MXPA98008427A - Methods of transfer of in vivo genes for lesio cure - Google Patents

Abstract

The present invention relates to an in vivo method for focusing on specific DNA and transferring it to mammalian repair cells. The transferred DNA can include DNA encoding a therapeutic protein of interest. The invention is based on the discovery that mammalian repair cells proliferate and migrate to an injury site where they collect DNA and express it actively. The invention also relates to pharmaceutical compositions which can be used in the practice of the invention to transfer the DNA of interest. Such compositions include any suitable matrix in combination with the DNA of interest

Description

METHODS OF TRANSFER OF GENES I LIVE FOR HEALING OF INJURIES 1. INTRODUCTION The present invention relates to a novel in vivo method for the presentation and direct transfer of DNA encoding a therapeutic pratein of interest in mammalian repair cells. The method includes the implantation of a matrix containing the DNA of interest (known herein as a "gene-activated matrix") at a site of recent injury. The repair cells that normally originate in viable tissue surrounding the wound proliferate and break in the matrix activated by genes, where they find, collect and express the DNA. The transfected repair cells therefore act as in situ bioreactors (located within the site of the lesion) qif. & they produce agents (RNA encoded by DNA, proteins, etc.) that heal the wound. The invention also relates to pharmaceutical compositions which can be used in the practice of the invention to transfer the DNA of interest. Such compositions include suitable matrices of this type in combination with the DNA of interest. 2. BACKGROUND OF THE INVENTION 2.1 WOUND HEALING The therapies currently available for wound healing include the administration of therapeutic proteins. Such therapeutic proteins may include regulatory factors involved in the normal healing process with, for example, systemic hormones, cytokines, growth factors and other proteins that regulate the proliferation and differentiation of cells. Growth factors, cytokines and hormones having said wound healing ability include, for example, the superfa ilia of transforming growth Beta factor proteins (TGF-Beta) ICO, D.A., 1995, Cell Biology International, 19,357-371) the acid fibroblast growth factor < FBF > (Slavin, J., 1995, Cell Biolsgy International, 19: 431-444), the macrophage colony stimulation factor (M-CBF) and ragulatory agents of calcium camo, for example, parathyroid hormone (ITTH). Several problems are related to the use of therapeutic proteins, ie, proteins, in wound healing therapies. First, the purification and / or recombinant production of therapeutic proteins is often an expensive and time-consuming process. Despite the best efforts, however, purified protain preparations are frequently unstable making their storage and use difficult, and protein instability can cause unexpected inflammatory reactions (in protein breakdown products) that are toxic to humans. the guest Second, the systemic administration of therapeutic proteins, ie, cytokines, can be related to severe undesired side effects in damaged na tissue. Due to insufficient administration to specific cells and tissues in the body, the administration of high doses of protein is required to ensure that sufficient amounts of pratein reach the appropriate target tissue. Due to the short half-life in the body due to proteolytic degradation, the proteins must be administered repeatedly, which may cause an immune reaction against the therapeutic proteins. The circulation of high doses of therapeutic proteins is often toxic due to the pleiotropic effects of the protein administered, and can cause severe side effects. T & As a result, the exogenous administration of recombinant proteins is inefficient. Attempts were made to limit the administration of high levels of proteins through the immobilization of therapeutic protein in the target site. However, this therapeutic approach complicates the readministration of the protein for repeated dosing. Fourth, for several proteins such as, for example, membrane receptors, transcription factors and intracellular binding pratein, the biological activity depends on the correct expression and localization in the cell. In the case of many proteins, the correct cellular localization occurs as the protein is lac inally modified within the cells. Accordingly, said proteins can not be administered exogenously such that they are properly absorbed and located within the cell. As these problems demonstrate, current therapies with recombinant proteins for wound healing are deficient because they do not present a rational method of administration of exogenous proteins. These proteins, that is to say, proteins, are normally produced in their action state in physiological quantities and are efficiently administered to signaling receptors on the cell surface. 2.2 GENETIC THERAPY Genetic therapy was originally conceived as a replacement therapy for specific genes for the correction of inherited defects to deliver functionally active therapeutic genes in target cells. Initial efforts towards somatic gene therapy were based on indirect means of introducing genes into tissues, it is known as ex vivo gene therapy, for example, white cells are removed from the body, said target cells are transfected or infected with vectors carrying genes recombined before, and are re-implanted in the body ("autologous cell transfer"). Several transfection techniques are currently available and used to transfer the DNA in vitro into cells? the inclusion of calcium phosphate-DNA precipitation, DEAE-Dextran transfection, electroporation, lipase-mediated DNA transfer to or transduction with recombinant viral vectors. Such active treatment protocols have been proposed to transfer DNA into several different cell types including epithelial cells. { US Patent 4,868,116; Margan and Mulligan W087 / 00201; Morgan et al., 1987, Science 237Í 1476-1479? Morgan and Mui Ligan, U.S. Patent No. 4,980,286), endothelial cells (W089 / 05345), hepatocytes (14089/07136? Wolff et al., 1987, Proc. Nati. Acad. Sci. USA 84: 3344-3348? Ledley et al. al., 1987 Prac. Nati, Acad. Sci. 84: 5335-5339; Wilson and Mulligan, W089 / 07136; Wilson et al., 1990, Proc. Nati. Acad. Sci. 87: 8437-8441) fibroblasts (Palmer et al, 1987, Proc. Nati, Acad Sci USA 84: 1055-1059: Anson et al., 1987, Mol. Biol. Med. 4: 11-20: Rosenberg et al., 1988, Science 242: 1575 -1578: Naughton &Naughfcon, US Pat. No. 4,963,489), lymphocytes (Anderson et al., US Patent No. 5,399,346, Blaese, RM et al., 1995, Science 270: 475-480) and hem topoytic precursor cells. B. et al. 1989, Prac. Nati Acad. Sci. USA 86: 8892-8996; Anderson et al., US Patent No. 5, 399, 346). Recently, in vivo direct transfer of genes with DNA formulations trapped in lipasomes has been attempted (Ledley et al., 1987, J. Pediatrics 110: 1); or in proteoliposomes containing viral envelope receptor proteins (Nicolau et al., 1983, Proc.Nat.Acid.Sci.U.S.A.80: 1068); and DNA coupled to a poly-1-γ-glycoprotein complex vehicle. In addition, "gene triggers" were used to deliver genes into cells (Australian Patent No. 9068389). It has been speculated that naked DNA, or DNA associated with liposome, can be formulated in solutions with liquid carriers for injection into the interstitial spaces for DNA transfers in cells (Felgner, W090 / 11092). Perhaps one of the main problems associated with current genetic therapies, both ex vivo and in vivo, is the inability to efficiently transfer DNA into a population of target cells and achieve a high level of gene product extension in vivo. Viral vectors are considered the most efficient system, and defective viral vectors have been used for recombinant replication to transduce (ie, infect) both ex vivo and in vivo cells. Such vectors have included retroviral vectors, adenoviruses and viral vectors associated with adenoviruses and herpes. While they are highly efficient for transferring genes, the main disadvantages related to the use of viral vectors include the inability of many viral vectors to infect non-dividing cells; problems related to insertional utagenesis; inflammatory reactions to the virus and potential production of helper virus, and to production and transmission of harmful virus to other human patients. In addition to the low efficiency of most cell types for collecting and expressing foreign DNA, many populations of focused cells are found in numbers so low in the body that the efficiency of DNA presentation to specific types of target cells is even more diminished. There is currently no protocol or method to increase the efficiency with which DNA is focused on the target cell population. 3. COMPENDIUM OF THE INVENTION The present invention relates to a novel method for specifically targeting and transferring DNA in mammalian repair cells involved in wound healing for the purpose of expressing therapeutic products at the wound site. The method of the invention includes the administration of a gene-activated matrix at a site of fresh injury in the body. In this environment, the repair cells are located at the site of the wound, where they become transfected and eventually produce agents encoded by DNA (RNA, proteins, etc.) that increase wound healing. The invention is based, in part, on the discovery that repair cells, active in the healing process of lesions, proliferate and migrate from the surrounding tissue to the wound area and infiltrate the gene-activated matrix. The matrix acts as a scaffold that promotes cell growth and, in turn, gene transfer, through the local accumulation of repair cells near DNA. While in the matrix, repair cells are surprisingly efficient in collecting DNA and expressing it as translational products, ie, proteins, or transcription products, ie, antisense and ribose as. The transfected repair cells then serve as local biareactars by amplifying the production of the gene product in vivo. While any number of DNA sequences can be employed in the method, preferred DNA sequences are the sequences q >They encode the translation products (ie, proteins) or transcription products (ie, antisense or ribaso ace) that (a) promote tissue repair; or (b) they can interrupt the disease process (thus allowing normal tissue healing).

The invention overcomes the limitations of the procedures currently used for wound healing that include the administration of therapeutic proteins. Priípero, the DNA, is both stable and non-toxic, it can be safely administered in high doses in vivo. Second, there is no need for repeated administration, even when such repeated administration is possible. Cells that collect and express DNA provide a supply of gene product at the site of injury. Third, the invention can be practiced in such a way that it adapts to the temporary dosing requirements. For example, DNA can be presented in vectors that are integrated into the genome of the target cell. In this house, all fixed cells will contain and express the transferred DNA, thus acting as a continuous source for the therapeutic agent. In contrast, non-integration systems can be used where the DNA is not integrated into the genome and the gene does not pass into the fixed cells. In such a case, when the wound healing process ends and the gene product is no longer needed, the gene product is not expressed. The invention is demonstrated by means of examples showing that genes can be transferred and expressed reproducibly in various damaged soft and hard tissues. Specifically, it is shown that the method of the present invention overcomes the problems related to the currently available protocols of gene therapy.

The method of the present invention offers a transfer of genes to an adequate number of repair cells to achieve functional effects, ie, in the absence of any other cellular or target identification by the physician. In vivo methods of genetic therapies require a certain form of di- recision that very often does not work. In the method of the invention, retrieval is not a problem. By analogy, DNA acts much like a "bait" in a "trap": repair cells find the DNA that has been prserved and then released into the matrix activated by genes. These cells, in turn, have a surprising capacity to collect DNA and express it as a therapeutic agent. In one embodiment of the invention, the method of the present invention can be employed as a drug delivery system through the transfer of DNA into mammalian repair cells for the purpose of stimulating a soft tissue repair and tissue regeneration. The repair cells will be the cells that normally arrive at the area of the lesion to be treated. Accordingly, there is no difficulty associated with obtaining suitable target cells to which the therapeutic compositions should be applied. All that is required is the implantation of a matrix activated by genes at the site of the lesion. The nature of this biological entanglement is such that the appropriate repair cells will actively collect and express the DNA in the absence of any additional information to cell identification by the physician. In atra mode, the method of the present invention, using both biological and synthetic matrices, can be used to transfer the DNA into repair cells in mammals to stimulate skeletal regeneration. In a further embodiment, the method of the present invention, employing both biological and synthetic matrices, can be used to transfer the DNA into mammalian cells to stimulate ligament and tendon repair. The method of the invention can be further employed, employing both synthetic and synthetic camo matrices, to transfer DNA into mammalian repair cells to stimulate skeletal muscle repair and / or repair blood vessels. In DNA to be used in the practice of the present-; invention can include any DNA encoding translational products (ie, proteins) or transcription products (i.e., antisense or ribazymes) that promote tissue repair or that may interrupt a disease process. For example, DNA may comprise genes encoding therapeutically useful proteins such as growth factors, cytokines, hormones, etc. Finally, DNA can encode anti-sense molecules or ribazymes that can inhibit the translation of mRNAs that encode proteins that inhibit the healing of lesions that induce inflammation. The DNA encoding the therapeutic product of interest is associated with a matrix or impregnated within a matrix to form a matrix activated by genes. Once prepared, the gene-activated matrix is placed in the mammal at the site of an injury. The invention is demonstrated through examples, where the efficiency of in vivo transfer and expression of genes in tissues subjected to repair and regeneration is demonstrated. 3.1 DEFINITIONS Camo is used here, the following terms shall have the meanings indicated below. A gated-activated matrix (8AM) is defined herein as any matrix material containing DNA encoding a therapeutic agent of interest. For example, gene-activated matrices are placed within sites in lesions in the body of a mammalian host to effect healing of the lesion.

A repair cell is defined herein as any cell that is stimulated to igrate and proliferate in response to a tissue injury. Repair cells are a component of the healing response of lesions. Such cells include fibroblasts, capillary endateliales cells, capillary pericytes, mononuclear inflammatory cells, segmented inflammatory cells and granulation tissue cells. A wound site is defined as any location in the host that arises from traumatic tissue damage, or alternatively, from tissue damage induced by surgical procedures or resulting from surgical procedures. 4. DESCRIPTION OF THE DRAWINGS Figure 1A: Fibrous Non-union Femoral Osteotomy Model. A 5-m osteotomy was created surgically in the femurs of adult male Sprague-Dawley rats. The spaces shown here are representative of the entire control group, with mammalian hosts receiving either an osteotomy alone (n = 3), an osteotomy plus a collagen sponge (n = 10) or / and an osteotomy plus a collagen sponge containing a control plasmid DNA (marker gene) (n-23). A simple x-ray film showing a control rat femur immediately after the surgical intervention. The gap was stabilized by an external fixture consisting of a plate and 4 nails. The skin incision was closed by a pair of metal staples. Figure IB: A ray film? simple that shows a rat femur osteotomy of control 9 weeks after the surgical intervention. The rounded surgical margins (arrows) lead to a reactive bone formation and are consistent with the classic radiographic appearance of a joint fracture. Figure 1C: A hollow tissue histology section 3 weeks after the surgical intervention showing the proliferation of repair fibroblasts and capillaries integrated in an extracellular edematous matrix. A focal inflammatory infiltrate of lymphocytes and macrophages is also present. Figure ID: Histology section of a 9-week control gap showing dense fibrous tissue. lcm = 20 μm (C and D). Figure 2: Schematic diagram of the pBAMi construct encoding mouse BMP-4. The position of the CMV promoter, BMP-4 coding sequence, HA epitopes, and bovine growth hormone polyadenylation signal are indicated. Figure 3A. Expression of BMP-4 by fib oblas os of repair. The expression of plasmid-encoded BMP-4 was detected in paraffin-embedded, demineralised tissues, fixed with Bauins, using the anti-HA antibody and immunosuppressed method 4 weeks after the implantation of an activated matrix by a gene containing DNA from plasmid pGAMl. The arrows indicate examples of positive staining (red-brown) of fibroblast cytoplasm (micrograph in the upper left part). These cells were identified as fibroblasts based on spindle morphology, fascicle growth, and positive immunology for type I procollagen (not illustrated). Serial sections incubated with pre-rabbit serum or without the first antibody were negative. Negative results were also obtained with fictitiously operated controls (collagen sponge alone) incubated with the anti-HA.ll antibody (micrograph in the upper right). Consistently, a false positive staining of tacr? Phages, asteoplasts, and astesblasts was observed in control sections incubated with the HA.11 antibody. A newly formed bone island is shown 3 weeks after the transfer of pGAMl into the micrograph at the bottom, to the left. New bone is related to the formation of granulation tissue. A high-magnification view of freshly squeezed bone is shown in the micrograph at the bottom, to the right. Arrows indicate presumed ostesb 1 astss on the surface of trabeculae of new bone. Hollow tissues were stained using hematoxylin and eosin. { superior micrograph) or with Gomori's trichromatic method (tissues rich in collagen have a green appearance ^ lower micragraphs). Icm = 20 mm. { superior micrographs). Figure 3B. X-ray of simple animal films (23 weeks after the operation). On single film radiography (left), the arrow indicates the approximate position of the osteotomy gap that is filled with radiodense tissue. Note that the external fixator has been removed. As indicated by the veined pattern, bone remodeling is underway. The arrowheads indicate defects in bone adjacent to the hollow (a consequence of nail placement). The two distal nail sites presented complete healing at this time (not illustrated). The entire mounted photograph (right) presents a section of tissue dyed in a trichromatic way according to Gomori of the hollow of the illustrated animal (after the sacrifice). Arrows point towards the hollow that is now covered by a well integrated cortical bone. Circular defects in the marrow space (any space of the bone) result from the placement of more internal fixation pins. The tissue disruption at the bottom of the micrograph is a sample management artifact. Figure 4A. Schematic diagram of the p6AM2 construct that encodes human PTH1-34. The position of an upstream long terminal repeat that drives the expression of PTHI-34 (arrow), the coding sequence of PTH1-34, the SV40 promoter that drives the expression of neo (arrow), the coding sequence of neo, pBR sequences, and the downstream long terminal repeat are illustrated. Figure 4B. The transfer and expression of the PTH1-34 gene drives the formation of new bone in vivo. A simple film radiograph showing new bone source from a 5 mm osteotomy gap 9 weeks after planting in an animal that received a matrix activated by a gene containing plasmid pGAM2 DNA. The arrows indicate radiating tissue in the hole. The results shown here are representative of experiments with an additional animal. Figure 5. New bone formation in vivo through a SAM of two plasmids. (top) simple film radiograph showing new bone bridge from a 5mm gap 4 weeks after implantation in an animal that received a matrix activated by gene containing plasmid DNA from pGAMl plus pGAM2. Arrows indicate radiodense tissue in the hollow (histologically confirmed to be bone), (bottom) simple film radiograph of the hollow shown in the photo above after the removal (5 weeks before; total of 17 weeks after the surgical intervention) of the external fixator. The arrows indicate the location of the hollow that is filled with radiodense tissue except in the case of a band of submillary tissue 1 hoisted near the proximal surgical margin. As indicated by the veined pattern, an extensive replenishment response is being carried out. The results shown here are representative of experiments with an additional animal. Figure 6. Adenovirus-mediated gene transfer in bone repair / regeneration cells in vivo. The UltraFiber (r) implant was immersed for 6 min. in a solution of the AdCMVlacZ virus (10,000,000,000- 100,000,000,000 plaque-forming units or PFU / l) and then implanted in the osteotomy site. The defect was allowed to heal for 3 weeks during that time the progression of the wound healing response was moni- tored by a weekly radiographic examination. At 3 weeks, it was estimated that 40 of the defect was filled with callous tissue. The mammalian host was sacrificed and the tissues were fixed in Bouins' fixation, then demineralized for 7 days using standard solutions of formic acid. Photomicrographs were taken of cross sections of new bone (calcae) that formed at the site of the osteotomy 3 weeks after the surgical intervention. Panel in the upper left: note the positive beta-gal topical staining (red) of cells of the callus tissue of the UltraFiber adenovirus implant (mr). This result indicates that cell surface receptors that measured infection, and consequently viral transmission, are expressed by callus cells (at least one population) during this process of fracture healing. Panel in the left upper part: negative control of serial cut stained with the vehicle of the Beta-gal antibody plus non-specific rabbit LgS antibody cackles. Panel at the bottom: note the positive Beta-gal (red) core staining of chondracites at the osteotomy site filled with UltraFiber (r) and AdRSVntlacZ. This result demonstrates the exquisite specificity of the apti- Beta-al antibody, and demonstrates conclusively the expression of the marker gene product in the osteotomy gap. Figure 7. The transfer of plasmid pGAM2 gene to repair fibroblasts results in a new bone growth in the rat osteotomy model. Simple film radiograph showing new bone source from a gap of 5m 6 weeks after implantation in an animal that received a matrix activated by gene containing pGAMI plasmid DNA plus pSAM2. The flachas indicate radiodense tissue in the hollow (it was confirmed histologically that it was bone). 5. DETAILED DESCRIPTION OF THE INVENTION The present invention relates to an in vivo method for the presentation and rearrangement of DNA in mammalian repair cells for the purpose of eKprssa. r therapeutic agents. The method of the present invention includes the implantation or placement of gep-activated matrices at a recent wound site. The healing of wounds is usually a tereotypic, coordinated sequence of events that includes (a) tissue disruption and loss of normal tissue architecture; (b) cell necrosis and hemorrhage; hemsstasis (clot formation); (c) infiltration of segmented and manonucidal inflammatory cells with vascular congestion and tissue edema; (d) dissolution of the clot as well as damaged cells and tissues by mananuclear cells (sacrofhages) (e) formation of granulation tissue (fibroplasia and angiagenesis). This sequence of cellular events has been observed in lesions of all tissues and organs generated in a large number of mammalian tissues (Gailet et al., 1994, Curr Opin Cell Cell Biol. 6: 717-725). Therefore, the cellular sequence described above is a universal aspect of the repair of all the tissues of mammals. The invention is based on the discovery that the repair cells involved in the healing process of lesions prsliferan and naturally go to the site of tissue damage and infiltrate the gene-activated matrix. Surprisingly, these repair cells, which are normally difficult to transfect efficiently, either in vitro or in vivo, are extremely efficient at absorbing and expressing DNA when the healing process of injury activates them to proliferate. Taking advantage of this feature, the methods of the present invention are designed to efficiently transfer one or more DNA molecules encoding therapeutic agents to the proliferating repair cells. The methods include administering a matrix activated by a gene that contains DNA encoding translational products (ie, therapeutic proteins) or transcription products (ie, antisense or ribosomes) within a mammalian host at the site of a wound. . The wound may arise from traumatic tissue damage, or alternatively, from tissue damage and s. is induced by surgical procedures or resulting from surgical procedures. As the proliferating repair cells igar in a gene-activated matrix and make contact with it, they collect and express the DNA of interest thereby amplifying the amount of the therapeutic agent, protein or RNA. The transfected repair cells thus serve as local bioreactors that p vadmzeex therapeutic agents that influence the local repair environment. For example, growth factors or cytokines produced by transfected repair cells will bind and stimulate white effector cells that express cell-coagulated surface receptors, thus stimulating and amplifying the cascade of physiological events normally associated with the healing process of lesions. Automatically, repair cells can absorb and express DNA that encodes proteins that inhibit the activity of antagonists in the process of c rac tion of lesions. DNA can also encode RNA molecules from ribozyme to antisense that can be used to inhibit mRNAs that encode inflammatory proteins or other factors that inhibit wound healing or cause excessive fibrosis. The matrix activated by the gene of the invention can be transferred to the patient using various techniques. For example, when they stimulate the healing and regeneration of wounds, the matrices are transferred directly to the site of the injury, that is, the fractured bone, the damaged connective tissue, etc. For use in the repair of the skin, the matrices are applied topically. For their use in organ regeneration, the matrices are placed chemically in a lesion in the organ. Since the method of the present invention is based on the migration and natural proliferation of repair cells at a site of injury, and infiltration into the matrix activated by the gene located at the site of the lesion, followed by DNA uptake, he understands that the matrices must be transferred to a site in the body where the healing process of the injury has been induced. A particularly important feature of the present invention is that the repair path can be manipulated to result in either the formation of tissue healing and / or tissue regeneration. For example, overexpression of therapeutic proteins at the wound site can result in regeneration of damaged tissue without formation of scar tissue. In such cases, for example, in the case of bone repair, said regeneration is desirable because the healing tissue is not optimally designed to support a normal mechanical function. Alternatively, around a suture it may be desirable to form scar tissue to inherently maintain weak tissue together. Accordingly, the methods of the invention can be used to stimulate the healing of lesions with or without the formation of healing tissue according to the type and level of therapeutic pratein stressed. Direct transfer of plasmid DNA from a matrix to a mammalian repair cell, by stimulating the wound healing process, offers many advantages, first, the ease of production and purification of DNA constructs compares favorably with the cost of the traditional method of protein production. Second, matrices can act as structural scaffolds that, in themselves, promote cell growth and proliferation. Thus, they facilitate the directing of repair cells for gene transfer. Third, direct gene transfer can be a useful method of administering drugs for molecules that are normally subject to complex biasynthetic processing or for receptors that were properly placed on the cell membrane. These types of molecules do not work if they are administered exogenously to the cell. The present invention also relates to pharmaceutical compositions comprising matrices containing DNA for their. Use in healing wounds. The compositions of the invention are generally formed by biacampatible or compatible bone matrix material, which contains DNA encoding a therapeutic protein of interest. The invention overcomes the indications specifically associated with current therapies with recombinant proteins for applications in wound healing. First, direct gene transfer is a rational strategy that allows transfected cells to (a) make physiological amounts of therapeutic protein, modified in a manner *? 5 specifies for tissue and context, and (b) supplying this protein to the appropriate cell surface signaling receptor under the appropriate circumstances. For reasons described above, exogenous administration of such molecules is associated with important administration and dosing problems. Second, repeated administration, while possible, is not required with gene-activated matrix technology: the uptake of DNA cells can be controlled precisely with well-established long-term release technologies, or, alternatively, the integration of transfected DNA can be related to the long-term expression of recombinant protein. The method of the present invention can be applied universally to lesions involving many different cells, tissues and organs; granulation tissue repair cells (Gailet et al., 1994, Curr Opin Cell Cell Bioi 6: 717-725) are "focused" when the method of the invention is emplaced. The invention is demonstrated here in three animal models (dog, rat and rabbit) and five tissues (bone, tendon, ligament, blood vessel and skeletal muscle), using three marker genes (Beta-alactssida = a, luciferase and alkaline phosphatase) three Promoter systems (CMV, RSV, LTR and SV40), two types of matrices (biological and synthetic). In all cases, the repair cells that migrated to the matrix activated by genes were successfully transfected. Particularly, a functional result (bone growth) was demonstrated after the transfer of genes to fibroblasts to repair a plasmid tire that encodes either BMP-, which acts as a signal transduction switch for osteoblast differentiation and growth (Wazney , 1992, Mol. Reprod Dev. 32: 160-167; Reddi, 1994, Curr. Opin Benet, Deve. 4: 737-744) or PTH1-34, which recruits osteoprsgeni? Er cells (Orisff, et al. 1992, Endocrology 131: 1603-1611; Dempster et al, 1995 Endocrin Rev. 4: 247-250). 5.1 MATRIX ACTIVATED BY GEN Any biocompatible matrix material containing DNA encoding a therapeutic agent of interest, such as translational product, ie, therapeutic pratein, or transcription products, ie, antisense or ribasy, may formulated and employed in accordance with the present invention. The gauge-activated matrices of the present invention may be derived from any bi-encapsable material. Such materials may include, but are not limited to, biodegradable or non-biodegradable materials formulated in scaffolds that support cell growth and fixation, powders or gels. Matrices of synthetic polymers or proteins that occur naturally, for example, collagen, other extracellular matrix proteins, or other structural macromolecules can be derived. The DNA incorporated in the matrix can encode any of several therapeutic proteins according to the intended therapeutic use. Such prateins may include growth factors, cytosine, hormones or any other protein capable of resulling the growth, differentiation or physiological function of the cell. DNA can also encode molecules of ribos i a or antisense i ^ and inhibit the translation of proteins that inhibit the repair of lesions and / or induce inflammation. The transferred DNA may not be integrated into the genome of the target cell; in fact, the use of non-integrating DNA in the matrix activated by genes is the preferred embodiment of the present invention. In this way, when the ion curing process ends and the gene product is no longer required, the gene product is not expressed. Therapeutic kits containing a patchy bisca matrix and DNA form another aspect of the invention. In some cases, the aquipas contain matrices activated by preformed cells thus allowing the physician to directly administer the matrix within the body. Alternatively, doses may contain the necessary components for the formation of a matrix activated by genes. In such cases, the physician can combine the components to form the matrices activated by genes that can then be used therapeutically by placement in the body. In one embodiment of the invention, the dies can be used to coat surgical devices with, for example, suture materials or implants. In another embodiment of the present invention, the gene-activated matrices include sponges, tubes, bandages, lyophilized components, gels, patches, well powders and telfa cushions ready for use. 5.1.1 MATRIX MATERIALS In one aspect of the present invention, compositions are prepared wherein the DNA encoding the therapeutic agent of interest is related to a matrix or is impregnated within said matrix to form a matrix activated by genes. The matrix compositions work ii) to facilitate the growth of repair cells (addressing); and (ii) to contain the DNA (administration). Once the matrix activated by genes has been prepared, said matrix is stored for future use or immediately placed at the site of the lesion. The type of matrix that can be employed in the compositions, devices and methods of the present invention is virtually limited and can include both biological and synthetic matrices. The matrix will have all the ^ Q characteristics commonly associated with "Biocopatibility" to the extent that it has a form that does not produce an adverse, allergic or other reaction when administered to a mammalian host. Such matrices can be formed of both natural and synthetic materials. The matrices can be non-bioavailable in cases in which it is desired to leave permanent structures in the body; or they can be made from degradable material when the expression of the therapeutic protein is only required for a short period of time. The matrices can be in the form of sponges, implants, tubes, taifa coils, bandages, cushions, lyophilized components, gels, patches, and well nanoparticles.

In addition, matrices can be designed to allow the prolonged release of DNA for long periods of time. The invention of the matrix material will be different in accordance with the particular circumstances and the site of the wound to be treated. Matrices such as those described in U.S. Pat. No. 5,270,300, which is incorporated herein by reference, may be employed. Physical and chemical characteristics such as biocampat ib 11, biadegradabí 1 idad, resistance, rigidity, interface property and cosmetic appearance can be taken into consideration when choosing a matrix, as you know it 50 well the experts in the field. Appropriate matrices will administer the DNA molecule and will also act as a scaffold in situ through which mammalian repair cells can span. When the matrices are to be maintained for long periods of time, non-bispecific matrices may be used, for example, sintered hydroxyapatite, bioglass, alumina, other bioceramic materials and metallic materials, particularly titanium. A suitable administration system based on ceramics is that described in U.S. Pat. No. 4,596,574, which is incorporated herein by reference. The bioceramics can be altered in terms of their composition, such as calcium-aluminium phosphate; and can be processed to modify particular physical and chemical characteristics, such as, for example, pore size, particle size, particle shape, and biadegradability. Polymeric matrices, including acrylic ester polymers and pallets of lactic acid, may also be employed, as presented in US Pat. 4,521,909 and 4,563,489, respectively, which are incorporated herein by references. Particular examples of useful polymers are orthoesters, anhydrides, propylcocortrans, or a polymer of one or more gamma-hydrocarboxylic acid onomers, for example gamma-hydroic acid (glycolic acid). ) and / or gam a-hydraxypropionic acid (lactic acid). A particularly important aspect of the present invention is its use in connection with orthopedic implants to artificial interfaces and joints, including the implants themselves and functional parts of an implant, such as screws, surgical pins, etc. In preferred embodiments, it is contemplated that the metallic surface or the metal surfaces of an implant or a part thereof, such as titanium surface, will be coated with a material having affinity for the nucleic acids, more preferably a roxi lapatit, and then the coated metal will be coated adiciapal epte with the gene or nucleic acid to be transferred. The available chemical groups of the absorption material, such as hydra-iapati t, can be easily manipulated to control their affinity for nucleic acids, as is known to those skilled in the art. In preferred embodiments, it is contemplated that a biodegradable matrix is likely to be most useful. A biodegradable matrix is generally defined as a matrix that can be reabsorbed in the body. Potential biodegradable matrices for your. use in relation to compositions, devices and methods of this invention include, for example, calcium sulfate, calcium triphosphate, hydroxyapatite, polylactic acid, polyanhydrides, purified protein matrices, and extracellular matrix compositions are defined chemically and biodegradable. Other biodegradable and biocampatible polymers which may be employed are well known in the art and include, by way of examples and not to limit the present invention, polyesters or plastic axes, palilcides and polymers of polylactic acid. igl icol ico ("PLGA") (Langer and Falkman, 1976, Nature 263: 797-800); bed polyethers for example polyapralactone ("PCL"); polyhydric acid; cyanoacrylates of poiyalkyl such as, for example, n-butyl cyanoacrylate and isopropyl cyanoacrylate; pal lick and lick; pol i (orthoesters); pol i fosf genos; polypeptides; polyurethanes; and mixtures of these polymers. It is understood that virtually any polymer known to be later developed suitable for the sustained or controlled release of nucleic acids can be employed in the present invention. In preferred embodiments, the biodegradable biodegradable polymer is a copolymer of glycolic acid and lactic acid ("PLCA") having a ratio between the units of lactic acid, units of glycolic acid lying between 100/0 and approximately 25/75. The average molecular weight ("MW") of polymer will typically be located within a range of about 6,000 to 700,000 and preferably from about 30,000 to 120,000 in accordance with that determined by gel permeation chromatography using commercially available polystyrene of molecular weight. standard, and will have an intrinsic viscosity within a range of O.5 to 10.5. The duration of the period of continuous administration to controlled release of nucleic acids from the matrix according to the present invention will depend to a large extent on the average molecular point of the polymer and on the composition ratio between lactic acid and glycoic acid. In general terms, a higher ratio between lactic acid and glycolic acid, such as for example 54/25, will provide a longer period of controlled or sustained release of nucleic acids, while a lower proportion between lactic acid and glycolic acid will provide a faster release of nucleic acids. Preferably. ^ The ratio between lactic acid and glycolic acid is 50/50. The length of the sustained or controlled release period will also depend on the average molecular weight of the polymer. Generally, a higher molecular weight polymer will provide a longer period of controlled or sustained release. In the case of the preparation, for example, of matrices that provide a controlled or sustained release for about 3 months, when the ratio in terms of composition of the lactic acid and glycolic acid is 10/0, the average molecular weight preferable of the polymer is within a range of about 7,000 to 25,000; when the ratio between lactic acid and glycolic acid is 90/10, the preferable average molecular weight of the polymer is within a range of 6,000 to 30,000; and when the ratio between lactic acid and glycoic acid is 80/20, the preferable average molecular weight of the polymer is within a range of about 12,000 to 30,000. Another type of bio-material that can be used is the small intestinal submucosa (SIS). The SIS graft material can be prepared from a segment of the jejunum of adult pigs. The tissue sample isolation can be carried out using routine tissue culture techniques, for example, the techniques presented in Badybafc et al., 1989, J. Surg. Res. 47: 74-80. The SIS material is prepared by removing the mesenteric tissue, reversing the segment, followed by the removal of the mucosa and superficial submucosa using a mechanical abrasion technique. After returning the segment to its original orientation, the serosa and muscle layers are rinsed and stored for later use.

Another particular example of a suitable material is fibrous collagen which can be lyophilized after extraction and partial purification from tissue, and then sterilized. Matrices can also be prepared from collagen of tendon or dermal collagen, which can be obtained from various commercial sources such as Sigma and Collagen Corporation. Collagen matrices can also be perpared as described in US patents no. 4,394,370 and 4,975,527, which are incorporated herein by reference. In addition, cross-links made from collagen and gi icosami or lcano (GAG) can be employed as described in Y nnas & Burke, North American patent na. 4,505,266, in the pré.ci; í s. of the present invention. The collagen / GAG matrix can effectively serve as a scaffold or scaffold structure where repair cells can migrate. A matrix of collagen can also be used as matrix material, as for example that described in Bell, US Patent no. 4,485,097. The various collagenous materials can also be found in the form of my collagen. For example, the fibrous collagen implant material called Ul traFiber (mr), obtainable from Norian Corp., (1025 Terra Bella Ave., Mountain View, CA, 94043) can be used for matrix formation. The North American patent no. 5,231,169, which is 56 incorporated herein by reference, describes the preparation of mineralized collagen through the formation of calcium phosphate mineral under agitation lava in situ in the presence of dispersed collagen fibrils. Such a formulation can be employed in the context of the delivery of a segment of a nucleic acid segment to a bone woven site. Mineralized collagen may be used, for example, as part of a matrix-activated therapeutic kit for genes for fracture repair. Collagen has been identified at least 20 different forms and each of these collagen can be used in the practice of the invention. For example, collagen can be purified from hyaline cartilage, which is isolated from diatradial joints or growth plates. Type II collagen purified from hyaline cartilage is commercially available and can be purchased, for example, from Sigma Chemical Company, St. Louis. Type I collagen from rat tail tendon can be purchased, for example, from Collagen Corporation. Any form of recombinant collagen, which can be obtained from a host cell that replaces collagen, including bacterial yeast, mammalian cells and insect cells, can also be employed. When collagen is used as matrix material, it may be helpful to remove what is known as the "talopyptide", which is located. at the end of the collagen molecule and which is known to induce an inflammatory response. The collagen used in the present invention can, if desired, be supplemented with additional minerals such as calcium, for example in the form of calcium phosphate. As much the collagen of native type like recombipante can be complemented by means of the mixture, absorption, to well association of another type with additional minerals of this form. 5.1.2 DNA The present methods and compositions may employ several different types of DNA molecules. The DNA molecules can include genomic DNA, cDNAs, single-stranded DNA, double-stranded DNA, triple-stranded DNA, oligonucleotides and Z-DNA. DNA molecules can encode several factors that promote the healing of lesions, including extracellular, cell surface, and intracellular RNAs and proteins. Examples of extracellular proteins include growth factors, citpins, therapeutic protein, hormones, and hormone peptide fragments, inhibitors of cytosine, growth and differentiation factors of peptides, interieucins, chemokines, interferons, stimulation factors of colonies as well as angiogenic factors. 58 Examples of such proteins include, but are not limited to, the TGF-beta molecule superfamily, including the 5 isafaces of TGF-bata and bone morphogenic proteins (BMP), latent-binding proteins of TGF-beta LTBP; keratinocyte growth factor (KGF); hepatacyte growth factor (HGF); platelet-derived growth factor (PDGF); insulin-like growth factor (IGF); the basic fibroblast growth factors (FGF-1, FGF-2, etc.), vascular endothelial growth factor (VEGF); Factor VIII and Factor IX; erythropoietin (EPO); tissue plasminogen activator (TPA); activins and inhibins. Hormones that can be employed in the practice of the foregoing invention include growth hormone (GH) and parathyroid hormone (PTH). Examples of extracellular proteins also include extracellular matrix proteins such as, for example, alkaline, laminin, and fibronectin. Examples of cell surface protein include the family of cell adhesion molecules (eg, integrins, selectins, members of the Ig family such as for example N-CAM and Ll, and cadherins); cyclin signaling receptors such as TGF-beta type I and type II receptors and the FGF receptor; and signaling co-receptors such as betaglycan and syndecan. Examples of intracellular RNAs and proteins include the family of signal transduction kinases, ci toesqueletal proteins camo for example taima and vinculin, cyclin binding proteins such as for example the family of latent linker prsteins of TGF-beta, and nuclear proteins us they act in trans, such as transcription factors and enhancement factors. DNA molecules can also encode proteins that block pathological processes, thus allowing the natural healing process of lesions to develop unhindered. Examples of blast factors include ribosomes that destroy the function of APN and DNAs that, for example, encode tissue inhibitors of enzyme that destroy the integrity of the proteins, for example, inhibitors of etaloproteinases associated with arthritis. One can obtain the DNA segment by coding the protein of interest using a variety of molecular biology techniques generally known to those skilled in the art. For example, genomic libraries or cDNA can be screened using primers or probes with sequences based on known nucleotide sequences. A palimerase chain reaction (PCR) can also be employed to generate the DNA fragment encoding the pratein of interest. When energetically, the DNA fragment can be obtained from a commercial source. Genes with sequences that vary from those described in the literature are also encompassed by the invention insofar as the altered or modified gene continues to encode a protein that functions to stimulate the healing of lesions directly or indirectly. These sequences include those caused by point mutations, sequences due to degenerations of the genetic code or allelic variants that occur naturally, and additional modifications introduced by genetic manipulation, that is, by the hand of man. Techniques for introducing changes in nucleotide sequences designed to alter the functional properties of encoded proteins or psipeptides are well known in the art. Such modifications include the removal, insertion or substitution of bases that result in changes in the amino acid sequence. Changes can be made to increase the activity of a coded protein, to increase its biological stability or half-life, to change its glycosylation pattern, to provide sensitivity to temperature or to alter the protein expression pattern and the like. . All these modifications to the nucleotide sequences e.t§p encompassed by this invention. The DNA encoding the translational or transcriptional products of inerts can be manipulated particularly in several vector systems that provide large-scale replication of DNA for the preparation of gene-activated matrices. These vectors can be designed to contain the necessary elements to direct the trapsciption and / or translation of the DNA sequence collected by the repair cells in the wound in vivo. Vectors that can be used include, but not limited to, the vectors derived from bacteriophage DNA recombinant plasmid DNA or AE'N of costed. For example, plasmid vectors such as pBR322, pUC 19/18, pUC 118, 119 and the M12 mp series of vectors can be used. Bacteriophage vectors can include lambda gtlO, lambda gtíl, lambda gtl8-23, lambda ZAP / R and the EMBL series of bacteriophage vectors. Vectors that can be used include, but are not limited to, pJB8, pCV03, pCV 107, pCV IOS, pTM, pMCS, pNNL, pHSG274, COS202, C0S203, pWE! 5, pWE16 and the caromide 9 series. vectors that allow the in vitro transcription of RNA, for example, the SP6 vectors can also be used to produce large amounts of RNA that can be incorporated in the matrices. Alternatively, recombinant mantle virus vectors including. Without being limited thereto, virus derivatives such as herpes viruses, retroviruses, viral viruses, adenoviruses, adeno-associated viruses or bovine papilloma viruses can be manipulated.

While they can use integrating vectors, non-integrating systems, which do not transmit genetic engineering to fixed cells for many generations, they prefer to heal wounds. In this way, the gene product is expressed in the wound healing process, and as the gene is diluted in subsequent generations, the expressed amount of gene product also decreases. Methods well known to those skilled in the art can be employed to construct expression vectors containing the protein coding sequence operably associated with appropriate transcription / translation control signals. These methods include in vitro recombinant DNA techniques as well as synthetic techniques. See, for example, the techniques described in Sambroak, et al., 1992, Molecular Cloning, A Laboratory Manual (Molecular Cloning, A Laboratory Manual), Cold Spring Harbor Laboratory, N.Y. and Ausubel et al., 1989, Current Protocols in Molecular Bialogy, (Current Protocols in Molecular Biology), Greene Publishing Associates% /. Wiley? Ntersc ience, N.Y. The genes that code for the proteins of interest can be operatively associated with several different pra stores / enhancer elements. The expression elements of these vectors can vary in their strength and specificities. Depending on the guest / vector system employed, any of several suitable transmission and translation elements may be employed. The promoter may have the form of a promoter naturally associated with the gene of interest. Alternatively, the DNA can be positioned under the control of a tuna-like or heterologous promoter, that is, a promoter not normally associated with this gene. For example, tissue-specific promoter elements can be used to regulate the expression of the transferred DNA in specific cell types. Examples of transcriptional control regions that exhibit tissue speci fi city described and that may be employed, include, but are not limited to: elastase I gene control region that is active in pancreatic acinar cells (Swift et al., 1984, Cell 38). : 639-646; Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol. 50: 399-409; MacDsnald, 1987, Hepatology 7: 42S-51S); insulin gene control region that is active in pancreatic Beta cells (Hanahan, 1985, Nature 315: 115-122); immunoglobulin gene control region that is active in lymphoid cells (Grosschedl et al., 1984, Cell 38: 647-658; Ada s et al., 1985, Nature 318: 533-538; Alexander et al., 1987 , Mol. Cell. Biol. 7: 1436-1 44); the albumin gene control region that is active in the liver (Pinkert et al., 1987, Genes and Devel., 1: 268-276); alpha-fetoprotein gene control region that is active in the liver (Kru la? f et al., 1985, Mol. Cell. Biol. 5: 1639-1648; Hammer et al., 1987, Science 235: 53- 58); control region of alpha-1-ant itr ipisin gene that is active in the liver (Kelsey et al., 1987, Genes and Devei. 1: 161-171); control region of the beta-glabine gene that is active in myeloid cells (Magram et al., 1985, Nature 315: 338-340, Kollias et al., 1986, Cali 46: 89-94); control region of the basic honey protein gene that is active in oligodendrocyte cells in the brain (Readhead et al., 1987, Cell 48: 703-712); Miasin light chain-2 gene control region that is active in skeletal muscle (Shani, 1985, Nature 314: 283-286); and ganadotropic release hormone gene control region that is active in the hypothalamus (Masan et al., 1986, Science 234: 1372-1378). Promoters isolated from the genome of viruses growing in mammalian cells can be used, (eg, RSV, vaccinia virus 7.5, SV40, HSV, adenovirus MLP, and LTV and CMV MMTV promoters), as well as promates produced by DNA recombinant or biep synthetic techniques. In some cases, the promoter elements can be either inducible or inducible promoters and can be employed under appropriate conditions to direct a regulated or high-level expression of the gene of interest. The expression of genes under the control of constitutive promoters does not require the presence of a specific substrate to induce the expression of genes and will occur under all cell growth conditions. By contrast, the expression of genes controlled by inducible promoters responds to the presence or absence of an induction agent. Sa also require specific initiation signals for sufficient translation of inserted protain coding sequences. These signals include the ATG initiation cadon and adjacent sequences. In cases where the entire coding sequence, including the insertion cadon and adjacent sequences are inserted into the appropriate expression vectors, additional translational control signals may not be required. However, in cases where only part of the coding sequence is inserted, exogenous translation control signals, including the ATG start codon, must be provided. In addition, the initiation codon must be in phase with the reading frame of the prstein coding sequences to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can come from various sources, both natural and synthetic. The efficiency and control of the expression can be explained by the inclusion of transcription attenuation sequences, increasing elements, etc.

In addition to the DNA sequences encoding therapeutic proteins of interest, the scope of the present invention includes the use of antisense DNA molecules or ribozymes that can be transferred into the mammalian repair cell. Such antisense and ribazymes molecules can be used to inhibit the translation of RNA encoding proteins from genes that inhibit a disease process or the healing process of injury thus allowing tissue repair to be carried out. The expression of antisense RNA molecules will act to directly detect the translation of tnRNA by binding to the target mRNA and preventing protein translation. The expression of ribozymes, which are enzymatic RNA molecules capable of catalyzing the specific dissociation of RNA can also be used to block protein translation. The mechanism of action of the ribozymes includes the specific hybridization of sequences of the ribozyme molecule with complementary white RNA, followed by a dissociation endonu.cleol í t ic. Within the scope of the invention, ribozytic molecules are manipulated > t.a for hammerhead motifs that specifically and efficiently catalyze the endonucleal dissociation of RNA sequences. RNA molecules can be generated by transcribing DNA sequences that encode the RNA molecule. Within the scope of the present invention, multiple genes can also be used, combined in a single genetic construct under the control of one or more promoters, or prepared with separate constructs of the same type or of different types. Thus, an almost infinite combination of different genes and genetic constructs can be used. Certain combinations of genes can be designed or else their use can re-introduce one another in the achievement of synergistic effects on the stimulation and regeneration of cells, each and every one of these combinations are within the scope of the present invention. In fact, many synergistic effects have been described in the scientific literature in such a way that a person with certain knowledge in the art could easily identify combinations of synergistic propablemanta genes, or even combinations of genes and proteins. 5.1.3. PREPARATION OF MATRICES ACTIVATED BY. GENES In preferred embodiments, a matrix or implant material is in contact with the DNA encoding a therapeutic product of interest by immersing the matrix material in a stock solution of recombinant DNA. The amount of DNA, and the amount of contact time required for the incorporation of DNA into the matrix, will depend on the type of matrix used "and a person with certain knowledge in the field will be able to easily determine them without extensive experiments.

DNA can be encapsulated within a matrix of synthetic polymers such as block polymers of polylactic acid (see Langer and Fslkman, 1976 Na ture, 263: 797-800 which is incorporated herein by reference). Again, these parameters can easily be determined by a person with certain knowledge in the field without extensive experiments. For example, the amount of a DNA construct that is applied to the matrix will be determined by considering several biological and medical factors. The particular gene, the matrix, the wound site, the age of the mammalian host, sex and diet are taken into account, as well as additional clinical factors that may affect the healing of the wound, such as the serum levels of various factors and hormones. . In further embodiments of the invention, compositions of biological and synthetic matrices and DNA can be lyophilized together in order to form a dry pharmaceutical powder. The matrix activated by yen can be rehydrated before its implantation in the body, or alternatively, the matrix associated with genes can be rehydrated naturally when it is placed in the body.In some cases, medical devices such as implants, sutures, wound healing, etc. they can be coated with the nucleic acid compositions of the invention employing conventional well-known coating techniques. Such methods include, by way of example but not limitation, the immersion of the device in the nucleic acid composition, the brush application of nucleic acid composition on the device and / or the spraying of the device with the aerosol nucleic acid compositions. . The device is then dried, either at room temperature or with the aid of a drying oven, optionally under reduced pressure. A preferred method for suture coating is offered in the exercises. In the case of sutures coated with a polymeric matrix containing plasmid DNA, applicants have discovered that the application of a coating composition containing a total of about 0.1 to 10 mg of plasmid DNA and preferably about 15 μl of plasmid DNA is preferred. mg of plasmid DNA, on a 70 cm long suture employing approximately 5 to 100, preferably about 5 to 50, and more preferably about 15 to 30 reversing applications provides a uniform and therapeutically effective coating.

In a particularly preferred embodiment, the invention provides coated sutures, especially sutures coated with a polymic matrix containing nucleic acids encoding therapeutic proteins that stimulate the healing of lesions in vivo. Sutures that can be coated in accordance with the methods and compositions of the present invention include any suture of natural or synthetic origin. Typical suture materials include, by way of example and not limitation, silk, cotton, linen, psilolefins such as polyethylene and polypropylene, palyesters such as polyethylene terephthalate, homopolymers and copolymers of hydraxicarbsixic acid esters. , collagen (simple or chromed), cat gut string (simple or chrome), and suture substitutes such as cyanaacri latos. The sutures may have any convenient shape, for example, strains or portions, and may have a wide range of sizes as is customarily employed in the art. The advantages of coated sutures, especially sutures coated with a polymeric matrix containing nucleic acids encoding therapeutic proteins that stimulate wound healing, cover virtually the entire field of surgical use in humans and animals. 5.2 USES OF THE MATRIX ACTIVATED BY GENES The invention can be applied to a wide range of wound healing situations in human medicine.

These situations include, but are not limited to, bone repair, tendon repair, and ligament repair, blood vessel repair, skeletal muscle repair, and skin repair. For example, through the use of a gene-activated matrix technology, the cyclin growth factors produced by transfected repair cells influence other cells in the wound, through the binding of cell surface signaling receptors, stimulating and amplifying thus the cascade of physiological events normally associated with the process of wound healing.

The final result is the increase in tissue repair and regeneration. The method of the present invention is also useful when the chemical object is to block a disease process, thus allowing the natural healing of tissue, or else the objective is to replace a genetically defective protein function. The lesions can arise from traumatic damage either to the energetic or to traumatic damage or alternatively, to tissue damage induced by a surgical procedure or as a result of a surgical procedure. The matrix activated by genes of the present invention can be transferred to the patient using various techniques. For example, matrices may be transferred directly to the site of the wound by the physician's hand, either as a therapeutic implant or as a coated device (eg, suture, coated implant, etc.).

The matrices can be administered topically, either placed chemically in a normal tissue site in order to treat diseased tissue at a distance. The process of wound healing is a coordinated sequence of events that include, ejaculation, clot formation, coagulum dissolution with concurrent removal of damaged tissue, and granulation tissue deposit as initial repair material. The granulation tissue is a mixture of fibroblasts and capillary blood basins. The wound healing process includes several cell populations including endothelial cells, precursor films, macrophages and fibroblasts. The regulatory factors involved in the repair of a lesion are known and include systemic hormones, cytokines, growth factors, extracellular matrix proteins and other proteins that regulate growth and digestion. The DNA transfer methods and matrix compositions of the present invention will have a wide range of applications as a drug delivery method to stimulate the repair and regeneration of tissues in a variety of different types of tissues. These situations include, but are not limited to, bone repair, skin repair, connective tissue repair, organ regeneration, or regulation of vasculogenesis and / or angiogenesis. The use of gene-activated matrices can also be used to treat patients with impaired healing ability as a result, for example, of the effects of age or diabetes. The matrices can also be used for the treatment of lesions that heal slowly due to natural reasons, for example, in elderly patients, and in patients who do not respond to existing bed therapies, for example in patients with chronic skin lesions. An important feature of the present invention is that the formation of scar tissue at the site of injury can be regulated by the selective use of gene-activated matrices. The formation of scar tissue can be regulated by controlling the levels of therapeutic protein e: -presad ?. In some cases, as for example in the treatment of burns or of connective tissue, it is especially desirable to inhibit the formation of scar tissue. The methods of the present invention include the grafting or transplantation of the matrices containing the DNA of interest in the host. Provisions for transplanting the matrices may include surgical placement, or replacement of the matrices in the host. In cases in which matrices must be injected, the matrices are placed in a syringe and injected into a patient at the site of the injury. Multiple injections can be made in the area of the wound. Alternatively, the matrices can be surgically placed at the site of the wound. The amount of matrices required to achieve the purpose of the present invention, is to say, the stimulation of wound repair and regeneration varies according to the size, age and weight of the host. It is an essential feature of the invention that if a gated matrix is transferred to the host, either by injection or surgical intervention, that local tissue damage is sufficient to induce the process of wound healing. It is a necessary requirement for the induction of the migration and proliferation of the white mammalian repair cells towards the matrix site activated by üßpss. A speci fi c modalities are described. 5.3 BONE REGENERATION Bone has a substantial regeneration capacity after a fracture. The complete but orderly fracture repair sequence includes ostasis, clot dissolution, granulation tissue growth, callus formation, and callus remodeling to obtain an optimized structure (AW Ha., 1930, J. Bone Joint Surg. 12827-844). Cells involved in this process include platelets, inflammatory cells, fibroblasts, endothelial cells, pericytes, osteoclasts, and osteogenic progenitors. Racientemante, several factors of differentiation and peptide growth were identified that seem to control the cellular events associated with bone repair and repair (Erlebacher, A., et al., 1995, Cell 80, 371-378). Bone morphogenic proteins (BMPs), for example, are extracellular soluble factors that control the future of the osteogenic cell: BMP genes are normally expressed by cultured fetal osteoblasts (Harris, SE et al., 1994, J. Bone Min. Res. 9, 389-394) and by osteoblasts during the skeleton of mouse embryos (Lysns, .M., Et al., 1989, Genes Dev. 3, 1657-1668; Lyons, K.M. at al., 1990, Development 190, 833-844; Jones, M.C. , et al., 1991, Develament 111, 531-542), recombinant BMP proteins initiate the differentiation of cartilage and bone progenitor cells (Yamaguchi, A., et al., 3.991, J. Cell Bis. 113, 681 -687; Ahrens, M., et al., 1993, J. Bone Min. Res. 12, 871-880; Giteiman, SE, et al., 1994, J. Cell Biol., 126, 1595-1609; Rosen , V., et al., 1994, J. Cell Biol. 127, 1755-1766), the provision of recombinant BMPs induces a sequence of bone formation similar to endocombral bone formation (Wozney, JM, 1992, Mol. Reprod Dev 32, 160-167, Reddi, AH, 1994, Curr Opin Genet, Dev 4, 737-744), and BMP-4 gene expression is deregulated early in the process of repair of fractures (Nakase, T., et al., 1994, J. Bane Min. Res. 9, 651-659). Asterogenic protein I, a member of a family of molecules related to BMPs (Ozkaynak, E., et al., 1990, EMBO J. 9, 2085-2093), may have similar effects in vitro and in vivo (Sampath, TK, et al., 1992, J. Bioi, Chem. 267, 20352-20362, Cook, SD, et al., (1994) J. Bone Joint Surg, 76-A, 827-838). It has also been shown that TGF-beta can stimulate cartilage and bone formation in vivo (Cantrella, M., et al., 1994, Endocrine Rev. 15, 27-38; Su ner, DR, et al., 1995, J. Bone Joint Surg, 77A, 1135-1147). Finally, parathyroid hormone (PTH) is a hormone of 84 amino acids that increases the plasma concentration in extracellular Ca ++ fluid. In skeletal tissues, the intelligent administration of a fragment of PTH that poses the requisites is ruu les for biological activity (aa 1-34) produces a true anabolic affection: numerous in vivo to in vitro studies provide clear evidence that the Administration of PTH1-34 in animals (including rats) results in the independent formation of high quality bone due to a combined inhibitory effect on osteoclast and an etiulatory effect on the osteogenic cell (Dempstar, DW, at al., 1993). , Endocrine Rev. 14, 690-709). The peptide PTH1-34 interacts cytenetically with BMP-4, which upregulates the expression of PTH receptors of functional cell surfaces in astrablast cells in vitro (Ahrens, M., et al., 1993, J. Bane Min. Res. 12, 871-880). As recombinant proteins before, peptide growth and differentiation factors, such as BMP and TGF-betal, represent promising therapeutic alternatives for fracture repair (Wozney, JM, 1992, Mol Reprsd Dev 32, 160-167; , AH, 1994, Curr Opin Genet, Dev 4, 737-744, Centrella, M., et al., 1994, Endocrine Rev. 15, 27-38; Su ner, DR, et al., 1995 J Bone Joint Surg, 77-A, 1135-1147). However, relatively high doses (amounts in the microgram range) are required to stimulate significant new bone formation in animals, creating concern that future human therapies may be expensive and may have an increased risk of toxicity. In one embodiment of the present invention, gene-activated matrices are surgically implanted at a 5-m osteotomy site in the rat, a complex fracture model that does not heal in humans. The present inventors have found that the transfer of genes to repair cells in the osteotomy gap can be easily achieved. Defects in the process of bone repair and regeneration are associated with significant complications in chemical orthopedic practice, for example, non-fibrous union after bone fracture, implant interface failures and large allograft failures. Many complete fractures are currently treated using autsgrafts, but this technique is not effective and is related to complications. Naturally, any new technique designed to stimulate bone repair would be a valuable tool for the treatment of bone fractures. A significant part of the fractured bones is still being treated., allowing natural mechanisms to repair the injury. Even though progress has been made in the treatment of fractures in recent years, including improved devices, the development of new processes to stimulate or improve adherence repair mechanisms would be an important progress in this field. The present invention can be used to transfer a bone growth gene to promote fracture repair. Other important aspects of this technology include the use of gene transfer to treat patients with "weak bones", as for example in diseases of the osteoporssis type; to improve the insufficient cure that may arise for unknown reasons, for example, no fibrous union; to promote the integration of implants and the function of artificial articulations; to stimulate the healing of other skeletal injuries with, for example, Achilles tendon; and as an auxiliary to repair defects gives great size. It is known that bone tissue has the capacity for repair and regeneration and there is a certain understanding of the cellular and molecular base that supports these processes. The onset of new bone formation includes the par icipation of repair cells, their clanal expansion and their di erentiation. Once initiated, bone formation is promoted by various polypeptide growth factors. The newly formed bone is then maintained by means of a series of local and systemic growth and differentiation factors. Several orfogenetic bone protein genes have been cloned (Wozney et al., 1988, Rosen et al., 1989, Connect, Tissue Res., 20: 313: 319, summarized in Alper, 1994) and this work has established BMPs. as members of the transforming growth factor beta superfamily (TGF-beta) based on DNA sequence homologies. Cloning of different BMP genes resulted in the designation of individual BMP genes and proteins such as BMP-1 to at least BMP-8. It is generally considered that BMPs 2-8 are astogenic whereas BMP-1 may have a more generalized orphan gene (Shimell et al., 1991, Cell, 67: 469-481). BMP-3 is also known as osteogenic (Luyten et al., 1989, J. Biol. Chem., 264: 13377-13380) and BMP-7 is also known as 0P-1 (Ozkaynak et al., 1990, EMBO J., 9: 2085-2093). The TSFs and BMPs act on cells through complete interactions, specific for tissues with cell surface receptors ds I Roberts% -. Sporn, 1989, M.B. Sporn and A.B. Roberts, Eds., Spr inger-Verlag, Heidelberg, 95 (Part 1); Aralkar et al., 1991). It has also been shown that transforming growth factors (TGFs) have a central function in the regulation of tissue healing by affecting cell proliferation, gene expression, and matrix protein synthesis. { Roberts. Sporn, 1989, M.B. Sporn and A.B. Roberts, Eds., Spr inger-See lag, Heidelberg, 95 (Part 1)). For example, TGF-beta! and TGF-beta2 can initiate both cong agenesis and oogenene (Joyce et al., 1990, J. Cell Biol., 110; 195-2007; Izu i et al., 1992, J. Bone Min. Res. , 7: 115-11; Jingushi et al., 1992, J. Qrthap. Res., 8: 364-371).

Other growth factors / hormones in addition to TGF and BMP can be employed in the practice of the present invention to influence the formation of new bony after a fracture. For example, a fibroblast growth factor injected into a rat fracture site (Jingushi et al., 1990) in high multiple doses (1.0 mg / 50 ml) resulted in a significant increase in cartilage tissue in the fracture gap, while lower doses had no effect. Calcium regulating hormones with, for example, parathyroid hormone (PTH) can also be used in one aspect of the present invention. PTH is a calcium regulation hormone of 84 amino acids whose main function is to alleviate the concentration of Ca ++ in the plasma and in the extracellular fluid. It has also been shown that intact PTH stimulates bone resorption in organ culture more than 30 years ago, and it is known that the hormone increases the number and activity of asteoblasts. Studies with native hormone and with sisthetic peptides have shown that the amino terminus of the molecule (aa-i-34) contains the structural requirements for biological activity (Tregaear et al., 1973; Her ann-Erlee et al., 1976, Endocrine Research Communications, 3: 21-35; Riond, 1993, Clin. Sci., 85: 223-228). In one embodiment of the present invention, the gene-activated matrices are surgically implanted at the site of the bone fracture. Such surgical procedures may include direct injection of a GAM separation at the site of the fracture, surgical repair of a complete fracture, or arthroscopic surgical intervention. In cases where gene-activated arrays are employed to repair the fractured bone, mammalian repair cells will naturally migrate and praliferate at the site of bone damage. The present inventors have surprisingly discovered that the transfer of genes in repair cells in tissue regeneration in the osteotomy gap could be carried out easily. Currently, preferred methods for achieving gene transfer generally include the use of fibrous collagen implant material involved in a DNA solution shortly before its placement at the site at which one wishes to promote bone growth or the use of a preparation of plasmid DNA encapsulated in a synthetic matrix co or for example a copolymer gives block of PLGA. As the studies presented here show, the implant material facilitates the focused absorption of exogenous plasmid constructs by cells in the osteotomy hollow, which clearly helps bone regeneration / repair. The transgenes, after cellular uptake, direct the expression of recombinant polypeptides, as shown by in vivo expression of functional marker gene products. Additional studies are presented here that demonstrate that the transfer of an asteotropic gene results in the cellular expression of a recombinant asteatropic molecule, said expression is directly related to the stimulation of new bone formation. Specifically, a gene transfer vector encoding BMP-4 and a gene transfer vector encoding a fragment of human PTH-4, alone and in combination, will stimulate new bone formation. After considering a relatively large number of candidate genes, a gene transfer vector encoding a fragment of human parathyroid hormone, hPTHl-34, will stimulate new bone formation in Sprague-Dawley rats, indicating that the human peptide can efficiently bind to the PTH / PTHrP receptor in the cellular surface of rat asteoblasts. 5.4 SOFT TISSUES The present invention can also be used to stimulate the growth or regeneration of soft tissues such as ligament, tendon, cartilage and skin. Damage to the skeletal connective tissue caused Traumatic injuries can be treated using matrices that contain appetites that encode various growth factors. The connective tissue usually consists of cells and extracellular matrix organized in a characteristic tissue archi- tecture. Tissue injuries can disrupt this architecture and stimulate a wound healing response. The methods of the present invention are especially well suited for the stimulation of growth and regeneration of cinchonactive tissue since it is important that the damaged tissue is regenerated without formation of cyclization tissue since the scar tissue can interfere with the mechanical function normal connective tissue. Various thinking factors can be used to promote soft tissue repair. These factors include, not limited to, members of the TGF-Beta superfamily (eg, TGF-Beta itself), which stimulates the expression of genes encoding extracellular matrix proteins, and other cytokines such as EGF and PDGF. Examples of other genes that may be employed include (a) cycloses such as the growth and differentiation factors of peptides, terleukins, chemokines, interferons, colony stimulation factors.; (b) angiogenic factors co or for example FGF and VEGF; (c) extracellular matrix proteins, for example collagen, inina, and fibronectin; id) the family of cell adhesion molecules (eg, integrins, seiectins, members of Ig families such as N-CAM and Ll, and cadherins); (e) cell surface cytokine signaling receptors such as, for example, TGF-Beta type I and type II receptors, as well as FGF receptors; (f) non-signaling co-receptors for example betaglycan and syndecan; (g) the family of signal transducing kinases; (h) ci toesqueletal proteins with, for example, talin and vinculin; (i) proteins that bind to cytokines such as the latent-binding protein family of TGF-Beta; Y . { j) trans-acting nuclear proteins or for example transcription factors. Once formed, these matrices can be placed in the host mammal in the area of the connective tissue wound. Matrices activated by genes can be injected directly into the area of connective tissue damage. Alternatively, surgical techniques, such as arthroscopic surgical intervention, can be used to deliver the matrices in the area of the connective lesion. 5.5 REGENERATION OF BLOODS The present invention can also be used to stimulate the repair and regeneration of organ tissue. Damage to organs caused by traumatic injuries or surgical intervention can be treated by using the methods of the present invention. In the case of the liver, the liver may be damaged due to an excessive consumption of alcohol or due to infection with several types of infectious agents or eg hepatitis virus. The kidneys can also fail as a result of damage caused by kidney disease. Mucasales membranes of the esophagus, stomach or duodenum may cause ulcerations caused by acid and pepsin in gastric juices. Ulcerations may also be related to the colonization of gastric mucosal cells by Helicobacter pylori bacteria. These organs and diseases serve only as examples, the methods of the invention can also be used to treat diseases or to stimulate the regeneration of organ in any organ of the body ^ Matrices containing DNA encoding cytokines that stimulate cell pro-formation and differentiation , and / or regulate tissue morphogenesis, can be implanted at the site of the appropriate organ. Such factors may include, but are not limited to, the transforming growth factor protein family, the platelet-derived growth factor i'PDGF), the insulin-like growth factor fIGF) and the immune factor. fibroblast (PDGF). In some cases, it may be useful to express growth factors and / or cytokines that stimulate the proliferation of specific cell types for a given organ, eg, hepatocytes, renal or cardiac cells, etc. For example, the growth factor of hepata itss can be expressed to stimulate the healing process of liver injury. For the treatment of ulcers resulting from infection by Hel icobacter, the matrices activated by genes may contain DNA encoding antimicrobial proteins. The matrices activated by genes of the present invention can be surgically implanted in the organ to be treated. Alternatively, laproscopic surgical procedures can be employed to transfer the matrixes activated by genes in the body. In cases in which the treatment responds to a tissue injury, the natural process of wound healing will stimulate the migration and proliferation of the repair cells towards the transplanted matrices. Alternatively, when the gene-activated matrices are transferred to organs that have not been damaged, for example, when matrices are implanted to express therapeutic proteins that are not involved in the healing of wounds.The process of wound healing can be stimulated through the induction of lesions. 5.6 REGULATION OF A GJOG? NESIS The present invention can also be used to regulate the formation and expansion of blood vessels, or vasculsgénesi s and angisgenesis, respectively. Both physiological processes play an important role in the healing of wounds and in the regeneration of organs. Initially, at the site of a wound, a granulation tissue is deposited which is a mixture of collagen, matrix and blood vessels, and provides resistance to the wound during tissue repair. The formation of new blood vessels includes the proliferation, migration and infiltration of vascular enteral cells and is known to be regulated by several polypeptide growth factors. Several polypeptides with an endothelial cell growth promoting activity were identified, including acid-base and basic growth factors (FGF), vascular endatelial growth factor (VEGF), and placentally derived growth factor iPOBF. To stimulate the formation and dissemination of blood vessels, the DNA encoding said growth factors can be incorporated into matrices and these matrices can be implanted in the host. In some cases, it may be necessary to induce the cell healing process through >Js wounds to the tissue. It may be desirable to inhibit the proliferation of blood vessel formation such as in angiagenesis associated with the growth of solid tumors that depend on vascularization for growth. Tumor angiogenesis can be inhibited through the transfer of DNA encoding negative inhibitors of angiogenesis, such as thrombospandin or angiostatin. In specific embodiments of the invention, DNA encoding for example thrombospondin or angiostatin can be incorporated into a matrix followed by implantation of the matrix in a patient at the site of the tumor. 5.7 REPAIR OF THE SKIN The present invention can also be used to stimulate the growth and repair of cutaneous tissue. In injuries that involve damage to areas of the skin, and particularly in the case of massive burns, it is important that the skin grows very quickly in order to avoid infections, reduce fluid loss, and reduce the area of scars. potential Damage to the skin resulting from burns, perforations, cuts and / or abrasions can be treated using the matrices activated by genes of the present invention. Cutaneous disorders such as psoriasis, atopic dermatitis or cutaneous damage arising from fungal, bacterial and viral infections or from the treatment of skin cancers with, for example, melanoma, can also be treated using the methods of the present invention. Matrices containing DNA encoding cytokines that stimulate proliferation and differentiation of pial cells, including central basal pracusoral cells, quercites, elanocytes, Langerhans cells and Mer cells can be used to treat skin damage and disorders. Gene-activated matrices serve two purposes, protecting the wound against infection and dehydration and supplying the DNA for absorption by repair cells. The matrixes activated by genes of the present invention may include skin patches, cadaver skin, bandages, gauze, collagen crosslinks such as those presented in US Patent 4,505,266 or bian in US Patent 4,485,097, cre ans or topical gels. Before the application of the matrices on the site of the injury, the damaged skin or the devitalized tissue can be removed. The DNA to be incorporated in the matrices can encode several different growth factors including keratin growth factor (KGF) or epidermal growth factor (EGF). The DNA encoding I-1 of the cell is known to be a potent inducer of the migration and proliferation of epithelial cells as part of the process of how it can also be incorporated into the matrices of the present invention. 6. EXAMPLE: IMPRESSIVE IMPAIR MATERIAL FOR USE IN TRANSFER OF BONE GENES Several implant materials can be used to transfer genes to the site of bone marrow and / or bone regeneration in vivo. These materials are unduly in a solution that contains the DNA to gene that must be transferred to the site of new bone growth. Alternatively, DNA can be incorporated into the matrix according to a preferred method. A particular example of a suitable material is fibrous collagen which can be lyophilized after extraction and partial purification from the tissue and then sterilized. Another particularly preferred collagen is type II collagen with the most preferred collagen, being either type II replenishing collagen or mineralized collagen type II. Prior to placement in osteotomy sites, implant materials are unduly disrupted by DNA (or virus) solutions under sterile conditions. The immersion can be carried out during any appropriate and convenient period of time, for example, from 6 minutes to one night. The DNA solution (for example, plasmid) is a sterile aqueous solution, such as for example sterile water, or an acceptable regulator, and the concentration is generally between about 0.5 and 1.0 mg / ml. The currently preferred plasmids are plasmids such as pGL2 romega), pSV40Beta-g1, pAd.CMVlacZ, and pcDNA3. 7. EXAMPLE: DETECTION OF PROTEIN IN VIV AFTER EXPRESSION OF TRANSGENES 7.1 TRANSGEN OF BETA-GALACTOSIDASE Bacterial beta-galactosidase can be detected immunohistochemically. Osteotomy tissue samples are fixed in Bouins' fixation fluid, said samples are demineralized and then cut in half along the longitudinal plane. One half of each sample was embedded in paraffin for subsequent immunohistochemical identification of the bacterial beta-g lactasidase protein. In the house of the istochemical in, cross sections (2 to 3 m thick) were transferred to microscope slides coated with pal iL-1 isine and fixed in acetone at a temperature of 0 ° C for at least 20 ip . The sections were rehydrated in PBS. The activity of endogenous paroxidase was quenched by immersing the tissue sections in hydrogen peroxide to O. IX (in 95X methanol) at room temperature for 10 minutes, and the quenched sections were washed 3x in PBS. In some cases, sectioned calvaries were demineralized by immersion in EDTA at -%, pol i vini ipirrolodina at 5%, and sucrose at 7%. 7.4, for 24 hours at 4 ° C. The demined sections were washed 3x before their. application for antibodies. Primary antibodies without dilution were used in the form of a hybridoma supernatant. The purified antibodies were applied to tissue sections at a concentration of 5 mg / ml. Primary antibodies were detected with biotinylated rabbit anti-mouse IgS and strepvidin conjugated with peroxidase (Zy ed Histostain-SPki t). After staining with peroxidase, sections were counter stained with hematoxylin. Bacterial beta-gal was also detected by substrate utilization tests using commercially available equipment (eg Promega) according to manufacturers' instructions. 7.2 TRANSFER OF LUCIFERASE Luciferase was detected by substrate utilization tests where commercially available equipment (eg, Promega) was used according to the manufacturer's instructions. 7.3 TRANSFUSES OF PTH PTH Racombinant, as an example peptide hPTHI-34, was tested in osteotomy tissue tissue agendas, for example, using two radioimmunoassay equipment available according to the manufacturer's protocols. Institute Diagnostics, San Juan Ca is t a no, CA). One team is the team Intact PTH-Parathy roíd Hormone lOOT íHormonas Parat iruidea Intacta PTH KXíT? . This radioimmunoassay employs a pa antibody to the carboxyl e of the intact hormone and this is used to measure the endogenous levels of hormone in osteotomy tissue.

This test was used to establish a baseline value of PTH expression in the rat osteotomy model. The second equipment is a two-site immunoradiometric equipment for the measurement of rat PTH. This equipment uses antibodies purified by specific affinities for the amino terminal of the intact rat hormone (PTH1-34) and, as a result, it will measure the endogenous production of PTH as well as the replenishing protein. Previous studies have shown that these antibodies cross-react with human PTH and therefore can recognize recombinant molecules in vivo. The values obtained in the equipment No. i (antibody for the carboxy terminal) were subtracted from the values obtained in equipment No. 2 (antibody for the amino terminus) to obtain accurate and sensitive measurements. The level of racombinating tissue correlates accordingly with the degree of new bone formation. 7.4 TRANSFER OF BMP BMP proteins, with or for example the murine BMP-4 fcransgan peptide product, were detected in unachiems using a specific antibody that recognizes the HA epitome (Majmudar et al., 1991, J. Bone and Min. Res. 6: 869-881), co or the onoclanal antibody available from Boehringer-M nnheim. Antibodies can also be used for the BMP proteins themselves. Such antibodies, together with various immunoassay methods, are described in U.S. Patent No. 4,857,456, which is incorporated herein by reference. Osteotomy tissue samples were fixed in Bsuins fixation solution, said samples were demineralized and then cut in half along the longitudinal plane. One half of each sample was placed in paraffin for subsequent immunohistochemical identification of the recombinant murine BMP-4 molecule. 8. EXAMPLE: THE TRANSFER OF A GENE 0STE0TR0PIC0 STIMULATES REGENERATION / OSA SNARE REPAIR The following experiment was designed to investigate if gene transfer could be used to create transfected cells that constitutively express hPTH-34 re-exchange in vivo, and if this transgene can stimulate bone formation . The rate of new bone formation was analyzed in the following manner. At the time of the necropsy, the osteotomy site was carefully dissected to carry out a histamorphometric analysis. The dimensions A-P and M-L of the caloso fabric were measured using c librators. The samples were then fixed by immersion in a solution of fixation of Bouins, washed in ethanol, and demineralized in regulated formic acid. A plastic integration of the decalcified material was used due to the superior dimensional stability of the methacrylate during the preparation and selection of the samples. Tissue blocks were dehydrated in increasing concentrations of alcohol and integrated. Sa cut sections 5 m thick in the coronal plane using a microtome from Reichert Palycot. Half-width sections of the medial cavity were prepared to avoid a sampling bias. Sections were stained for light microscopy using a Goldner trichromatic stain to differentiate bone, osteoid, cartilage, and fibrous tissue. The sections were covered using an assembly medium from Eukitt (Calibrated Instruments, Ardsley, NY). Histophometric analyzes were carried out in a clear field using a Nikon Optiphot research microscope. Standard dot counting stereology techniques were used using a 10 m m reticulated: < 10 mm. The total area of the callus was measured with a 125-fold amplification or index of the overall intensity of the healing reaction. Fractions of bone area, cartilage. and fibrous woven were able to be amplified 250 times for the relative contribution of each tissue to the formation of calla. Pivs or that the dimensions of the osteotomy gap reflect the baseline (time O), a measurement of the bone area was used at subsequent intervals of time to indicate the rate of bone recovery. Statistical significance was assessed and complete analysis of variance was carried out, with psst-hoc comparisons between groups performed using a Tukey's range test. In the 5 mm rat osteotomy model described above, it was found that PTH transgene expression can stimulate nausea of bone in living animals. This is an especially important finding since it is known that hPTHl-34 is a more potent anabolic agent when administered intermittently and not continuously, and it is the continuous type administration that results from the gene transfer methods and pleadss here í. 9. EXAMPLE: DIRECT TRANSFER OF GENE IN LIVE OSEA REGENERATION Activated matrices were implanted by genes that contained Expression plasmid DNA in mammals in large segmental voids created in the femur of adult males. The implantation of matrices activated by genes containing plasmids of beta-gaiacts idasa or luciferase caused the absorption of DNA and the expression of functional enzyme by the repair cells growing in the gap.

A latent process, the implantation of a matrix, activated by genes that contained either a phagein 4 morphogenic bone plasmid or a coding plasmid of a paratirsidea hormone fragment (amino acids 1-34) resulting in a biological response of a new bone filling of the hole. Finally, the implantation of a matrix activated by two-pyramide genes encoding the morphogenic bone pratein 4 and the parathyroid hormone fragment, which act sys erically in vitro, caused the more rapid formation of new bone than any of these factors alone. These studies show that for the first time the repair cells in bone can be manipulated genetically in vivo. While it is a useful tool for studying repair fibroblast biology and the wound healing response, the gated matrix of the present invention also has wide therapeutic utility. 9.1 MATERIALS AND METHODS 9.1.1 MAMMER GUARD MODEL To create a 5 mm osteotomy, four screws with a diameter of 1.2 mm were screwed into the femoral diaphysis of normal adult Sprague-Dawley rats under general anastasia and with constant irrigation. A parallel screw placement guided by template was confirmed by means of fluorography, the screws being 3.5 m at the edge of the decorator and at intervals of 2.5 mm). A fixator placement a; triple x 0 x 10 x 5 mm) was then obtained on the screws. External fixing plates were manufactured with an aluminum alloy in a CNC laminator to ensure high tolerances. Prefabricated fasteners with safety washers and threaded screws were made of stainless steel. All the fixative parts were sterilized with ethylene oxide gas before the surgical intervention. They created segmental defects of mm to the middle of the structure with an oscillating closing Micro 100 Hall (Zim er Inc., Warsam, SN). Collagen sponges were placed which were kept in the osteotomy gap until they were surrounded by clotted bleeding; Preliminary studies showed that this maneuver fixed the sponge with the osteotomy site. The skin incision was closed with staples. The fixative provided the necessary stability in such a way that the displacement of the mammalian host was not limited for a period of several weeks. 9.1.2 INMUNOHISTOGUIMIC Tissues were prepared for light microscopy and immunohistochemistry was carried out as described (Wong et al., 1992, J. Biol. Chem. 267: 5592-5598). Histology sections were incubated with a commercially available anti- Beta-g l antibody (dilution 1: 200, 5 '> 3') and with a paliclonal antibody anti- HA.il commercially available (dilution 1: 500, BAbCO). 9.1.3 LUCYFERASE AND B-GAL ENZYME TESTS Luciferase and Beta-gal activity were determined by using the Luciferase Assay System (Promega) and Beta-galactosidase Enzy e Assay System (Assay System). Enzyme Beta-alactosides) (Promega) according to the protocols offered by the manufacturer. 9.1.4 PLASMID OF EXPRESSION OF pGAMl To assemble pGAMl, mRNA was prepared from day 13.5 p.c. with embryos of CD-1 mice using equipment reagents and protocols (Paly AT Tract mRNA? solation System S, Promega). One was used? iNAR of mRNA to generate cDNA using commercial reagents (Reverse Transar iptase System, Promega). A full-length mouse BMP-4 cDNA coding sequence was generated by the porase chain reaction (PCR) using the following conditions: 94 * C, 4 min., 1 cycle; 94 * C, i min., 65 * C, i min., 72 bC, 1 min., 30 cycles; 72 ° C, 8 min., 1 cycle. The sequence of the polymerase chain reaction primers was based on the known mouse BMP-sequence (GenBank): upstream starter - 5 'CCAT6ATTCCTGSTAACCSAAT8CT6 3'; downstream indicator -5 'CTCAGCGGCATCCGCACCCCTC 3'. Sa purified a unique psl imer-jsa chain reaction product of the expected size (1.31-b) by electrophoresis in gal of agarose and said product was cloned into the TA cloning vector (Invitragen). The 5 'end of the additional modified BMP-4 fus insert (polymerase chain reaction) by the addition of a 27 nucleotide sequence encoding the HA epitope, and the BMP-4 insert was cloned into the expression vector pcABN3 (SnVi trogen). The plasmid DNA was prepared which was sequenced (both strands) to ensure the orientation and integrity of the BMP-insert. Plasmid pGAMl was expressed using an in vitro transcription and translation equipment (TNT T7 Coupled Reticulocyte Lysate System, Promega) in accordance with the protocols offered by the manufacturer. Radiolabelling of protein, immunoprecipitation, sample preparation and SDS-PAGE, autoradiography, transient transfection, and Western analysis were carried out as described (Yin et al., 1995, J. Bial. Chem. 270: 10147-10160 ). 9.1.5 EXPRESSION PLASMIDE pSAM2 Human iroid hormone cDNA fragments encoding preprol-34 amino acids were generated by polyamide chain reaction. The sequence of the polymerase chain reaction primers was based on the known human PTH sequence (GenBank): upstream starter - 5 'GCG6ATCCGCGAT6ATACCT6CAAAAGACAT8 3'; initiator downstream - 5 ' GCGGATCCGC8TCAAAAATTGT6CACATCC 3 '. This pair of primers conjugated Ba HS sites at both ends of the polymerase chain reaction fragment. The fragment was digested with BamHS and ligated into a Ba Hl cloning site in the PLJ retrovirus vector (Wilsan et al., 1992, Endacrinol 130: 2947-2954). A clone with the insert was eventually isolated in the coding orientation (pGAM2) and said clone was characterized by DNA sequence analysis. To generate retroviral mother substances, the CRIP packaging cell line (Wilson, J.M., et al., 1992, Endocrinology 130: 2947-2954) was transfected with 10 ug of recombinant vector DNA using the calcium phosphate ds method. After a one-night incubation, a culture medium was harvested and applied to cultured rat cells (Eagle Medium Modified by Dulbecco, supplemented with 1015 fetal bovine serum, penicillin (100 units / ml), and streptomycin fl00 mg / ml) (all reagents were purchased from Gibco-BRL Life Technologies, Inc.) containing retroviriopial particles. Independent clones of successfully transduced rat cells were obtained by standard infection and selection procedures. Briefly, rat-1 cells were grown to confluence, division 1:10, and on is selected in G4Í8 i mg / ml. Gibca-BRL Life Technologies, Inc.). In some cases, antibiotic resistant colonies were combined in a single culture. In other cases, independent colonies of resistant cells were maintained. Similar methods were used to generate clones of rat-1 cells transduced with the BAGT retrovirus, which encodes the bacterial enzyme b-gal. The concentration of hPTHI-34 in cell culture medium was estimated by the use of a commercial radioimmunoassay equipment (SNS-PTH, Nichols) and in accordance with the manufacturer's protocol. The biological activity of the peptide encoded by pGAM2 was evaluated in accordance with that described (McCauley, et al., 1994, Mol Cell Endocrol.lOl: 331-336). 9,1.6 PREPARATION OF COLLAGEN SPONGES ACTIVATED BY GENES For each osteotomy well, lyophilized bovine tracheal collagen (10 mg, Sigma) was completely humidified in a sterile solution of plasmid DNA of 0.5-1.0 mg and allowed to incubate for 1 -16 hours at a temperature of 4 ° C after implantation. 9.1.7 RADIOGRAPHY Single film radiographs were obtained weekly (top view) while mammalian hosts were awake, using a portable X-ray unit fGF, model 300). The > "?? o -?? ci ón was given 1/10 sec to 57 ¡? - 'and 15 roa 9.2 RESULTS 9.2.1 OSTEOTOMY MODEL Our ípodelo system used a 5 mm half-structure osteotomy in the femur of The osteotomy gap was stabilized by means of an external fixator with four screws, while the osteotomy repair in the rat ended 9 weeks after the surgical intervention, the form of repair depends on the size of the hollow: a hole of 2 cm. mm healthy by means of bone union, for a healthy 5 mm gap by a fibrous junction (Rouleau, JP, et al., Trans: Ortho Res. Soc. 20 :) Controlled mammalian hosts maintained for up to 13 weeks after The surgical intervention confirmed the observation that the 5 m gaps typically heals by non-fibrous junction.Single-film x-ray and weekly histolagia (figure 1A-D) demonstrate that bone was not formed in mammalian hosts receiving either an osteotomy of 5 m room { n = 3), a 5 m osteotomy plus a collagen sponge. { n = 10), or a 5 mm osteotomy plus a collagen sponge containing naked plasmid DNA of marker gene (n = 23). All 36 control hollows were healed by fibrous tissue deposit. The control femurs presented new focal pepasteal bone formation (a complication in the placement of screws). A transient inflammatory response was also observed after surgery, focal. { lymphocytes and macrophages) in hollow tissues. 9.2.2 MARKER GENE STUDIES In a preliminary feasibility study, lacZ and beta-gal expression plasmid DNAs were successfully transferred in vivo. The objective was to standardize the preparation protocol of the matrix activated pair genes and the post-operative temporal course. A GAM encoding luciferase was placed in the osteotomy gap of a rat and a matrix activated by genes encoding Beta-gal was placed in the hollow of a second animal. Three weeks later, hole homogenases (consisting of granulation tissue) were prepared after careful dissection of surrounding bone, cartilage and skeletal muscle. Aliquots of each homogenate were evaluated for anzimatic expression by substrate utilization assay. The expected epz imat activity was detected in each sample of age. Positive results were obtained in other experiments where conditions varied (eg, DNA dose, time to protein expression assays). 9.2.3 TRANSFERENCE OF GENE BMP-4 Having shown that hollow cells express in fup ic tones, they then give the adsorption of DNA from a matrix, we are asked yes. Transfer of gains could be used to modulate bone regeneration. We chose to express BMP-4, an asteoinducer factor that is normally expressed by progenitor cells during the repair of tissue. A full-length mouse BMP-4 cDNA was generated by polymerase chain reaction and said cDNA was subcloned into the eukaryotic expression vector pcDNA3 (Invitrogen) f Figure 2). To specifically detect recombinant proteins, the 3 'end of the BMP-4 coding sequence was modified by the addition of hemagglutinin epitope (HA). Recombinant BMP-4 was expressed from this csnstructa fpGAMS) using an in vitro transcription and translation protocol. Inprecipitation studies established the ability of the HA epitope to be recognized by a paliclanal anti-HA antibody. The biosynthesis of recombinant BMP-4 was evaluated after transient transfection of 293T cells grown with PGAMS piásmido DNA. Bed was demonstrated by immunoprecipitation, BMP-4 molecules were assembled into homodies, secreted and processed as expected. Taken together, these results established that the HA epitope was recognized by the polyclonal anti-HA antibody. Sa collagen sponges containing pGAMS DNA were placed in the hollow of nine adult rats maintained during 4-24 setBínEis. In a mammalian host sacrificed 4 weeks after surgery in the surgical ion, immunohistochemical studies using the anti-HA antibody demonstrated the expression of PGAMS by repair fibroblasts within the gap. This was significant since we did not observe a false positive stain in a tissue tissue study from thirteen mammalian control hosts. Micracopic foci of new bone, originating from both surgical margins, were also observed in the 4-week samples. Consistent with a classic description of bone formation by autoinduction (Upst, 1965, Science 150: 893-899), these foci consisted of bone plates covered by large cuboidal osteoblasts and supported by a cellular connective tissue composed of orbital plea fibroblasts. capillary vessels. In seven mammalian hosts slaughtered 5-12 weeks after the surgical intervention, the amount of radiographic new bony increased steadily (Figure 3A), even though the BMP-4 encoded by the transgene was not detectable by immunohistochemistry. Bridges, defined as new bone that extends from the surgical robots through the osteotomy hollow, were typically observed at 9 weeks. A ninth mammalian host survived without complications for 24 weeks after surgery. For the 18 sem-i as, enough new bone was formed to allow removal of the outer fi brous, and the mammalian host moved well for an additional 6 weeks (FIG. 3A). At the time of sacrifice, the hollow was re-filled with new bone subjected to active ramodalation, with the exception of a thin band of radiolucent tissue near the distal margin of the hollow. Since the mammalian host had successfully moved without fixation, it is considered that this band was partially mineralized. Consistent with this hypothesis, a biomechanical test was carried out (Frankenburg et al., 1994, Trans Ortho, Pes. Soc. 19: 513), which showed that the cured hollow had essentially the same mechanical resistance as the femur. operated from the same mammalian host (difference of 6.31Í, maximum test of torsion). The radiographic appearance of the contralateral femur was not changed in all nine cases, which means that the effects of gene transfer and overexpression of BMP-4 were limited to the osteotomy gap. 9.2.4 TRANSFER AND EXPRESSION OF A PLASMIDE COCKTAIL (BMP-4 • * • PTH1-34) Bone regeneration is usually rejusted by several factors acting in a regulated sequence, and we therefore wonder whether the expression of several Anabolic factors could stimulate the bone formation of aeam = »s powerful than a single factor. To evaluate this hypothesis, we chose the delivery of a GAM of two plasmids encoding BMP-4 plus a fragment of parathyroid hormone (PTH) peptide. PTH is a hormone of 84 amino acids that increases the plasma concentration and extracellular Ca ++ fluid. In skeletal injuries, the intermittent administration of PTH fragment that possesses the structural requirements for biological activity (aa 1-34) produces a true anabolic effect: numerous in vivo and in vitro studies offer clear evidence that administration of PTH1 -34 in mammalian hosts f including rats) results in high-quality, independent bone formation, by an inhibitory effect in relation to osteoclasts combined with a stimulation effect on osteogenic cells (Dempster et al., 1993, Endocrin Rev. 14: 690-709). The PTH1-34 peptide is known to synergistically interact with BMP-4, which upregulates the expression of functional cell surface PTH receptors to differentiate asteoblast (Ahrens et al., 1993, J. Bona Min. Res. 12: 871-880). A fragment of cDNA qua encoding human PTH1-34 was generated by reaction in polymerase tissue. To establish its biological activity, the fragment was subcloned into the retroviral vector PLJ fWilsan et al., 1 ^ 2, Endocrin, 130: 2947-2954), generating the expression pGAM2 fFig. 4A). An existence of recombinant, defective retroviruses was prepared by rapl ication and said existence was applied to rat3-I cells in culture. Independent clones were obtained from transduced rat-I cells, and stable integration and expression of retroviral DNA was demonstrated by Southern analysis and Northern A radioimmunoassay was used to establish the concentration of human PTH 1-34 in conditioned media of individual clones. ROS 17 / 2.8 cells possess PTH cell surface receptors, which belong to the superfa ilia of the G protein-coupled receptors (Dempster et al., 1993, Endocrin. Rav. 14: 690-709). Incubation of ROS 17/2 cells. B with aliquots of media from a stably transduced cell line (secretion > 2 pg / ml through radioimmunoassay) resulted in a 2.7-fold increase in CAMP response versus control, result that established that the secreted PTHi-34 peptide was biologically active. GAMs containing p6AM2 plasmid DNA alone stimulated bone GAMs containing the DNAs of the expression plasmid of BMP-4 and PTH1-34 were implanted together in the osteotomy gap of three mammalian hosts adding them. Source formation was observed at 4 weeks in the mammalian hosts (a mammalian host was sacrificed at this time for histology), and at 12 weeks a sufficient amount of new bone had been formed in the remaining mammalian hosts to allow removal of the external fixator (figure 5). Both mammalian hosts were moving bian at the time of publication 15 and 26 weeks after implantation, respectively. Based on plain film radiography, the effects of gene transfer and expression appear again to be limited to the hole or theotomy. After studies employing a caiagen sponge, it was also shown that the plasmid DNA could be ad- ministered to cells in a sustained manner after encapsulation within a preparation of block polymers of polylactic particles. The results demonstrate that the cultured cells can be transfected by plasmid DNA mediated by the polylactic-polypeptide particles. The results also indicated that repair fibroblasts (rat osteotomy model) in vivo collect and express in plasmid DNA released from block polymers of polylactic-polylactic particles. Figure 7 demonstrates that repair fibroblasts (rat osteotomy model) in vi or absorb and express plasmid DNA from p6AM2 after release of the polypical Ig-i1colic particles. Bed? E ues r-i in Figure 7, the expression of PTH1-34 encoded by pli = mido is rel e? Ons with a new bone ion form means iva in the osteotomy gap. Taken together, these studies show that the matrix technology developed by genes does not depend on a collagen matrix to be successful. Therefore, the technology is sufficiently broad to be able to be combined with biological matrices and with synthetic matrices. 10. EXAMPLE: TRANSFER OF GENES FOR REGENERATION OF TENDON AND FOR REGENERATION OF CROSSED LIGAMENT SN VIVO There is a clinical need to stimulate the formation of scarring during the repair of the Achilles tendon and ligaments (shoulders and knees) in order to increase competition mechanics of damaged tissue. A model system has been developed in which segmental defects are created in the Achilles tendon and a novel biamaterial is used, the small intestinal mucosa to well SIS as molecular supply agent / tendon implant.

In the present example, the ability to deliver and express marker gene constructs in the regeneration of tendon tissue using the bone graft is demonstrated.

SIS. 10.1 MATERIALS AND METHODS Segmental defects were created in the Achilles tendon and a SIS co-preparation or tendon implant / molecular delivery system was used. Plasmid mother solutions were prepared. { psVogal, Promega) in accordance with standard protocols (Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, (Molecular Cloning, A Laboratory Manual), Cold Spring Harbar Labaratory Press). A SIS graft material is prepared from a segment of the jejunum of adult pigs (Badylak et al., 1989, J. Surg. Res. 47: 74-80). At the time of harvest, mesenteric tissues were removed, the segment was inverted, and both the mucosa with the superficial submucosa were removed by means of a mechanical abrasion technique. After returning the segment to its original orientation, the serosa and muscle layers were rinsed, said layers were sterilized by a treatment with diluted acetic acid, and stored at a temperature of 4'C until use. Mestizo dogs f all studies) were anesthetized, intubated, placed in right lateral recovery on a heating pad, and kept under inhalation anesthesia. Sa used a lateral incision from the junction between muscle and tendon to the plantar fascia to expose the Achilles tendon. A double thickness SIS sheet was wrapped around a central part of the tendon, both ends were sutured, a segment of 1.5 cm tendon was removed through a lateral opening in the graft material, and the graft was closed and the site of the surgical intervention. The leg was immobilized for 6 weeks and then used freely for 6 weeks. Graft tissues were collected at time points indicated below, said tissues were fixed in Bouiris solution, and embedded in paraffin. Tissue sections f8 μm) were cut and used for isotoxic inaiunoh. 10.2 RESULTS In an initial study, a single SIS material (SIS graft alone) promoted the regeneration of the Achilles tendon after the creation of a segmental defect in mongrel dogs during a period that lasted for up to 6 months after the intervention. surgical The re-modeling process involved the rapid formation of granulation tissue and the eventual degradation of the graft. No scar tissue was formed and no evidence of rejection mediated by the immune system was observed. In a second study, SIS was immersed in a solution of plasmid DNA graft of SIS + plasmid) and said graft was subsequently implanted as an Achilles tendon graft (n = 2 dogs) or a crossed ligament graft fn = 2 dogs ) in normal mongrel dogs. A pSVBeta gal plasmid using simian virus 40 regulation sequences to boost Beta-iactosidase activity (Beta-gal) could be detected by isotope immunochemistry using a specific antibody in 4/4 mammalian hosts. Negative control bed, SH did not detect any Beta-gal activity in the unalarged Aquila tendon, nor in the cruciate ligand of these mammalian hosts. Accordingly, it appears that SIS facilitated the uptake and subsequent expression of plasmid DNA in neotendn cells in both the ligament and ligament tendons. A third study was designed to evaluate the temporal course of Beta-gal transgene expression. SIS + plasmid grafts were implanted for 3, 6, 9, and 12 weeks (n = 2 dogs per time point) and the expression of transgenes was tested by means of immunohistochemistry. Transverse sections (8 μm) of tissue fixed according to Bouins were cut and mounted, embedded in paraffin in Probeon Plus (Fisher) plates. An immunohistochemical study was carried out in accordance with the protocol provided with the Histostain-SP (Zy ed) team. Briefly, the plates were incubated with a well-characterized anti-Beta-galactosidase antibody. { dilution 12:00, 5 '- >; 3 '), said platens were washed in PBS, incubated with a second biotinylated antibody, washed, stained with the enzyme conjugate plus a mixture of substrate chromogen, and then treated with nema toxin and eosin. A bacterial Beta-gal activity was observed in tendons that received the SIS + plasmid graft (8/8 mammalian hosts), even though the trapsgenes e: psion is not rigorously quasi-, presented a p_eo to the ^ -1 weeks. The ei-pressure of bacterial Beta-gal gene was not detected in 35 mammalian hosts who received SIS grafts alone. 11. EXAMPLE: TRANSFER OF IRAL ADEN GENE IN OSEA REGENERATION SN VSVO An alternative method to achieve in vivo genetic transfer for tissue regeneration is the use of an adensvirus-mediated transfer event. A successful adenoviral gene transfer of a marker gene construct was achieved in bone repair cells in the rat osteotomy model. 11.1 MATERIALS AND METHODS pAd. CMVlacZ, adenoviral vector, is an example of a defective replication adenoviral vector that can be replicated in permissive cells (Stratford-Parricaudat et al., 1992, J. Clin Invest. 90: 626-630). In this particular vector, the initial promoter / promoter of the egalovirus (CMV) ss is used to activate the transcription of lacZ with an SV40 polyadenylation sequence cloned downstream of the reporter gene (Davidsop et al., 1993, N). ture Genetics 3: 219-223). pAd.RSV4 has essentially the same structure as pAdCMVlacZ, however, the CMV promoter and the unique Bglll cloning site have been replaced through a cassette with a f agment! E-G? I qua consists of a RSV promoter, a multiple cloning site, and a pol? «'A-r site. The greater flexibility of this vector is useful in the subcloning of osteotropic genes, for example the cDNA fragment of hPTHl-34, for use in subsequent studies. An Ultra Fiber (mr) implant was immersed for 6 minutes in a lacZ AdCMV virus solution (10,000,000,000- 100,000,000,000 plaque drug units or PFU / l) and then implanted at the ostsotamy site. The defect was allowed to heal for 3 weeks, during that time period, the wound healing response schedule was monitored by weekly radiographic examination. At three weeks, it was estimated that the 40U of the defect was filled with callus tissue. The mammalian host was sacrificed and the tissues were fixed in Bouins fixation, and then the tissues were demineralized for 7 days using standard solutions of formic acid. 11.2. RESULTS The results obtained conclusively demonstrated the expression of the marker gene product in chondrocyte type cells in the osteotomy gap (figure 6). The signal directed towards the nucleus was also observed in p reosteab 1 a s to. 12. EXAMPLE: TRANSFERENCE TO MUSCLE ESOUEI ETAL MUSCLE There is a scarce clinical formation during the repair of soft tissue besides the tendon of the ligaments (shoulder and knee) to improve competition. mechanics of damaged tissue. A model system was developed in which incisions are made in adult rat rat muscle and a suture preparation is coated with a preparation of PL6A particles and sustained release plasmid DNA is employed camoseskeletal device / gene delivery . To demonstrate the feasibility of the coating compositions and methods of the invention, a surgical suture was coated with marker DNA (encoding human placental alkaline fasphatase) and used to suture rat muscle tissue. The experiment demonstrates the transfer and successful expression of DNA in the repaired tissue with the reverse suture. 12.1 MATERIALS AND METHODS 12.1.1 PREPARATION OF ADF4-PLGA COATING COMPOSITION To a solution of PLGA / chloropher a (314 (weight / volume) copal 50/50 number of polygalactic polyglotonic acid PLGA, average molecular weight 90,000, inherent viscosity: 1.07) O.2 L of a solution containing DNA marker encoding human placental alkaline phosphatase (1 mg of DNA, 0.5 M TPS-EDTA, 0.5 mM EDTA, pH 7.3) was added. The solution was emulsified by subsiding for 2 minutes followed by sonication for 30 seconds and at a temperature of about 0 ° C using a sonicator of the micapunta probe type with a power output of 55 Watts. This process provided an emulsion that had the appearance of milk type. 12.2 COATING OF A SURGICAL SUTURE An orifice was drilled in a piece of Teflon coated sheet (Norton Performance Pl stic Corp.)., Akron, OH) using a size 22 needle. A droplet (approximately 60 μL) of a PLGA-DNA emulsion was placed in the orifice. A 3-0 chromic suture with a length of 70 cm was used (Ethicon) through the hole to cover the suture. As the suture passed through the hole, it was soaked in a thin uniform coating (approximately 30 μm thick) of the coating composition. The suture was allowed to dry in the air for approximately 3 minutes, and the coating process was repeated 15 times allowing each coating to air dry. The coated suture was examined by electron microscopy (pipelining: 150 times), and it was found that the suture was more coated with a uniform coating of DNA-PLGA. In addition, the coating remained intact even after passing the suture through the tissue several times. 12.1.3 REPAIR OF SKELETAL MUSCLE WITH SUTURE REVERSED The suture prepared above was cooked in the skeletal muscle tissue of two normal adult rats with satisfactory surgical results. The suture showed good fixation properties. One week later, the muscle plus the suture was dissected, frozen in liquid nitrogen and ground into powder. The powder was incubated in 200 μL of lysis buffer, said powder was exposed to three cycles of cangelamienta-unfreezing and clarification. The clear liquid was assayed for alkaline phosphatase activity using standard methods after incubation at a temperature of 65 ° C. 12.2 RESULTS The results indicated that the rat skeletal muscle cooked with coated sutures and recovered after one week had an alkaline phosphatase activity, which indicates that the alkaline fasphatase gene of the marker was expressed in muscle tissue. Control recoveries will not show significant alkaline phosphatase activity. These data demonstrate that emulsions can be used to effectively coat sutures and administer genes to proliferating repair cells in vivo. 13. EXAMPLE: TRANSFER OF BLOOD VESSELS This is the only need to avoid excessive fibrosis (restajos i s) that may occur, for example, during the repair of blood vessels and after angioplasty. This can be achieved, for example, by supplying genes encoding inhibitors of lysyl oxidase, to bian by transferring genes encoding certain TGF-Beta. There is also the clinical need to regulate angiagenesis, for example, in houses of disorders for vascular insufficiency, where the objective is to stimulate the formation of new vessels with the avoidance of tissue hypoxia and the death of cells. A model system has been developed in which repair cells in large blood vessels in rabbits are transfected with a preparation of PLGA particles and extended release plasmid DNA. Repair cells are present because these rabbit blood vessels have a cellular lesion that mimics clinical atherosclerosis in humans. The present example demonstrates the ability to administer and express marker gene constructs in large blood vessel repair cells. 13.1 MATERIALS AND METHODS New Zealand white rabbits of both sexes were used for this study, with a rais of 3.1 to 3.5 kg. The rabbits were anesthetized using ketamine (35 / mg / kg) and xylazine (5 mg / kg) SM, and maintenance anesthesia was achieved with administration through a marginal vein of ketamine IV (8 mg / kg). Segments of approximately 2c of both iliac arteries were isolated between the descending aortic bifurcation and the inguinal ligament, said segments were tied, and all the small branches of these arterial segments were ligated. Local thrombus formation was prevented by administration in the marginal vein of the heparin ear (100 mg). Through iliac arteriotomy, a balloon angioplasty catheter (2.0 mm balloon) was inserted into iliac artery segments and the balloon was dilated for 1 minute at a pressure of 8 at. After balloon dilation, the angioplasty catheter was removed, 20 mg of heparin was administered intraarterially to avoid distal thrombosis. Both ends of the iliac artery were tightened with 10OO silk, the suspension of 5 mg / ml of DNA-Nanoparticles in each iliac artery was impelled for 3 minutes at 0.5 atm. The wound was structured. Rabbits were sacrificed 2 weeks after balloon angioplasty and nanoparticle delivery. Through a vertical lower abdominal incision, both iliac arteries were isolated. A 2 cm segment of the iliac artery was bilaterally removed. The carotid artery of rabbit was taken as a control sample. The tissue was preserved in liquid nitrogen for alkaline phosphatase assay. 13.2 RESULTS The results of the phosphatase expression assays indicated that a nanoparticle plus DNA formulation could deliver nucleic acids to repair cells in the iliac arteries of young rabbits injured with a balloon catheter. Both the right and left iliac arteries were positive for phosphatase activity after exposure to the nanoparticle plus DNA formulations. No fashatase activity was detected in the control aorta. These positive results indicate that, after exposure to a matrix activated by genes, repair cells in large blood vessels can absorb and express nucleic acid molecules. The present invention is not limited in scope to the exemplified embodiments that are intended to illustrate specific aspects of the invention, and all clans, DNA sequences or functionally equivalent amino acids are within the scope of the invention. In fact, those skilled in the art will be able to make various modifications to the present invention from the foregoing description and the attached drawings. Such modifications are within the scope of the claims to a; ace. 9, and will also understand that all the sizes of basic parass offered for nucleotides are ionic and are used for decoding purposes.

Claims (25)

1. REI I DICATIONS i. A method for transferring a DNA molecule containing a promoter operably linked to a sequence encoding a gene product in a mammalian repair cell, comprising the application of a biacampa tibie matrix containing the DNA molecule to a lesion in the body, in such a way that repair cells that migrate to the site of the lesion infiltrate the matrix, acquire the DNA molecule, and express the gene product encoded by the DNA in vivo.
2. 2. The method of claim 1 wherein the biocompatible matrix is collagen, metal, hydroxyapatite, biovidria, aluminate, bioceramics materials, purified proteins, or racelimare matrix compositions,
3. 3. The method of claim 1 wherein the biocompat matrix ible is collagen.
4. 4. The method of claim 3 wherein the collagen is collagen of type SI.
5. The method of claim 1 wherein the DNA encodes a therapeutic pratein.
6. 6. The method gives the re i ica n t where the transferred DNA encodes a growth factor.
7. 7. The method of reification 1 where the transferred DNA is more than a DNA molecule.
8. 8. The method of claim 6 wherein the growth factor is transforming growth factor-Beta (TGF-Beta), fibroblast growth factor (FGF), platelet-derived growth factor (PDGF), insulin-like growth factor (IGF), or archane bone factor (BMP).
9. 9. The method of claim 5 wherein the therapeutic protein is a hormone.
10. The method of claim 9 wherein the hormone is growth hormone (GH).
11. 11. The method of claim 9 wherein the hormone is human parathyroid hormone (PTH).
12. 12. The method of claim 1 where said site of injury is a site of a bone fracture.
13. The method of claim 1 wherein said site of injury is a site of connective tissue damage.
14. 14. The method of claim 1 wherein said site of injury is a site of organ damage.
15. 15. An electron-activated matrix comprising a biocompatible matrix containing a DNA molecule having a promoter operably linked to a sequence that matches a therapeutic protein.
16. 16. A matrix activated by genes comprising a matrix L > The carrier contains a DNA molecule having a promoter operably linked to a sequence encoding an anti- sense RNA.
17. 17. A gene-activated matrix comprising a biocompatible matrix containing a DNA molecule having a promoter operably linked to a sequence qua encoding a growth factor.
18. 18. The matrix activated by genes of claim 17 wherein the growth factor is TGFBeta, FGF, PDGF, IGF, or BMP.
19. 19. The gena-activated matrix of claim 15, wherein the matrix contains no more than one DNA molecule.
20. 20. The matrix activated by genes of claim 16, wherein the matrix is collagen, metal, hydraxyapatite, biavidry, aluminate, bioceramic materials, metallic materials, purified proteins or extracellular matrix compositions.
21. 21. The matrix activated by genes of claim 15, wherein the biocompatible matrix is collagen.
22. 22. The matrix activated by genes of claim 21, wherein the collagen is type II collagen.
23. 23. The equipment comprising, in a suitable container, a matrix preparation activated by genas.
24. 24. A kit comprising, in an old container, a bilamphattable matrix preparation and a D a a n a n e that encodes a therapeutic pratein.
25. 25. A method for preparing a DNA-matrix composition, comprising contacting a DNA molecule with a biocompatible matrix such that the DNA is non-covalently bound to the matrix.