NL2029020B1

NL2029020B1 - NOVEL HIGH-OLEIC ACID ALLELIC MUTATION OF BRASSICA NAPUS BnFAD2 GENE AND DEVELOPMENT AND USE OF SNP LABELING PRIMER THEREOF

Info

Publication number: NL2029020B1
Application number: NL2029020A
Authority: NL
Inventors: Zhang Yaofeng; Lin Baogang; Fu Ying; Yu Huasheng; Zhang Dongqing
Original assignee: Zhejiang Acad Agricultural Sci
Priority date: 2021-08-23
Filing date: 2021-08-23
Publication date: 2022-04-06
Also published as: NL2029020A

Abstract

The present disclosure relates to a novel high-oleic acid allelic mutation of a Brassica napas BnFADZ gene and relates to SNP molecular marker development and a molecular marker assisted 5 breeding technology of a novel high-oleic acid allelic variation. The present disclosure discloses two pairs of novel high-oleic acid allelic mutations (BnAfadZa and BanadZa) of the BnFADZ gene in Brassica napas. The gene has nucleotide sequences shown as SEQ ID N021 and ID NO:2. The present disclosure further provides two pairs of speciﬁc KASP molecular markers KASP-421 and KASP-1073 which can rapidly screen novel high-oleic acid allelic mutation sites, and the 10 markers are used for gene identiﬁcation of a single plant and screening of a high-oleic acid strain. The provided two pairs of KASP molecular markers by the present disclosure are both developed from a SNP variation of an exon region of the Brassica napus BnFAD2 gene and have higher speciﬁcity in screening results and more accurate and reliable detection results. The provided KASP molecular markers by the present disclosure only need two steps: PCR and ﬂuorescence 15 detection, have low cost and high throughput, and are particularly suitable for classiﬁed screening and identiﬁcation of high-oleic acid genotypes of offsprings of breeding populations. A combination of the two molecular markers can give offspring materials with the oleic acid content as high as 88% through screening.

Description

NOVEL HIGH-OLEIC ACID ALLELIC MUTATION OF BRASSICA NAPUS BnFAD2

GENE AND DEVELOPMENT AND USE OF SNP LABELING PRIMER THEREOF TECHNICAL FIELD

[01] The present disclosure relates to a novel high-oleic acid allelic mutation of a Brassica napus BnFAD2 gene and relates to an SNP molecular marker development and molecular marker assisted breeding technology of a novel high-oleic acid allelic variation.

BACKGROUND ART

[02] Rape (Brassica napus) is the fifth largest crop after rice, wheat, corn and soybeans in China, and it is also one of the most important oil crops in the world. Fatty acid compositions in rapeseed oil have a decisive effect on its edible quality, nutritional value, storage and processing quality, use and final market value. Fatty acids in the rapeseed oil mainly comprise palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), eicosenoic acid (C20:1) and erucic acid (C22:1), etc. The oleic acid is an important ingredient of the fatty acids of Brassica napus and belongs to monounsaturated fatty acid. The improvement of the oleic acid content has great significance for further improving the quality of the rapeseed oil: (1) remarkably reduce low density lipoprotein cholesterol in blood plasma and prevent cardiovascular diseases such as arteriosclerosis in human body; (2) dramatically improve insulin sensitivity on the premise of not influencing insulin secretion, thereby having positive effect on treating diabetes; (3) meet requirements of food processing industries in frying, cake making and the like, and ensure that the rapeseed oil has longer shelf life due to the fact that the oleic acid has low unsaturation degree, is insensitive to oxidation during processing, storage and transportation and frying and has good thermal stability; and (4) more beneficial to producing biodiesel due to a high methyl esterification degree and high combustion value, and in addition, the oleic acid can also be used for preparing various chemical products, and living goods and daily cosmetics such as lipsticks, soaps, lip creams, sun creams and the like.

[03] Molecular markers are a powerful tool for crop breeding due to accuracy, rapidness and high efficiency, and the technology is substantively utilized in crops due to advantages of early selection, immunity from environmental influence, accuracy, rapidness and high efficiency. There are many types of molecular markers. At present, the markers that have been substantively used in crops include early restriction fragment length polymorphism (RFLP), random amplified polymorphism DNA (RAPD) and amplified fragment length polymorphism (AFLP), and are developed to the most widely used simple sequence repeat (SSR) and cleaved amplified polymorphic sequence (CAPS). However, these methods have limitations of low throughput or high cost. Kompetitive allele specific PCR (KASP) is a technology proposed by LGC (Laboratory of the Government Chemist, UK) for accurate biallelic determination of SNPs in genome and InDels at specific sites. KASP molecular markers have advantages of high stability, accuracy and efficiency, low cost, rapidity and the like. Especially when a sample size is large and SNP sites are few, the application characteristics of the KASP become the most significant.

[04] In recent years, certain progress has been made in the screening and molecular positioning of Brassica napus strains with high oleic acid content in seeds. Guan Chunyun et al. used 8-10 Roentgen $0Co radiation for radiation breeding and continuous screening of offsprings to obtain several high-oleic acid materials with the oleic acid content of 70% or more (Guan Chunyun, et al., Acta Agronomica Sinica, 2006, 32 (11): 1625-1629). Pu Huiming et al. used low-dose *°Co-y rays to treat germinating seeds of Brassica napus to obtain a new high-oleic acid germplasm with the oleic acid content of more than 80% (Chinese patent application number 201010513722.9). Zhou Yongming et al. obtained selected lines and varieties of high oleic Brassica napus with oleic acid content of higher than 78% through polymerization hybridization and microspore cultivation (Chinese patent application number 200910273435.2). Nevertheless, actual use of high-oleic acid germplasm in production is not extensive enough, mainly because a genetic mechanism of a high- oleic acid trait of Brassica napus is more complicated and genetic markers (such as molecular markers, nucleic acid mutation sites, etc.) are rarely reported. Although previous studies have found that improvement of the oleic acid content of Brassica napus is mainly caused by genetic mutations in the major gene of fatty acid desaturase 2 (F4D2) and linked molecular markers are developed. For example, Yang et al. found that there was a copy of mutation in BaFAD2, originated from a 4-bp insertion mutation (Theor Appl Genet. 2012; 125(4):715-29), the high-oleic acid mutation material was used to develop a specific high-oleic acid co-dominant SCAR molecular marker of Brassica napus (Chinese patent number CN 101824472 B), a pair of linked SSR markers (Chinese patent publication number CN 110305980 A) and a pair of KASP markers (Chinese patent publication number CN 110326532 A). Guan Chunyun et al. found that a high- oleic acid mutant resulted from a conversion of base G at position 270 of one copy of BnFAD2 gene to base A, which resulted in a conversion of a codon from TGG to TGA (a stop codon). In addition, base mutations at 1044 and 1062 also led to production of stop codons (Guan Chunyun, etal, Acta Agronomica Sinica, 2006, 32(11): 1625-1629). Long Weihua et al. found that there were mutations of two gene copies of BnFAD2 in a high-oleic acid mutant. One copy of BnaA.FAD2a had a G-to-A substitution at position 316 of a nucleotide sequence, the other copy of BnaC.FAD2a had a G-to-A substitution at position 908 of the nucleotide sequence (Chinese patent publication number CN 106282206 A), and two pairs of CAPS markers were developed for mutations of these two copies (Chinese patent publication number CN 107828908 A). In the

Chinese patent, there are several examples of molecular markers that can be used to detect mutation sites of the BnFAD2 gene in Brassica napus. Unfortunately, different high-oleic acid mutation materials have different phenotypes of the content of oleic acid. The oleic acid content of most high-oleic acid mutants is only 76-77%. More importantly, the copy numbers of BnFAD2 gene mutations for different materials are not the same. Molecular markers in which only one gene copy is mutated do not allow simultaneous detection of multiple-copy mutations in materials with multiple copies of mutations. The positions of the base mutations are different despite of the same gene site, which leads to lack of versatility of these site-specific molecular markers among different materials. Solving the above bottleneck problems mainly lies in full exploration of high- oleic acid multiple alleles of Brassica napus BnFAD2 and in development of specific molecular markers. In addition, the molecular markers disclosed in the above reports almost all relate to types of markers such as SCAR, SSR, and CAPS. These types of markers have limitations such as low throughput, high cost and complicated processes. KASP molecular markers have advantages such as high stability, accuracy and efficiency, low cost, and rapidity, especially when a sample size is large and SNP sites are few, the application of the KASP exhibits the most significant characteristics and can make up shortages of those types of markers.

SUMMARY

[05] The present disclosure aims to overcome defects in the existing patents or technologies and provides new nucleotide mutation sites of a high-oleic acid phenotype produced by BnFA4D?2 capable of controlling an oleic acid content of a Brassica napus seed and the new nucleotide mutation sites take BnFAD2a of chromosome A05 and BnCFAD2a of chromosome C05 as target genes. Through separation and identification of the BnAFAD2a and BnCFAD2a, two novel alleles capable of indicating an ultrahigh-oleic acid character (the oleic acid content is higher than 85%) in Brassica napus are provided and high-efficiency and practical KASP molecular markers are developed based on SNP variation in a gene coding region. The KASP molecular markers can record and analyze the fluorescent signal generated in a PCR process through a computer and realize monitoring of mutation sites, and have high consistency with phenotypes in detection results; and electrophoresis is not needed in the detection process, such that aerosol pollution of a PCR product, environmental pollution caused by EB and harms on human body are thoroughly avoided. The present disclosure firstly proposes a high-oleic acid allelic mutation of a novel Brassica napus BnFAD2 gene, develops high-efficiency and practical KASP molecular markers based on a SNP mutation in a gene coding region, realizing rapid and accurate detection of novel nucleotide mutation sites, and providing an accurate, rapid and effective detection method for breeding of high-oleic acid variety of Brassica napus.

[06] To achieve the first objective of the present disclosure, the present disclosure uses the following technical solutions.

[07] Nucleotide mutation sites of a high-oleic acid phenotype produced by a BnHAD2 for controlling an oleic acid content of a Brassica napus comprise one or two of the following:

[08] 1. A C-to-T substitution existed at position 421 of the nucleotide sequence of the BnAFAD2a located on chromosome A05 of Brassica napus, namely, C421T, and the mutant gene is named BrAfad2a and has the nucleotide sequence of SEQ ID NO: 1; and

[09] 2. A G-to-A substitution existed at position 1073 of the nucleotide sequence of the BnAFAD2a located on chromosome C05 of Brassica napus, namely, G1073A, and the mutant gene is named BnCfad2a and has the nucleotide sequence of SEQ ID NO:2.

[10] Further, the present disclosure also discloses proteins encoded by the nucleotide mutation sites BnAfad2a and BnCfad2a, and the proteins have the amino acid sequence of SEQ ID NO:3 and ID NO:4, respectively.

[11] Further, the present disclosure also discloses KASP molecular markers for the nucleotide mutation sites BnAfad2a and BnCfad2a, where the molecular markers are KASP-421 and KASP- 1073, respectively. The molecular marker KASP-421 has the nucleotide sequence of SEQ ID NO.5:

[12] 5 gtgeggecaccacgecttcagegactaccagtggetggacgacaccegteggecteatettecactecticctectegtecettactictectgg aagtacagt[c/t]atcgacgccaccattccaacactggctccctcgagagagacgaagtgtttgtccccaagaagaagtcagacatcaagt ggtacggcaagtacctcaacaaccctttg-3' and the base at position 104 from the 5'-end of the nucleic acid sequence is a SNP site.

[13] The molecular marker KASP-1073 has the nucleotide sequence of SEQ ID NO.6:

[14] 5- tetgttetccacgatgccgcattatcacgcgatggaagctaccaaggcgataaagccgatactgggagagtattatcagttcgatgggacgc cggtggttaaggcgatgtggalg/a]|ggaggcgaaggagtgtatctatgtggaaccggacaggcaaggtgagaagaaaggtegtgttctgg tacaacaataagttatga-3' and the base at position 114 from the 5'-end of the nucleic acid sequence is a SNP site.

[15] Further, the present disclosure also discloses use of the KASP molecular markers in determining presence of nucleotide mutation sites Brdfad2a and BnCfad2a in a biological sample.

[16] Further, the present disclosure also discloses PCR specific amplification primers for the KASP molecular markers. In the present invention 100-bp flanking sequences on both sides with an SNP site as a center are extracted, and multiple primers are designed. Through multiple polymorphism screenings and verification by multiple tests in multiple segregated populations, markers KASP-421 and KASP-1073 have the best amplification effect and can clearly distinguish a wild type and a high-oleic acid mutant type in SNP variations of Bn4FAD2a and BnCFAD2a.

[17] The primers for molecular marker KASP-421 include:

[18] 1) two specific primers:

[19] Primer AlleleFAM: 5'-gttggaatggtggcgtcgatg-3', as shown in SEQ ID NO.7;

[20] Primer AlleleHEX: S'-gtgttggaatggtggcgtcgata-3', as shown in SEQ ID NO.8; and 5 [BĲ 2) one common primer:

[22] Primer Common: 5'-ggacgacaccgtcggectca-3', as shown in SEQ ID NO.9;

[23] The primers for molecular marker KASP-1073 include:

[24] 1) two specific primers:

[25] Primer AlleleFAM: S'-ggtggitaaggcgatgtggag-3', as shown in SEQ ID NO. 10;

[26] Primer AlleleHEX: 5'-cggtggttaaggcgatgtggaa-3', as shown in SEQ ID NO. 11; and

[27] 2) one common primer:

[28] Primer Common: 5'-ccggttccacatagatacactcctt-3', as shown in SEQ ID NO. 12.

[29] Both pairs of the KASP markers contain three primers and separately include two specific primers designed for base differences at key sites, and one common primer. The 3’-ends of the i5 two specific primers were allelic variant bases and the 5’-ends were connected to specific FAM and HEX fluorescent adapter sequences of KASP reaction reagents of LGC (Laboratory of the Government Chemist, UK).

[30] Further, the present disclosure also discloses a kit for determining the presence of nucleotide mutation sites BnAfad2a and BnCfad2a in a biological sample and the kit may at least include the PCR specific amplification primers.

[31] Further, the present disclosure also discloses a method for determining the production of a high-oleic acid phenotype in a target biological sample and the method may include the following steps:

[32] 1) conducting PCR amplification on genomic DNA of the biological sample by using the PCR specific amplification primers;

[33] 2) determining a genotype of a target SNP by using a primer set of molecular marker KASP-421: if only base T is detected at position +421, BnAFAD2a of a Brassica napus sample is determined to be a high-oleic acid allele and the genotype is defined as AA; if only base C is detected, the locus is determined to be a middle and low oleic acid allele and the genotype is defined as aa; and if both T and C are detected at the detection locus, the locus is determined to be a heterozygote and the genotype is defined as Aa; and

[34] determining a genotype of a target SNP by using the primer set of molecular marker KASP-1073: if only base A is detected at position +1073, BnCFAD2a of a Brassica napus sample 1s determined to be a high-oleic acid allele and the genotype is defined as BB; if only base G is detected, the locus is determined to be a middle and low oleic acid allele and the genotype is defined as bb; and if both A and G are detected at the detection locus, the locus is determined to be a heterozygote and the genotype is defined as Bb; and

[35] 3) combining results of KASP-421 and KASP-1073, if the genotype of the sample is detected to contain both two high-oleic acid alleles and the genotype is AABB, the sample to be detected is an ultrahigh-oleic acid single plant or strain.

[36] Preferably, the amplification system may be 2.5 ul of a brassica napus sample DNA template (20 ng/pl), 2.5 ul of 2 x KASP Master mix and 0.07 ul of KASP Assay Mix (a molar concentration ratio of F-HEX:F-FAM:R=2:2:5).

[37] PCR reaction conditions may be as follows: 94°C for 15 min; 94°C for 20 sec, 61-55°C for 1 min, and reducing an annealing temperature by 0.6°C in each cycle for a total of 10 cycles; 94°C for 20 sec and 55°C for 1 min, a total of 26 cycles; if an amplification effect is not ideal, adding 3 cycles and at most three times on the basis of the 26-cycle episode of PCR reaction. After reaction is completed, reading fluorescence data of a KASP reaction product by using a scanner Pherastar which will automatically converts a fluorescence scanning result into a graph; detecting a fluorescence signal and checking the genotyping condition by using a BMG PHERAstar instrument. If the typing is insufficient, continuing amplification and checking the genotyping condition every 3 cycles until the typing is complete.

[38] Further, the present disclosure also discloses a method for breeding a plant with high oleic acid content in seeds, the nucleotide mutation sites BnAfad2a and/or BnCfad2a are introduced into aplant, and the method is used to detect a target biological sample. Preferably, the target biological sample may be the plant, or cells, plant tissues or organs, seeds, or offsprings thereof.

[39] Most preferably, results of KASP-421 and KASP-1073 are combined, a high-oleic acid material with the oleic acid content larger than 85% and the genotype AABB is selected as a male parent, a stable line with excellent comprehensive agronomic traits is selected as a female parent, crossing, back-crossing and selfing are conducted, assisted selections of KASP-421 and KASP- 1073 markers are combined, and the two pairs of the novel BnA4fad2a and BnCfad2a multiple alleles are simultaneously introduced into the female parent material with excellent comprehensive agronomic traits. In the assisted selection breeding for offsprings, if the genotype of the sample is detected to contain two high-oleic acid alleles and the genotype is AABB, then the sample to be detected is an ultrahigh-oleic acid single plant or line, and the subsequent self-crossed offsprings also show persistently stable high oleic acid; if the genotype of the sample is detected to be aabb, then there is no probability that high-oleic acid strains will be segregated from the self-crossed offsprings; and if there are some strains with excellent comprehensive agronomic traits, the oleic acid content is at an above-the-average level (75%-80%), the phenotype of two pairs of the molecular markers is identified to be heterozygous, including AaBB, Aabb, AaBb, AABb, aaBb,

then in the self-crossed offsprings of these strains, a screening population can be scaled up according to a segregation ratio, and a good line with excellent comprehensive agronomic traits and the oleic acid content of more than 85% (AABB) can be selected.

[40] Compared with the prior art, the present disclosure has the following beneficial effects.

[41] (1) The mutation sites of the present disclosure are novel high-oleic acid sites compared with the previously reported mutation sites. (2) The oleic acid content indicated by the mutation sites is higher and can reach 88.57% at most when two sites exist at the same time, which exceeds the oleic acid content corresponding to other sites or molecular markers disclosed in the past. (3) Most of the molecular markers developed at the early stage based on a BnFAD2 gene belong to molecular markers linked to target genes and wrong identification caused by genetic exchange exists, while the KASP molecular markers provided by the present disclosure are functional markers designed and developed based on the mutation sites of coding regions of Brassica napus Bn4FAD2 and BnCFAD2 genes, they can directly reflect alleles, being free of wrong identification caused by genetic exchange. (4) the molecular markers provided by the present disclosure can directly and specifically distinguish and detect a C or T base of a SNP mutation site of the BnAFAD?2 gene and a G or A base of a SNP mutation site of the BnCFAD2 gene in Brassica napus. (5) The use method of the SNP molecular markers provided by the present disclosure is accurate, reliable and easy to operate, and superior to traditional SSR, CAPS, SCAR and other markers in identification and assisted selection breeding of a high-oleic acid genotype of Brassica napus in terms of detection throughput and detection accuracy. (6) The molecular markers provided by the present disclosure have low cost and high throughput in practical use. At present, methods for detecting SNP include sequencing, DNA chips, mass spectrometry, etc., and most of these methods are costly and slow. The provided molecular markers by the present disclosure only need two steps: PCR and fluorescence detection, have low cost and high throughput and specificity, and are particularly suitable for classified screening and identification of different resistance genotypes in breeding populations.

BRIEF DESCRIPTION OF THE DRAWINGS

[42] FIG. | shows the positioning result for quantitative trait locus (QTL) of oleic acid of an F: population of the present disclosure. Figure notes: FIG. 3 shows the scanning results of three natural production years from 2016 to 2017, 2017 to 2018, and 2018 to 2019 (brassica napus is a cross-year crop) represented by red, blue and black lines respectively, threshold value of LOD (limitation of detection) for QTL scanning is 2.5 (represented by a line). The x-coordinate represents different chromosomes of Brassica napus and the y-coordinate represents the LOD value The contribution rate of the target QTL and target gene information are marked at the top part of a QTL peak map.

[43] FIG. 2 is a comparison diagram indicating SNP variation sites of a high-oleic acid allele of a BnAFAD2 gene and a wild-type allele; and the number marked above the box is the base position of a mutant nucleotide in corresponding gene coding region and FC81 and E183 represent a high-oleic acid parent and a wild-type parent, respectively;

[44] FIG. 3 is a comparison diagram indicating SNP variation sites of a high-oleic acid allele of a BnCFAD2 gene and a wild-type allele; and the number marked above a box is a base position of a mutant nucleotide in corresponding gene coding region and FC81 and E183 represent a high- oleic acid parent and a wild-type parent, respectively;

[45] FIG. 4 is a scatter plot of the primer set for molecular marker KASP-431 of the present disclosure when the molecular marker KASP-431 is applied in typing of a BndFAD?2 allelic gene in an F segregation population (QFC81xJE183) containing 111 strains.

[46] FIG 5 is a scatter plot of the primer set for molecular marker KASP-1073 of the present i5 disclosure when molecular marker KASP-1073 is applied in typing of a BnCFAD? allelic gene in an F segregation population (2FC81x3E183) containing 111 strains;

[47] FIG 6 is a scatter plot of the primer set for molecular marker KASP-431 of the present disclosure when molecular marker KASP-431 is applied in typing of a BnA4FAD2 allelic gene in an F, segregation population (2FC90xZE121) containing 90 strains; and

[48] FIG 7 is a scatter plot of the primer set for molecular marker KASP-1073 of the present disclosure when molecular marker KASP-1073 is applied in typing of a BnCFAD2 allelic gene in an F segregation population (2FC90x$E121) containing 90 strains.

[49] Statement on biological deposit

[50] Brassica napus FC81 high oleic acid strain in this application was deposited, in China Center for Type Culture Collection (CCTCC) at Wuhan University on December 2, 2019 with an accession number of CCTCC NO: P201923.

DETAILED DESCRIPTION [S1] Example 1

[52] Search and acquirement of novel allelic mutations capable of indicating high-oleic acid trait of brassica napus based on two copies of Bn FAD2. [S3] (1) In our previous study, a high-oleic acid homozygous strain (FC81, deposit date: December 2, 2019; accession number: CCTCC NO: P201923) with the oleic acid content of 87.67% was used as a female parent, a medium-low oleic acid homozygous strain (E183, conventional existing strain) with the oleic acid content of 63.56% was used as a male parent, and an F»

segregation population was obtained by crossing. Genomic DNA was extracted from fresh and tender leaves of the F: segregation population and the parents. For detailed preparation method, reference can be made to the method reported by Li Jia et al. (Li Jia et al., An effective method for extracting total DNA from leaves of Brassica napus, Journal of Huazhong Agricultural University, 1994, 13(5): 521-523), in which mass of DNA was measured by 1% agarose gel electrophoresis, and the DNA concentration was determined by an ultraviolet spectrophotometer (model: Pharmacia Biotech, Gene Quantll).

[54] (2) Determination of the oleic acid content: after seeds were harvested per single plants, the fatty acid content was analyzed by using a gas chromatograph (HP6890, Germany).30-50 grains of full seeds were randomly selected from mixed samples of parent and offspring, the seeds were ground and poured into a 10-ml test tube, 1 ml of a mixture of ethyl ether and petroleum ether (at a volume ratio of 1:1) was added into the test tube, and an equal volume of methanol (containing 5% KOH) was added for esterification reaction, and an obtained mixture was allowed to stand still for 40 min or longer for complete reaction. Finally, distilled water was added to make up to 10 ml for extraction and an upper ether layer solution was sampled for determination. The fatty acid compositions were determined by gas chromatography and chromatographic conditions were as follows:

[55] Chromatograph: Hewlett Packard (HP6890, Germany), hydrogen flame ionization detector, manual injection, injection volume 0.4 ul (analysis injection volume for half grain was

0.8 pl) and split ratio was 1:45; the chromatographic column was HP-inowax19091N-133, 30mx0.25mmx0.25um capillary column; temperatures of detector and injection chamber are 250°C and 280°C respectively; carrier gas: N2, 30 ml/min, make-up gas 40 min/min; air flow rate: 300 ml/min; Hb flow rate: 30 min/min; furnace temperature: continual heating up, hold at 180°C for 2 min, then heat up to 220°C at 10°C/min and hold for 7 min. The fatty acid compositions were determined by comparing retention time of a peak position with that of a standard reference, and the content was expressed in area percentage. When the measured data were analyzed and processed, 7 main fatty acids were considered: palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), arachidonic acid (C20:1) and erucic acid (C22:1).

[56] (3) SNP chip analysis of genotypes of two parents and F2 segregation population and linkage analysis

[57] A 60K Brassica napus SNP chip developed by Illumina was used to type DNA samples from the two Brassica napus parents and F» segregation population. After polymorphic SNP sites were screened in the parents, their distribution in the F2 population was analyzed. According to the distribution in the F2 segregation population, data analysis was conducted. According to the law of linkage exchange, a genetic map of Brassica napus was constructed by using population genotype data. The used software was Joinmap3.0 and the minimum LOD value was set to 2.5 to obtain a linkage map. The oleic acid content data and SNP genotypes of 190 single plants in the F2 population were input into a computer, and WinQTLcart4.0 software was run to perform QTL mapping of the data. Target genes for controlling the oleic acid content were identified as BnAFAD2a on chromosome A05 and BnCFAD2a on chromosome C05 of Brassica napus (FIG. 1).

[58] (4) Amplification and analysis of parental genomic DNA by primer pair 19TA11

[59] The primer pair 19TA11 (see Table 1 for the primer pair sequences) was used to amplify the BnAFAD2a on chromosome A05 and BnCFAD2a on chromosome COS of Brassica napus of the two parents FC81 and E183, respectively.

[60] PCR system Genomic DNA Tul 10xBuffer 5uL dNTP Mixture (10 mM) 1 ul Primer F (10 uM) 1 ul Primer R (10 uM) I ul KOD (1 U/uL) I ul ddH20 up to 50uL

[61] PCR procedure 94°C 5 min 98°C 30 sec 56°C 30 sec | 32 cycles 68°C 3 min 68°C 5 min 25°C 1 min

[62] An amplified product was detected by 1.0% agarose gel electrophoresis in a horizontal electrophoresis tank, 1 x TAE buffer (0.04 M Tris-acetate, 0.001 MEDTA, pH 8.0) was used, the voltage of 8 V/cm was set and electrophoresis was conducted for 35 min. After the electrophoresis was completed, a gel imaging system (UVP) was used for photography and storage.

[63] Table 1 ‘Name of Primers Sequence (53) TI9TAII-F TCTCGAGCTTTCGCGAGCTCATGGGTGCAGGTGGAAGA

AT

19TA11-R AGGTCGACTCTAGAGGATCCTCATAACTTATTGTTGTA

CCAG

[64] (5) Recovery and cloning of Bn4FAD2a and BnCFAD2a in parents

[65] A DNA fragment amplified in the Brassica napus parents by the primer pair 19TA11 was obtained in the above recovery step. Operating procedures were followed according to a method provided in instructions of a Gen Clean column DNA gel recovery kit (purchased from Shanghai Generay Biotech Co., Ltd): an amplified DNA fragment was dug out from 1.0% agarose gel by using a blade and put into a 1.5-ml centrifuge tube, 300 ul of binding solution B was added per 100 mg of agarose gel, heating was conducted in a 55°C water bath for 10 min, and even mixing was conducted every other 2 min; the melt gel solution was transferred to a Gen Clean column inside a collection tube and placed at room temperature for 2 min and centrifugation was conducted at 3,000 rpm for 30 sec. Waste liquid in the collection tube was discarded, 500 pl of wash solution was added, centrifugation was conducted at 8,000 rpm for 30 sec at room temperature, and the step was repeated. Waste liquid in the collection tube was discarded, the Gen Clean column was put into the same collection tube, centrifugation was conducted at 10,000 rpm for 1 min, the Gen Clean column was put into a new 1.5-ml centrifuge tube, 30 ul of elution buffer was added to a membrane center in the column, allowed to stand at room temperature for 2 min Centrifugation was conducted at 10,000 rpm for | min, liquid in the centrifuge tube was the recovered DNA fragment, and the recovered DNA fragment can be used immediately or stored at -20°C for later use.

[66] The recovered target DNA fragment was ligated to a pMDT-18 vector (the vector was purchased from TaKaRa company, agented by Takara Biomedical Technology (Dalian) Co., Ltd.). The operating procedures were followed according to the method provided in the instructions of the kit: reagents were centrifuged for a short time before use and collected at a bottom part of a tube; ligation reaction was conducted in a 0.5-ml centrifuge tube, and a ligation reaction system was 2.0 ul of DNA, 0.5 ul of pMDT-18 vector and 2.5 ul of solution I. A pipette was used to mix evenly up and down several times and an obtained mixture was placed in a refrigerator at 4°C for overnight for ligation reaction. An LB liquid medium and an LB solid medium (containing 100 mg/ml of ampicillin, 24 mg/ml of isopropyl-thioB-D-galactoside and 20 mg/ml of 5-bromo-4- chloro-3-indole-a-D-galactoside) were prepared. Competent cells were taken from a -70°C refrigerator and placed on ice until they were slowly thawed (about 5 min); a ligation reaction solution was collected by centrifugation, 2 ul of the reaction solution was added into a sterilized

1.5-ml centrifuge tube (pre-cooled on ice). Bottom part of the tube containing the competent cells was gently flicked with fingers to mix evenly, 50 ul of the competent cells were taken to be added nto the 1.5-ml centrifuge tube containing 2 ul of the ligation reaction solution and gently flicked with fingers to mix evenly and placed on ice for 20 min. Heat shock was conducted in a 42°C water bath for 90 sec (do not shake) and placed on ice for 5 min. 500 ul of LB liquid medium was added and shake culture was conducted at 37°C for 1 h (150 rmp/min). 200 pl of transformed liquid was pipetted after the shake culture, spread on a sterile LB solid medium and placed at 37°C for 16-20 h. Blue-white screening was conducted, 24 positive clones were selected for numbering, and shake culture was conducted in a sterile liquid LB medium (containing 50 pg/ml of ampicillin) for 16-20 h; and 2 ul of bacterial liquid after the shake culture was used as a PCR template, M13 was used as primer (forward primer: 5'-CAGGGTTTTCCCAGTCACGA-3', reverse primer 5'- CGGATAACAATTTCACACAGGA-3") for amplification and PCR reaction was conducted as described in the above steps. An amplification result was detected on 1.0% agarose gel. If the obtained DNA fragment was larger than a target DNA fragment by about 200 bp, transformation was successful and 100 ul of each 8 successfully transformed bacterial liquid was drawn and sent to BGI Technology Inc. for sequence determination. 400 pl of 50% sterile glycerol was added to the remaining 400 ul of turbid bacterial liquid and the bacterial liquid was stored in a 2-ml sterile is centrifuge tube at -70°C and numbered.

[67] DNA fragments amplified in the Brassica napus parents by the primer pair 19TA11 in the present disclosure were each subjected to 15 repeated sequencing. Coding sequence lengths of the BnAFAD2a and BnCFAD2a genes amplified by the primer pair 19TA11 were both 1,155 bp. The two parents had a C-to-T substitution at position 421 of the nucleotide sequence of the Bnd FAD2a located on chromosome A05 of Brassica napus, namely, C421T and had a G to A at position 1073 of the nucleotide sequence of the BndFAD2a located on chromosome C05 of Brassica napus, namely, G1073A. By a sequence comparison with the BnFADZ2 gene reported in the previous study, it was found that the high-oleic acid multiple alleles of the Bndfad2a located on chromosome A05 of Brassica napus and BnCfad2a located on chromosome C05 of Brassica napus provided by the present disclosure were novel variants. The nucleotide sequences of the genes were as shown in SEQ ID NO:1 and ID NO:2 and the protein sequence was as SEQ ID NO:3 and ID NO:4.

[68] Example 2

[69] Development of a SNP marker capable of detecting a new type of high-oleic acid allelic mutations in BnFAD2 gene of Brassica napus.

[70] 100-bp flanking sequences on both sides with an SNP site of the above-mentioned gene coding region as a center were extracted and a sequence difference of Bn4FAD2a and BnCFAD2a obtained by cloning was combined to design primers to specifically amplify Bn4FAD2a and BnCFAD24 gene sequence fragments to exclude interference of a homologous gene sequence with the detection. Multiple primer sets were designed in the experiment and each primer set was composed of three primers. Through multiple polymorphism screenings and verification by multiple tests in multiple segregation populations, markers KASP-421 and KASP-1073 had the best amplification effect and could clearly distinguish a wild type and a high-oleic acid mutant type in SNP variations of the BnAFAD2a and BnCFAD2a. Both pairs of the KASP markers contain three primers, each KASP marker containing two specific primers designed for base differences at key sites and one common primer. The 3’-ends of the two specific primers of KASP-421 were allelic variant bases C/T and the 5’-ends were connected to FAM and HEX fluorescent adapter sequences specific to KASP reaction reagents of LGC (Laboratory of the Government Chemist, UK). The 3’-ends of the two specific primers of KASP-1073 were allelic variant bases G/A and the 5’-ends were connected to FAM and HEX fluorescent linker sequences specific to KASP reaction reagents of LGC (Laboratory of the Government Chemist, UK). All primers were synthesized by LGC Company in the UK. The primers of the KASP markers provided by the present disclosure were a combination of following specific primers.

[71] The primers for molecular marker KASP-421 include:

[72] two specific primers:

[73] Primer AlleleFAM: 5'-gttggaatggtggcgtcgatg-3",

[74] Primer AlleleHEX: 5'-gtgttggaatggtggcgtcgata-3'; and

[75] one common primer:

[76] Primer Common: S'-ggacgacaccgteggectca-3'.

[77] The primers for molecular marker KASP-1073 include:

[78] two specific primers:

[79] Primer AlleleFAM: 5'-ggtggttaaggcgatgtggag-3';

[80] Primer AlleleHEX: 5'-cggtggttaaggcgatgtggaa-3'; and

[81] one common primer:

[82] Primer Common: 5'-ccggttccacatagatacactectt-3'.

[83] Example 3

[84] Establishment of SNP marker system capable of detecting new type of high-oleic acid allelic mutations in BnFAD2 gene of Brassica napus and use of SNP marker system in assisted breeding of high-oil acid trait in Bassica napus.

[85] An F; population containing 111 Fz segregation strains (2FC81x3E183) and an F» population containing 90 F> segregation strains (YFC90xJE121, both FC90 and E121 were conventional strains) were selected, two sets of KASP primers KASP-421 and KASP-1073 as designed above were used and preliminary screening and verification of the segregation populations on a LGCSNP line genotyping platform were conducted. The detailed operation steps were as follows:

[86] (1) a conventional method (CTAB method) was used to extract leaf genomic DNA of a material to be detected; the mass of the extracted DNA was respectively detected by agarose electrophoresis and Nanodrop2 100, and the agarose electrophoresis showed that a DNA band was single, with A260/280 between 1.8-2.0 and A260/230 between 2.0-2.2, such DNA samples met quality requirements and the DNA was diluted to a concentration of 20 ng/uL for later use; and

[87] (2) the DNA extracted in step | was used as a template, SNP markers KASP-421 and KASP-1073 developed by Example 2 capable of detecting a new type of high-oleic acid allelic mutations in BnFAD2 gene of Brassica napus were used for amplified PCR to obtain an amplified product.

[88] Preparation of KASP marker primer reaction system:

[89] 2.5 ul of a Brassica napus sample DNA template (20 ng/ul), 2.5 ul of 2xKASP Master mix and 0.07 ul of KASP Assay Mix (a molar concentration ratio of F-HEX:F-FAM:R=2:2:5).

[90] The PCR reaction conditions were: 94°C for 15 min; 94°C for 20 sec, 61-55°C for 1 min, each cycle of annealing temperature reduced by 0.6°C, 10 cycles; and 94°C for 20 sec, 55°C for 1 min, 26 cycles. If an amplification effect was not satisfactory, 3 cycles can be added for each time and at most three times on the basis of the 26-cycle episode of PCR reaction. After the reaction was completed, fluorescence data of a KASP reaction product was read by using a scanner Pherastar and a fluorescence scanning result was automatically converted into a graph. A fluorescence signal was detected and a genotyping condition was checked by using a BMG PHERAstar instrument. If the genotyping was insufficient, amplification was continued and the genotyping condition was checked every 3 cycles until the typing was complete. If base T is detected at position +421 in a detection result of KASP-421, then BnA4FAD2a of a Brassica napus sample was determined to be a high-oleic acid allele and the genotype was defined as AA; if base C was detected, then the locus was determined to be a middle and low oleic acid allele and the genotype was defined as aa; and if both T and C were detected at the detection locus, then the locus was determined to be a heterozygote and the genotype was defined as Aa. A genotype of a target SNP was determined by using the primer set of molecular marker KASP-1073: if only base A was detected at position +1073, then BnCFAD2a of a Brassica napus sample was determined to be a high-oleic acid allele and the genotype was defined as BB; if only base G was detected, the locus was determined to be a middle and low oleic acid allele and the genotype was defined as bb; and if both A and G were detected at the detection locus, then the locus was determined to be a heterozygote and the genotype was defined as Bb.

[91] Table 2 Typing results of primarily screened segregation populations by KASP markers KASP-421 and KASP-1073

Serial No.

Name of Strain Origin of Population KASP-421 KASP-1073 Content of Oleic Acid (%) TU 63 CFCSxJEIS3 Aaa wb 74s

2 6-4 GFC8IxSE183 aa Bb 72.57 3 6-6 GFC81xZE183 Aa BB 80.33 4 6-9 GFC8ixdE183 AA BB 86.68 6-12 GFC8IxJE183 AA BB 84.4 6 6-13 CFCR1xJE183 aa Bb 70.93 7 6-18 QFC81xdE183 aa BB 78.5 8 6-22 SFC8IxSE183 AA BB 85.92 9 6-23 GFC8IxSEI83 Aa BB 80.44 6-24 GFC81xZE183 AA Bb 81.97 11 6-25 SFPC81x$E183 Aa BB 78.1 12 6-26 SFC8IxJE183 aa Bb 67.55 13 6-27 GFC81x3E183 AA BB 85.4] 14 6-34 QFC81xZE183 AA Bb 83.2 6-35 SFC8Ix3E183 Aa bb 67.59 16 6-38 GFC8Ix3E183 Aa BB 80.94 17 6-43 GFC81x3E183 aa bb 69.83 18 6-48 QFC81xZE183 Aa Bb 77.68 19 6-49 QFC8IxSE183 aa Bb 74.14 6-50 GFC81xZE183 aa bb 63.07 21 6-103 QFC81xZE183 Aa bb 71.65 22 6-104 CFC81xJE183 Aa BB 82.9 23 6-106 GFC8ixJE183 Aa BB 80.09 24 6-107 QFC381xZE183 AA Bb 83.22 6-108 QFCB1x E183 AA BB 87.19 26 6-109 GFC8IxJE183 AA bb 78.51 27 6-112 GFC81xZE183 Aa bb 75.67 28 6-114 QFC81x E183 aa bb 63.99 29 6-115 GFC8IxZE183 Aa BB 81.28 6-116 GFC8IxSE183 aa Bb 69.79 31 6-120 SFC81x3E183 Aa bb 74.69 32 6-122 GFC8IxZE183 AA Bb 83.42 33 6-125 GFC8IxJEI83 aa Bb 72.97 34 6-126 GFC81xZE183 Aa bb 74.98

6-128 GFC81xZE183 AA bb 79.3] 36 6-131 QFC81xSE183 AA Bb 82.83 37 6-132 GFC8IxJE183 Aa Bb 76.08 38 6-133 GFC8IxZE183 AA Bb 82.84 39 6-137 GFC81x$E183 aa bb 71.87 40 6-139 CFC81x E183 Aa BB 80.44 41 6-141 QFC8IxJE183 AA Bb 82.16 42 6-142 GFC81x3E183 AA Bb 82.58 43 6-143 gFC81xZE183 AA Bb 82.61 44 6-146 GFC8IxJE183 Aa Bb 77.95 45 6-158 GFCSIx3E183 AA Bb 81.18 46 6-159 GFC81xZE183 AA BB 87.13 47 6-160 QFC81x$E183 Aa BB 77.79 48 6-166 CFC8IxSE183 Aa Bb 76.94 49 6-168 GFC81x3E183 Aa BB 80.92 50 6-169 QFC81x E183 AA BB 87 51 6-171 SFC8Ix$E183 aa Bb 68.53 52 6-178 GFC8IxSE183 AA BB 86.86 53 6-181 SFC81x$E183 Aa BB 80.78 54 6-185 QFC81x E183 AA bb 81.23 55 6-188 CFC8IxSEI83 aa bb 67.45 56 6-190 GFC81x$E183 Aa BB 78.2 57 6-193 GFC8IxZE183 AA Bb 83.35 58 6-196 CFC8IxSE183 aa bb 66.12 59 6-204 GFC81xZE183 aa Bb 69.11 60 6-208 QFC81xdE183 Aa bb 74.85 61 6-209 GFC81x$E183 aa Bb 63.29 62 6-213 GFC8IxSE183 AA Bb 81.78 63 6-214 GFC81xSE183 Aa Bb 77.59 64 6-216 SFC81x2E183 Aa bb 72.31 65 6-217 SFC8IxSE183 aa Bb 69.3 66 6-221 GFC81xZE183 AA Bb 83.2 67 6-222 QFC81xSE183 Aa BB 81.27 68 6-224 GFC8IxJE183 Aa BB 80.29 69 6-225 GFC8IxZE183 AA Bb 82.99 70 6-226 GFC81x$E183 AA Bb 81.17

71 6-227 GFC81xZE183 aa bb 65.41 72 6-229 QFC81xSE183 aa Bb 69.75 73 6-230 GFC8IxJE183 Aa BB 80.82 74 6-233 GFC8IxZE183 Aa Bb 73.53 75 6-236 GFC81x$E183 aa bb 65.59 76 6-239 CFC81x E183 aa Bb 68.54 77 6-241 QFC8IxJE183 Aa Bb 75.87 78 6-243 GFC81x3E183 Aa bb 69.16 79 6-250 gFC81xZE183 AA Bb 83.54 80 6-251 GFC8IxJE183 Aa BB 83.27 81 6-252 GFCSIx3E183 aa Bb 68.57 82 6-256 GFC81xZE183 Aa Bb 75.96 83 6-257 QFC81x$E183 Aa BB 75.23 84 6-258 CFC8IxSE183 AA BB 86.77 85 6-260 GFC81x3E183 aa Bb 66.79 86 6-261 QFC81x E183 Aa BB 78.14 87 6-262 SFC8Ix$E183 AA Bb 83.03 88 6-269 GFC8IxSE183 Aa BB 81.58 89 6-271 SFC81xJE183 aa bb 66.35 90 6-272 QFC81x E183 AA Bb 80.46 91 6-276 CFC8IxSEI83 AA BB 86.91 92 6-277 GFC81x$E183 Aa Bb 76.45 93 6-282 GFC8IxZE183 Aa bb 72.77 94 6-287 CFC8IxSE183 aa bb 69.94 95 6-292 GFC81xZE183 AA Bb 82.92 96 6-294 QFC81xdE183 Aa BB 81.97 97 6-301 GFC81x$E183 Aa BB 63.2

98 6-302 GFC8IxSE183 aa bb 65.99 99 6-304 GFC81xSE183 aa bb 59.39 100 6-633 SFC81x2E183 AA Bb 83.87 101 6-636 CFC81x$E183 Aa BB 81.93 102 6-638 GFC81xZE183 AA Bb 83.45 103 6-642 QFC81xSE183 AA Bb 84.37 104 6-643 GFC8IxJE183 aa Bb 69.76 105 6-647 CFC8IxJEI83 aa Bb 71.39 106 6-653 GFC81x$E183 AA BB 87.18

107 6-661 GFC81xZE183 AA bb 75.49 108 6-667 QFC81xSE183 AA Bb 84.03 109 6-679 GFC8IxJE183 Aa BB 82.91 110 6-682 GFC8IxZE183 AA BB 88.57 111 6-690 GFC81xZE183 Aa BB 83.22 112 411 SE183 aa bb 58.75 113 4-16 JE183 aa bb 57.82 114 4-28 JE183 aa bb 55.5

115 5-2 QFC81 AA BB 88.03 116 5-15 GFC81 AA BB 87.3

117 5-18 GFC81 AA BB 86.29 118 3-5 9FC90xZE121 aa bb 69.66 119 3-9 gFC90x$E121 aa bb 64.31 120 3-10 CFC90x$E121 aa bb 68.2

121 3-13 GFC90x$E121 AA bb 81.74 122 3-14 QFC90xZE121 aa bb 71.66 123 3-15 SFC90x$E121 Aa bb 77.1

124 3-17 GFC90xZE121 aa bb 71.52 125 3-21 SFC90xSE121 AA bb 82.35 126 3-23 GFC90xZE121 Aa bb 76.99 127 3-25 SFC90xSE121 AA bb 78.67 128 3-26 GFC90xSE121 AA bb 82.1

129 3-29 GFC90xZE121 Aa bb 75.31 130 3-31 CFC90xSE121 AA bb 78.12 131 3-32 GFC90xZE121 AA bb 81.51 132 3-33 QFC90xSE121 AA bb 79.14 133 3-34 2FC90xZEL21 Aa bb 77.6

134 3-38 SFC90x3E121 aa bb 65.07 135 3-40 SFC90xJE121 AA bb 78.54 136 3-43 SFC90xZE121 AA bb 82.95 137 3-44 CFC90x$E121 Aa bb 76.81 138 3-45 GFC90x$E121 AA bb 80.08 139 3-47 QFC90xSE121 AA bb 78.07 140 3-48 GFC90xFE121 AA bb 81.21 141 3-49 SFC90x$E121 AA bb 80.23 142 3-50 GFC90x$E121 AA bb 80.01

143 3-84 GFC90x$E121 AA bb 78.9] 144 3-104 QFC90xSE121 Aa bb 76.49 145 3-106 GFC90xFE121 Aa bb 7741 146 3-107 CFC90xJE121 AA bb 81.02 147 3-112 GFC90x$E121 AA bb 81.45 148 3-116 CECY0xLE121 AA bb 78.49 149 3-117 QFC90xJE121 Aa bb 75.17 150 3-119 GFC90x$E121 aa bb 64.47 151 3-121 gFC90xZE121 AA bb 82.06 152 3-124 gFC9OxFE121 AA bb 80.88 153 3-129 GFC90xSE121 aa bb 71.24 154 3-132 9FC90xZE121 Aa bb 76.6

155 3-134 gFC90x$E121 Aa bb 77.69 156 3-137 CFC90x$E121 Aa bb 75.95 157 3-138 GFC90x$E121 AA bb 80.09 158 3-141 QFCY0x E121 AA bb 77.49 159 3-143 SFC90x$E121 AA bb 77.27 160 3-147 GFC90xZE121 AA bb 80.46 161 3-150 SFC90xSE121 Aa bb 77.96 162 3-151 QFC90x2E12] AA bb 80.12 163 3-154 SFC90xSE121 Aa bb 76.26 164 3-158 GFC90xSE121 AA bb 81.07 165 3-163 GFC90xZE121 aa bb 67.22 166 3-173 CFC90xSE121 AA bb 80.78 167 3-177 GFC90xZE121 aa bb 69.58 168 3-179 QFC90xSE121 aa bb 63.56 169 3-180 gFC90x$E121 aa bb 66.79 170 3-184 SFC90x3E121 aa bb 68.07 171 3-185 SFC90xJE121 Aa bb 74.62 172 3-189 SFC90xZE121 aa bb 69.9

173 3-198 CFC90x$E121 Aa bb 73.91 174 3-202 GFC90x$E121 AA bb 77.21 175 3-203 QFC90xSE121 aa bb 61.63 176 3-204 QFCI0xIE12] AA bb 80.37 177 3-205 SFC90=xJE121 Aa bb 75.54 178 3-207 GFC90xZ$E121 Aa bb 74.08

179 3-208 GFC90x&E121 AA bb 78.77 180 3-213 9FC90xZE121 AA bb 78.77 181 3-217 SFC90xFE12] AA bb 82.21 182 3-218 GFC90xSE121 Aa bb 76.42 183 3-220 9FC90xZE121 AA bb 80.26 184 3-221 2FC90xFE121 aa bb 71.4 185 3-228 GFC90xZE121 AA bb 78.78 186 3-230 @FC90xZE121 AA bb 81.86 187 3-232 SFC90x$E121 aa bb 70.35 188 3-239 QFCI0xSE121 Aa bb 75.72 189 3-233 QFC90xSE121 AA bb 76.53 190 3-240 9FC90xZE121 aa bb 69.02 191 3-242 2FC90xFE121 Aa bb 75.22 192 3-248 GFC90xZE121 Aa bb 74.93 193 3-252 GFC90xSE121 AA bb 81.18 194 3-253 2FC90xZE121 AA bb 80.42 195 3-255 SFC90xJE121 Aa bb 76.18 196 3-260 GFC90xZE121 AA bb 77.51 197 3-262 QFC0xIE121 Aa bb 75.36 198 3-263 QFC90x E12] Aa bb 75.12 199 3-265 GFC90xSE121 Aa bb 73.98 200 3-269 QFC90x E121 aa bb 71.02 201 3-270 QFCI0x E12] AA bb 78.6 202 3-271 GFC90xZE121 Aa bb 76.33 203 3-272 SFC90x&E121 Aa bb 75.76 204 3-275 9FC90xZE121 AA bb 79.81 205 3.277 SFC90xFE12] Aa bb 76.68 206 3-278 GFC9O0xHE121 AA bb 78.28 207 3-279 GFC90xZE121 aa bb 70.13

[92] Table 3 Genotypes of KASP421 and KASP1073 and the oleic acid content in two F2 populations “population OF amber of Average Content of Oleie Highest Colors of Oleic Minimum Content of Olete ype Strain Acid (%) Acid (%) Acid (%) TQFCRIXAGE AABB 12 8678 s8ss1 saa 183+ AABb 23 82.9 84.37 80.46

AAbb 4 78.64 81.23 75.49 AaBB 24 79.84 83.27 63.2 AaBb 9 76.45 77.95 73.53 Aabb 1 73.34 78.5 67.59 aaBb 16 69.94 74.14 66.79 aabb 15 66 69.94 59.39 ] _ AAbb 42 79.89 82.95 76.53 QFCY0x JE 191 Aabb 28 75.97 77.96 73.91 aabb 20 68.24 71.66 61.63

[93] From the above data, it can be seen that the markers KASP-421 and KASP-1073 can be used to accurately detect the new type of high-oleic acid allelic variants; offspring genotype amplification and typing effects were good; an allele with a T base in the KASP-421 locus and an allele with an A base in the KASP-1073 locus were high-oleic acid alleles; and if the material aggregated the T base in the KASP-421 locus and A base in the KASP-1073 at the same time, the phenotype of the oleic acid content was ultra-high oleic acid content and a phenotypic value can exceed 88%.

[94] Examples of the present disclosure are described above and the above illustration of the disclosed examples enables a person skilled in the art to implement or practice the present i0 disclosure. Various modifications to these examples are readily apparent to a person skilled in the art. Generic principles defined herein may be practiced in other examples without departing from the spirit or scope of the present disclosure. Thus, the present disclosure is not limited to the examples shown herein but falls within the widest scope consistent with the principles and novel features disclosed herein.

SWP202106457 - Sequence Listing.ST25 374264

SEQUENCE LISTING <110> Zhejiang Academy of Agricultural Sciences <120> Novel high-oleic acid allelic mutation of brassica napus bnfad2 gene and development and use of snp labeling primer thereof <130> SWP202106457 <160> 12 <170> PatentIn version 3.5 <210> 1 <211> 1155 <212> DNA <213> Brassica napus <400> 1 atgggtgcag gtggaagaat gcaagtgtct cctccctcca aaaagtctga aaccgacaac 60 atcaagcgcg taccctgcga gacaccgccc ttcactgtcg gagaactcaa gaaagcaatc 120 ccaccgcact gtttcaaacg ctcgatccct cgctctttect cctacctcat ctgggacatc 180 atcatagcct cctgcttcta ctacgtcgcc accacttact tccctctect ccctcaccct 240 ctctcctact tcgcctggcc tctctactgg gcctgccagg gctgcgtcct aaccggcgtc 300 tgggtcatag cccacgagtg cggccaccac gccttcagcg actaccagtg gctggacgac 360 accgtcggcc tcatcttcca ctccttcctc ctcgtccctt acttctcctg gaagtacagt 420 tatcgacgcc accattccaa cactggctcc ctcgagagag acgaagtgtt tgtccccaag 480 aagaagtcag acatcaagtg gtacggcaag tacctcaaca accctttggg acgcaccgtg 540 atgttaacgg ttcagttcac tctcggctgg cctttgtact tagccttcaa cgtctcgggg 600 agaccttacg acggcggctt cgcttgccat ttccacccca acgctcccat ctacaacgac 660 cgtgagcgtc tccagatata catctccgac gctggcatcc tcgccgtctg ctacggtctc 720 taccgctacg ctgctgtcca aggagttgcc tcgatggtct gcttctacgg agttcctctt 780 ctgattgtca acgggttctt agttttgatc acttacttgc agcacacgca tccttccctg 840 cctcactatg actcgtctga gtgggattgg ttgaggggag ctttggccac cgttgacaga 900 gactacggaa tcttgaacaa ggtcttccac aatatcacgg acacgcacgt ggcgcatcac 960 ctgttctcga ccatgccgca ttatcatgcg atggaagcta cgaaggcgat aaagccgata 1020 Pagina 1

SWP202106457 - Sequence Listing.ST25 374264 ctgggagagt attatcagtt cgatgggacg ccggtggtta aggcgatgtg gagggaggcg 1080 aaggagtgta tctatgtgga accggacagg caaggtgaga agaaaggtgt gttctggtac 1140 aacaataagt tatga 1155 <210> 2 <211> 1155 <212> DNA <213> Brassica napus <400> 2 atgggtgcag gtggaagaat gcaagtgtct cctccctcca agaagtctga aaccgacacc 60 atcaagcgcg taccctgcga gacaccgccc ttcactgtcg gagaactcaa gaaagcaatc 120 ccaccgcact gtttcaaacg ctcgatccct cgctctttect cctacctcat ctgggacatc 180 atcatagcct cctgcttcta ctacgtcgcc accacttact tccctctect ccctcaccct 240 ctctcctact tcgcctggcc tctctactgg gcctgccaag ggtgcgtcct aaccggcgtc 300 tgggtcatag cccacgagtg cggccaccac gccttcagcg actaccagtg gcttgacgac 360 accgtcggtc tcatcttcca ctccttcctc ctcgtccctt acttctcctg gaagtacagt 420 catcgacgcc accattccaa cactggctcc ctcgagagag acgaagtgtt tgtccccaag 480 aagaagtcag acatcaagtg gtacggcaag tacctcaaca accctttggg acgcaccgtg 540 atgttaacgg ttcagttcac tctcggctgg ccgttgtact tagccttcaa cgtctcggga 600 agaccttacg acggcggctt cgcttgccat ttccacccca acgctcccat ctacaacgac 660 cgcgagcgtc tccagatata catctccgac gctggcatcc tcgccgtctg ctacggtctc 720 ttccgttacg ccgccgcgca gggagtggcc tcgatggtct gcttctacgg agtcccgctt 780 ctgattgtca atggtttcct cgtgttgatc acttacttgc agcacacgca tccttccctg 840 cctcactacg attcgtccga gtgggattgg ttgaggggag ctttggctac cgttgacaga 900 gactacggaa tcttgaacaa ggtcttccac aatattaccg acacgcacgt ggcgcatcat 960 ctgttctcca cgatgccgca ttatcacgcg atggaagcta ccaaggcgat aaagccgata 1020 ctgggagagt attatcagtt cgatgggacg ccggtggtta aggcgatgtg gaaggaggcg 1080 aaggagtgta tctatgtgga accggacagg caaggtgaga agaaaggtgt gttctggtac 1140

Pagina 2

SWP202106457 - Sequence Listing.ST25 374264 aacaataagt tatga 1155 <2105 3 <211> 384 <212> PRT <213> Brassica napus <400> 3 Met Gly Ala Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Glu Thr Asp Asn Ile Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr

Val Gly Glu Leu Lys Lys Ala Ile Pro Pro His Cys Phe Lys Arg Ser 40 45 Ile Pro Arg Ser Phe Ser Tyr Leu Ile Trp Asp Ile Ile Ile Ala Ser 50 55 60 Cys Phe Tyr Tyr Val Ala Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 Leu Ser Tyr Phe Ala Trp Pro Leu Tyr Trp Ala Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Val Trp Val Ile Ala His Glu Cys Gly His His Ala Phe 100 105 119 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu Ile Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser Tyr Arg Arg His 130 135 140 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp Ile Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Pagina 3

SWP202106457 - Sequence Listing.ST25 374264 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Ala Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Ala 195 200 205 Cys His Phe His Pro Asn Ala Pro Ile Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gln Ile Tyr Ile Ser Asp Ala Gly Ile Leu Ala Val Cys Tyr Gly Leu 225 230 235 240 Tyr Arg Tyr Ala Ala Val Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu Ile Val Asn Gly Phe Leu Val Leu Ile Thr Tyr 260 265 270 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly Ile 290 295 300 Leu Asn Lys Val Phe His Asn Ile Thr Asp Thr His Val Ala His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr His Ala Met Glu Ala Thr Lys Ala 325 330 335 Ile Lys Pro Ile Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys Ile Tyr Val Glu Pro 355 360 365 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 Pagina 4

SWP202106457 - Sequence Listing.ST25 374264 <2105 4 <211> 384 <212> PRT <213> Brassica napus <400> 4 Met Gly Ala Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Glu Thr Asp Thr Ile Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr

Val Gly Glu Leu Lys Lys Ala Ile Pro Pro His Cys Phe Lys Arg Ser 40 45 Ile Pro Arg Ser Phe Ser Tyr Leu Ile Trp Asp Ile Ile Ile Ala Ser 50 55 60 Cys Phe Tyr Tyr Val Ala Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 Leu Ser Tyr Phe Ala Trp Pro Leu Tyr Trp Ala Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Val Trp Val Ile Ala His Glu Cys Gly His His Ala Phe 100 105 119 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu Ile Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp Ile Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Pagina 5

SWP202106457 - Sequence Listing.ST25 374264 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Ala Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Ala 195 200 205 Cys His Phe His Pro Asn Ala Pro Ile Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gln Ile Tyr Ile Ser Asp Ala Gly Ile Leu Ala Val Cys Tyr Gly Leu 225 230 235 240 Phe Arg Tyr Ala Ala Ala Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu Ile Val Asn Gly Phe Leu Val Leu Ile Thr Tyr 260 265 270 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly Ile 290 295 300 Leu Asn Lys Val Phe His Asn Ile Thr Asp Thr His Val Ala His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr His Ala Met Glu Ala Thr Lys Ala 325 330 335 Ile Lys Pro Ile Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Ala Met Trp Lys Glu Ala Lys Glu Cys Ile Tyr Val Glu Pro 355 360 365 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 Pagina 6

SWP202106457 - Sequence Listing.ST25 374264 <210> 5 <211> 211 <212> DNA <213> Brassica napus <400> 5 gtgcggccac cacgccttca gcgactacca gtggctggac gacaccgtcg gcctcatctt 60 ccactccttc ctecctegtece cttacttctc ctggaagtac agtcatcgac gccaccattc 120 caacactggc tccctcgaga gagacgaagt gtttgtcccc aagaagaagt cagacatcaa 180 gtggtacggc aagtacctca acaacccttt g 211 <210> 6 <211> 196 <212> DNA <213> Brassica napus <400> 6 tctgttctcc acgatgccgc attatcacgc gatggaagct accaaggcga taaagccgat 60 actgggagag tattatcagt tcgatgggac gccggtggtt aaggcgatgt ggagggaggc 120 gaaggagtgt atctatgtgg aaccggacag gcaaggtgag aagaaaggtg tgttctggta 180 caacaataag ttatga 196 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer AlleleFAM for molecular marker KASP-421 <400> 7 gttggaatgg tggcgtcgat g 21 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer AlleleHEX for molecular marker KASP-421 <400> 8

Pagina 7

SWP202106457 - Sequence Listing.ST25 374264 gtgttggaat ggtggcgtcg ata 23 <216> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer Common for molecular marker KASP-421 <400> 9 ggacgacacc gtcggcctca 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer AlleleFAM for molecular marker KASP-1073 <400> 10 ggtggttaag gcgatgtgga g 21 <21e> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer AlleleHEX for molecular marker KASP-1073 <400> 11 cggtggttaa ggcgatgtgg aa 22 <2105 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer Common for molecular marker KASP-1073 <400> 12 ccggttccac atagatacac tcctt 25 Pagina 8

Claims

-22- Conclusions:

A mutant gene of a high oleic acid phenotype produced by a gene BnFAD2 for directing an oleic acid content of a Brassica napus seed, wherein the mutant gene is the result of a G-to-A substitution at position 1073 of a nucleotide sequence of BnCFAD 2g located on chromosome CO5 of Brassica napus, namely G1073A; and the mutant gene is designated BnCfad2a and has the nucleotide sequence of SEQ ID NO:2.

The protein encoded by the mutant gene BnCfad20 according to claim 1, wherein the protein has the amino acid sequence of SEQ ID NO:4,

The linked KASP molecular marker for the mutant gene BnCfad2a according to claim 1, wherein the molecular marker is KASP-1073; and molecular marker KASP-1073 has the following nucleotide sequence of SEQ ID NO.6 is: Tetgttctccacgatgccgcattatcacgcgatggaagctaccaaggcgataaagccgatactgggagagtattatcagttcg atgggacgccggtggttaaggcgatgtggals / alggaggcgaaggagtgtatctatgtggaaccggacaggcaaggtgag aagaaaggtgtgttctggtacaacaataagttatga-3 'and the 114th base from the 5'-end of the nucleic acid sequence is a SNP location.

Use of the linked molecular marker KASP according to claim 3 in determining the presence of the mutant gene BnCfad2g in a biological sample.

PCR-specific amplification primers for the linked KASP molecular marker according to claim 3, wherein the primers of molecular marker KASP-1073 comprise: 1} two specific primers: Primer AlleleFAM: 5'-ggtggttaaggcgatgtggag-3', as shown in SEQ ID NO.10; and Primer _AlleleHEX: 5'-cggtggttaaggcgatgtggaa-3', as shown in SEQ ID NO.11; and 2} a common primer: Primer Common: 5'-ccggttccacatagatacactcctt-3', as shown in SEQ ID NO.12.

-23-

A test kit for determining the presence of the mutant gene BnCfad2a in a biological sample, comprising at least the PCR-specific amplification primers according to claim 5.

A method for determining the production of a high oleic acid phenotype in a biological target sample comprising the following steps: 1} performing PCR amplification on genomic DNA of the biological sample using the PCR specific amplification primers according to claim 5 and a primer set of molecular marker KASP-421; wherein the primer set of molecular marker KASP-421 comprises: Primer_AlleleFAM: 5'-gttggaatggtggcgtcgatg-3' as shown in SEQ ID NO.7; Primer _AlleleHEX: 5'-gtgttggaatggtggcgtcgata-3' as shown in SEQ ID NO.8; and Primer Common: 5'-ggacgacaccgteggcctca-3' as shown in SEQ ID NO.9; 2} Determining a genotype of a target SNP using the primer set of molecular marker KASP-421: if only base T is detected at position +421, it is determined that BnAFAD2a from a Brassica napus sample is a high-oleic acid allele and the genotype is defined as AA; if only base C is detected, then the locus is determined to be an intermediate and low oleic acid allele and the genotype is defined as aa; if T and C are simultaneously detected at the detection locus, then the locus is determined to be a heterozygote and the genotype is defined as Aa; the BnAFad2a gene has the nucleotide sequence of SEQ ID NO:1; Determining a genotype of a target SNP using the primer set of molecular marker KASP-1073: if only base A is detected at +1073, BnCFADZa from a Brassica napus sample is determined to be a high oleic acid allele and the genotype is defined as BB; if only base G is detected, the locus is determined to be an intermediate and low oleic acid allele and the genotype is defined as bb; and

-24- if A and G are simultaneously detected at the detection locus, then the locus is determined to be a heterozygote and the genotype is defined as Bb; and 3) combining the results of KASP-421 and KASP-1073: if the genotype of the sample is detected to contain both two high oleic acid alleles and the genotype is AABB, then the sample examined is an ultra high oleic acid plant or race.

The method of claim 7, wherein an amplification system comprises 2.5 µl of a Brassica napus sample DNA template, 2.5 µl 2xKASP Master mix and 0.07 µl. KASP Assay Mix includes; PCR reaction conditions are as follows: 94°C for 15 min; 94°C for 20 sec, 61-55°C for 1 minute, and decreasing an annealing temperature by 0.6°C in each cycle for a total of 10 cycles; 94°C for 20 sec and 55°C for 1 min, a total of 26 cycles; if an amplification effect is not ideal, add 3 cycles for each time and at most three times based on the 26 cycle episode of the PCR reaction; after the reaction is completed, reading fluorescence data from a KASP reaction product using a Pherastar scanner and automatically graphing a fluorescence scan result; detecting a fluorescence signal and checking a genotyping condition using a BMG PHERAstar instrument; and if typing is unsatisfactory, continuing amplification and checking the genotyping condition every 3 cycles until typing is complete. S. A method for obtaining a plant with a high oleic acid content in seeds, the method comprising the steps of: introducing the BnCfadZa gene according to claim 1 into a plant, or introducing the mutant gene BnAfad2a and the BnCfad2a according to claim 1 in a plant, and using the method of claim 7 or 8 to detect a biological target sample; and the BnAfad20 gene has the nucleotide sequence of SEQ ID NO:1.

-25-

The method of obtaining a high oleic acid plant in seeds according to claim 9, wherein the biological target sample is the plant or cells, plant tissues or organs or progeny thereof.

The method of obtaining a high oleic acid plant in seeds according to claim 10, wherein the biological target sample is a seed.