAET | aagggcicactgicagactttcttaaggctaatgtggtcicttggaatgaactitgtcatattgcagaa
MARGLAYLHEDIPGLKDGHKPA | accatggctagagpattggcatatttacatgaggatatacctggctiaaaagatggccacaagcctg
ISHRDIKSKNVLLKNNLTACIADF | caatctctcacagggacatcaaaagtaaaaalgtgctgltgaaaaacaatctgacagcttgcattgct
OptoBR2 GLALKFEAGKSAGDTHGOVGTR | gactttgggtiggccttaaagttcgaggctggcaagtctgcaggtgacacccatgggcaggitget
RYMAPEVLEGAINFORDAFLRID | acccggaggiatatggctccagaggtettggagegtectataaacttccaaagggacgcatttctg
MYAMGLVLWELASRCTAADGP | aggatagatatgtacgccatgggattagtcctatgggaatiggctictcgttgcactgctgcagatgg
VDEYMLPFEEEIGOHPSLEDMOE | acccgtagatgagtacalgttaccattigaggaagaaattggccagcatccatctcttgaagatatgc
VVVHKKKRPVLRDYWOKHAG apgaagttgitgigcataaaaaaaagaggccigiittaagagaltatiggcagaaacalgcaggaat
MAMLCETIEECWDHDAEARLSA | ggcaatgctcigtgaaacgatagaagaatgitgegatcatgalgcagaagccaggttatcagctgg
GCVGERITQOMORLTNITTEDIVT | atgtegtaggtgaaagaatiactcagatgcaaagactaacaaatatcattactacagaggacattgla
VVTMVTINVDEPPKESSLKMDKK | acagtggtcacaatggtgacaaatgittgactttcctcccaaagaatctagtctaaagatggacaaaa
TIVWFRRDLRIEDNPAL AAAAHE | agactatagttiggittagaagagacctaag gatfgaggataatcctgcattagcagcagctgcica
GSVEPVEIWCPEEEGOFYPGRAS | cgaaggatctgttiitccigtcticatitggigicetgaagaagaaggacagtittatcctggaagage
RWWMKQSLAHLSQSLKALGSD | ticaagatggtggaigaaacaatcacttgctcacttatctcaatccttgaaggctcttggatctgacct
LTLIKTHNTISAILDCIRVTGATK | cactitaatcaaaacccacaacac gatttcagcgatcttggatigtaiccgcettaccggtgctacaa
VVFNHLYDPVSLVRDHTVKEKL | aagtcgtcittaaccacctctatgatcctgittcgttagttcgggaccataccgtaaaggagaagctg
VERGISVQSYNGDLLYEPWEIYC | gtggaacgtgegatcictgtgcaaagctacaatggagatclattgtatgaaccglgggagatatact
EKGKPFTSENSYWKKCLDMSIES | gcgaaaagggcaaacciittacgagiitcaattctiactggaagaaatgcttagatatgtcgatigaat
VMLPPPWRLMPITAAAEAIWAC | ccgtiatgcttcctcctcctiggcggtigatgccaalaactgcagcgectgaagcgaitteggcgtgt
SIEELGLENEAEKPSNALLTRAW | tcgaitgaagaactagggctggagaatgaggecgagaaaccgageaatgegtigtiaactagage
SPGWSNADKLLNEFIEKQLIDYA | ttggtctccaggatggagcaatgctgalaagttactaaalgagitcatcgagaagcagltgaiagatt
KNSKKVVGNSTSLLSPYLHFGEI | aigcaaagaacagcaagaaagitgitgggaatictacitcactacttictccgiatctccatticggeg
SVRHVFOCARMKOIWARDKNS | aaataagcptcagacacgtittccagtgigcccggatgaaacaaaltatatgggcaagagataaga
EGEESADLFLRGIGLREYSRYICF | acagtgaaggagaagaaagtgcagatctitlictiaggggaatcggittaagagagtatictcggtat
NFPFTHEQSLLSHLRFFPWDADYV | atatgtttcaacttcccgtttactcacgagcaatcgtigtlgagtcatcticggtttitcccitgggatgct
DKFKAWRQGRTGYPLVDAGMR | gatgttgataagttcaaggcctggagacaaggcaggaccggttatccgitggtggatgccggaat
ELWATGWMHNRIRVIVSSFAVK | gagagagcitigggciaccgpgatggatgcataacagaataagagtgattgtttcaagctitgctgtg
FLLLPWKWGMKYFWDTLLDAD | aagtttcttetccttccatggaaatggggaatgaaglattictgggatacactiitggatgctgatitgg
LECDILGWOYISGSIPDGHELDRL | aatgtgacatccttggclggcagtatatctctgggagtatccccgatggccacgagcttgatcgcit
DNPALQGAKYDPEGEYIRQWLP | ggacaatcccgcgtlacaaggcgccaaalatgacccagaaggtgagtacataaggcaatggctic
ELARLPTEWIBHPWDAPLTVLK ccgagcttgcgagattgccaactgaatggatccatcatccalgggacgclcettlaaccglactcaa
ASGVELGTNYAKPIVDIDTAREL | agctictggtgtggaactc ggaacaaactatgcgaaacccattgtagacatcgacacagctcgiga
LAKAISRTREAQIMIGAA gctactagctaaagctalttcaagaacccgigaagcacagalcatgaicggagcagcataa
[18] 3. Linearization of a recombinant adenovirus vector
[19] (1) The pAd-OptoBR1 adenovirus vector and the pAd-OptoBR2 adenovirus vector were cut with Pad restriction enzymes at 37°C for 15 min, and inactivated at 65°C for 20 min, respectively.
[20] (2)450 uL of a linearized recombinant adenovirus vector was added to 50 uL of a 3M sodium acetate solution, mixed well, 1 mL of pre-cooled absolute ethanol was added, stood at -20°C for 30 min and centrifuged at 12,000 g for 10 min. Supernatant was discarded, remaining solution was washed with 750 uL of 75% absolute ethanol (without DNAase/RNAase) and centrifuged at 12,000 g for 10 min. Washing was repeated for 1 time. 50 uL of ddH:O (without DNAase/RNAase) was added to dissolve precipitated linearized plasmids, and DNA concentration was determined.
[21] 4. Recombinant adenovirus packaging
[22] (1) A cell line of human embryonic kidney cells 293A (HEK293A) was inoculated into a 6-well plate at a concentration of 1x10° cells/well, under aseptic conditions, the cell line was cultured in a 37°C and 5% CO: incubator using 2 mL/well of a high-glycemic Dulbecco's modified eagle medium (DMEM) containing 5% fetal bovine serum as a medium (DMEMS); and 24 h after inoculation, linearized recombinant adenovirus plasmids were transfected.
[23] (2) Configuration of a liposome premix: 7.5 uL of a lipofectamine3000 was added to 125 uL of an Opti-MEM medium, pipetted and mixed well.
[24] (3) Configuration of a DNA premix: 2.5 pg of a linearized recombinant adenovirus vector was added to 125 pL of an Opti-MEM medium, 5 uL of a P3000 TM was added, pipetted and mixed well.
[25] (4) Configuration of a DNA-liposome mixture: products in (2) and (3) were mixed well, and stood at room temperature for 15 min.
[26] (5) 250 pL of the DNA-liposome mixture was added dropwise into the 6-well
IO plate, shook slightly to mix well, and incubated in the 37°C and 5% CO: incubator. 48 h after transfection, the DMEMS medium was replaced and culture was continued for 7- 10d.
[27] (6) After 7-10 d, transfected HEK293A cells were collected, and repeated freezing and thawing was conducted to lyse the cells, recombinant adenovirus was collected and amplified.
[28] 5. Cultivation of epidermal stem cells (EpiSCs): human epidermal stem cells were cultured under aseptic conditions, using a DMEM containing 10% fetal bovine serum, penicillin (100 U/ml) and streptomycin (100 pg/ml) as a medium (DMEM10), in a 37°C and 5% CO 2 incubator; the medium was changed after 24 h, non-adherent cells were discarded, and the medium was changed every 2 d thereafter. When reaching 80% fusion, the cells were digested with 0.25% trypsin and subcultured.
[29] 6. Adenovirus infection of the EpiSCs: EpiSCs were inoculated on a 6-well plate at a density of 0.7x10% cells/well; 12 h after inoculation, OptoBR1 adenoviruses and
OptoBR2 adenoviruses were added (both with an MOI of 50). 6 h after infection of the
EpiSCs, a fresh medium DMEM10 was changed. Infection effects were observed 48 h after the infection.
[30] Example 2 Functional and safety verification of an OptoBMPR system
[31] EpiSCs were infected with OptoBR1 adenovirus/OptoBR2 adenovirus for 48 h, and transfected cells were irradiated with 460-nm blue light (100 pW-cm™). After 30 s of radiation, it can be seen that OptoBR2 (red) in cytoplasm significantly aggregates to
OptoBR1 (green) of cell membrane, and gradually dissociates (leaves the cell membrane and diffuses into the cytoplasm) after 15 min of removing the blue light radiation (The results are shown in FIG. 2- A and FIG. 2-B, with a scale bar of 25 um. FIG. 2-A shows that under dark conditions, OptoBR1 labeled with a green fluorescent protein is anchored on cell membrane, and OptoBR2 labeled with a red fluorescent protein is distributed in cytoplasm; after 30 seconds of blue light stimulation, the OptoBR2 aggregates on the cell membrane and binds to the OptoBR1 anchored to the cell membrane; 15 minutes after being protected from light, the OptoBR2 redisperses into the cytoplasm. FIG. 2-B is an analysis result of fluorescence signal intensity near the cell membrane. It can be seen that a red fluorescence signal near the cell membrane is significantly enhanced under blue light stimulation).
[32] After irradiating transgenic cells with blue light of 0-100 uW:cm? for 1 h, the protein was collected and activation of the phosphorylated Smad1/5/8 signal pathways was detected. The results show that the phosphorylated Smad1/5/8 signal pathways are not activated without blue light radiation, and are significantly enhanced after blue light radiation, and a degree of phosphorylation increases with an increase in radiation intensity (The results are shown in FIG. 3. FIG. 3-A indicates that under stimulation of different concentrations of bmp2, a phosphorylation intensity of the Smad 1/5/8 increases with an increase of bmp2 concentration. FIG. 3-B indicates that under different multiplicity of infection (MOI) infection conditions, a photoactivation intensity of the
Smad1/5/8 increases with an increase of MOI. FIG. 3-C indicates that under different intensities of blue light stimulation, a phosphorylation intensity of the Smadl/5/8 increases with an increase of radiation energy). It can be seen from FIG. 3-A that the phosphorylation intensity of the Smad1/5/8 gradually increases with the increase of
Bmp2 concentration. It can be seen from FIG. 3-B that under different adenovirus MOLs, 460-nm blue light (100 uW:cm'?) phosphorylates intracellular Smad1/5/8 to different degrees. It can be seen from FIG. 3-C that under different intensity (0-100 pW-cm™) of blue light stimulation, the phosphorylation intensity of the Smad1/5/8 increases with light intensity. The above results confirm that the OptoBMPR system can real-time and quantitatively regulate the BMP/Smad1/5/8 signaling pathways in transgenic cells using blue light signals through genetic engineering methods.
[33] The OptoBR1 adenovirus/OptoBR2 adenovirus infected cells, and after 460-nm blue light irradiation, proteins were extracted with a radioimmunoprecipitation assay (RIPA) lysis buffer, and pSmad 1/5/8 phosphorylation level was detected by a Western
Blot method (referring to "Zhang X, Liu D, He Y, Lou K ‚Zheng D, Han W. Branched
Chain Amino Acids Protects Rat Mesangial Cells from High Glucose by Modulating
TGF-betal and BMP-7 [J]. Diabetes, metabolic syndrome and obesity: targets and therapy, 2019,12 (2433-2440."), to verify optical control performance of the OptoBMPR system. The safety of blue light irradiation was tested by detecting the effect of blue light on cell viability; EpiSC adenovirus and OptoBR 1/2 adenoviruses infected the
EpiSCs, after 24 h of continuous irradiation by 460-nm blue light (100 pW-cm™), cells away from light were used as a negative control, and cell viability was defected using a cck-8 method (referring to "Cai CC, Zhu JH, Ye LX, Dai YY, Fang MC, Hu YY, Pan
SL, Chen S, Li P J. Glycine Protects against Hypoxic-Ischemic Brain Injury by
Regulating Mitochondria-Mediated Autophagy via the AMPK Pathway[J]. Oxid
IO MedCell Longev, 2019, 4248529."). The results show that continuous blue light (100 uW-cm™) irradiation for 24 h does not affect the cell viability. In transgenic epidermal stem cells of the OptoBMPR system, 100 uW-cm™ 460-nm blue light radiation for 24 h can further enhance cell proliferation to a certain extent (EpiSCs: the epidermal stem cells; OptoBMPR EpiSCs: the transgenic epidermal stem cells of the OptoBMPR system) (FIG. 4).
Sequence Listing <110> Fourth Medical Center of Chinese PLA General Hospital <120> OPTOGENETIC BONE MORPHOGENETIC PROTEIN RECEPTOR (OPTOBMPR) SYSTEM AND CONSTRUCTION METHOD AND USE THEREOF <160> 4
IO <170> SIPOSequenceListing 1.0 <210> 1 <211> 540 <212> PRT <213> Artificial sequence <400> 1
Met Gly Cys Val Gln Cys Lys Asp Lys Glu Ala Thr Lys Leu Thr Lys 1 5 10 15
His Tyr Cys Lys Ser lle Ser Ser Arg Gly Arg Tyr Asn Arg Asp Leu 20 25 30
Glu Gln Asp Glu Ala Phe Ile Pro Val Gly Glu Ser Leu Lys Asp Leu 35 40 45
Ile Asp Gln Ser Gln Ser Ser Gly Ser Gly Ser Gly Leu Pro Leu Leu 50 55 60
Val Gln Arg Thr Ile Ala Lys Gln Ile GIn Met Val Arg Gln Val Gly 65 70 75 80
Lys Gly Arg Tyr Gly Glu Val Trp Met Gly Lys Trp Arg Gly Glu Lys 85 90 95
Val Ala Val Lys Val Phe Phe Thr Thr Glu Glu Ala Ser Trp Phe Arg 100 105 110
Glu Thr Glu lle Tyr Gln Thr Val Leu Met Arg His Glu Asn Ile Leu 115 120 125
Gly Phe Ile Ala Ala Asp Ile Lys Gly Thr Gly Ser Trp Thr Gln Leu 130 135 140
Tyr Leu Ile Thr Asp Tyr His Glu Asn Gly Ser Leu Tyr Asp Phe Leu 145 150 155 160
Lys Cys Ala Thr Leu Asp Thr Arg Ala Leu Leu Lys Leu Ala Tyr Ser 165 170 175
Ala Ala Cys Gly Leu Cys His Leu His Thr Glu Ile Tyr Gly Thr Gln 180 185 190
Gly Lys Pro Ala Ile Ala His Arg Asp Leu Lys Ser Lys Asn Ile Leu 195 200 205
Ile Lys Lys Asn Gly Ser Cys Cys Ile Ala Asp Leu Gly Leu Ala Val 210 215 220
Lys Phe Asn Ser Asp Thr Asn Glu Val Asp Ile Pro Leu Asn Thr Arg 225 230 235 240
Val Gly Thr Lys Arg Tyr Met Ala Pro Glu Val Leu Asp Glu Ser Leu 245 250 255
Asn Lys Asn His Phe Gln Pro Tyr Ile Met Ala Asp Ile Tyr Ser Phe 260 265 270
Gly Leu Ile Ile Trp Glu Met Ala Arg Arg Cys Ile Thr Gly Gly Ile 275 280 285
Val Glu Glu Tyr Gln Leu Pro Tyr Tyr Asn Met Val Pro Ser Asp Pro 290 295 300
Ser Tyr Glu Asp Met Arg Glu Val Val Cys Val Lys Arg Leu Arg Pro 305 310 315 320
Ile Val Ser Asn Arg Trp Asn Ser Asp Glu Cys Leu Arg Ala Val Leu 325 330 335
Lys Leu Met Ser Glu Cys Trp Ala His Asn Pro Ala Ser Arg Leu Thr 340 345 350
Ala Leu Arg Ile Lys Lys Thr Leu Ala Lys Met Val Glu Ser Gln Asp 355 360 365
Val Lys Ile Asn Gly Ala Ile Gly Gly Asp Leu Leu Leu Asn Phe Pro 370 375 380
Asp Met Ser Val Leu Glu Arg Gln Arg Ala His Leu Lys Tyr Leu Asn
385 390 395 400
Pro Thr Phe Asp Ser Pro Leu Ala Gly Phe Phe Ala Asp Ser Ser Met 405 410 415
Ile Thr Gly Gly Glu Met Asp Ser Tyr Leu Ser Thr Ala Gly Leu Asn 420 425 430
Leu Pro Met Met Tyr Gly Glu Thr Thr Val Glu Gly Asp Ser Arg Leu 435 440 445
Ser Ile Ser Pro Glu Thr Thr Leu Gly Thr Gly Asn Phe Lys Ala Ala 450 455 460
Lys Phe Asp Thr Glu Thr Lys Asp Cys Asn Glu Ala Ala Lys Lys Met 465 470 475 480
Thr Met Asn Arg Asp Asp Leu Val Glu Glu Gly Glu Glu Glu Lys Ser 485 490 495
Lys Ile Thr Glu Gln Asn Asn Gly Ser Thr Lys Ser Ile Lys Lys Met 500 505 510
Lys His Lys Ala Lys Lys Glu Glu Asn Asn Phe Ser Asn Asp Ser Ser 515 520 525
Lys Val Thr Lys Glu Leu Glu Lys Thr Asp Tyr Ile 530 535 540 <210> 2 <211> 850 <212> PRT <213> Artificial sequence <400> 2
Met Arg His His Lys Met Ala Tyr Pro Pro Val Leu Val Pro Thr Gln 1 5 10 15
Asp Pro Gly Pro Pro Pro Pro Ser Pro Leu Leu Gly Leu Lys Pro Leu 20 25 30
Gln Leu Leu Glu Val Lys Ala Arg Gly Arg Phe Gly Cys Val Trp Lys
Ala Gln Leu Leu Asn Glu Tyr Val Ala Val Lys Ile Phe Pro Ile Gln
50 55 60
Asp Lys Gln Ser Trp Gln Asn Glu Tyr Glu Val Tyr Ser Leu Pro Gly 65 70 75 80
Met Lys His Glu Asn Ile Leu Gln Phe Ile Gly Ala Glu Lys Arg Gly 85 90 95
Thr Ser Val Asp Val Asp Leu Trp Leu Ile Thr Ala Phe His Glu Lys 100 105 110
Gly Ser Leu Ser Asp Phe Leu Lys Ala Asn Val Val Ser Trp Asn Glu 115 120 125
IO Leu Cys His Ile Ala Glu Thr Met Ala Arg Gly Leu Ala Tyr Leu His 130 135 140
Glu Asp Ile Pro Gly Leu Lys Asp Gly His Lys Pro Ala Ile Ser His 145 150 155 160
Arg Asp Ile Lys Ser Lys Asn Val Leu Leu Lys Asn Asn Leu Thr Ala 165 170 175
Cys Ile Ala Asp Phe Gly Leu Ala Leu Lys Phe Glu Ala Gly Lys Ser 180 185 190
Ala Gly Asp Thr His Gly Gin Val Gly Thr Arg Arg Tyr Met Ala Pro 195 200 205
Glu Val Leu Glu Gly Ala Ile Asn Phe Gln Arg Asp Ala Phe Leu Arg 210 215 220
Ile Asp Met Tyr Ala Met Gly Leu Val Leu Trp Glu Leu Ala Ser Arg 225 230 235 240
Cys Thr Ala Ala Asp Gly Pro Val Asp Glu Tyr Met Leu Pro Phe Glu 245 250 255
Glu Glu Ile Gly Gin His Pro Ser Leu Glu Asp Met Gln Glu Val Val 260 265 270
Val His Lys Lys Lys Arg Pro Val Leu Arg Asp Tyr Trp Gln Lys His 275 280 285
Ala Gly Met Ala Met Leu Cys Glu Thr Ile Glu Glu Cys Trp Asp His 290 295 300
Asp Ala Glu Ala Arg Leu Ser Ala Gly Cys Val Gly Glu Arg Ile Thr 305 310 315 320
Gln Met Gln Arg Leu Thr Asn Ile lle Thr Thr Glu Asp Ile Val Thr 325 330 335
Val Val Thr Met Val Thr Asn Val Asp Phe Pro Pro Lys Glu Ser Ser 340 345 350
Leu Lys Met Asp Lys Lys Thr Ile Val Trp Phe Arg Arg Asp Leu Arg 355 360 365
Ile Glu Asp Asn Pro Ala Leu Ala Ala Ala Ala His Glu Gly Ser Val 370 375 380
Phe Pro Val Phe Ile Trp Cys Pro Glu Glu Glu Gly Gln Phe Tyr Pro 385 390 395 400
Gly Arg Ala Ser Arg Trp Trp Met Lys Gln Ser Leu Ala His Leu Ser 405 410 415
Gln Ser Leu Lys Ala Leu Gly Ser Asp Leu Thr Leu Ile Lys Thr His 420 425 430
Asn Thr Ile Ser Ala Ile Leu Asp Cys Ile Arg Val Thr Gly Ala Thr 435 440 445
Lys Val Val Phe Asn His Leu Tyr Asp Pro Val Ser Leu Val Arg Asp 450 455 460
His Thr Val Lys Glu Lys Leu Val Glu Arg Gly Ile Ser Val Gln Ser 465 470 475 480
Tyr Asn Gly Asp Leu Leu Tyr Glu Pro Trp Glu Ile Tyr Cys Glu Lys 485 490 495
Gly Lys Pro Phe Thr Ser Phe Asn Ser Tyr Trp Lys Lys Cys Leu Asp 500 505 510
Met Ser Ile Glu Ser Val Met Leu Pro Pro Pro Trp Arg Leu Met Pro 515 520 525
Ile Thr Ala Ala Ala Glu Ala Ile Trp Ala Cys Ser Ile Glu Glu Leu 530 535 540
Gly Leu Glu Asn Glu Ala Glu Lys Pro Ser Asn Ala Leu Leu Thr Arg 545 550 555 560
Ala Trp Ser Pro Gly Trp Ser Asn Ala Asp Lys Leu Leu Asn Glu Phe 565 570 575
Ile Glu Lys Gln Leu Ile Asp Tyr Ala Lys Asn Ser Lys Lys Val Val
580 585 590
Gly Asn Ser Thr Ser Leu Leu Ser Pro Tyr Leu His Phe Gly Glu Ile 595 600 605
Ser Val Arg His Val Phe Gln Cys Ala Arg Met Lys Gln Ile Ile Trp 610 615 620
Ala Arg Asp Lys Asn Ser Glu Gly Glu Glu Ser Ala Asp Leu Phe Leu 625 630 635 640
Arg Gly Ile Gly Leu Arg Glu Tyr Ser Arg Tyr Ile Cys Phe Asn Phe 645 650 655
Pro Phe Thr His Glu Gln Ser Leu Leu Ser His Leu Arg Phe Phe Pro 660 665 670
Trp Asp Ala Asp Val Asp Lys Phe Lys Ala Trp Arg Gln Gly Arg Thr 675 680 685
Gly Tyr Pro Leu Val Asp Ala Gly Met Arg Glu Leu Trp Ala Thr Gly 690 695 700
Trp Met His Asn Arg Ile Arg Val Ile Val Ser Ser Phe Ala Val Lys 705 710 715 720
Phe Leu Leu Leu Pro Trp Lys Trp Gly Met Lys Tyr Phe Trp Asp Thr 725 730 735
Leu Leu Asp Ala Asp Leu Glu Cys Asp Ile Leu Gly Trp Gln Tyr Ile 740 745 750
Ser Gly Ser Ile Pro Asp Gly His Glu Leu Asp Arg Leu Asp Asn Pro 755 760 765
Ala Leu Gln Gly Ala Lys Tyr Asp Pro Glu Gly Glu Tyr Ile Arg Gln 770 775 780
Trp Leu Pro Glu Leu Ala Arg Leu Pro Thr Glu Trp Ile His His Pro 785 790 795 800
Trp Asp Ala Pro Leu Thr Val Leu Lys Ala Ser Gly Val Glu Leu Gly 805 810 815
Thr Asn Tyr Ala Lys Pro Ile Val Asp Ile Asp Thr Ala Arg Glu Leu 820 825 830
Leu Ala Lys Ala Ile Ser Arg Thr Arg Glu Ala Gln Ile Met Ile Gly 835 840 845
Ala Ala 850 <210> 3 <211> 1623 <212> DNA <213> Artificial sequence <400> 3
IO atgggctgtg tgcaatgtaa ggataaagaa gcaacaaaac tgacgaagca ttattgtaag 60 agtatctcaa gcaggggtcg ttacaaccgt gatttggaac aggatgaagc atttattcca 120 gtaggagaat cattgaaaga cctgattgac cagtcccaaa gctctgggag tggatctgga 180 ttgcctttat tggttcagcg aactattgcc aaacagattc agatggttcg gcaggttggt 240 aaaggccgct atggagaagt atggatgggt aaatggcgtg gtgaaaaagt ggctgtcaaa 300 gtgtttttta ccactgaaga agctagctgg tttagagaaa cagaaatcta ccagacggtg 360 ttaatgcgtc atgaaaatat acttggtttt atagctgcag acattaaagg cactggttcc 420 tggactcagc tgtatttgat tactgattac catgaaaatg gatctctcta tgacttcctg 480 aaatgtgcca cactagacac cagagcccta ctcaagttag cttattctgc tgcttgtggt 540 ctgtgccacc tccacacaga aatttatggt acccaaggga agcctgcaat tgctcatcga 600 gacctgaaga gcaaaaacat ccttattaag aaaaatggaa gttgctgtat tgctgacctg 660 ggcctagctg ttaaattcaa cagtgataca aatgaagttg acataccctt gaataccagg 720 gtgggcacca agcggtacat ggctccagaa gtgctggatg aaagcctgaa taaaaaccat 780 ttccagccct acatcatggc tgacatctat agctttggtt tgatcatttg ggaaatggct 840 cgtcgttgta ttacaggagg aatcgtggag gaatatcaat taccatatta caacatggtg 900 cccagtgacc catcctatga ggacatgegt gagsttgtgt gtgtgaaacg cttgcggcca 960 atcgtgtcta accgctggaa cagcgatgaa tgtcttcgag cagttttgaa gctaatgtca 1020 gaatgttggg cccataatcc agcctccaga ctcacagctt tgagaatcaa gaagacactt 1080 gcaaaaatgg ttgaatccca ggatgtaaag attaatggag ctataggagg tgaccttttg 1140 ctcaattttc ctgacatgtc ggtcctagag cgccaaaggg ctcacctcaa gtacctcaat 1200 cccacctttg attctcetct cgccggcttc tttgccgatt cttcaatgat taccggcggc 1260 gagatggaca gctatctttc gactgccggt ttgaatcttc cgatgatgta cggteagacg 1320 acggtggaag gtgattcaag actctcaatt tcgccggaaa cgacgcttgg gactggaaat 1380 ttcaaggcag cgaagtttga tacagagact aaggattgta atgaggcggc gaagaagatg 1440 acgatgaaca gagatgacct agtagaagaa ggagaagaag agaagtcgaa aataacagag 1500 caaaacaatg ggagcacaaa aagcatcaag aagatgaaac acaaagccaa gaaagaagag 1560 aacaatttct ctaatgattc atctaaagtg acgaaggaat tggagaaaac ggattatatt 1620 taa 1623
<210> 4 <211> 2553 <212> DNA <213> Artificial sequence
<400> 4 atgagacatc acaagatggc ctaccctcct gtacttgttc ctactcaaga cccaggacca 60 cccccacctt ccccattact agggttgaag ccattgcagc tgttagaagt gaaagcaagg 120 ggaagatttg gttgtgtctg gaaagcccag ttgctcaatg aatatgtggc tgtcaaaata 180 tttccaatac aggacaaaca gtcctggcag aatgaatatg aagtctatag tctacctgga 240 atgaagcatg agaacatact acagttcatt ggtgcagaga aaagaggcac cagtgtggat 300 gtggacctgt ggctaatcac agcatttcat gaaaagggct cactgtcaga ctttcttaag 360 gctaatgtgg tctcttggaa tgaactttgt catattgcag aaaccatggc tagaggattg 420 gcatatttac atgaggatat acctggctta aaagatggcc acaagcetgc aatctctcac 480 agggacatca aaagtaaaaa tgtgctgttg aaaaacaatc tgacagcttg cattgctgac 540 tttggsttgg ccttaaagtt cgaggctggc aagtctgcag gtgacaccca tgggeaggtt 600 ggtacccgga ggtatatggc tccagaggtg ttggagggtg ctataaactt ccaaagggac 660 gcatttctga ggatagatat stacgccatg ggattagtcc tatgggaatt ggettctegt 720 tgcactgctg cagatggacc cgtagatgag tacatgttac catttgagga agaaattggc 780 cagcatccat ctcttgaaga tatgcaggaa gttgttgtgc ataaaaaaaa gaggcctgtt 840 ttaagagatt attggcagaa acatgcagga atggcaatgc tctgtgaaac gatagaagaa 900 tgttgggatc atgatgcaga agccaggtta tcagctggat stgtaggtga aagaattact 960 cagatgcaaa gactaacaaa tatcattact acagaggaca ttgtaacagt ggtcacaatg 1020 gtgacaaatg ttgactttcc tcccaaagaa tctagtctaa agatggacaa aaagactata 1080 gtttggttta gaagagacct aaggattgag gataatcctg cattagcagc agetgetcac 1140 gaaggatctg tttttcctgt cttcatttgg tgtcctgaag aagaaggaca gttttatcct 1200 ggaagagctt caagatggtg gatgaaacaa tcacttgctc acttatctca atccttgaag 1260 gctcttggat ctgacctcac tttaatcaaa acccacaaca cgatttcage gatcttggat 1320 tgtatccgcg ttaccggtgc tacaaaagtc gtctttaacc acctctatga tcctgtttcg 1380 ttagttcggg accataccgt aaaggagaag ctggtggaac stgggatctc tgtgcaaagc 1440 tacaatggag atctattgta tgaaccgtgg gagatatact gcgaaaaggg caaacctttt 1500 acgagtttca attcttactg gaagaaatgc ttagatatgt cgattgaatc cgttatgett 1560 cctectectt ggcggttgat gccaataact gcagcggctg aagcgatttg ggegtgtteg 1620 attgaagaac tagggctgga gaatgaggcc gagaaaccga geaatgegtt gttaactaga 1680 gcttggtctc caggatggag caatgctgat aagttactaa atgagttcat cgagaagcag 1740 ttgatagatt atgcaaagaa cagcaagaaa gttgttggga attctacttc actactttet 1800 ccgtatctcc atttcgggga aataagcgtc agacacgttt tccagtgtgc ccggatgaaa 1860
IO caaattatat gggcaagaga taagaacagt gaaggagaag aaagtgcaga tctttttett 1920 aggggaatcg gtttaagaga gtattctcgg tatatatgtt tcaacttccc gtttactcac 1980 gagcaatcgt tgttgagtca tcttcggttt ttcccttggg atgctgatgt tgataagttc 2040 aaggcctgga gacaaggcag gaccggttat ccgttggtgg atgccggaat gagagagctt 2100 tgggctaccg gatggatgca taacagaata agagtgattg tttcaagctt tgctgtgaag 2160 tttcttctce ttccatggaa atggggaatg aagtatttct gggatacact tttggatgct 2220 gatttggaat gtgacatcct tggctggcag tatatctctg ggagtatccc cgatggccac 2280 gagcttgatc gettggacaa tcccgcgtta caaggcgcca aatatgaccc agaaggtgag 2340 tacataaggc aatggcttcc cgagcttgcg agattgccaa ctgaatggat ccatcatcca 2400 tgggacgctc ctttaaccgt actcaaagct tctggtgtgg aactcggaac aaactatgcg 2460 aaacccattg tagacatcga cacagctcgt gagctactag ctaaagctat ttcaagaacc 2520 cgtgaagcac agatcatgat cggagcagca taa 2553
SEQLTXT
SEQUENCE LISTING
<110> Fourth Medical Center of Chinese PLA General Hospital <120> Optogenetic Bone Morphogenetic Protein Receptor (Optobmpr) System and Construction Method and Use Thereof <130> HKJIP202109544 <160> 4 <170> PatentIn version 3.3 <21e> 1 <211> 540 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of bone morphogenetic protein type I receptor
OptoBR1 <400> 1
Met Gly Cys Val Gln Cys Lys Asp Lys Glu Ala Thr Lys Leu Thr Lys 1 5 10 15
His Tyr Cys Lys Ser Ile Ser Ser Arg Gly Arg Tyr Asn Arg Asp Leu
Glu Gln Asp Glu Ala Phe Ile Pro Val Gly Glu Ser Leu Lys Asp Leu
Ile Asp Gln Ser Gln Ser Ser Gly Ser Gly Ser Gly Leu Pro Leu Leu 60
Val Gln Arg Thr Ile Ala Lys Gln Ile Gln Met Val Arg Gln Val Gly 65 70 75 80
Lys Gly Arg Tyr Gly Glu Val Trp Met Gly Lys Trp Arg Gly Glu Lys 85 90 95
Val Ala Val Lys Val Phe Phe Thr Thr Glu Glu Ala Ser Trp Phe Arg 100 105 119
Pagina 1
SEQLTXT
Glu Thr Glu Ile Tyr Gln Thr Val Leu Met Arg His Glu Asn Ile Leu 115 120 125
Gly Phe Ile Ala Ala Asp Ile Lys Gly Thr Gly Ser Trp Thr Gln Leu 130 135 140
Tyr Leu Ile Thr Asp Tyr His Glu Asn Gly Ser Leu Tyr Asp Phe Leu 145 150 155 160
Lys Cys Ala Thr Leu Asp Thr Arg Ala Leu Leu Lys Leu Ala Tyr Ser 165 170 175
Ala Ala Cys Gly Leu Cys His Leu His Thr Glu Ile Tyr Gly Thr Gln 180 185 190
Gly Lys Pro Ala Ile Ala His Arg Asp Leu Lys Ser Lys Asn Ile Leu 195 200 205
Ile Lys Lys Asn Gly Ser Cys Cys Ile Ala Asp Leu Gly Leu Ala Val 210 215 220
Lys Phe Asn Ser Asp Thr Asn Glu Val Asp Ile Pro Leu Asn Thr Arg 225 230 235 240
Val Gly Thr Lys Arg Tyr Met Ala Pro Glu Val Leu Asp Glu Ser Leu 245 250 255
Asn Lys Asn His Phe Gln Pro Tyr Ile Met Ala Asp Ile Tyr Ser Phe 260 265 270
Gly Leu Ile Ile Trp Glu Met Ala Arg Arg Cys Ile Thr Gly Gly Ile 275 280 285
Val Glu Glu Tyr Gln Leu Pro Tyr Tyr Asn Met Val Pro Ser Asp Pro 290 295 300
Ser Tyr Glu Asp Met Arg Glu Val Val Cys Val Lys Arg Leu Arg Pro 305 310 315 320
Pagina 2
SEQLTXT
Ile Val Ser Asn Arg Trp Asn Ser Asp Glu Cys Leu Arg Ala Val Leu 325 330 335
Lys Leu Met Ser Glu Cys Trp Ala His Asn Pro Ala Ser Arg Leu Thr 340 345 350
Ala Leu Arg Ile Lys Lys Thr Leu Ala Lys Met Val Glu Ser Gln Asp 355 360 365
Val Lys Ile Asn Gly Ala Ile Gly Gly Asp Leu Leu Leu Asn Phe Pro 370 375 380
Asp Met Ser Val Leu Glu Arg Gln Arg Ala His Leu Lys Tyr Leu Asn 385 390 395 400
Pro Thr Phe Asp Ser Pro Leu Ala Gly Phe Phe Ala Asp Ser Ser Met 405 410 415
Ile Thr Gly Gly Glu Met Asp Ser Tyr Leu Ser Thr Ala Gly Leu Asn 420 425 430
Leu Pro Met Met Tyr Gly Glu Thr Thr Val Glu Gly Asp Ser Arg Leu 435 440 445
Ser Ile Ser Pro Glu Thr Thr Leu Gly Thr Gly Asn Phe Lys Ala Ala 450 455 460
Lys Phe Asp Thr Glu Thr Lys Asp Cys Asn Glu Ala Ala Lys Lys Met 465 470 475 480
Thr Met Asn Arg Asp Asp Leu Val Glu Glu Gly Glu Glu Glu Lys Ser 485 490 495
Lys Ile Thr Glu Gln Asn Asn Gly Ser Thr Lys Ser Ile Lys Lys Met 500 505 510
Lys His Lys Ala Lys Lys Glu Glu Asn Asn Phe Ser Asn Asp Ser Ser 515 520 525
Pagina 3
SEQLTXT
Lys Val Thr Lys Glu Leu Glu Lys Thr Asp Tyr Ile 530 535 540 <2105 2 <211> 850 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of bone morphogenetic protein type II receptor OptoBR2 <400> 2
Met Arg His His Lys Met Ala Tyr Pro Pro Val Leu Val Pro Thr Gln 1 5 10 15
Asp Pro Gly Pro Pro Pro Pro Ser Pro Leu Leu Gly Leu Lys Pro Leu
Gln Leu Leu Glu Val Lys Ala Arg Gly Arg Phe Gly Cys Val Trp Lys
Ala Gln Leu Leu Asn Glu Tyr Val Ala Val Lys Ile Phe Pro Ile Gln 60
Asp Lys Gln Ser Trp Gln Asn Glu Tyr Glu Val Tyr Ser Leu Pro Gly 65 70 75 80
Met Lys His Glu Asn Ile Leu Gln Phe Ile Gly Ala Glu Lys Arg Gly 85 90 95
Thr Ser Val Asp Val Asp Leu Trp Leu Ile Thr Ala Phe His Glu Lys 100 105 119
Gly Ser Leu Ser Asp Phe Leu Lys Ala Asn Val Val Ser Trp Asn Glu 115 120 125
Leu Cys His Ile Ala Glu Thr Met Ala Arg Gly Leu Ala Tyr Leu His 130 135 140
Glu Asp Ile Pro Gly Leu Lys Asp Gly His Lys Pro Ala Ile Ser His
Pagina 4
SEQLTXT
145 150 155 160
Arg Asp Ile Lys Ser Lys Asn Val Leu Leu Lys Asn Asn Leu Thr Ala 165 170 175
Cys Ile Ala Asp Phe Gly Leu Ala Leu Lys Phe Glu Ala Gly Lys Ser 180 185 190
Ala Gly Asp Thr His Gly Gln Val Gly Thr Arg Arg Tyr Met Ala Pro 195 200 205
Glu Val Leu Glu Gly Ala Ile Asn Phe Gln Arg Asp Ala Phe Leu Arg 210 215 220
Ile Asp Met Tyr Ala Met Gly Leu Val Leu Trp Glu Leu Ala Ser Arg 225 230 235 240
Cys Thr Ala Ala Asp Gly Pro Val Asp Glu Tyr Met Leu Pro Phe Glu 245 250 255
Glu Glu Ile Gly Gln His Pro Ser Leu Glu Asp Met Gln Glu Val Val 260 265 270
Val His Lys Lys Lys Arg Pro Val Leu Arg Asp Tyr Trp Gln Lys His 275 280 285
Ala Gly Met Ala Met Leu Cys Glu Thr Ile Glu Glu Cys Trp Asp His 290 295 300
Asp Ala Glu Ala Arg Leu Ser Ala Gly Cys Val Gly Glu Arg Ile Thr 305 310 315 320
Gln Met Gln Arg Leu Thr Asn Ile Ile Thr Thr Glu Asp Ile Val Thr 325 330 335
Val Val Thr Met Val Thr Asn Val Asp Phe Pro Pro Lys Glu Ser Ser 340 345 350
Leu Lys Met Asp Lys Lys Thr Ile Val Trp Phe Arg Arg Asp Leu Arg
Pagina 5
SEQLTXT
355 360 365
Ile Glu Asp Asn Pro Ala Leu Ala Ala Ala Ala His Glu Gly Ser Val 370 375 380
Phe Pro Val Phe Ile Trp Cys Pro Glu Glu Glu Gly Gln Phe Tyr Pro 385 390 395 400
Gly Arg Ala Ser Arg Trp Trp Met Lys Gln Ser Leu Ala His Leu Ser 405 410 415
Gln Ser Leu Lys Ala Leu Gly Ser Asp Leu Thr Leu Ile Lys Thr His 420 425 430
Asn Thr Ile Ser Ala Ile Leu Asp Cys Ile Arg Val Thr Gly Ala Thr 435 440 445
Lys Val Val Phe Asn His Leu Tyr Asp Pro Val Ser Leu Val Arg Asp 450 455 460
His Thr Val Lys Glu Lys Leu Val Glu Arg Gly Ile Ser Val Gln Ser 465 470 475 480
Tyr Asn Gly Asp Leu Leu Tyr Glu Pro Trp Glu Ile Tyr Cys Glu Lys 485 490 495
Gly Lys Pro Phe Thr Ser Phe Asn Ser Tyr Trp Lys Lys Cys Leu Asp 500 505 510
Met Ser Ile Glu Ser Val Met Leu Pro Pro Pro Trp Arg Leu Met Pro 515 520 525
Ile Thr Ala Ala Ala Glu Ala Ile Trp Ala Cys Ser Ile Glu Glu Leu 530 535 540
Gly Leu Glu Asn Glu Ala Glu Lys Pro Ser Asn Ala Leu Leu Thr Arg 545 550 555 560
Ala Trp Ser Pro Gly Trp Ser Asn Ala Asp Lys Leu Leu Asn Glu Phe
Pagina 6
SEQLTXT
565 570 575
Ile Glu Lys Gln Leu Ile Asp Tyr Ala Lys Asn Ser Lys Lys Val Val 580 585 590
Gly Asn Ser Thr Ser Leu Leu Ser Pro Tyr Leu His Phe Gly Glu Ile 595 600 605
Ser Val Arg His Val Phe Gln Cys Ala Arg Met Lys Gln Ile Ile Trp 610 615 620
Ala Arg Asp Lys Asn Ser Glu Gly Glu Glu Ser Ala Asp Leu Phe Leu 625 630 635 640
Arg Gly Ile Gly Leu Arg Glu Tyr Ser Arg Tyr Ile Cys Phe Asn Phe 645 650 655
Pro Phe Thr His Glu Gln Ser Leu Leu Ser His Leu Arg Phe Phe Pro 660 665 670
Trp Asp Ala Asp Val Asp Lys Phe Lys Ala Trp Arg Gln Gly Arg Thr 675 680 685
Gly Tyr Pro Leu Val Asp Ala Gly Met Arg Glu Leu Trp Ala Thr Gly 690 695 700
Trp Met His Asn Arg Ile Arg Val Ile Val Ser Ser Phe Ala Val Lys 705 710 715 720
Phe Leu Leu Leu Pro Trp Lys Trp Gly Met Lys Tyr Phe Trp Asp Thr 725 730 735
Leu Leu Asp Ala Asp Leu Glu Cys Asp Ile Leu Gly Trp Gln Tyr Ile 740 745 750
Ser Gly Ser Ile Pro Asp Gly His Glu Leu Asp Arg Leu Asp Asn Pro 755 760 765
Ala Leu Gln Gly Ala Lys Tyr Asp Pro Glu Gly Glu Tyr Ile Arg Gln
Pagina 7
SEQLTXT
770 775 780
Trp Leu Pro Glu Leu Ala Arg Leu Pro Thr Glu Trp Ile His His Pro 785 790 795 800
Trp Asp Ala Pro Leu Thr Val Leu Lys Ala Ser Gly Val Glu Leu Gly 805 810 815
Thr Asn Tyr Ala Lys Pro Ile Val Asp Ile Asp Thr Ala Arg Glu Leu 820 825 830
Leu Ala Lys Ala Ile Ser Arg Thr Arg Glu Ala Gln Ile Met Ile Gly 835 840 845
Ala Ala 850 <210> 3 <211> 1623 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of bone morphogenetic protein type II receptor OptoBR1 <400> 3 atgggctgtg tgcaatgtaa ggataaagaa gcaacaaaac tgacgaagca ttattgtaag 60 agtatctcaa gcaggggtcg ttacaaccgt gatttggaac aggatgaagc atttattcca 120 gtaggagaat cattgaaaga cctgattgac cagtcccaaa gctctgggag tggatctgga 180 ttgcctttat tggttcagcg aactattgcc aaacagattc agatggttcg gcaggttggt 240 aaaggccgct atggagaagt atggatgggt aaatggcgtg gtgaaaaagt ggctgtcaaa 300 gtgtttttta ccactgaaga agctagctgg tttagagaaa cagaaatcta ccagacggtg 360 ttaatgcgtc atgaaaatat acttggtttt atagctgcag acattaaagg cactggttcc 420 tggactcagc tgtatttgat tactgattac catgaaaatg gatctctcta tgacttcctg 480 aaatgtgcca cactagacac cagagcccta ctcaagttag cttattctgc tgcttgtggt 540 ctgtgccacc tccacacaga aatttatggt acccaaggga agcctgcaat tgctcatcga 600
Pagina 8
SEQLTXT gacctgaaga gcaaaaacat ccttattaag aaaaatggaa gttgctgtat tgctgacctg 660 ggcctagctg ttaaattcaa cagtgataca aatgaagttg acataccctt gaataccagg 720 gtgggcacca agcggtacat ggctccagaa gtgctggatg aaagcctgaa taaaaaccat 780 ttccagccct acatcatggc tgacatctat agctttggtt tgatcatttg ggaaatggct 840 cgtcgttgta ttacaggagg aatcgtggag gaatatcaat taccatatta caacatggtg 900 cccagtgacc catcctatga ggacatgcgt gaggttgtgt gtgtgaaacg cttgcggcca 960 atcgtgtcta accgctggaa cagcgatgaa tgtcttcgag cagttttgaa gctaatgtca 1020 gaatgttggg cccataatcc agcctccaga ctcacagctt tgagaatcaa gaagacactt 1080 gcaaaaatgg ttgaatccca ggatgtaaag attaatggag ctataggagg tgaccttttg 1140 ctcaattttc ctgacatgtc ggtcctagag cgccaaaggg ctcacctcaa gtacctcaat 1200 cccacctttg attctcctct cgccggcttc tttgccgatt cttcaatgat taccggcggc 1260 gagatggaca gctatctttc gactgccggt ttgaatcttc cgatgatgta cggtgagacg 1320 acggtggaag gtgattcaag actctcaatt tcgccggaaa cgacgcttgg gactggaaat 1380 ttcaaggcag cgaagtttga tacagagact aaggattgta atgaggcggc gaagaagatg 1440 acgatgaaca gagatgacct agtagaagaa ggagaagaag agaagtcgaa aataacagag 1500
Caaaacaatg ggagcacaaa aagcatcaag aagatgaaac acaaagccaa gaaagaagag 1560 aacaatttct ctaatgattc atctaaagtg acgaaggaat tggagaaaac ggattatatt 1620 taa 1623 <210> 4 <211> 2553 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of bone morphogenetic protein type II receptor OptoBR2 <400> 4 atgagacatc acaagatggc ctaccctcct gtacttgttc ctactcaaga cccaggacca 60 cccccacctt ccccattact agggttgaag ccattgcagc tgttagaagt gaaagcaagg 120
Pagina 9 ggaagatttg gttgtgtctg gaaagcccag ttgcteoatg aatatgtggc tgtcaaaata 180 tttccaatac aggacaaaca gtcctggcag aatgaatatg aagtctatag tctacctgga 240 atgaagcatg agaacatact acagttcatt ggtgcagaga aaagaggcac cagtgtggat 300 gtggacctgt ggctaatcac agcatttcat gaaaagggct cactgtcaga ctttcttaag 360 gctaatgtgg tctcttggaa tgaactttgt catattgcag aaaccatggc tagaggattg 420 gcatatttac atgaggatat acctggctta aaagatggcc acaagcctgc aatctctcac 480 agggacatca aaagtaaaaa tgtgctgttg aaaaacaatc tgacagcttg cattgctgac 540 tttgggttgg ccttaaagtt cgaggctggc aagtctgcag gtgacaccca tgggcaggtt 600 ggtacccgga ggtatatggc tccagaggtg ttggagggtg ctataaactt ccaaagggac 660 gcatttctga ggatagatat gtacgccatg ggattagtcc tatgggaatt ggcttctcgt 720 tgcactgctg cagatggacc cgtagatgag tacatgttac catttgagga agaaattggc 780 cagcatccat ctcttgaaga tatgcaggaa gttgttgtgc ataaaaaaaa gaggcctgtt 840 ttaagagatt attggcagaa acatgcagga atggcaatgc tctgtgaaac gatagaagaa 900 tgttgggatc atgatgcaga agccaggtta tcagctggat gtgtaggtga aagaattact 960 cagatgcaaa gactaacaaa tatcattact acagaggaca ttgtaacagt ggtcacaatg 1020 gtgacaaatg ttgactttcc tcccaaagaa tctagtctaa agatggacaa aaagactata 1080 gtttggttta gaagagacct aaggattgag gataatcctg cattagcagc agctgctcac 1140 gaaggatctg tttttcctgt cttcatttgg tgtcctgaag aagaaggaca gttttatcct 1200 ggaagagctt caagatggtg gatgaaacaa tcacttgctc acttatctca atccttgaag 1260 gctcttggat ctgacctcac tttaatcaaa acccacaaca cgatttcagc gatcttggat 1320 tgtatccgcg ttaccggtgc tacaaaagtc gtctttaacc acctctatga tcctgtttcg 1380 ttagttcggg accataccgt aaaggagaag ctggtggaac gtgggatctc tgtgcaaagc 1440 tacaatggag atctattgta tgaaccgtgg gagatatact gcgaaaaggg caaacctttt 1500 acgagtttca attcttactg gaagaaatgc ttagatatgt cgattgaatc cgttatgctt 1560 cctcctcctt ggcggttgat gccaataact gcagcggctg aagcgatttg ggcgtgttcg 1620 attgaagaac tagggctgga gaatgaggcc gagaaaccga gcaatgcgtt gttaactaga 1680
Pagina 10 gcttggtctc caggatggag caatgctgat sagttoctas atgagttcat cgagaagcag 1740 ttgatagatt atgcaaagaa cagcaagaaa gttgttggga attctacttc actactttct 1800 ccgtatctcc atttcgggga aataagcgtc agacacgttt tccagtgtgc ccggatgaaa 1860 caaattatat gggcaagaga taagaacagt gaaggagaag aaagtgcaga tctttttctt 1920 aggggaatcg gtttaagaga gtattctcgg tatatatgtt tcaacttccc gtttactcac 1980 gagcaatcgt tgttgagtca tcttcggttt ttcccttggg atgctgatgt tgataagttc 2040 aaggcctgga gacaaggcag gaccggttat ccgttggtgg atgccggaat gagagagctt 2100 tgggctaccg gatggatgca taacagaata agagtgattg tttcaagctt tgctgtgaag 2160 tttettctcc ttccatggaa atggggaatg aagtatttct gggatacact tttggatgct 2220 gatttggaat gtgacatcct tggctggcag tatatctctg ggagtatccc cgatggccac 2280 gagcttgatc gcttggacaa tcccgcgtta caaggcgcca aatatgaccc agaaggtgag 2340 tacataaggc aatggcttcc cgagcttgcg agattgccaa ctgaatggat ccatcatcca 2400 tgggacgctc ctttaaccgt actcaaagct tctggtgtgg aactcggaac aaactatgcg 2460 aaacccattg tagacatcga cacagctcgt gagctactag ctaaagctat ttcaagaacc 2520 cgtgaagcac agatcatgat cggagcagca taa 2553
Pagina 11

Claims (4)

Conclusies l. Optogenetisch systeem van botmorfogenetische-eiwitreceptor (OptoBMPR), dat een eerste recombinant plasmide dat een botmorfogenetisch-eiwitreceptor type I (OptoBR1) tot expressie brengt en een tweede recombinant plasmide dat een botmorfogenetische-eiwitreceptor type II (OptoBR2) tot expressie brengt, omvat; waarbij het OptoBR 1 een aminozuursequentie heeft die weergegeven is in SEQ ID Nr. 1; waarbij het OptoBR2 een aminozuursequentie heeft die weergegeven is in SEQ IDConclusions l. Bone morphogenetic protein receptor optogenetic system (OptoBMPR), comprising a first recombinant plasmid expressing a bone morphogenetic protein receptor type I (OptoBR1) and a second recombinant plasmid expressing a bone morphogenetic protein receptor type II (OptoBR2); wherein the OptoBR 1 has an amino acid sequence shown in SEQ ID NO. 1; wherein the OptoBR2 has an amino acid sequence shown in SEQ ID Nr. 2; waarbij een coderend gen van het OptoBR1 een nucleotidesequentie heeft die weergegeven is in SEQ ID Nr. 3; waarbij een coderend gen van het OptoBR2 een nucleotidesequentie heeft die weergegeven is in SEQ ID Nr. 4; waarbij het eerste recombinante plasmide en het tweede recombinante plasmide elk een adenovirus als een constructievectorruggengraat gebruiken; waarbij het OptoBMPR-systeem verder adenovirusverpakkingscellen omvat, en waarbij de adenovirusverpakkingscellen embryonale niercellen omvatten.No. 2; wherein a coding gene of the OptoBR1 has a nucleotide sequence shown in SEQ ID NO. 3; wherein a coding gene of the OptoBR2 has a nucleotide sequence shown in SEQ ID NO. 4; wherein the first recombinant plasmid and the second recombinant plasmid each use an adenovirus as a construction vector backbone; wherein the OptoBMPR system further comprises adenovirus packaging cells, and wherein the adenovirus packaging cells comprise embryonic kidney cells. 2. Constructiewerkwijze van het OptoBMPR-systeem volgens conclusie 1, die de volgende stappen omvat: 1) het invoegen van een coderend gen dat het OptoBR1 tot expressie brengt in een eerste constructieplasmideruggengraat om het eerste recombinante plasmide te verkrijgen; en 2) het invoegen van een coderend gen dat het OptoBR2 tot expressie brengt in een tweede constructieplasmideruggengraat om het tweede recombinante plasmide te verkrijgen; waarbij stap (1) en stap (2) in elke volgorde uitgevoerd kunnen worden.The method of construction of the OptoBMPR system according to claim 1, comprising the steps of: 1) inserting a coding gene expressing the OptoBR1 into a first construction plasmid backbone to obtain the first recombinant plasmid; and 2) inserting a coding gene expressing the OptoBR2 into a second constructor plasmid backbone to obtain the second recombinant plasmid; wherein step (1) and step (2) may be performed in any order. 3. Gebruik van het OptoBMPR-systeem volgens conclusie 1, voor het bereiden van een bereiding om intracellulaire BMP/Smad 1/5/8-signaalwegen te activeren.Use of the OptoBMPR system according to claim 1, for preparing a preparation to activate intracellular BMP/Smad 1/5/8 signaling pathways. 4. Gebruik volgens conclusie 3, dat de volgende stappen omvat: het co-transfecteren van epidermale stamcellen om transgene cellen te verkrijgen met behulp van het eerste recombinante plasmide en het tweede recombinante plasmide in het OptoBMPR-systeem, het bestralen van de transgene cellen met 460 nm blauw licht gedurende 30 s — 24 h om de BMP/Smad 1/5/8-signaalwegen in de transgene cellen te activeren; waarbij het 460 nm blauwe licht een stralingsintensiteit van 0,1 — 100 UW cm heeft.Use according to claim 3 comprising the steps of: co-transfecting epidermal stem cells to obtain transgenic cells using the first recombinant plasmid and the second recombinant plasmid in the OptoBMPR system, irradiating the transgenic cells with 460 nm blue light for 30 s — 24 h to activate the BMP/Smad 1/5/8 signaling pathways in the transgenic cells; wherein the 460 nm blue light has a radiation intensity of 0.1 - 100 UW cm.
NL2030101A 2021-12-10 2021-12-10 Optogenetic bone morphogenetic protein receptor (optobmpr) system and construction method and use thereof NL2030101B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
NL2030101A NL2030101B1 (en) 2021-12-10 2021-12-10 Optogenetic bone morphogenetic protein receptor (optobmpr) system and construction method and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
NL2030101A NL2030101B1 (en) 2021-12-10 2021-12-10 Optogenetic bone morphogenetic protein receptor (optobmpr) system and construction method and use thereof

Publications (1)

Publication Number Publication Date
NL2030101B1 true NL2030101B1 (en) 2023-06-27

Family

ID=87103460

Family Applications (1)

Application Number Title Priority Date Filing Date
NL2030101A NL2030101B1 (en) 2021-12-10 2021-12-10 Optogenetic bone morphogenetic protein receptor (optobmpr) system and construction method and use thereof

Country Status (1)

Country Link
NL (1) NL2030101B1 (en)

Similar Documents

Publication Publication Date Title
CN108715850B (en) GING2 gene knockout in epidermal stem cells by using CRISPR-Cas system
CA2179014C (en) Method for inducing dna synthesis in neurons
US20180265890A1 (en) Efficient and safe transposon integration system and use thereof
EP1002091B1 (en) Nucleic acid sequence and method for selectively expressing a protein in a target cell or tissue
JP2023089132A (en) Non-Integrating DNA Vectors for Genetic Modification of Cells
US20210388387A1 (en) Synp151 (proc29), a promoter for the specific expression of genes in retinal ganglion cells
US10280408B2 (en) Method of suppressing gene transcription through histone lysine methylation
KR101220516B1 (en) Human Adult Stem Cells Secreting Anti-MDM2 and Uses thereof
ES2432183T3 (en) Clone of cells that produce FSH
Lee et al. Activation of the double-stranded RNA (dsRNA)-activated human protein kinase in vivo in the absence of its dsRNA binding domain.
Ma et al. Non-classical nuclear localization signal peptides for high efficiency lipofection of primary neurons and neuronal cell lines
WO2022078310A1 (en) Novel piggybac transposon system and use thereof
Rasmussen et al. Glutamatergic or GABAergic neuron-specific, long-term expression in neocortical neurons from helper virus-free HSV-1 vectors containing the phosphate-activated glutaminase, vesicular glutamate transporter-1, or glutamic acid decarboxylase promoter
Granger et al. Expression of the major neurofilament subunit in chicken erythrocytes
Zhang et al. The vesicular glutamate transporter-1 upstream promoter and first intron each support glutamatergic-specific expression in rat postrhinal cortex
NL2030101B1 (en) Optogenetic bone morphogenetic protein receptor (optobmpr) system and construction method and use thereof
CN114560915A (en) Modified high-titer SARS-CoV-2 pseudovirus
CN112342241B (en) Light-operated bone morphogenetic protein receptor system OptoBMPR and construction method and application thereof
Kouno et al. Ahnak/Desmoyokin is dispensable for proliferation, differentiation, and maintenance of integrity in mouse epidermis
KR101048766B1 (en) Composition for the prevention / treatment of diseases with mitochondrial dysfunction
Marsh et al. Herpes simplex viral and amplicon vector-mediated gene transfer into glia and neurons in organotypic spinal cord and dorsal root ganglion cultures
Kretz et al. A novel primary culture technique for adult retina allows for evaluation of CNS axon regeneration in rodents
RU2008122920A (en) PRODUCTIVITY ENHANCING PROTEIN FACTOR, NEW CELL LINES AND THEIR APPLICATION
WO2022232348A1 (en) Angiotensin-converting enzyme ii (ace2) transgenic animal and uses thereof
JP2009514544A5 (en)