NL2009411C2

NL2009411C2 - NEW VIAL PLANT PATHOGEEN.

Info

Publication number: NL2009411C2
Application number: NL2009411A
Authority: NL
Inventors: Marinus Verbeek; Bastiaan Franciscus Brandwagt
Original assignee: Zanten Holding B V Van
Priority date: 2012-09-04
Filing date: 2012-09-04
Publication date: 2014-03-05

Description

NIEUW VIRAAL PLANT PATHOGEEN Beschrijvingsinleiding 5 De onderhavige uitvinding heeft betrekking op virale pathogenen, of pathogene virussen, zoals plantenziektenbladnecrose veroorzakende virale pathogenen en meer specifiek op virale pathogenen, of pathogene virussen, die bladnecrose veroorzaken in planten die behoren tot het 10 geslacht Freesia. De onderhavige uitvinding heeft verder betrekking op werkwijzen en middelen voor het detecteren van de onderhavige virale pathogenen.The present invention relates to viral pathogens, or pathogenic viruses, such as plant disease leaf necrosis causing viral pathogens and more specifically to viral pathogens, or pathogenic viruses, that cause leaf necrosis in plants belonging to the genus Freesia. The present invention further relates to methods and means for detecting the present viral pathogens.

Sinds de jaren 70 is er een ziekte bekend in planten die behoren tot het geslacht Freesia. Deze ziekte 15 wordt in het Engels aangeduid als Freesia Leaf Necrosis Disease of FLN. Een van de symptomen van deze ziekte is bladnecrose, d.w.z. het afsterven van het blad. De ziekte wordt overgedragen via de bodem door infectie van ondergrondse plantendelen. De ziekte verspreidt zich ook 20 tijdens de vegetatieve vermeerdering, bijvoorbeeld naar nieuw gevormde stengelknolletjes (kralen) en bij de regeneratie in weefselkweek. Een manier op deze ziekte te bestrijden is het verwijderen van visueel zieke planten uit een populatie. Verschillende virussen zijn geïdentificeerd 25 als mogelijk verantwoordelijk voor het veroorzaken van deze ziekte.Since the 70s, a disease has been known in plants belonging to the genus Freesia. This disease is referred to in English as Freesia Leaf Necrosis Disease or FLN. One of the symptoms of this disease is leaf necrosis, i.e. leaf dying. The disease is transmitted through the soil through infection of underground plant parts. The disease also spreads during vegetative propagation, for example, to newly formed stem nodules (beads) and during regeneration in tissue culture. One way to combat this disease is to remove visually ill plants from a population. Various viruses have been identified as potentially responsible for causing this disease.

Een van deze virussen is het het Freesia Sneak Virus (FreSNV) ook wel aangeduid als Freesia ophiovirus (FOV). Een ander mogelijk kandidaatpathogeen is het Freesia 30 Leaf Necrosis Virus ook wel aangeduid als FLNV. FLNV is alleen sporadisch waargenomen na electronenmicroscopie, er bestaat geen gangbare detectiewijze voor. FOV kan worden gedetecteerd met behulp van PCR en ELISA. In het vakgebied 2 wordt vooral FreSV aangemerkt als het belangrijkste pathogeen dat verantwoordelijk is voor het veroorzaken van bladnecrose in planten, en met name planten van het geslacht Freesia.One of these viruses is the Freesia Sneak Virus (FreSNV) also referred to as Freesia ophiovirus (FOV). Another possible candidate pathogen is the Freesia 30 Leaf Necrosis Virus, also referred to as FLNV. FLNV is only sporadically observed after electron microscopy, there is no conventional detection method for it. FOV can be detected using PCR and ELISA. In field 2, FreSV in particular is designated as the most important pathogen responsible for causing leaf necrosis in plants, and in particular plants of the genus Freesia.

5 De bladnecrose veroorzakende ziekte is een significante negatieve factor in vooral de Freesia teelt en de enige op dit moment beschikbare afdoende remedie is het verwijderen van visueel zieke planten in een zo vroeg mogelijk stadium om verdere verspreiding te voorkomen. Het 10 is dan ook van groot belang om aanwezigheid van bladnecrose veroorzakende virussen zoals FreSV, en mogelijk FLNV, in een zo vroeg mogelijk stadium na infectie te detecteren, bij voorkeur als er (nog) geen ziektebeelden zijn. In een uitzonderlijke situatie kunnen plantenvirussen symptoomloos 15 of latent aanwezig zijn in specifieke vatbare plantenrassen. Het is van groot belang ook latent geïnfecteerde planten van deze plantenrassen te kunnen verwijderen, omdat ze een bron van de ziekte vormen.The leaf necrosis-causing disease is a significant negative factor, particularly in Freesia cultivation, and the only effective remedy currently available is the removal of visually ill plants at the earliest possible stage to prevent further spread. It is therefore of great importance to detect the presence of leaf necrosis-causing viruses such as FreSV, and possibly FLNV, at the earliest possible stage after infection, preferably if there are (still) no clinical pictures. In an exceptional situation, plant viruses can be present without symptoms or latently in specific susceptible plant varieties. It is of great importance to be able to remove latent infected plants from these plant varieties as they are a source of the disease.

Belangrijke middelen om een vroege en gevoelige 20 detectie te verschaffen is het met behulp van MoleculairImportant means to provide an early and sensitive detection is by means of Molecular

Biologische technieken detecteren van virale nucleïnezuren, zoals bij voorbeeld met behulp van de polymerase kettingreactie (BCR) of Loop mediated isothermal amplification (LAMP), of daarvan afgeleide eiwitten zoals 25 bij voorbeeld met behulp van ELISA.Biological techniques detect viral nucleic acids, such as for example by the polymerase chain reaction (BCR) or Loop mediated isothermal amplification (LAMP), or proteins derived therefrom such as for example by ELISA.

Een groot probleem is echter dat in slechts 70% tot 75% van de visueel zieke planten in een geïnfecteerde populatie, FreSV kan worden gedetecteerd met zowel ELISA als PCR. In andere woorden, naast de bekende Freesia pathogenen 30 FreSV, Freesiamozaïekvirus (FreMV) en bonenscherpmozaïekvirus (Bean Yellowing Mosaic Virus of BYMV), bestaat er een ander viraal pathogeen dat bladnecrose veroorzaakt.A major problem, however, is that in only 70% to 75% of the visually ill plants in an infected population, FreSV can be detected with both ELISA and PCR. In other words, in addition to the known Freesia pathogens FreSV, Freesia mosaic virus (FreMV) and bean-sharp mosaic virus (Bean Yellowing Mosaic Virus or BYMV), there is another viral pathogen that causes leaf necrosis.

33

Omdat het verwijderen van geïnfecteerde planten het enige op dit moment beschikbare effectieve middel is om verspreiding van bladnecrose te voorkomen, bestaat er in het vakgebied in grote behoefte om dit onbekende pathogeen te 5 identificeren en daarmee over middelen te beschikken om infecties met dit pathogeen in een vroeg stadium te detecteren.Because the removal of infected plants is the only effective means currently available to prevent the spread of leaf necrosis, there is a great need in the art to identify this unknown pathogen and thus to have means to prevent infections with this pathogen in a detect early stage.

De onderhavige uitvinding heeft daarom tot doel, naast andere doelen, om dit onbekende virale pathogeen te 10 identificeren.It is therefore an object of the present invention, in addition to other objects, to identify this unknown viral pathogen.

Daarnaast heeft de onderhavige uitvinding tot doel om middelen te verschaffen voor de detectie van dit onbekende virale pathogeen.In addition, the present invention has for its object to provide means for the detection of this unknown viral pathogen.

De bovenstaande doelen van de onderhavige 15 uitvinding, naast andere doelen, zijn volgens een eerste aspect bereikt door het verschaffen van een viraal pathogeen zoals gedefinieerd in de hierbij behorende conclusie 1.The above objects of the present invention, in addition to other objects, have been achieved in a first aspect by providing a viral pathogen as defined in the appended claim 1.

Specifiek zijn de bovenstaande doelen van de onderhavige uitvinding, naast andere doelen, bereikt door 20 het verschaffen van een viraal pathogeen, of virus, dat bladnecrose veroorzaakt, en vooral in planten behorende tot het genus Freesia, waarbij het genoom van het virale pathogeen een sequentie omvat met tenminste 70% sequentie identiteit met SEQ ID No. 1.Specifically, the above objectives of the present invention, among other objectives, have been achieved by providing a viral pathogen, or virus, that causes leaf necrosis, and especially in plants belonging to the genus Freesia, wherein the genome of the viral pathogen has a sequence with at least 70% sequence identity with SEQ ID NO. 1.

25 De onderhavige uitvinders hebben verrassenderwijs gevonden dat in planten die bladnecrose symptomen vertoonden, maar waarin FreSV, Freesiamozaïekvirus (FreMVj en bonenscherpmozaïekvirus (Bean Yellowing Mosaic Virus of BYMV) niet kon worden aangetoond, het onderhavige virale 30 pathogeen werd gedetecteerd.The present inventors have surprisingly found that in plants that exhibited leaf necrosis symptoms, but in which FreSV, Freesia mosaic virus (FreMVj and bean-sharp mosaic mosaic virus (Bean Yellowing Mosaic Virus or BYMV) could not be detected), the present viral pathogen was detected.

Een Blast search tegen de NCBI database toonde een lage homologie met virussen uit de groep van de Tenuivirussen (Rice stripe virus) en het genus Phlebovirus.A Blast search against the NCBI database showed a low homology with viruses from the group of Tenuiviruses (Rice stripe virus) and the genus Phlebovirus.

44

Deze virussen behoren samen met het genus Tospovirus tot de familie Bunyaviridae. De lage homologie toont echter aan dat het onderhavige virale pathogeen een tot nu niet bekend virus is en een nieuwe groep van virussen vertegenwoordigd.Together with the Tospovirus genus, these viruses belong to the Bunyaviridae family. However, the low homology shows that the present viral pathogen is a virus that is not yet known and represents a new group of viruses.

5 Sequentie identiteit zoals hierin gebruikt wordt gedefinieerd als het aantal identieke residuen tussen twee optimaal gepaarde sequenties, in het Engels "aligned sequences", gedeeld door de totale lengte van de onderhavige SEQ ID Nos. vermenigvuldigd met 100%.Sequence identity as used herein is defined as the number of identical residues between two optimally matched sequences, in English "aligned sequences" divided by the total length of the present SEQ ID Nos. multiplied by 100%.

10 In het onderhavige geval zal een sequentie welke 70% identiteit heeft met SEQ ID No. 1 tenminste, bij een optimale paring tussen deze sequentie en SEQ ID No. 1, dus 2977 identieke residuen bezitten.In the present case, a sequence having 70% identity with SEQ ID NO. 1 at least, with an optimal match between this sequence and SEQ ID NO. 1, so 2977 have identical residues.

Volgens een voorkeursuitvoeringsvorm heeft de 15 onderhavige uitvinding betrekking op virale pathogenen waarbij het genoom van de virale pathogenen een sequentie omvat met tenminste 80%, de voorkeur geniet tenminste 90%, meer de voorkeur geniet tenminste 95% en meest de voorkeur geniet tenminste 100% sequentie identiteit met SEQ ID No. 1. 20 Bij voorkeur worden de virale pathogenen volgens de onderhavige uitvinding verder gekenmerkt doordat het genoom van de virale pathogenen een sequentie omvat met tenminste 70% sequentie identiteit met SEQ ID No. 2 zoals met tenminste 80%, de voorkeur geniet tenminste 90%, meer de 25 voorkeur geniet tenminste 95% en meest de voorkeur geniet tenminste 100% sequentie identiteit met SEQ ID No. 2.According to a preferred embodiment, the present invention relates to viral pathogens in which the genome of the viral pathogens comprises a sequence with at least 80%, preferably at least 90%, more preferably at least 95% and most preferably at least 100% sequence identity with SEQ ID No. 1. Preferably, the viral pathogens of the present invention are further characterized in that the genome of the viral pathogens comprises a sequence with at least 70% sequence identity with SEQ ID NO. 2 as with at least 80%, preferably at least 90%, more preferably at least 95% and most preferably at least 100% sequence identity with SEQ ID NO. 2.

Volgens een andere voorkeursuitvoeringsvorm worden de virale pathogenen volgens de onderhavige uitvinding verder gekenmerkt doordat het genoom van de virale 30 pathogenen een sequentie omvat met tenminste 70% sequentie identiteit met SEQ ID No. 3 zoals met tenminste 80%, de voorkeur geniet tenminste 90%, meer de voorkeur geniet 5 tenminste 95% en meest de voorkeur geniet tenminste 100% sequentie identiteit met SEQ ID No. 3.According to another preferred embodiment, the viral pathogens of the present invention are further characterized in that the genome of the viral pathogens comprises a sequence with at least 70% sequence identity with SEQ ID NO. 3 as with at least 80%, preferably at least 90%, more preferably at least 95% and most preferably at least 100% sequence identity with SEQ ID NO. 3.

In een bijzonder de voorkeur genietende uitvoeringsvorm wordt het genoom van de onderhavige virale 5 pathogenen gekenmerkt door het omvatten van SEQ ID No. 1, SEQ ID No. 2 en SEQ ID No. 3.In a particularly preferred embodiment, the genome of the present viral pathogens is characterized by including SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID No. 3.

Een tweede aspect van de onderhavige uitvinding heeft betrekking op werkwijzen voor het detecteren van een bladnecrose in planten, en vooral in planten van het genus 10 Freesia, veroorzakend viraal pathogeen in een monster omvattende: (a) het verschaffen van tenminste een nucleïnezuuramplificatie primerpaar gebaseerd op, of afgeleid van, een sequentie gekozen uitA second aspect of the present invention relates to methods for detecting leaf necrosis in plants, and in particular in plants of the genus Freesia, causing viral pathogen in a sample comprising: (a) providing at least one nucleic acid amplification primer pair based on , or derived from, a sequence selected from

15 de groep die bestaat uit SEQ ID No. 1, SEQ ID15 the group consisting of SEQ ID NO. 1, SEQ ID

No. 2 en SEQ ID No. 3; (b) het uitvoeren van een nucleïnezuuramplificatie op het monster met het tenminste een primerpaar; en 20 (c) het detecteren van de aanwezigheid of afwezigheid van een bladnecrose in Freesia veroorzakend viraal pathogeen gebaseerd op de resultaten van de nucleïnezuuramplificatie van stap (b).No. 2 and SEQ ID No. 3; (b) performing a nucleic acid amplification on the sample with the at least one primer pair; and (c) detecting the presence or absence of a leaf necrosis in Freesia-causing viral pathogen based on the results of the nucleic acid amplification of step (b).

25 In het vakgebied is het ontwerpen van primerparen op basis van een bekende sequentie, zoals in het onderhavige geval SEQ ID No. 1, SEQ ID No. 2 en/of SEQ ID No. 3, routine waarbij bijvoorbeeld kan worden verwezen naar http://www.ncbi.nlm.nih.gov/tools/primer-blast/.In the art, the design of primer pairs is based on a known sequence, such as in the present case, SEQ ID NO. 1, SEQ ID NO. 2 and / or SEQ ID NO. 3, routine where, for example, reference can be made to http://www.ncbi.nlm.nih.gov/tools/primer-blast/.

30 Het bovenstaande geldt tevens voor nucleïnezuur amplificaties protocollen waarbij kan worden verwezen naar http://www.protocol-online.org/prot/Molecular Biology/PCR/ en http://nar.oxfordjournals.org/content/28/12/e63.abstract.The above also applies to nucleic acid amplification protocols where reference can be made to http://www.protocol-online.org/prot/Molecular Biology / PCR / and http://nar.oxfordjournals.org/content/28/12/ e63.abstract.

66

Stap (c) van de onderhavige werkwijze omvat in voorkomende gevallen het detecteren van een nucleïnezuur amplificatie fragment met een grootte welke overeenkomt met de afstand tussen de individuele primers van het betreffende 5 primerpaar in de relevante sequentie, d.w.z. de onderhavige sequentie waarop deze primers zijn gebaseerd of waarvan ze zijn afgeleid.Step (c) of the present method includes, where appropriate, detecting a nucleic acid amplification fragment with a size corresponding to the distance between the individual primers of the relevant primer pair in the relevant sequence, ie the present sequence on which these primers are based or from which they are derived.

Volgens een bijzonder de voorkeur genietende uitvoeringsvorm van dit tweede aspect van de onderhavige 10 uitvinding is de in stap (b) gebruikte nucleïnezuur amplificatie een polymerase kettingreactie (PCR) of loop mediated isothermal amplification (LAMP).According to a particularly preferred embodiment of this second aspect of the present invention, the nucleic acid amplification used in step (b) is a polymerase chain reaction (PCR) or loop mediated isothermal amplification (LAMP).

Volgens dit tweede aspect van de onderhavige uitvinding is het monster een nucleïnezuurextract verkregen 15 uit een individuele plant, zoals een Freesia plant, of groep van planten, zoals Freesia planten.According to this second aspect of the present invention, the sample is a nucleic acid extract obtained from an individual plant, such as a Freesia plant, or group of plants, such as Freesia plants.

Volgens een bijzonder de voorkeur genietende uitvoeringsvorm van dit tweede aspect van de onderhavige uitvinding wordt het onderhavige nucleïnezuuramplificatie 20 primerpaar gekozen uit de groep die bestaat uit het primerpaar SEQ ID No. 4 en 5/ het primerpaar SEQ ID No. 6 en 7 en het primerpaar SEQ ID No. 8 en 9.According to a particularly preferred embodiment of this second aspect of the present invention, the present nucleic acid amplification pair of primers is selected from the group consisting of the primer pair SEQ ID NO. 4 and 5 / the primer pair SEQ ID NO. 6 and 7 and the primer pair SEQ ID NO. 8 and 9.

Volgens een derde aspect heeft de onderhavige uitvinding betrekking op het gebruik van tenminste een 25 sequentie gekozen uit de groep die bestaat uit SEQ ID No. 1, SEQ ID No. 2 en SEQ ID No. 3 voor het detecteren van een in planten, en vooral planten van het genus Freesia, bladnecrose veroorzakend viraal pathogeen.According to a third aspect, the present invention relates to the use of at least one sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID No. 3 for detecting a viral pathogen that causes leaf necrosis in plants, and in particular plants of the Freesia genus.

Volgens een vierde aspect heeft de onderhavige 30 uitvinding betrekking op een nucleïnezuursequentie gekozen uit de groep die bestaat uit SEQ ID No. 1, SEQ ID No. 2 en SEQ ID No. 3.In a fourth aspect, the present invention relates to a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID No. 3.

77

Volgens een vijfde aspect heeft de onderhavige uitvinding betrekking op een kit voor het detecteren van een bladnecrose in planten, en vooral planten van het genus Freesia, veroorzakend viraal pathogeen in een monster 5 omvattende: a) tenminste een nucleïnezuuramplificatie primerpaar gebaseerd op, of afgeleid van, een sequentie gekozen uit de groep die bestaat uit SEQ ID No. 1, SEQ ID No. 2 en SEQ ID No. 3; 10 b) instructies voor gebruik.In a fifth aspect, the present invention relates to a kit for detecting leaf necrosis in plants, and in particular plants of the genus Freesia, causing viral pathogen in a sample comprising: a) at least one nucleic acid amplification primer pair based on, or derived from, , a sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID No. 3; 10 b) instructions for use.

Volgens een bijzonder de voorkeur genietende uitvoeringsvorm van dit vijfde aspect van de onderhavige uitvinding omvat de onderhavige kit tenminste een nucleïnezuuramplificatie primerpaar gekozen uit de groep die 15 bestaat uit het primerpaar SEQ ID No. 4 en 5; het primerpaar SEQ ID No. 6 en 7 en het primerpaar SEQ ID No. 8 en 9.According to a particularly preferred embodiment of this fifth aspect of the present invention, the present kit comprises at least one nucleic acid modification primer pair selected from the group consisting of the primer pair SEQ ID NO. 4 and 5; the primer pair SEQ ID no. 6 and 7 and the primer pair SEQ ID NO. 8 and 9.

De onderhavige uitvinding zal verder worden toegelicht aan de hand van het onderstaande voorbeeld van meest de voorkeur genietende voorkeursuitvoeringvormen van 20 de onderhavige uitvinding.The present invention will be further elucidated with reference to the example below of most preferred preferred embodiments of the present invention.

Voorbeeld Sequentiebepaling van het genoom van een onbekend Freesiavirus geassocieerd met bladnecrose 25Example Sequence determination of the genome of an unknown Freesia virus associated with leaf necrosis

IntroductieIntroduction

Freesialijnen (Royal van Zanten, Rijsenhout, Nederland) die duidelijk symptomen van de ziekte 30 freesiabladnecrose vertoonden, werden gebruikt in dit voorbeeld. In deze lijnen konden de volgende virussen niet worden aangetoond: Freesiamozaïekvirus,Freesial lines (Royal van Zanten, Rijsenhout, the Netherlands) that clearly showed symptoms of the freesia leaf necrosis disease were used in this example. The following viruses could not be detected in these lines: Freesia mosaic virus,

Bonenscherpmozaïekvirus of het Freesia sneak virus (FreSV), 8 dat vooralsnog wordt aangezien als de veroorzaker van bladnecrose. Hoewel FreSV, wel in 70% tot 75% van de gevallen in Freesia met bladnecrosesymptomen voorkomt, werd al vermoed dat er nog een ander plantenpathogeen in het spel 5 was.Bean-sharp mosaic virus or the Freesia sneak virus (FreSV), 8 which is currently considered to be the cause of leaf necrosis. Although FreSV occurs in leafy necrosis symptoms in 70% to 75% of the cases in Freesia, it was already suspected that another plant pathogen was involved.

Door middel van large-scale parallel pyrosequencing of "deep sequencing" is nu een ander, nieuw virus gevonden in FreSV-vrije freesialijnen met bladnecrose.By means of large-scale parallel pyrosequencing or "deep sequencing", another new virus has now been found in FreSV-free freesial lines with leaf necrosis.

10 Gebruikte materialen10 Materials used

Freesiaknollen van de FreSV-, FreMV- en BYMV-vrije freesialijnen Laguna Beach en 2614E werden gebruikt als uitgangsmateriaal. Met bladmateriaal zijn toetsplanten 15 soorten Nicotiana benthamiana en N. hesperis geïnoculeerd en het virus is vervolgens aangehouden in genoemde toetsplantensoorten.Freesia tubers from the FreSV, FreMV and BYMV free milling lines Laguna Beach and 2614E were used as starting material. With leaf material, test plants 15 species of Nicotiana benthamiana and N. hesperis have been inoculated and the virus is subsequently maintained in said test plant species.

Voor het deep-sequencen zijn twee monsters bereid door een gedeeltelijke viruszuivering, RNA extractie en cDNA 20 synthese uit te voeren op geïnfecteerd bladmateriaal: 1. N. benthamiana met virus uit freesia "Laguna Beach" herkomst Royal van Zanten Rijsenhout 2. Freesiaplanten, herkomst 2614E herkomst Royal 25 van Zanten RijsenhoutFor deep sequencing two samples were prepared by performing a partial virus purification, RNA extraction and cDNA synthesis on infected leaf material: 1. N. benthamiana with virus from freesia "Laguna Beach" origin Royal van Zanten Rijsenhout 2. Freesia plants, origin 2614E origin Royal 25 van Zanten Rijsenhout

ResultatenResults

Uit monster 1 werden geen duidelijke virale RNA 30 sequenties verkregen, vermoedelijk doordat de virusconcentratie in het plantmateriaal te laag was. Zomerperiode. De virusconcentratie na de gedeeltelijke zuivering was erg laag. Dit werd geconstateerd na inoculatie 9 van deze viruspreparatie op toetsplanten (door het waarnemen van het aantal lokale lesies) en waarschijnlijk was die concentratie net te laag voor goede sequentieresultaten.No clear viral RNA sequences were obtained from sample 1, presumably because the virus concentration in the plant material was too low. Summer period. The virus concentration after the partial purification was very low. This was observed after inoculation 9 of this virus preparation on test plants (by observing the number of local lesions) and probably that concentration was just too low for good sequence results.

Uit monster 2 (gedeeltelijk gezuiverd freesiablad) 5 werden sequenties verkregen die met een "de novo assembly" tot 3 contigs konden worden samengevoegd. De naar eiwit vertaalde RNA sequenties werden vergeleken met eiwit sequenties in de NCBI database met het software programma BlastX. De resultaten hiervan zijn weergegeven in Tabel 1.From sample 2 (partially purified freesia leaf) 5 sequences were obtained that could be combined with a "de novo assembly" into 3 contigs. The protein RNA-translated sequences were compared with protein sequences in the NCBI database with the BlastX software program. The results are shown in Table 1.

1010

Tabel 1: Verkregen contigs en BlastX resultatenTable 1: Obtained contigs and BlastX results

Contig lengte BlastX resultaat (SEQ ID) (nt) 1 4253 L protein AEA30064 Identities = [Turuna virus] 291/1346 (22%) 2 1024 RNA polymerase AAO31605 Identities = [Rice stripe 28/113 (25%) virus] 3 314 nucleocapsid AEA30067 Identities = [Alenquer 24/82 (29%) virus]Contig length BlastX result (SEQ ID) (nt) 1 4253 L protein AEA30064 Identities = [Turuna virus] 291/1346 (22%) 2 1024 RNA polymerase AAO31605 Identities = [Rice stripe 28/113 (25%) virus] 3 314 nucleocapsid AEA30067 Identities = [Alenquer 24/82 (29%) virus]

Ter controle zijn op de verkregen sequenties voor 15 elk contig specifieke primers ontwikkeld en getest op plantmateriaal (Freesia en N. benthamina)met ziektebeelden, zonder dat FOV, FreMV of BYMV kon worden aangetoond. De oligonucleotide primers en de te verwachten amplicon fragmentgroottes zijn vermeld in Tabel 2.As a control, the sequences obtained for each contig-specific primer have been developed and tested on plant material (Freesia and N. benthamina) with pathogens, without FOV, FreMV or BYMV being detected. The oligonucleotide primers and the expected amplicon fragment sizes are listed in Table 2.

20 1010

Tabel 2: Primers (5'-----3') ontworpen op de 3 verkregen contigsTable 2: Primers (5 '----- 3') designed on the 3 contigs obtained

Template Oligonucleotide primers Verwacht amplicon (SEQ ID) (nt) ï FV-1F TAAAGAGAGAAGGAGATGTG, SEQ ID No. 4 820 FV-1R ACAGAACAGAAAGGAATAGG, SEQ ID No. 5 2 FV-2F TTTCTCTTCAATCAGCTGC, SEQ ID No. 6 3ÖÖ FV-2R TTTCTTTTGGTCTCACTAACC, SEQ ID No.Template Oligonucleotide primers Expected amplicon (SEQ ID) (nt) FV-1F TAAAGAGAGAAGGAGATGTG, SEQ ID NO. 4 820 FV-1R ACAGAACAGAAAGGAATAGG, SEQ ID NO. 5 2 FV-2F TTTCTCTTCAATCAGCTGC, SEQ ID NO. 6 3ÖÖ FV-2R TTTCTTTTGGTCTCACTAACC, SEQ ID NO.

7 3 FV-3F TGGCATTATGTCGATCACCC, SEQ ID No. 8 250 FV-3R TCTATTGATGATTGAGTCCC, SEQ ID No. 9 5 Toetsingen op Freesia en N. benthamiana, beide geïnfecteerd met "freesiabladnecrose" gaven PCR fragmenten met alle drie de primerparen en van de verwachtte fragmentgroottes. Een Freesiazaailing uitgezaaid op steriel medium(negatieve controle) gaf geen reactie in bovengenoemde 10 PCR reacties.7 3 FV-3F TGGCATTATGTCGATCACCC, SEQ ID NO. 8 250 FV-3R TCTATTGATGATTGAGTCCC, SEQ ID NO. Tests on Freesia and N. benthamiana, both infected with "freesia leaf necrosis" gave PCR fragments with all three primer pairs and of the expected fragment sizes. A Freesia seedling seeded on sterile medium (negative control) gave no reaction in the above 10 PCR reactions.

ConclusieConclusion

Uit het Freesiamateriaal opgegroeid uit knollen 15 van lijn 2614E zijn drie duidelijke virus sequenties verkregen. Een BlastX search tegen de NCBI database liet geen hoge homologieën zien met bekende virussen. Wel werden lage homologieën (22 tot 29%) gevonden met virussen uit de groep van de Tenuivirussen (Rice stripe virus) en het genus 11From the Freesia material grown from tubers 15 of line 2614E, three clear virus sequences have been obtained. A BlastX search against the NCBI database did not show high homologies with known viruses. Low homologies (22 to 29%) were found with viruses from the group of Tenuiviruses (Rice stripe virus) and the genus 11

Phlebovirus (behoort samen met het genus Tospovirus tot de familie Bunyaviridae).Phlebovirus (together with the genus Tospovirus belongs to the Bunyaviridae family).

De lage percentages homologieën geven aan dat het wèl virussequenties zijn, maar dat ze toebehoren aan een 5 nieuw virus. Er zijn tot nu toe drie verschillende contigs uit de sequentieanalyse naar voren gekomen.The low percentages of homologies indicate that they are virus sequences, but that they belong to a new virus. Up to now, three different contigs have emerged from the sequence analysis.

De positieve toetsing van het geïnfecteerde Freesia en N. benthamiana materiaal met de voor het nieuwe Freesiavirus ontwikkelde RT-PCR primers geeft aan dat op 10 basis van de gegenereerde sequentie data een specifieke diagnostische toets voor het nieuwe Freesia leaf necrosis virus ontwikkeld is.The positive testing of the infected Freesia and N. benthamiana material with the RT-PCR primers developed for the new Freesia virus indicates that a specific diagnostic test for the new Freesia leaf necrosis virus has been developed based on the generated sequence data.

1212

SEQUENCE LISTINGSEQUENCE LISTING

<110> Van Zanten Holding B.V.<110> Van Zanten Holding B.V.

5 <120> BLADNECROSE VEROORZAKEND VIRAAL PATHOGEEN5 <120> SHEET NECROSE CAUSING VIALAL PATHOGEN

<130> 4/2MX51/1 <160> 9 10 <170> BiSSAP 1.0<130> 4 / 2MX51 / 1 <160> 9 10 <170> BiSSAP 1.0

<210> 1 <211> 4253 15 <212> DNA<210> 1 <211> 4253 <212> DNA

<213> Unknown <22 0> <221> source 20 <222> 1. .4253 <223> /mol_type="DNA" /note="Contig 1 of new Freesia leaf necrosis virus" /organism="Unknown" 25 <400> 1 gaacaaagaa gactaccaca aatgaattct atattgctga aaggacgcga agtttttagg 60 actccactga agtacatttc tcatgaaacc tgtgaggtga atttttctat aaagagagaa 120 30 ggagatgtgt tcattttaga agttgaaagt ccttctgatg atgatgcctt agacaacttg 180 actaagactc tgtcttctta cttggaattc aaaggagaaa aatttagtca ctctgaaatg 240 gatagactgc cccatgattt aatcttaggg ttgataagca cagacactcc tagaaaatta 300 35 actgatgtcc acaaaaggaa gtacaatgtg gatgattcta aaactccaga tcatttaaca 360 caagattact gctttgaatt aggaacttct agtttggggt ctacaatggc atttgactca 420 40 aaaaagacaa aatatcacaa actttgtcaa gacaacaaga taaaaaacat gataatggga 480 13 gtgggcccaa tggaagtttc tgtaaatttt aacttaagtg atgaagaagt aaatctcatt 540 agcaaactat attctttagg aaaaagaata caatttaaag ctagcaaatt gggattcttg 600 5 atttcaaaga atgaggggga tttagagaaa tctttgagat tttccatgag caatgtgtca 660 gagaattatc ccaagagtat attgaatatt gaaaaaaatg aatggaaaaa atggtctaat 720 10 catctggaag aaaattgttt taagctgaat gaagctaatt tcaaaatcta ctctgactta 780 gcaaaaaatt catctgatgc aataaagact atgctcatag atgagaattc tggaagaaca 840 ggtgctaaac ttgatctcaa agcaaaagaa gagtacacat ataaggtaga tgagttgaac 900 15 accaggagta actctgataa aaaaggtttt cctattcctt tctgttctgt tgatttaggt 960 tcttttgatt tctcaggaaa gatcaaaagc aatacttctc ttggagagtt gtggagctca 1020 20 ataaaagaca cttacactat aagagatatt gaacaatctt atgaaacttg tgaaagaaaa 1080 aactatgatt tgacagaaga atatgatatg agaatgtcta aagaacatag attagatata 1140 agagaaaaaa acagaacaaa aataaattta tcccattctg ctaagcaaga tttgtctgaa 1200 25 actggatatt tgggaaaaaa attctctaaa aaacaaaaga aggaaaacga acaaaatagc 1260 ctgggttact cactgagcaa agattatgat ctgtctgatt ttgacagttt tgtcacaaat 1320 30 tcagaaatgt tggaatattg gtctgtaagt gaaaaatttg ataaagtcag cagcttgtta 1380 agtataggta attatggtgc ttcagattgt tctacaaaat ttataagaaa attttgttct 1440 acaaaattag gatcctgttc agaatttttg agttcactct tttcagaatt gaatctaaat 1500 35 tttaaaaaac caactaaacc caatgagttt attgttaatc agattcccaa ctataaagct 1560 ttgttagcgg tgcacaacac tggttctaac aaacacactt tttacacaat actagtcctt 1620 40 aaagaaaact taactcaatt tgactcgtgt aaaaacattt ttaggaaatg gttagatgta 1680 14 ggagattata tggcacttaa catttcttca acaagaagac atgacatttc aaactattta 1740 ttttgcacgt ctaaaatcat ttccatgcta gccactcata tggaggtttt cggagatgat 1800 5 cttaatgtct caacaaaatt cagatcttca gaagaatttt attttcattt attagtatat 1860 ttggaaaaca ataatcaagt ttctgagaca ctgcaactag ttagatactt ctacatgaaa 1920 10 actaattctt ctaaattgat gccagtttct ttgctttcac cagtagaaaa attacctcaa 1980 ataattagaa ctagattttg ttgctatgct ataaaaaaat tactaaattc tttttatgaa 2040 atgtcattaa gaagagacaa aatatctcat caaactttag aaaaagaaga agaaactgaa 2100 15 gaagaaaatt tttctgaaga tttcttgata ggaacctatt cttacatatc ttcaaaacaa 2160 ctcagaaact atgaagaagt tttattgtta tcatacggtg gaatttatca caacaaagaa 2220 20 aaatctgaca atatagtttc aaatttgcaa atatatagga aactgactaa agaagaatta 2280 aaaattgata aagaaaatat agagaggttg aagaatgggt ttgaaccttc taattctctt 2340 gacatgccac ctcatggatt ctctggaatc catctgagaa attgcggatt ggctctatta 2400 25 gaagatataa aaaagagggg tatcagcttt ggagacttgc aacagagaat agccatgggt 2460 ttgaataaaa taacttatga agaactagct acattcaagt ctagcttaga agctcatcat 2520 30 ctgaccaaag actcatctga tgaagattat ctaaaccatt acccagactt gcaattcaat 2580 tctaaatgca aagatgataa aaacaaatat aaatatggga agacatgtag agccttggaa 2640 ggagttttac atttacttga aagcttacat attgatgaaa acacaaaacc ctttcatata 2700 35 atctctgatt taatatcaga atgcaacaaa aaaggtggaa ttgttgcaat tttgttcaaa 2760 aaagctcaat ttggctcagt gagagaaatt tttattttaa ccatgtttgc aagaatagtg 2820 40 gttaaattcg tcgaaacagt gtctagaact gtggcagagt gcttgccaaa tgaatattta 2880 15 actaaagggt cttcaaagct aaattcaacc ccaatgcact acaataaagt cagatccatg 2940 aaaagaagtg gagatgttac tctcaatatg tttgattctt tggattgtaa aacttggtgt 3000 5 cagaatttta catttcctgc tttcggtaat ttgttctctg ttatttttag agaatggcca 3060 gaaatctctg aagtgataag aacagtattc aacatggcta gttccaaaag acatgaaatg 3120 10 acagagactt taatgagttt attcatcaaa catcaagaaa taaactctac ttcagattca 3180 atgaatgttt tgaaggctga atttttaagt aaagaaggag gcaacttaag tagaggaaat 3240 caatctattt ttgttaataa tgtgagtaat tttatgcaag gaatttttca ttatacttca 3300 15 actgttttac attctgcaca tctcatcatg atgactaaaa taatttctca atacattaaa 3360 aaagatgaac caaagttaaa agctttagtt catacaacaa aagcttcttc agatgatgga 3420 20 tctagtttga taactgctat catgagagaa ccaacaagaa aagaatatct tagagttaga 3480 gcgaaattgt tggttgctag tgaaatgcta tatagatctt atcctctagc ttgtgcttgg 3540 ataggagaac caaagagtac aagatttgta gaaaatggag ttgaagaatt taattctttg 3600 25 tggtcttata ggaacactgt tctttctgtg cctagcaagt tcacggcagc agcagtatgt 3660 ccaaaaataa caaggagtgc tatagagaga atgagagtgg atcataattc tctcaactct 3720 30 tgtatagaaa atggatgttc aatgaagttg actaaaatca tagaaatgtg ttgcgcacta 3780 aatcattata tcatattagg gcttgattca ctctctaaca gaatgtggat aaaaatgacc 3840 caaaatttgc agcaagttcc tcatcctact tcttggctat atatttctac acctgcttta 3900 35 tctggaccaa cattaggttt tgacgcaaca ttacacaatt tcttagaaac aaatagtttg 3960 agcagaaaaa ttcactttat cgtaactgaa ttattagcag gatcatttga cataaaatct 4020 40 ggttttttaa tacaatctag tataataatt ggaaatttat ctaaatacac tgactttttg 4080 16 agaagaacca taaatcatga agaattagag ataatggaag aagaattaaa tgaaaaacct 4140 gaaatgcttt atagaaactc aacttctagg agtgaaataa aattgaaaat attgttgaaa 4200 5 gcaaaaagtt caggtgcaga aagagcattt gtttttgaag atgaatcagc aat 4253 <210> 2 10 <211> 1024 <212> DNA <213> Unknown <22 0> 15 <221> source <222> 1..1024 <223> /mol type="DNA" /note=" Contig 2 of new Freesia leaf necrosis virus " /organism="Unknown" 20 <400> 2 gtttcccagc atatttgaag ttattacaaa cattgtgctc agaaaaagaa tcaattaaca 60 ctattgagcc acatagtaaa actttgttag acatgttgaa gctatatagt gaagtgacaa 120 25 tgcctatagg gagaagaaga aaattgccca taaaaattaa atttccaaaa acaaggagtg 180 agtcagaaat ttctcttcaa tcagctgcta aattcaaatg gttttctata tttaatgatt 240 30 atgatgaaga tcaaaacttt tcctcttttt tagaatacaa aaaattgtat aattggttag 300 gtgacactta tgaagagact gtcttaaaat tgaggaatat gggggtggaa ggaaatgtgc 360 atacaacaat acaaggatta cttatgtcag agtctgataa agatagaaca gtaactttca 420 35 tgcactcagg aaaaaaagaa tcaacaatca tatcttcttt tttaagttgc attgaatatt 480 gtcaagaaaa agattcaagg ttagtgagac caaaagaaat ctattctaag acagatttag 540 40 gtagatttat tgaaatagag agacaaatgt ttccatatgt ctcaatacat cctaaaatca 600 17 gacaattgat tgacaagaca aaaactgatg ctttagaaat gtgtaaactt attatagaag 660 aaaatcaaga gctttttgtc aaagaaagga aagaaagaga aattaggttt atgcctaata 720 5 ggttaaaaaa cttattaacc attggtgctt gtcatttaag atcaaaagat aaatcagaga 780 tagaaaatgt tttattgaat tactcaactg gttacataat aacatatctg aaagaacaaa 840 10 taaaaaatga ggaagggttg tggaaaggaa agggagaatt ttttgtaagg actaaacata 900 catctttctt aatagaatgt tgggatgata cagttaaaaa agtgtatagt tcatcagtta 960 ataaaataac tcaacattta aacctgctga caaaaatatt taaagtttta aaattaaaaa 1020 15 aaaa 1024 <210> 3 20 <211> 314 <212> DNA <213> Unknown <220> 25 <221> source <222> 1..314 <223> /mol_type="DNA" /note=" Contig 3 of new Freesia leaf necrosis virus " /organism="Unknown" 30 <400> 3 aaaaaattgg cattatgtcg atcaccccag aagaagttaa acaaatggtt gaactgatca 60 aggaaaagat tgacgagaaa acaattaatg agatatccga gtcaatttcc ttcaaaggct 120 35 tcaatccaag agttattttc aaaatcatca atgataaaat aaaagccaat ccttctgtga 180 agaaagacct ctacatcatg atagtgttcg gattaactag aggtttcgga ggaggtaaaa 240 40 gctgggactc aatcatcaat agaacaaacc ctgaaggcag agaaaaatta caaaatgcaa 300 18 aggacaaatt ggaa 314 5 <210> 4<213> Unknown <22 0> <221> source 20 <222> 1.4253 <223> / mol_type = "DNA" / note = "Contig 1 of new Freesia leaf necrosis virus" / organism = "Unknown" 25 < 400> 1 gaacaaagaa gactaccaca aatgaattct atattgctga aaggacgcga agtttttagg 60 actccactga agtacatttc tcatgaaacc tgtgaggtga atttttctat aaagagagaa 120 30 ggagatgtgt tcattttaga agttgaaagt ccttctgatg atgatgcctt agacaacttg 180 actaagactc tgtcttctta cttggaattc aaaggagaaa aatttagtca ctctgaaatg 240 gatagactgc cccatgattt aatcttaggg ttgataagca cagacactcc tagaaaatta 300 35 actgatgtcc acaaaaggaa gtacaatgtg gatgattcta aaactccaga tcatttaaca 360 caagattact gctttgaatt aggaacttct agtttggggt ctacaatggc atttgactca 420 40 aaaaagacaa aatatcacaa actttgtcaa gacaacaaga taaaaaacat gataatggga 480 13 gtgggcccaa tggaagtttc tgtaaatttt aacttaagtg atgaagaagt aaatctcatt 540 agcaaactat attctttagg aaaaagaata caatttaaag ctagcaaatt gggattcttg 600 5 atttcaaaga atgaggggga tttagagaaa tctttgagat tttccatgag caatgtgtca 660 gagaattatc ccaagagtat attgaatatt gaaaaaaatg aatggaaaaa atggt ctaat 720 10 catctggaag aaaattgttt taagctgaat gaagctaatt tcaaaatcta ctctgactta 780 gcaaaaaatt catctgatgc aataaagact atgctcatag atgagaattc tggaagaaca 840 ggtgctaaac ttgatctcaa agcaaaagaa gagtacacat ataaggtaga tgagttgaac 900 15 accaggagta actctgataa aaaaggtttt cctattcctt tctgttctgt tgatttaggt 960 tcttttgatt tctcaggaaa gatcaaaagc aatacttctc ttggagagtt gtggagctca 1020 20 ataaaagaca cttacactat aagagatatt gaacaatctt atgaaacttg tgaaagaaaa 1080 aactatgatt tgacagaaga atatgatatg agaatgtcta aagaacatag attagatata 1140 agagaaaaaa acagaacaaa aataaattta tcccattctg ctaagcaaga tttgtctgaa 1200 25 actggatatt tgggaaaaaa attctctaaa aaacaaaaga aggaaaacga acaaaatagc 1260 ctgggttact cactgagcaa agattatgat ctgtctgatt ttgacagttt tgtcacaaat 1320 30 tcagaaatgt tggaatattg gtctgtaagt gaaaaatttg ataaagtcag cagcttgtta 1380 agtataggta attatggtgc ttcagattgt tctacaaaat ttataagaaa attttgttct 1440 acaaaattag gatcctgttc agaatttttg agttcactct tttcagaatt gaatctaaat 1500 35 tttaaaaaac caactaaacc caatgagttt attgttaatc agattccca a ctataaagct 1560 ttgttagcgg tgcacaacac tggttctaac aaacacactt tttacacaat actagtcctt 1620 40 aaagaaaact taactcaatt tgactcgtgt aaaaacattt ttaggaaatg gttagatgta 1680 14 ggagattata tggcacttaa catttcttca acaagaagac atgacatttc aaactattta 1740 ttttgcacgt ctaaaatcat ttccatgcta gccactcata tggaggtttt cggagatgat 1800 5 cttaatgtct caacaaaatt cagatcttca gaagaatttt attttcattt attagtatat 1860 ttggaaaaca ataatcaagt ttctgagaca ctgcaactag ttagatactt ctacatgaaa 1920 10 actaattctt ctaaattgat gccagtttct ttgctttcac cagtagaaaa attacctcaa 1980 ataattagaa ctagattttg ttgctatgct ataaaaaaat tactaaattc tttttatgaa 2040 atgtcattaa gaagagacaa aatatctcat caaactttag aaaaagaaga agaaactgaa 2100 15 gaagaaaatt tttctgaaga tttcttgata ggaacctatt cttacatatc ttcaaaacaa 2160 ctcagaaact atgaagaagt tttattgtta tcatacggtg gaatttatca caacaaagaa 2220 20 aaatctgaca atatagtttc aaatttgcaa atatatagga aactgactaa agaagaatta 2280 aaaattgata aagaaaatat agagaggttg aagaatgggt ttgaaccttc taattctctt 2340 gacatgccac ctcatggatt ctctggatec catctgaga a attgcggatt ggctctatta 2400 25 gaagatataa aaaagagggg tatcagcttt ggagacttgc aacagagaat agccatgggt 2460 ttgaataaaa taacttatga agaactagct acattcaagt ctagcttaga agctcatcat 2520 30 ctgaccaaag actcatctga tgaagattat ctaaaccatt acccagactt gcaattcaat 2580 tctaaatgca aagatgataa aaacaaatat aaatatggga agacatgtag agccttggaa 2640 ggagttttac atttacttga aagcttacat attgatgaaa acacaaaacc ctttcatata 2700 35 atctctgatt taatatcaga atgcaacaaa aaaggtggaa ttgttgcaat tttgttcaaa 2760 aaagctcaat ttggctcagt gagagaaatt tttattttaa ccatgtttgc aagaatagtg 2820 40 gttaaattcg tcgaaacagt gtctagaact gtggcagagt gcttgccaaa tgaatattta 2880 15 actaaagggt cttcaaagct aaattcaacc ccaatgcact acaataaagt cagatccatg 2940 aaaagaagtg gagatgttac tctcaatatg tttgattctt tggattgtaa aacttggtgt 3000 5 cagaatttta catttcctgc tttcggtaat ttgttctctg ttatttttag agaatggcca 3060 gaaatctctg aagtgataag aacagtattc aacatggcta gttccaaaag acatgaaatg 3120 10 acagagactt taatgagttt attcatcaaa catcaagaaa taaactctac ttcagattca 3180 atgategttt tgaaggctga attttt Aagt aaagaaggag gcaacttaag tagaggaaat 3240 caatctattt ttgttaataa tgtgagtaat tttatgcaag gaatttttca ttatacttca 3300 15 actgttttac attctgcaca tctcatcatg atgactaaaa taatttctca atacattaaa 3360 aaagatgaac caaagttaaa agctttagtt catacaacaa aagcttcttc agatgatgga 3420 20 tctagtttga taactgctat catgagagaa ccaacaagaa aagaatatct tagagttaga 3480 gcgaaattgt tggttgctag tgaaatgcta tatagatctt atcctctagc ttgtgcttgg 3540 ataggagaac caaagagtac aagatttgta gaaaatggag ttgaagaatt taattctttg 3600 25 tggtcttata ggaacactgt tctttctgtg cctagcaagt tcacggcagc agcagtatgt 3660 ccaaaaataa caaggagtgc tatagagaga atgagagtgg atcataattc tctcaactct 3720 30 tgtatagaaa atggatgttc aatgaagttg actaaaatca tagaaatgtg ttgcgcacta 3780 aatcattata tcatattagg gcttgattca ctctctaaca gaatgtggat aaaaatgacc 3840 caaaatttgc agcaagttcc tcatcctact tcttggctat atatttctac acctgcttta 3900 35 tctggaccaa cattaggttt tgacgcaaca ttacacaatt tcttagaaac aaatagtttg 3960 agcagaaaaa ttcactttat cgtaactgaa ttattagcag gatcatttga cataaaatct 4020 40 ggttttttaa tacaa tctag tataataatt ggaaatttat ctaaatacac tgactttttg 4080 16 agaagaacca taaatcatga agaattagag ataatggaag aagaattaaa tgaaaaacct 4140 gaaatgcttt atagaaactc aacttctagg agtgaaataa aattgaaaat attgttgaaa 4200 5 gcaaaaagtt caggtgcaga aagagcattt gtttttgaag atgaatcagc aat 4253 <210> 2 10 <211> 1024 <212> DNA <213> Unknown <22 0> 15 <221> source <222> 1.1024 <223> / mol type = "DNA" / note = "Contig 2 of new Freesia leaf necrosis virus" / organism = "Unknown" 20 <400> 2 gtttcccagc atatttgaag ttattacaaa cattgtgctc agaaaaagaa tcaattaaca 60 ctattgagcc acatagtaaa actttgttag acatgttgaa gctatatagt gaagtgacaa 120 25 tgcctatagg gagaagaaga aaattgccca taaaaattaa atttccaaaa acaaggagtg 180 agtcagaaat ttctcttcaa tcagctgcta aattcaaatg gttttctata tttaatgatt 240 30 atgatgaaga tcaaaacttt tcctcttttt tagaatacaa aaaattgtat aattggttag 300 gtgacactta tgaagagact gtcttaaaat tgaggaatat gggggtggaa ggaaatgtgc 360 atacaacaat acaaggatta cttatgtcag agtctgataa agatagaaca gtaactttca 420 35 tgcactcagg aaaaaaagaa tcaacaatca tatcttcttt tt taagttgc attgaatatt 480 gtcaagaaaa agattcaagg ttagtgagac caaaagaaat ctattctaag acagatttag 540 40 gtagatttat tgaaatagag agacaaatgt ttccatatgt ctcaatacat cctaaaatca 600 17 gacaattgat tgacaagaca aaaactgatg ctttagaaat gtgtaaactt attatagaag 660 aaaatcaaga gctttttgtc aaagaaagga aagaaagaga aattaggttt atgcctaata 720 5 ggttaaaaaa cttattaacc attggtgctt gtcatttaag atcaaaagat aaatcagaga 780 tagaaaatgt tttattgaat tactcaactg gttacataat aacatatctg aaagaacaaa 840 10 taaaaaatga ggaagggttg tggaaaggaa agggagaatt ttttgtaagg actaaacata 900 catctttctt aatagaatgt tgggatgata cagttaaaaa agtgtatagt tcatcagtta 960 ataaaataac tcaacattta aacctgctga caaaaatatt taaa22 2 2 2 2 2 2 2 2 > 1,314 <223> / mol_type = "DNA" / note = "Contig 3 of new Freesia leaf necrosis virus" / organism = "Unknown" 30 <400> 3 aaaaaattgg cattatgtcg atcaccccag aagaagttaa acaaatggtt gaactgatca 60 aggaaaagat tgacgagaatatatgatatgatatgatcatcate ttcaaaggct 120 35 tcaatccaag agttattttc aaaatcatca atgataaaat aaaagccaat ccttctgtga 180 agaaagacct ctacatcatg atagtgttcg gattaactag aggtttcgga ggaggtaaaa 240 40 gctgggactc aatcatcaat agaacaaacc ctgaaggcag agaaaaatta caaaatgcaa aggacaaatt ggaa 18 300 314 5 <210> 4

<211> 20 <212> DNA<211> 20 <212> DNA

<213> artificial sequences 10 <22 0> <221> source <222> 1..20 <223> /mol type="DNA" /note="primer FV-1F" 15 /organism="artificial sequences" <400> 4 taaagagaga aggagatgtg 20 20<213> artificial sequences 10 <22 0> <221> source <222> 1..20 <223> / mol type = "DNA" / note = "primer FV-1F" 15 / organism = "artificial sequences" <400 > 4 taaagagaga aggagatgtg 20 20

<210> 5 <211> 20 <212> DNA<210> 5 <211> 20 <212> DNA

<213> artificial sequences 25 <22 0> <221> source <222> 1..20 <223> /mol type="DNA" 30 /note="primer FV-1R" /organism="artificial sequences" <400> 5 acagaacaga aaggaatagg 20 35<213> artificial sequences 25 <22 0> <221> source <222> 1..20 <223> / mol type = "DNA" 30 / note = "primer FV-1R" / organism = "artificial sequences" <400 > 5 acagaacaga aaggatagg 20 35

<210> 6 <211> 19 <212> DNA<210> 6 <211> 19 <212> DNA

40 <213> artificial sequences 19 <22 0> <221> source <222> 1..19 5 <223> /mol type="DNA" /note="primer FV-2F" /organism="artificial sequences" <400> 6 10 tttctcttca atcagctgc 1940 <213> artificial sequences 19 <22 0> <221> source <222> 1..19 5 <223> / mol type = "DNA" / note = "primer FV-2F" / organism = "artificial sequences" < 400> 6 10 tttctcttca atcagctgc 19

<210> 7 <211> 21 15 <212> DNA<210> 7 <211> 21 <212> DNA

<213> artificial sequences <22 0> <221> source 20 <222> 1..21 <223> /mol type="DNA" /note="primer FV-2R" /organism="artificial sequences" 25 <400> 7 tttcttttgg tctcactaac c 21 <210> 8 30 <211> 20<213> artificial sequences <22 0> <221> source 20 <222> 1..21 <223> / mol type = "DNA" / note = "primer FV-2R" / organism = "artificial sequences" 25 <400 > 7 tttcttttgg tctcactaac c 21 <210> 8 30 <211> 20

<212> DNA<212> DNA

<213> artificial sequences <22 0> 35 <221> source <222> 1..20 <223> /mol type="DNA" /note="primer FV-3F" /organism="artificial sequences" 40 20 <400> 8 tggcattatg tcgatcaccc 20 5 <210> 9<213> artificial sequences <22 0> 35 <221> source <222> 1..20 <223> / mol type = "DNA" / note = "primer FV-3F" / organism = "artificial sequences" 40 20 < 400> 8 tggcattatg tcgatcaccc 20 5 <210> 9

<211> 20 <212> DNA<211> 20 <212> DNA

<213> artificial sequences 10 <22 0> <221> source <222> 1..20 <223> /mol type="DNA" /note="primer FV-3R" 15 /organism="artificial sequences" <400> 9 tctattgatg attgagtccc 20 20<213> artificial sequences 10 <22 0> <221> source <222> 1..20 <223> / mol type = "DNA" / note = "primer FV-3R" 15 / organism = "artificial sequences" <400 > 9 tctattgatg attgagtccc 20 20

Claims

Viral pathogen characterized in that the genome of the viral pathogen comprises a sequence with at least 70% sequence identity with SEQ ID NO. 1.

The viral pathogen according to claim 1, wherein the genome of the viral pathogen comprises a sequence with at least 80%, preferably at least 90%, more preferably at least 95% and most preferably at least 100% sequence identity with SEQ ID No. 1.

The viral pathogen of claim 1 or claim 2, wherein the genome of the viral pathogen further comprises a sequence with at least 70% sequence identity with SEQ ID NO. 2.

The viral pathogen according to claim 3, wherein the genome of the viral pathogen further comprises a sequence of at least 80%, preferably at least 90%, more preferably at least 95% and most preferably at least 100% sequence identity with SEQ ID NO. 2.

The viral pathogen of any one of claims 1 to 4, wherein the genome of the viral pathogen further comprises a sequence with at least 70% sequence identity with SEQ ID NO. 3.

The viral pathogen of claim 5, wherein the viral pathogen genome further comprises a sequence of at least 80%, preferably at least 90%, more preferably at least 95% and most preferably at least 100% sequence identity with SEQ ID No. 3.

The viral pathogen of any one of claims 5 to 6, wherein the genome of the viral pathogen is SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID No. 3.

A method for detecting a leaf necrosis causing viral pathogen in a sample comprising: (a) providing at least one nucleic acid amplification primer pair based on, or derived from, a sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID

The method of claim 8, wherein the nucleic acid amplification is a polymerase chain reaction (PCR) or loop mediated isothermal amplification (LAMP).

The method of claim 8 or claim 9, wherein the sample is a nucleic acid extract.

The method of any one of claims 8 to 9, wherein the nucleic acid amplification primer pair is selected from the group consisting of the primer pair SEQ ID NO. 4 and 5; the primer pair SEQ ID no. 6 and 7 and the primer pair SEQ ID NO. 8 and 9.

12. Use of at least one sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID No. 3 for detecting a viral pathogen.

13. Use according to claim 12, wherein said detection comprises detecting a sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID No. 3 in a sample.

14. Use according to claim 12, wherein said detection comprises detecting a protein at least partially encoded by a sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID No. 3 in a sample.

The use of claim 14 wherein the detection comprises ELISA.

15 No. 2 and SEQ ID No. 3; (b) performing a nucleic acid amplification on the sample with the at least one primer pair; and (c) detecting the presence or absence of a leaf necrosis in a freesia-causing viral pathogen based on the results of the nucleic acid amplification of step (b).

A nucleic acid sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID No. 3. 25

17. Kit for detecting a viral pathogen in a sample comprising: a) at least one nucleic acid amplification primer pair based on, or derived from, a sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID No. 3; b) instructions for use.

The kit of claim 17 comprising at least one nucleic acid amplification primer pair selected from the group consisting of the primer pair SEQ ID NO. 4 and 5; the primer pair SEQ ID no. 6 and 7 and the primer pair SEQ ID NO. 8 5 and 9.

19. A kit for detecting a viral pathogen in a sample comprising: a) means, preferably antibodies, for detecting a protein at least partially encoded by a sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID No. 3; b) instructions for use. 15