NL2029922B1

NL2029922B1 - Gpd1l-deleted human embryonic stem cell line and construction method and use thereof

Info

Publication number: NL2029922B1
Application number: NL2029922A
Authority: NL
Inventors: Pan Hongming; Lin Yan; Yue Liling; Dong Tao; Ji Hui; Shen Lei; Liu Jicheng; Jin Haifeng
Original assignee: Univ Qiqihar Medical
Priority date: 2021-11-26
Filing date: 2021-11-26
Publication date: 2022-11-15
Also published as: NL2029922A

Abstract

The present disclosure provides a GPDlL-deleted human embryonic stem cell line and a construction method and use thereof, and belongs to the technical field of genetic engineering. In the GPDlL-deleted human embryonic stem cell line constructed by the present disclosure, GPDlL is deleted, karyotype is normal, pluripotency markers of stem cells are normal, the stability of serial passage is excellent, triploblastic teratoma can be formed in animals, and there is no mycoplasma contamination. GPDlL-deleted human embryonic stem cell line H9 can be used to investigate an effect of GPDlL deletion on differentiated cardiomyocyte function and screen a therapeutic medicament.

Description

GPDIL-DELETED HUMAN EMBRYONIC STEM CELL LINE AND CONSTRUCTION METHOD AND USE THEREOF TECHNICAL FIELD

[01] The present disclosure belongs to the technical field of genetic engineering, and specifically relates to a GPDIL-deleted human embryonic stem cell line and a construction method and use thereof.

BACKGROUND ART

[02] Human-derived cardiomyocyte is an urgent need for experimental models. Human embryonic stem cell can just solve this problem, which has multiple differentiation potentials and can be differentiated into substantial human-derived cardiomyocytes for studies.

SUMMARY

[03] In view of this, an objective of the present disclosure is to provide a GPDIL-deleted human embryonic stem cell line and a construction method and use thereof, providing an ideal material for subsequent studies.

[04] The present disclosure provides a GPD1L-deleted human embryonic stem cell line, where a GPD1L gene is knocked out by using CRISPR/Cas9 technology based on a human embryonic stem cell.

[05] As for the GPDIL-deleted human embryonic stem cell line provided by the present disclosure, a GPD/L gene is knocked out based on a human embryonic stem cell. The GPDIL-deleted human embryonic stem cell line has a potential of differentiating into cardiomyocytes, a property of complete deletions of GPDIL protein, and a stable karyotype; pluripotency markers of stem cells thereof are positive and normal, and triploblastic teratoma can be formed in SCID rats; there is no mycoplasma contamination, and the stability of serial passage is excellent. In view of the above performance, the GPDIL-deleted human embryonic stem cell line can be used as a biological material in investigating an effect of GPDIL deletion on differentiated cardiomyocyte function and screening a therapeutic medicament for a disease.

BRIEF DESCRIPTION OF THE DRAWINGS

[06] FIG. 1 illustrates a verification result of successful construction of a GPD IL-deleted human embryonic stem cell line;

[07] FIG. 2 illustrates a karyotyping result of a GPD1L-deleted human embryonic stem cell.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[08] The present disclosure provides a GPD1L-deleted human embryonic stem cell line, where a GPD IL gene is knocked out by using CRISPR/Cas9 technology based on a human embryonic stem cell.

[09] In the present disclosure, knockout of the GPDIL gene may preferably include insertion mutation in exon 4 of GPDIL diallele. In an example of the present disclosure, the knockout of the GPD/L gene is insertion of base A in the exon 4 of GPDIL diallele to allow a stop codon TGA to appear in amino acid 157 of GPDIL protein after GPDIL expression, leading to premature termination of protein translation. The human embryonic stem cell may preferably include human embryonic stem cell line HY.

[10] The present disclosure provides a construction method of the GPDIL-deleted human embryonic stem cell line, including the following steps:

[11] step 1, designing sgRNA of targeted GPDIL gene, cloning the gene into a CRISPR/Cas9 plasmid, and constructing a targeted GPDIL gene knockout plasmid; and

[12] step 2, transforming the targeted (PD 11 gene knockout plasmid in step 1 into a human embryonic stem cell, and screening to obtain the GPD1L-deleted human embryonic stem cell line.

[13] In the present disclosure, sgRNA of targeted GPD/L gene 1s designed and cloned into a CRISPR/Cas9 plasmid, and a targeted GPDIL gene knockout plasmid is constructed.

[14] Example 1

[15] A construction method of the GPDIL-deleted human embryonic stem cell line was provided, including the following content:

[16] 1. Maintenance culture and passage of human embryonic stem cells

[17] (1) In a biosafety cabinet, old culture medium was discarded; after rinsing with

PBS, a new E8 medium was changed.

[18] (2) When the cells grew to 70%-80% confluence, passage could be allowed.

The cells were rinsed with PBS once, and digested with 0.05 mM EDTA at 37°C for 5 min; digestive fluid was gently absorbed, a new E8 medium was added, and cells were fallen off by pipetting, the passage ratio could be determined according to the experiment, and the ratio was generally 1:6.

[19] 2. Design of GPDIL-knockout sgRNA

[20] (1) Downloading and saving of CDS sequence of GPDIL: using Snapgene software, a new DNA file was created, the CDS sequence of GPDIL was pasted into the New DNA File, named, and saved for use;

[21] (2) Downloading and saving of GPD/L gene sequence: NCBI website was opened, GPDIL was searched, the genomic sequence was downloaded, the genomic sequence of GPDIL was saved by SnapGene, and exons were labeled; the common exon of the GPD/L gene was EXON4,

[22] (3) Design of sgRNA: EXON4 was selected as the exon, and sgRNA 5'-3' (GGGAGCCAACATTGCCAATG, SEQ ID NO: 1) was designed on the Zhang Lab website.

[23] 3. Construction of GPDIL-knockout plasmid

[24] (1) Linearization of CRISPR/Cas9 plasmid

[25] (The plasmid was pSpCas9(BB)-2A-GFP (PX458) purchased from Addgene)

[26] 1 pug Plasmid

[27] lul FastDigest BbsI (Fermentas)

[28] lul FastAP (Fermentas)

[29] 2uL 10x FastDigest Buffer

[30] ddH:0 to 20 ul.

[31] The digested product was purified by agarose gel, and the linearized plasmid was extracted by gel extraction kit.

[32] (2) sgRNA was double-stranded (sgRNA was synthesized by Nuozai Union (Beijing) Biomedical Technology Co., Ltd, CACC was added to the 5-end of the sgRNA-F, and AAAC was added to the 5-end of the sgRNA-R), and the whole reaction system was placed in a 95°C water bath; after the water bath was powered off and cooled down naturally, the reaction system was cryopreserved at -20°C for use.

[33] 1pL sgRNA-F (100 uM)

[34] IuL sgRNA-R (100 pM)

[35] 1 puL 10x T4 Ligation Buffer (NEB)

[36] 6.5uL ddH20

[37] 0.5uL T4PNK (NEB) |38] Total 10 pL.

[39] (3) The linearized plasmid was ligated to the double-stranded sgRNA. The reaction system was as follows:

[40] 50 ng Bhs digested plasmid from step 1

[41] 1 pL phosphorylated and annealed oligo duplex from step 2 (1:200 dilution)

[42] 1uL T4 DNA Ligase (NEB)

[43] luL T4 DNA Ligase Buffer (NEB)

[44] ddH:O to 10 pL.

[45] The reaction system was incubated at room temperature for 30 min.

[46] (4) The product in step 3 was transformed into Escherichia coli competent cells to complete the transformation of recombinant plasmid into FE. coli. The recombinant plasmid was extracted by using EndoFree Mini Plasmid Kit IT (DP118, TIANGEN).

[47] (5) The sgRNA sequence of the recombinant plasmid was identified, where the sequencing primer F was: GACTATCATATGCTTACCGT (SEQ ID NO: 4). The sequencing was done by SinoGenoMax Company Limited.

[48] 4. Electroporation of GPD/L-knockout plasmid into human embryonic stem cells

[49] (1) In a biosafety cabinet, 100 uL of electro-transfection buffer (CELLAPY: Ca3012040) and 2.5 ug of plasmid were added to a 1.5 mL EP tube, and mixed well for use;

[50] (2) Embryonic stem cells were removed from an incubator, digested into a cell suspension, transferred to a 15 mL centrifuge tube, and centrifuged at 1,000 rpm for 3 min; the supernatant was discarded, and the rest of supernatant was pipetted thoroughly with a yellow pipette tip and a white pipette tip, respectively;

[51] (3) The electro-transfection buffer was added to the cell suspension and mixed well in an electroporation cuvette, the program was set and then electroporation was conducted;

[52] (4) After electroporation, the cell suspension was transferred to a prefabricated culture plate, and cultured in the incubator; in general, resistant drug screening could be conducted three days after electroporation;

[53] (5) After drug screening with 0.3 pg/mL Puro for around one week, significantly transparent small positive clones could be found under light microscope; 5 alternatively, drug concentrations could be increased gradually to 0.3, 0.5, 1.0, and 2.0 ug/mL to purify the cells; in general, the drug screening lasted for 7-10 days, and the positive clones could be purified with 0.8 pg/mL Puro.

[54] 5. Sequencing and identification of positive clone PCR product

[55] (1) PCR primer design: When the CRISPR gene knockout system edits genes, InDel usually occurs near the PAM region. Therefore, the designed PCR primers have to include the DNA sequence that produces InDels. Thus, PCR primer design must conform to the above rules. Meanwhile, in order to make the sequencing result reliable and stable, in general, the upstream primer should be located 60 bp beyond the upstream of the PAM region, the upstream primer must be designed in the upstream intron sequence of this exon, and the downstream primer should be located 60 bp beyond the downstream of the PAM region. Primers of the DNA sequence near the PAM region were designed according to the design principle. GPDIL primers (5'-3') were as follows: F: GGGAGCCAACATTGCCAATG, SEQ ID NO: 2; R: CATTGGCAATGTTGGCTCCC, SEQ ID NO: 3.

[56] (2) DNA extraction of target clone: 50 pL of clone cell suspension was transferred into a PCR tube, and the program of the PCR system was set: at 95°C for 10 min, holding at 25°C; 2 pL of Proteinase K was added into a PCR tube, the PCR tube was placed in the PCR system again, and the program of the PCR system was set: at 58°C for 30 min; at 95°C for 10 min; holding at 4°C. After extraction, the DNA was cryopreserved at -20°C for use.

[57] (3) Tm values of the PCR primers: After the primer design was completed, the optimal Tm values of the PCR primers should be determined. A 20 uL PCR system was formulated in an 8-strip PCR tube, including: 10 pL of 2x Taq Master Mix, 1 pL of F, 1 uL of R, 1 pL of target clone DNA, and 7 pL of ddH20; the PCR program was as follows: 95°C for 3 min; 38 cycles of 95°C for 30 s, 50-65°C for 30 s, and 72°C for 30 s; 72°C for 5 min; holding at 4°C. After the PCR product was electrophoresed, a brightest single band was selected, and its corresponding Tm value was the optimal Tm value.

[58] (4) Sequencing of the target clone: The PCR system was: 25 uL of 2x Taq Master Mix, 2 uL of F, 2 pL of R, 2 uL of DNA, and 19 uL of ddH:0; a PCR program was set: 95°C for 3 min; 38 cycles of 95°C for 30 s, Tm for 30 s, and 72°C for 30 s; 72°C for 5 min; holding at 4°C. The PCR product was sequenced and analyzed.

[59] (5) Analysis of sequencing result: Using SnapGene software, the sequencing result was compared with GPDIL CCDS and scored in combination with https://ice.synthego.com/#/; when 3n+1/-1 or 3n+2/-2 occurred, such a clone would be selected. The result of DNA sequencing indicated that one A was inserted before base 2 prior to the PAM region, combined with Western blot of GPDIL, it was determined that the GPDIL-deleted human embryonic stem cell line was established successfully.

[60] Example 2

[61] A method for identifying the deletion of GPDIL protein in the GPD1L-deleted human embryonic stem cell line was provided. The specific method was described as follows:

[62] 1. Differentiation of GPDIL-deleted human embryonic stem cell into cardiomyocyte

[63] (1) To each well of a 6-well plate, 4 mL of cardiac differentiation medium 1 was added to GPD1L-deleted human embryonic stem cells; after culture for 48 h, 4 mL of cardiac differentiation medium 2 was added; after culture for 48 h, 4 mL of cardiac differentiation medium 3 was added; thereafter, the cardiac differentiation medium 3 was changed every 2 days.

[64] (2) The day of adding the cardiac differentiation medium 1 was regarded as Day 1. In general, on Days 8-10 of cardiac differentiation, beating cardiomyocyte clusters were observed under microscope, and the GPD1L-deleted human embryonic stem cells could be differentiated into cardiomyocytes.

[65] 2. Total protein extraction from cardiomyocytes derived from GPDIL-deleted human embryonic stem cells

[66] (1) Preparation of cell lysis buffer: 970 uL of M-PER Mammalian Protein Extraction Reagent, 10 uL of proteinase inhibitor (100x), 10 uL of phosphatase inhibitors (100%), and 10 pL of EDTA (100x) were mixed well in an EP tube under shaking, precooled and stored at 4°C; cardiomyocytes were added to each well of a 6-well plate, and 30-50 uL of cell lysis buffer was needed to add.

[67] (2) Cell preparation: The cells were rinsed with PBS precooled at 4°C thrice,

and cell lysis buffer precooled at 4°C was added, all cells were scraped off the plate, and the cell suspension was transferred to an EP tube. Using an ultrasonic cell disruptor, the cells were disrupted on ice to obtain cell pellets invisible to the naked eye, which were stored at -80°C in the short run.

[68] 3. Protein denaturation

[69] (1) According to the volume of total protein, the protein loading buffer was mixed well with total protein of cells for later use in a ratio described in instructions.

[70] (2) In a metal bath, the protein denaturation temperature could be at 60°C, 65°C, or 100°C, and the denaturation time was 5 min in general. The protein could be stored at -20°C in the long run after dispensing at 20 uL/tube.

[71] 4 Western blot of cardiomyocytes derived from GPDIL-deleted human embryonic stem cells

[72] (1) Resolving gel preparation: The resolving gel concentration was 8%, 2.7 mL of 30% Act/Bis, 2.5 mL of 4xresolving gel buffer, 4.7 mL of ddH20, 100 pL of 10 % APS, and TEMED were added successively, mixed well, and poured; after being allowed to stand for around 20-30 min, pouring of stacking gel could be ready.

[73] (2) Stacking gel preparation: The stacking gel concentration was 4%; 0.65 mL of 30% Acr/Bis, 1.25 mL of 4x stacking gel buffer, 3.05 mL of ddH20, 50 uL of 10 % APS, and 5 pL of TEMED were added successively, mixed well, and poured; a comb was inserted, and 75% alcohol was added for defoaming; after being allowed to stand for 20-30 min at room temperature, the stacking gel was cured.

[74] (3) Running buffer preparation: 10x running buffer was diluted to 1+ with ddH:0.

[75] (4) Loading of protein samples of cardiomyocytes derived from GPDIL-deleted human embryonic stem cells: Protein marker and samples were added to the loading wells successively, where 3-5 uL of the marker was usually added, 10-20 pL of the sample was usually added to each well, and the consistency of the volume of the sample well was guaranteed as far as possible.

[76] (5) Electrophoresis: A constant voltage mode was adopted; the voltage of the stacking gel was 50-80 V, and the voltage of the resolving gel was 80-120 V; the spread of the target protein was determined according to the protein marker, and the electrophoresis was stopped.

[77] (6) Transfer buffer preparation: According to the requirements of the instructions, 100 mL of 10+ WB transfer buffer, 200 mL of absolute methanol, and 700 mL of ddH20 were formulated into 1 L of electro-transfection buffer.

[78] (7) Transfer: A PVDF membrane and six pieces of filter paper (usually 9 x 6 cm in size) with an approximate size were cut according to the size of the gel. The PVDF membrane was soaked in absolute methanol for 10 s and balanced in the transfer buffer for 5 min. The transfer was conducted in a sandwich manner; a constant current mode was 300-400 mA; the transfer time was 120 min.

[79] (8) Blocking: The PVDF membrane was rinsed with TBST for 1-2 min; 5% skim milk was formulated with 1x TBST solution, followed by blocking on a shaker at room temperature for 1 h.

[80] (9) Primary antibody incubation of GPDIL protein: The PVDF membrane was rinsed with TBST thrice (5 min each time), followed by incubation on the shaker at 4°C overnight.

[81] (10) Secondary antibody incubation: The PVDF membrane was rinsed with TBST thrice (5 min each time), followed by incubation with Goat anti-Mouse IgG (H +L) IRDye 800CW secondary antibody for 1 h under shaking.

[82] (11) The PVDF membrane was rinsed with TBST thrice (5 min each time).

[83] (12) Detection of GPDIL protein: LI-COR-Odyssey Infrared Fluorescence Imaging System was used for imaging analysis to determine the deletion of GPDIL protein.

[84] The results are shown in FIG. 1. The expression of the GPDIL protein was not detected in cardiomyocytes derived from the GPDIL-deleted human embryonic stem cells constructed by the present application, whereas the cardiomyocytes derived from wild-type human embryonic stem cells could express the GPDIL protein normally. This indicated that the GPDIL-deleted human embryonic stem cells were constructed successfully.

[85] Example 3

[86] A karyotyping test for GPDIL-deleted human embryonic stem cells was described. The specific method was described as follows:

[87] (1) The GPDIL-deleted human embryonic stem cells were passed in a 6-well plate and karyotyped when the confluence reached around 50%.

[88] (2) E8 medium supplemented with 100 ng/ml Colcemid (Gibco #15210040) was changed for 2 h.

[89] (3) The cells were rinsed with PBS once and digested with 0.05 mM EDTA for min; the cell suspension was centrifuged at 1,000 rpm for 3 min, and cell pellets were reserved.

[90] (4) The cell pellets were mixed well with 3 mL of 37°C 0.075 mol/L potassium 5 chloride, and treated hypotonically at 37°C for 20 min.

[91] (5) The cell suspension was prefixed with 1 mL of newly prepared stationary liquid (methanol: glacial acetic acid = 3:1, in a volume ratio), mixed well, and centrifuged at 1,000 rpm for 3 min, and the supernatant was discarded.

[92] (6) 3 mL of the stationary liquid in step 5 was added, gently mixed well, allowed to stand at room temperature, and fixed for 20 min.

[93] (7) After centrifugation at 1,000 rpm for 3 min, the supernatant was discarded, and the cell pellets were fixed again.

[94] (8) The supernatant was discarded, drops of fresh stationary liquid was added and mixed well gently; the suspension was ground-glass-like.

[95] (9) One or two drops of the suspension were dropped onto a clean slide with ice water or dry one. The suspension was dropped from a height, and the droplets were dispersed as far as possible; the slide was passed over the fire in dry air; the slide was baked at 70°C for 2 h for aging.

[96] (10) 3 mL of 0.25% trypsin solution was added into 45 mL of 0.9% normal saline; the solution was adjusted to pH 6.8-7.2 and preheated at 37°C.

[97] (11) Trypsin digestion: The slide to be digested was digested in the trypsin solution for 2-3 min.

[98] (12) The slide was rinsed with 0.9% normal saline, and trypsin digestion was stopped.

[99] (13) The slide was stained with Giemsa staining solution for 10-15 min, and the back of the slide was rinsed with tap water and dried. The karyotype was observed and analyzed under light microscope and photographed.

[100] The chromosome karyotype of the GPD1L-deleted human embryonic stem cell was 46, XX, without deletion and deformity (FIG. 2).

[101] According to the results of the above examples, in the GPD1L-deleted human embryonic stem cell line constructed by the present disclosure, GPDIL 1s deleted, karyotype is normal, pluripotency markers of stem cells are normal, the stability of serial passage 1s excellent, triploblastic teratoma can be formed in animals, and there is no mycoplasma contamination.

GPD1L-deleted human embryonic stem cell line H9 can be used to investigate an effect of GPDIL deletion on differentiated cardiomyocyte function and screen a therapeutic medicament.

Sequence Listing <110> Qiqthar Medical University <120> GPDIL-DELETED HUMAN EMBRYONIC STEM CELL LINE AND

CONSTRUCTION METHOD AND USE THEREOF <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 gggagccaac attgccaatg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 gggagccaac attgccaatg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 cattggcaat gttggctccc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 gactatcata tgcttaccgt 20

SEQLTXT

SEQUENCE LISTING <110> Qiqgihar Medical University <120> GPD1L-DELETED HUMAN EMBRYONIC STEM CELL LINE AND CONSTRUCTION

METHOD AND USE THEREOF <130> HKJIP202108635 <160> 4 <170> PatentIn version 3.5 <21e> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sgRNA <400> 1 gggagccaac attgccaatg 20 <2105 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPD1L primers: F <400> 2 gggagccaac attgccaatg 20 <2105 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPD1L primers: R <400> 3 cattggcaat gttggctccc 20 <2105 4 <211> 20 <212> DNA Pagina 1

SEQLTXT

<213> Artificial Sequence

<220>

<223> sequencing primer F

<400> 4 gactatcata tgcttaccgt 20 Pagina 2

Claims

213 - Conclusions

A GPDIL-deleted human embryonic stem cell line in which a GPDIL gene has been knocked out by CRISPR/Cas9 technology based on a human embryonic stem cell.

The GPDIL-deleted human embryonic stem cell line according to claim 1, wherein silencing of the GPD/L gene comprises insertion mutation in exon 4 of GPD/L diallele.

The GPD IL-deleted human embryonic stem cell line according to claim 1 or 2, wherein the human embryonic stem cell comprises human embryonic stem cell line H9.

A method of construction of the GPDIL-deleted human embryonic stem cell line according to any one of claims 1 to 3, comprising the following steps: step 1, designing sgRNA of target (GPD/L gene, cloning the gene into a CRISPR/ Cas9 plasmid, and constructing a target GPDIL gene silencing plasmid, and step 2, transforming the target GPD/L gene silencing plasmid into a human embryonic stem cell, and screening to obtain the GPDIL-deleted human embryonic stem cell line .

The construction method according to claim 4, wherein the sgRNA in step | has a nucleotide sequence shown in SEQ ID NO:1.

The construction method of claim 4, wherein the screening is followed by verification; and wherein the verification comprises DNA sequencing and western blot.

Use of the GPDIL-deleted human embryonic stem cell line according to any one of claims 1-3 or a GPDIL-deleted human embryonic stem cell line obtained by the construction method according to any one of claims

- 14 - 4 — 6 in investigating an effect of GPDIL deletion on differentiated cardiomyocyte function.

Use of the GPDIL-deleted human embryonic stem cell line according to any one of claims 1-3 or a GPDIL-deleted human embryonic stem cell line obtained by the construction method according to any one of claims 4-6 in the screening of a drug for the treatment of a disease caused by GPD1L mutation.

Use according to claim 8, wherein the disease is a heart disease caused by GPD IL mutation.