KR100543994B1 - In vivo gene transfer methods for wound healing - Google Patents

Abstract

The present invention relates to an in vivo method for specifically targeting and delivering DNA to mammalian repair cells. The delivered DNA includes any DNA that encodes the desired therapeutic protein. The present invention is based on the discovery that mammalian repair cells proliferate and migrate to the wound site to selectively receive and express DNA. The invention also relates to pharmaceutical compositions used to practice the invention to deliver the desired DNA. Such compositions include any suitable matrix in combination with the desired DNA.

Description

IN VIVO GENE TRANSFER METHODS FOR WOUND HEALING}

The present invention relates to novel in vivo methods for providing and directly delivering DNA encoding desired therapeutic proteins into mammalian repair cells. This method involves the implantation of a matrix containing the desired DNA (hereinafter referred to as "gene activated matrix") into a new wound site. Repair cells from living tissues around the wound proliferate and migrate to the gene-activated matrix where they meet and take DNA to express DNA. Transfected repair cells act as bioreactors (localized to the wound site) in situ to produce substances that heal wounds (DNA-encoded RNA, proteins, etc.).

The invention also relates to pharmaceutical compositions that can be used to practice the invention to deliver the desired DNA. Such compositions include a suitable matrix complexed with the desired DNA.

2. Background of the Invention

2.1. Wound healing

Therapies for treating wounds currently used are the administration of therapeutic proteins. Such therapeutic proteins include regulatory factors associated with normal therapeutic processes such as systemic hormones, cytokines, growth factors, and other proteins that regulate the differentiation and proliferation of cells. Growth factors reported to have the ability to treat such wounds. Cytokines and hormones include transforming growth factor-β superfamily (TGF-β) proteins (Cox, D.A., 1995, Cell Biology International, 19: 357-371); Acidic fibroblast growth factor (FGF) (Slavin, J., 1995, Cell Biology International, 19: 431-444); Macrophage-colony forming stimulating factor (M-CSF) and calcium regulatory substances such as epithelial hormone (PTH) and the like.

There are several problems associated with using therapeutic proteins such as cytokines in treating wounds. First of all, purification, recombinant production, etc. of therapeutic proteins is a costly and time consuming process. However, despite these vast efforts, purified protein preparations are sometimes unstable and cumbersome in storage, and if the proteins are unstable, they can induce unexpected inflammatory responses (to protein bonsai products) to toxic to the host. .

Second, systemic delivery of therapeutic proteins such as cytokines can cause serious side effects in intact tissues. Because of the ineffective delivery to specific cells and tissues in the body, a sufficient amount of protein must be available to reach the appropriate tissue target. Because of the short half-life resulting from proteolysis, the protein must be administered repeatedly, which can cause an immune response to the therapeutic protein. As a large amount of therapeutic protein circulates, the various effects of the administered protein can cause toxicity, which causes serious side effects.

Third, external transport of recombinant proteins is inefficient. Attempts have been made to limit the administration of large amounts of protein through immobilization of the therapeutic protein to the target site. However, such therapeutic methods require a complex process of re-administering proteins to provide repeat doses.

Fourth, biological activity for various proteins, such as membrane receptors, transcription factors, and intracellular binding proteins, depends on accurate expression and localization in the cell. For many proteins, accurate cell localization occurs when the protein undergoes posttranslational modification in the cell. Thus, such a protein cannot be administered externally in a manner that is properly taken up and localized in the cell.

Since these problems have been demonstrated, current recombinant protein therapies for treating wounds are not available because they do not present an appropriate method of delivering such external proteins. These proteins, such as cytokines, are normally produced at their site of action in physiological amounts and effectively delivered to signal generating receptors on the cell surface.

2.2. Gene therapy

Gene therapy is originally conceived as a therapy that replaces specific genes to correct for genetic defects in order to deliver an active therapeutic gene with a function into a targeted cell. Early attempts at somatic gene therapy use indirect means of inducing genes into tissues (called ex vivo gene therapy), for example, by removing target cells from the body and transfecting the vector with the recombinant gene. Is then transplanted back into (“self-transferring”). There are a variety of transfection techniques available for delivering DNA into cells in vitro; Calcium phosphate-DNA precipitation, DEAE-dextran transfection, electroporation, liposome-mediated DNA delivery or transduction using recombinant viral vectors, and the like. Such ex vivo treatments include epithelial cells (U.S. Patent 4,868,116; Morgan and Mulligan WO 87/00201; Morgan et al., 1987, Science 237: 1476-1479; Morgan and Mulligan, U.S. Patent No. 4,980,286); Endothelial cells (WO89 / 05345); Hepatocytes (WO89 / 07136; Wolff et al., 1987, Proc. Natl. Acad. Sci. USA 84: 3344-3348; Ledley et al., 1987 Proc. Natl. Acad. Sci. 84: 5335-5339; Wilson and Mulligan, WO 89/07136; Wilson et al., 1990, Proc. Natl. Acad. Sci. 87: 8437-8441); Fibroblasts (Palmer et al., 1987, Proc. Natl. Acad. Sci. USA 84: 1055-1059; Anson et al., 1987, Mol. Biol. Med. 4: 11-20; Rosenberg et al., 1988 Science 242: 1575-1578; Naughton & Naughton, US Patent 4,963,489); Lymphocytes (Anderson et al., U.S. Patent No. 5,399,346; Blaese, R.M. et al., 1995, Science 270: 475-480); DNA delivery to various cell types, including hematopoietic stem cells (Lim, B. et al. 1989, Proc. Natl. Acad. Sci. USA 86: 8892-8896; Anderson et al., US Patent No. 5,399,346) It is used to

DNA captured in liposomes (Ledley et al., 1987, J. Pediatrics 110: 1); Or DNA bound to a proteoliposome comprising a viral envelope receptor protein (Nicolau et al., 1983, Proc. Natl. Acad. Sci. USA 80: 1068) and DNA bound to a polylysine-glycoprotein carrier complex. Attempts to deliver directly in vivo have recently been made. In addition, genes were transferred into cells using "gene guns" (Australian Patent No. 9068389). DNA associated with DNA or liposomes is made in liquid carrier solution for injection into niche spaces for delivery of DNA to cells (Felgner, WO90 / 11092).

One of the biggest problems associated with gene therapies currently designed, ex vivo or in vivo, is the inability to efficiently deliver DNA to target cell populations and the inability to express large amounts of gene products in vivo. Viral vectors are considered the most effective systems, which are transfected into cells ex vivo and in vivo using recombinant replication-defective viral vectors. Such vectors include retroviral vectors, adenovirus vectors and adeno-associated vectors, herpes viral vectors, and the like. The major drawback associated with using viral vectors, although very effective at delivering genes, is the problem of using many viral vectors to transduce into cells that do not divide; Problems associated with the occurrence of mutations due to insertion; Inflammatory responses to virus and helper virus production and the transmission of viruses that are harmful to other patients.

Because most cell types are less efficient at taking and expressing foreign DNA, many target cell populations are found in a smaller number in the body and the effect of providing DNA to specific target cell types is further reduced. To date, there are no methods for increasing the effect of targeting DNA on target cell populations.

3. Summary of the Invention

The present invention relates to a novel method of specifically targeting and delivering DNA into mammalian repair cells associated with wound treatment to express a therapeutic product at the wound site. The method of the present invention involves administering a gene activated matrix to a new wound site of the body. In this regard, repair cells are localized to the wound, where the wound is transfected, eventually producing DNA-encoded material (RNA, protein) to heal the wound.

The present invention is based on the discovery that repair cells active in the wound healing process proliferate, migrate to wound tissue and infiltrate into a gene activated matrix. The matrix acts as a backbone that promotes cell growth and promotes gene delivery through local accumulation of repair cells near the DNA. In the matrix, repair cells have a surprising effect on taking DNA and expressing it as a translation product, ie a protein or transcription product such as antisense and ribozyme. Transduced repair cells act as local bioreactors that can amplify the production of gene products in vivo.

Several DNA sequences may be used in the method, but suitable DNA sequences may be used to a) facilitate tissue repair; Or b) encoding detoxification products (eg proteins) and transcriptional products (eg antisense or ribozymes) which can disrupt the disease process and thus allow normal tissue healing.

The present invention overcomes the disadvantages of the processes currently used to heal wounds associated with administering a therapeutic protein. First, stable and nontoxic DNA can be safely administered in large quantities in vivo. Second, if possible, repeated administrations can be avoided. Cells that take and express DNA provide the gene product at the wound site. Third, the present invention can be implemented in a manner that requires a temporary dose. For example, DNA is provided to a vector that can be inserted into the genome of a target cell. In this case, all progeny cells contain and express the transduced DNA to serve as a source of continuous supply of therapeutic agent. In contrast, when using a system that does not bind, DNA is not inserted into the genome and genes are not delivered to progeny cells. In this case, once the wound healing process is complete, the gene is no longer needed and the gene product need not be expressed.

The present invention is described by way of examples, which are expressed in vivo in soft tissues and hard tissues that are variously wounded by delivering genes repeatedly. In particular, the methods of the present invention overcome the disadvantages of currently available gene therapy procedures. The methods of the present invention can deliver genes to an appropriate number of repair cells to achieve a functional effect without any other targets or without the need for practitioners to identify cells. Gene therapy in vivo methods require some targeted forms that often do not function. Targeting is not a problem in the method of the invention. According to the analysis, DNA acts from "trap" to "bait"; DNA encounters an unknown repair cell that has migrated into a proliferated and genetically activated matrix. Again, these cells can take DNA and express these DNA as therapeutic agents.

In one embodiment of the invention, the methods of the invention can be used as a drug delivery system for delivering DNA into mammalian repair cells for the purpose of stimulating soft and hard tissue repair and stimulating tissue repair. Recovery cells are cells that are normally at the wound site to be treated. Thus, there are currently no difficulties associated with obtaining appropriate target cells to supply the therapeutic composition. All are implanted with a gene-activated matrix at the wound site. The nature of this biological environment is that appropriate repair cells can take and express "bait" DNA without the need for any further targeting or cell identification.

In another embodiment, the methods of the present invention utilize both biological and synthetic matrices to stimulate bone muscle repair. In another embodiment, using biological and synthetic matrices, the methods of the present invention deliver DNA into mammalian cells to promote ligament and tendon repair. The methods of the present invention also use biological and synthetic matrices to deliver DNA into mammalian repair cells to stimulate bone muscle repair cells or vascular repair.

DNA used in the present invention includes any DNA that encodes translation products (eg proteins) and transcription products (antisense or ribozymes) that can promote tissue repair or disrupt disease progression. For example, DNA is a growth factor. It consists of genes that encode therapeutically useful proteins such as cytokines, hormones, and the like. DNA can also encode anti-sense or ribozyme molecules that prevent translation of mRNA encoding proteins that interfere with wound healing or induce inflammation.

The DNA encoding the desired therapeutic product is associated with or included in the matrix to form a gene activated matrix. Once the matrix is prepared, the matrix is placed at the wound site of the mammal.

The present invention will be described by way of examples, which illustrate the efficiency of in vivo delivery and expression of genes into tissues for repair and regeneration.

3.1 Definition

As used herein, the following terms have the meanings given below.

Gene activated matrix (GAM) is defined as any matrix material comprising DNA encoding a desired therapeutic agent. For example, genetically activated matrices are placed in the body wound sites of mammals to enhance wound healing.

Recovery cells are any cells that can stimulate migration and proliferation in response to tissue damage. Repair cells are components of the wound healing response. Such cells include fibroblasts, capillary endothelial cells, per capillary cells, mononuclear inflammatory cells, segmented inflammatory cells, granular tissue cells, and the like. A wound site refers to any location in the host resulting from tissue damage from trauma, tissue damage as a result of or derived from surgery.

1A is a femoral bone incision without fibrous adhesion (no union of bone breaks in fracture). A 5 mm bone incision is performed on the thigh of an adult male Sprague-Dawley rat. The gap indicated represents the entire reference population; Mammalian hosts receiving bone incision alone (n = 3), hosts receiving bone incision and collagen sponge (n = 10) and collagen sponges and bone incisions containing reference (marker gene) plasmid DNA (n = 2) Indicate host provided. The planar X-ray film shows the reference rat thighs immediately after surgery. The gap is stabilized by plates and four pin external fasteners. The skin incision is covered with a metal clip.

1B shows a planar x-ray film showing reference rat femoral 9 weeks after surgery. The round surgical edges (arrows) are due to reactive bone formation, consistent with the inherent radiographs of fractures lacking adhesion.

FIG. 1C is a tissue section of the gap tissue three weeks after surgery showing proliferating repaired fibroblasts and capillaries embedded in the extracellular matrix. It also shows inflammatory infiltrates composed of lymphocytes and macrophages.

1D is a tissue of 9 weeks reference gap showing dense fibrous tissue. 1 cm = 20 µm (C and D).

2 is a structural diagram of pGAM1 encoding murine BMP-4. CMV promoter, BMP-4 coding sequence, HA epitope, bovine growth hormone polyadenylation signal are shown.

3A shows BMP-4 expression by repaired fibroblasts. Plasmid-encoded BMP-4 expression was followed by Bouins-fixed, demineralized paraffins according to the immunoperoxy method 4 weeks after implantation of the gene activated matrix comprising pGAM1 plasmid DNA using an anti-HA antibody. Can be detected in tissues that are anchored to The arrow points to an example of positive staining of the fibroblast (red-brown) cytoplasm (micrograph on the upper left). Such cells were identified as fibroblasts based on spindle shape, fibrous growth, and positive immunostaining for type I collagen (not shown). Continuous portions incubated with rabbit pre-immune serum and incubated without the first antibody were negative. Negative results can also be obtained from sham-acted criteria (with collagen sponges only) incubated with anti-HA.11 antibody (micrograph on the top right). Fake positive staining of macrophages, osteoclasts and osteoblasts is consistent with that observed in the reference section incubated with HA.11 antibody. Newly formed bone three weeks after pGAM1 delivery can be seen in the micrograph on the bottom left. New bones associate with granular tissue formation. The micrograph on the bottom right shows the newly formed bone. Arrows indicate osteoblasts presumed on the surface of new bone connective tissue. Gap tissue can be stained using hematocillin and eosin (upper micrograph) or by the Gomori trichrome method (collagen-rich tissue appears green and lower micrograph). 1 cm = 20 mm (upper micrograph).

3B shows planar film radiographs of animals (after 23 weeks). In the planar film radioactive raft (left), the arrow indicates the approximate location of the bone incision gap, which is filled with radio-dense tissue. Remove the external fasteners. As pointed out in a way that changes, bone remodeling occurs. The arrowheads show defects in bone adjacent to the gap (result of pin placement). The two terminal pin regions then heal completely (not shown). The full photograph (right) shows the Gomori trichrome-colored tissue portion from the gap of the animal shown (after killing). Inner fixation pins created circular flaws in the bone space. The destruction of the tissue under the micrograph occurred when handling the specimen.

4A is a diagram of a pGAM2 structure encoding human PTH1-34. Location of the upstream long end repeat that leads to PTH1-34 expression (arrow), the PTH1-34 coding sequence, the SV40 promoter that leads to neo expression (arrow), the neo coding sequence, the pBR sequence, and the downstream long end repeat sequence.

4B induces new bone formation in vivo with PTH1-34 gene delivery and expression. Planar film radiographs show new bone linking 5 mm bone incision 9 weeks after transplantation in animals receiving a gene activated matrix comprising pGAM2 plasmid DNA. The arrow points to the radioactive dense tissue in the gap. The results indicated further experiments with one animal.

Figure 5 shows the formation of new bone in vivo through two-plasmid GAM (top). Planar film radiographs show a new bone linking 5 mm bone incision 4 weeks after transplantation in animals receiving a gene activated matrix containing pGAM1 and pGAM2 plasmid DNA. The arrow points to the radioactive dense tissue in the gap (histologically confirmed to be bone) (below). Photo showing the gap at the top after removal of the external fixture (5 weeks early, after 17 weeks in total). The arrow indicates the location of the gap, which is filled with radio-dense tissue, except for the strip of tissue that has been demineralized near the shear surgical edge. As shown in various ways, massive remodeling reactions occur. The results shown represent one additional animal experiment.

6 shows adenovirus-mediated gene delivery to bone repair / regenerating cells in vivo. Soak UltraFiber ^™ in a solution of AdCMVlacZ virus (10 ¹⁰ -10 ¹¹ PFU / mL) for 6 minutes and then implant in the bone incision. Binding is treated for three weeks, during which weekly radiographs are monitored to monitor the healing of the wound. For three weeks, 40% of the defects are filled with bone. Killing the mammalian host, tissue is fixed in Bouins fixative and minerals are removed for 7 days using standard formic acid solution. Three weeks after surgery, the micrographs were taken from the transverse section of the new bone (bone) formed in the bone incision. Upper left panel: Shows positive (red) β-gal cytoplasm staining osteoblast tissue cells from UltraFiber ^™ adenovirus implants. These results indicate that cell surface receptors that are virus-transduced by mediating infection are expressed by osteoblasts (at least one population) during the fracture healing process; Successive negative criteria are stained with carriers of non-specific rabbit IgG antibody cocktails and β-gal antibodies. Lower panel: Positive (red) β-gal nuclei that stain chondrocytes at the site of bone incision filled with UltraFiber ^™ and AdRSVntlacZ. These results show the very sophisticated specificity of the anti-β-gal antibody and consequently explain the expression of the marker gene product in the bone incision gap.

FIG. 7 shows the growth of new bone when delivered with the pGAM2 plasmid gene for repairing fibroblasts in a rat osteotomy model. Planar film radiographs show new bone linking 5 mm bone incision 6 weeks after transplantation in animals that received a gene activated matrix comprising pGAM1 and pGAM2 plasmid DNA. The arrow points to the radioactive dense tissue in the gap (histologically confirmed to be bone).

5. Description of the invention

The present invention relates to an in vivo method for providing and delivering DNA into mammalian repair cells for the purpose of expressing a therapeutic agent. The present invention relates to implanting a gene activated matrix into a new wound site.

Wound healing includes (a) tissue destruction and loss of normal tissue; (b) cell necrosis and bleeding; Hemostasis (coagulation); (c) infiltration of segmented mononuclear inflammatory cells and vascular congestion and tissue edema; (d) coagulation as well as damaged tissue and cell lysis by monocytes (macrophages); (e) It is an integrated and formalized series of processes involving the formation of granular cells (fibroblasts and angiogenesis). Such cellular processes are observed in wounded areas in all tissues and organs of many mammalian species (Gailet et al., 1994, Curr. Opin. Cell. Bio. 6: 717-725). Thus, the cell responses described above are general for the apparel of all mammalian tissues.

The present invention is based on the discovery that repair cells involved in the wound healing process naturally multiply and migrate to tissue injury sites and infiltrate into a gene activated matrix. Surprisingly, repair cells that are difficult to transfect effectively have a significant effect on the receipt and expression of DNA when activated to proliferate by the wound healing process.

With this advantage, the method of the present invention is designed to effectively deliver one or more DNA molecules encoding a therapeutic agent into proliferating repair cells. The method is to administer a genetically activated matrix comprising DNA encoding a translational product (such as a therapeutic protein) or a transcription product (such as antisense or ribozyme) to a wound site of a mammalian host. Wounds may result from tissue damage due to trauma or may result from tissue damage induced during or due to surgery.

Because proliferating repair cells migrate to and come into contact with the gene-activated matrix, they accept and express the desired DNA to amplify a certain amount of therapeutic agent, protein or RNA. Thus, transduced repair cells act as topical bioreactors that produce therapeutic agents that affect the topical repair environment. For example, growth factors or cytokines produced by transduced repair cells bind to and stimulate targeted effector cells expressing cognate cell surface receptors and thus undergo a physiological series of sequential processes normally associated with the wound healing process. Stimulate and amplify

Alternatively, repair cells may receive and express DNA encoding a protein that interferes with the antagonistic activity of the wound healing process. DNA can also encode antisense or mRNA that can be used to interfere with the translation of mRNA encoding inflammatory proteins or other factors that interfere with wound healing or cause excessive fibrosis.

The gene activated matrix of the present invention can be transferred to a patient using a variety of techniques. For example, when stimulating wound healing and regeneration, the matrix is delivered directly to wound sites such as fractured bone, damaged connective tissue, and the like. The matrix may be topically administered for use in repairing skin. To regenerate the trachea, the matrix is placed surgically on the wound in the trachea.

Since the method of the present invention is based on the natural migration and proliferation of repair cells at the wound site to infiltrate into the gene-activated matrix at the wound site to receive DNA, the embryo must be delivered to the site of the body to induce the wound healing process. do.

A particularly important feature of the present invention is to manipulate the healing process to achieve scar tissue or tissue regeneration. For example, overexpression of the therapeutic protein at the wound site results in the formation of scar tissue and regeneration of damaged tissue. In many cases, for example, bone regeneration, such regeneration is desirable because it is not desirable to make scar tissue to support normal mechanical function. Or it is desirable to make scar tissue around the suture to retain the original weak tissue together. Thus, the method of the present invention stimulates wound healing without the formation of scar tissue or the formation of scar tissue, depending on the kind and amount of therapeutic protein expressed.

Transferring plasmid DNA directly from the matrix to mammalian repair cells through the wound healing process has several advantages. First, the production and purification of DNA constructs is easy compared to the cost of traditional protein production methods. Second, the matrix is used as a structural framework to stimulate cell growth and proliferation. Thus, they carry out targeting of repair cells for delivering genes. Third, direct gene delivery is advantageous as a drug delivery method for receptors that must be properly located on the molecules or cell membranes that normally perform complex biosynthetic processes. This type of molecule does not work when administered to cells from the outside.

The present invention relates to pharmaceutical compositions consisting of a matrix comprising DNA that can be used for wound healing. The composition of the present invention is generally composed of a matrix material comprising DNA encoding a desired therapeutic protein as a biocompatible or bone compatible matrix.

The present invention addresses the shortcomings particularly associated with current recombinant proteins that can be used for wound healing. First, direct gene transfer causes the transduced cells to (a) make physiological amounts of therapeutic protein modified in a tissue and content specific manner; (b) It is an ideal strategy to deliver such proteins to the appropriate cell surface signaling receptors under appropriate circumstances. For the reasons mentioned above, delivery of such molecules from outside results in significant dosage and transport problems. Second, if possible, gene activation matrix technology eliminates the need for repeat dosing; Cell uptake of DNA can be precisely controlled by well-established delayed release transport techniques or binding of transduced DNA is associated with long-term recombinant protein expression.

The method of the present invention is widely available for wounds involving many other cells, tissues and organs; Repair cells of granulated tissue (Gailet et al., 1994, Curr. Opin. Cell. Biol. 6: 717-725) are “targeted” using the method of the present invention. Three marker genes (β-galactosidase, luciferase, alkaline phosphatase) in three animal models (dogs, mice, rabbits) and five tissues (bone, tendon, ligament, blood vessels and bone muscle) And three promoter systems (CMV, RSV, LTR and SV40) and two types of matrices (biosynthetic and biological matrices). In all cases repair cells that migrated into the gene activated matrix were successfully transduced. In particular, BMP-4 (Wozney, 1992, Mol. Reprod. Dev. 32: 160-167; Reddi, 1994, Curr. Opin. Genet. Deve. 4 :) acts as a signal induction switch for osteoblast differentiation and growth. 737-744) or encode PTH1-34 (Orloff, et al, 1992, Endocrinology 131: 1603-1611; Dempster et al., 1995 Endocrin Rev. 4: 247-250), which recruits bone progenitor cells. Explain that there was a functional outcome (bone growth) after gene delivery for fibroblast repair of the plasmid construct.

5.1 Gene Activated Matrix

Any biocompatible matrix material comprising DNA encoding a desired therapeutic agent, such as a detoxification product (such as a therapeutic protein) or a transcription product (antisense or ribozyme), can be made and used in accordance with the present invention.

The genetically activated matrix of the present invention can be derived from any biocompatible material. Such materials include, but are not limited to, biodegradable or non-biodegradable materials, powders, gels, which can be made into structures capable of supporting cell adhesion and growth. It can be derived from naturally occurring proteins such as synthetic polymers or collagen, other extracellular matrix proteins or other structural macromolecules.

DNA bound to the matrix can encode a variety of therapeutic proteins depending on the predictive therapeutic use. Such proteins include growth factors, cytokines, hormones or any other protein that can modulate the growth, differentiation or physiological function of cells. DNA can encode an antisense or ribozyme that interferes with the translation of a protein that interferes with wound healing or induces inflammation.

The transduced DNA does not need to bind into the genome of the target cell; It is also an embodiment of the present invention to use DNA that does not bind in a gene activated matrix. In this case, once wound healing is complete, the gene product is no longer needed and the gene product is not expressed.

Another feature of the invention is a therapeutic kit comprising a biocompatible matrix and DNA. In some cases, the kit includes a preformed gene activated matrix so that the doctor can administer the matrix directly to the body. Or the kit contains components necessary to make a gene activated matrix. In such cases, the doctor combines the ingredients to create a gene-activated matrix that can be located on the body and used therapeutically. In embodiments of the invention, the matrix can be used to cover surgical devices such as suture materials or implants. In another embodiment of the invention the genetically activated matrix comprises using a sponge, tube, band-aid, lyophilized component, gel, patch or powder and teflon pad.

5.1.1 Matrix Materials

According to one feature of the invention, the DNA encoding the desired therapeutic agent is associated with or included in the matrix to create a genetically activated matrix. The matrix composition comprises i) effecting growth of repair cells; And ii) settling (delivering) DNA. Once the genetically activated matrix is ready, it can be stored for later use or used directly on the wound.

Matrix forms that can be used in the compositions, devices, and methods of the present invention are not limited in practice, and include biological and synthetic matrices. The matrix has all the characteristics associated with being "biocompatible", which when administered to a mammalian host does not create side effects, allergies or other unwanted reactions. Such matrices can be made from natural and synthetic materials. The matrix may not be biodegradable, in which case it is desirable to remain permanent in the body; In biodegradable cows, it is desirable to ensure that the therapeutic protein is expressed only for a short time. The matrix can be sponge, implant, tube, telpa pad, band-aid, band, pad, lyophilized component, gel, patch, powder or nanoparticulate. In addition, the matrix can be designed to release DNA slowly over long periods of time.

The matrix material is chosen differently depending on the wound area to be treated and the specific circumstances. U.S. The matrix as described in Patent 5,270, 300 can be used. Physical and chemical features such as biocompatibility, biodegradability, strength, robustness, interface properties and appearance, etc. are considered in selecting the matrix and are known in the art. The appropriate matrix acts as an in situ framework through the transport of DNA molecules and the migration of mammalian repair cells.

A matrix that does not biodegrade when the matrix is maintained for a long time is used, for example, sintered hydroxyapatite, bioglass, aluminate, other bioceramin materials, metals in particular titanium, and the like. Suitable ceramic transport systems are detailed in US Pat. No. 4,956,574. Bioceramic may be modified with a composition such as calcium-aluminate-phosphate; This can be processed to modify certain physicochemical properties such as pore size, particle size, particle shape, biodegradability, and the like. Polymer matrices can be used, including, for example, acrylic ester polymers and lactic acid polymers such as those described in US Pat. Nos. 4,521,909 and 4,563,489. Useful polymers include, for example, orthoesters, anhydrides, propylene-cofumarates or polymers of one or more γ-hydroxy carboxylic acid monomers such as γ-hydroxy auric acid (glycolic acid) and / Or γ-hydroxy propionic acid (ratic acid).

Particularly important features of the present invention can be used in connection with orthopedic implants, interfaces and artificial joints, including functional parts of implants such as surgical screws, pins and the like. In a suitable embodiment, the metal surface or surface of the implant or portion thereof, such as the titanium surface, is coated with a substance that is compatible with the nucleic acid, most appropriate with hydroxyl apatite and then the coated metal is added to the gene or nucleic acid to be delivered. Can be covered.

Available chemical groups of absorbent materials, such as hydroxyapatite, can be engineered to modulate affinity for nucleic acids by methods known in the art.

In suitable embodiments, biodegradable matrices are considered to be the most useful. Biodegradable matrices are generally defined as those that can be reabsorbed by the body. Biodegradable matrices that may be utilized in connection with the compositions, devices and methods of the present invention include biodegradable and chemically defined calcium sulfides, calcium triphosphate, hydroxyapatite, polyacetic acid, polyanhydrides, purified protein matrices. And semi-purified extracellular matrix composition.

Biodegradable polymers that can be used are known in the art and include, for example, polyesters ("PLGA") such as polyglycolide, polylactide and polyratic polyglycolic acid interpolymers (Langer and Folkman, 1976, Nature). 263: 797-800); Polyethers such as polycaprolactone (“PCL”); Polyanhydrides; polyalkyl cyanoacrylates such as n-butyl cyanoacrylate and isopropyl cyanoacrylate; Polyacrylamide; Poly (orthoesters); Polyphosphazenes; Polypeptides; Polyurethane; And mixtures of such polymers, including but not limited to.

It will be appreciated that any polymer that can be developed after being suitable for delayed or controlled nucleic acid release may be used in the present invention.

In a suitable embodiment, the biodegradable polymer is a glycolic acid and a lactic acid ("PLGA") interpolymer having a ratio of lactic acid and glycolic acid units in the range of 100/0 to 25/75. The average molecular weight (“MW”) of the polymer is in the range of about 6,000 to 700,000, suitably in the range of about 30,000 to 120,000, which can be determined by gel-penetration chromatography using commercially available standard molecular weight polystyrene, and the inherent viscosity is About 0.5 to 10.5.

The duration of the sustained release or controlled release of nucleic acid from the matrix in accordance with the present invention depends on the composition ratio of the MW of the polymer and of the lactic acid / glycolic acid. In general, when the ratio of lactic acid / glycolic acid is high (eg 75/25), the delayed controlled manner of release of the nucleic acid is long, while when the ratio of lactic acid / glycolic acid is smaller, the release period of the nucleic acid is Shorten.

The delayed or controlled release period also depends on the MW of the polymer. In general, high molecular weight polymers provide delayed or controlled release over a significant period of time. When preparing a matrix with delayed or controlled release for about 3 months, when the composition ratio of lactic acid / glycolic acid is 100/0, the appropriate molecular weight of the polymer is about 7,000 to 25,000; For 90/10, the molecular weight is about 6,000 to 30,000; 80/20 is about 12,000 to 30,000.

Another form of biomaterial that can be used is small intestinal mucosa (SIS). SIS graft material can be made from the factory fragments of adult pigs. Isolation of tissue samples is described by Badybak et al., 1989, J. Surg. Res. It is performed using routine tissue culture techniques detailed at 47: 74-80. The mesenteric tissue is removed, the fragments are inverted, the mucosa removed and the surface submucosa fragments are removed using mechanical friction techniques to obtain the SIS material. After the fragments are returned to their original orientation, the membranes and muscle layers are washed off and stored for further use.

Another particular example of a suitable material is fibrous collagen, which is extracted from the tissue and sterilized by freeze drying after partial purification. The matrix may be prepared from dry or skin collagen, which may be obtained from a variety of sources such as Sigma and Collagen Corporation. Collagen matrices can be prepared according to the methods described in U. S. Patents 4,394,370 and 4,975,527.

See also Yannas Burke, U.S. Lattice made of collagen and glycosaminoglycan (GAG) as described in Patent 4,505,266 can be used in the present invention. Collagen / GAG matrices can be used as a support or "skeleton" structure in which repair cells migrate. Bell, U.S. Patent No. It can be used as the collagen matrix or matrix material described in 4,485,097.

Various collagen materials can be mineralized collagen type. For example, a fibrous collagen implant material called UltraFiber ^™ , available from Norian Corp., (1025 Terra Bella Ave., Mountain View, CA, 94043), can be used to make the matrix. U. S. Patent 5,231, 169 describes the preparation of mineralized collagen through the formation of calcium phosphate minerals with gentle stirring in situ in the presence of dispersed collagen fibers. Such compositions are used to transport nucleic acid fragments to bone tissue sites. Mineralized collagen can be used as part of a gene activated matrix therapeutic kit for fracture repair. For example, type II collagen is purified from hyaline cartilage isolated from movable joints or growth plates. Type I collagen in rat tail tendons was obtained from Sigma Chemical Company, St. Available from Louis. Any form of recombinant collagen can be used, which can be obtained from recombinant host cells capable of expressing collagen, including bacterial yeast, mammalian, and insect cells. When collagen is used as the matrix material, it is beneficial to remove what is called "telopeptide" located at the end of the collagen molecule known to induce an inflammatory response.

Collagen used in the present invention may be further supplemented with calcium in the form of calcium phosphate. Intrinsic collagen and recombinant collagen can be supplemented by adding or mixing minerals in this manner.

5.1.2. DNA

Various other forms of DNA molecules can be used in the methods and compositions of the present invention. DNA molecules include genomes, cDNAs, single stranded DNA, double stranded DNA, triple stranded DNA, oligonucleotides, Z-DNA and the like.

DNA molecules encode various factors that promote wound healing, including extracellular, cell surface, intracellular RNA and proteins. Examples of extracellular proteins include growth factors, cytokine therapeutic proteins, peptide fragments of hormones and hormones, cytokine disruptors, peptide growth and differentiation factors, interleukins, chemokines, interferons, colony stimulating factors, angiogenesis factors, and the like. Examples of such proteins include five TGF-β allotropes, bone morphogenesis proteins (BMP), latent TGF-β binding proteins, LTBP; Keratinocyte growth factor (KGF); Hepatocyte growth factor (HGF); Platelet induced growth factor (PDGF); Insulin-like growth factor (IGF); Basic fibroblast growth factors (FGF-1, FGF-2, etc.); Vasculature endothelial growth factor (VEGF); Factor VIII or factor IX; Erythropoietin (EPO); Tissue plasminogen activator (TPA); Superfamily of TGF-β molecules, including actibin and inhibin, and the like. Hormones usable in the present invention include growth hormone (GH) and epithelial hormone (PTH). Extracellular proteins also include collagen, laminin and fibronectin. Cell surface proteins include cell adsorption molecules (eg, integrins, selectins, Ig groups such as N-CAM and L1, caherin); Cytokine signal generating receptors such as type I and II TGF-β receptors and FGF receptors; Non-signaling co-receptors such as betaglycans and syndecans, and the like. Intracellular RNA and proteins include signal transduction kinases, cytoskeleton muscle proteins such as Tallinn and Vinculin, cytokine binding proteins such as the latent TGF-β binding protein family, and nuclear trans-acting proteins such as transcription and reinforcement factors. Include.

DNA molecules also encode proteins that block disease progression so that the natural wound healing process is not interrupted. Blocking factors include enzyme tissue disruptors that disrupt tissue integrity, such as ribozymes that destroy RNA and DNA functions that encode interferers of metalloproteinases associated with arthritis.

Various molecular biological techniques generally known in the art can be used to obtain DNA fragments encoding the desired proteins. For example, a cDNA or genomic library can be screened using primers or probes having sequences based on known nucleotide sequences. Polymerase chain formation reactions (PCR) can be used to make DNA fragments encoding the desired protein. Alternatively, commercially available DNA fragments can be obtained.

DNA having various sequences detailed in the literature or included in the present invention, such modified genes, should encode proteins having the function of stimulating wound healing in any direct or indirect manner. Such sequences include sequences by point mutations, sequences due to degeneracy of the genetic code or sequences due to naturally occurring alleles, and sequences with genetically engineered modifications by the human hand.

Techniques for causing changes in nucleotide sequences to modify the functional properties of encoded proteins or polypeptides are known in the art. Such modifications include changing the amino acid sequence by deletion, insertion or substitution of bases. In order to increase the activity encoded by such a change, to increase the biological stability or to increase the half-life, it is possible to change its proteoglycan manner, to provide temperature sensitivity or to change the expression pattern of the protein. have. Changes to such nucleotide sequences are within the scope of this invention.

DNA can be recombinantly inserted into a variety of vector systems that provide DNA replication on a large scale to create a genetically activated matrix. Such vectors allow in vivo repair cells to contain essential components that can accept, transcrib, and translate DNA sequences.

Available vectors can be derived from, but are not limited to, recombinant bacteriophage DNA, plasmid DNA or cosmid DNA. For example, plasmid vectors such as pBR322, pUC 19/18, pUC 118, 119 and the M13 mp vector can be used. The bacteriophage vector includes? Gt10,? Gt11,? Gt18-23,? ZAP / R, EMBL bacteriophage, and the like. Cosmid vectors that can be used include pJB8, pCV 103, pCV 107, pCV 108, pTM, pMCS, pNNL, pHSG274, COS202, COS203, pWE15, pWE16 and charomid 9 vectors and the like. Vectors capable of in vitro transcription of RNA, such as SP6 vectors, can be used to create large amounts of RNA that can bind into the matrix. Alternatively, recombinant viral vectors may include, but are not limited to, recombinant viruses derived from viruses such as herpes simplex virus, retrovirus, Bexonia virus, adenovirus, adeno-associated virus or bovine papilloma virus. Integrated viral vectors may be used, but it is desirable to use a non-integrated system that does not deliver gene products to progeny cells for generations. In this way, the gene product is expressed during the wound healing process, and the gene is diluted and removed in offspring, thus reducing the amount of expressed gene product.

Methods known in the art can be used to create expression vectors comprising protein coding sequences associated with appropriate transcriptional / translational control signals. Such methods include in vitro recombinant DNA techniques and synthetic techniques (Sambrook, et al., 1992, Molecular Cloning, A Laboratory Manual, cold Spring Harbor Laboratory, NY and Ausubel et al., 1989, Current Protocols in Molecular Biology , Described in Greene Publishing Associates & Wiley Interscience, NY).

Genes encoding the desired proteins can be associated with a variety of different promoters / enhancer elements. Such expression elements may vary in their strength and specificity. Any one of the appropriate transcription and translation elements can be used depending on the host / vector employed. The promoter may be in the form of a promoter that is naturally associated with the desired gene. Alternatively, a recombinant or heterologous promoter, such as a promoter, can be placed under promoter control that does not normally associate with the gene. For example, tissue specific promoter / enhancer elements can be used to regulate the expression of DNA delivered to specific cell types. Examples of transcriptional regulatory moieties that exhibit tissue specificity include, but are not limited to: Elastase I gene regulatory site having activity in pancreatic progenitor cells (Swift et al., 1984, Cell 38: 639-646; Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol. 50: 399-409 MacDonald, 1987, Hepatology 7: 42S-51S); Insulin gene regulatory portion active on pancreatic beta cells (Hanahan, 1985, Nature 315: 1150122); Immunoglobulin gene regulatory portion active in lymphocytes (Grosschedl et al., 1984, Cell 38: 647-658; Adams et al., 1985, Nature 318: 533-538; Alexander et al., 1987, Mol. Cell. Biol. 7: 1436-1444); Albumin gene regulatory regions that are active in the liver (Pinkert et al., 1987, Genes and Devel. 1: 268-276); Alpha-fetoprotein gene regulatory moieties that are active in the liver (Krumlauf et al., 1985, Mol. Cell. Biol. 5: 1639-1648; Hammer et al., 1987, Science 235: 53-58); Alpha-1-antitrypsin gene regulatory portion that is active in the liver (Kelsey et al., 1987, Genes and Devel. 1: 161-171); Beta-globin gene regulatory moieties active against bone cells (Magram et al., 1985, Nature 315: 338-340; Kollias et al., 1986, Cell 46: 89-94); Myelin basic protein gene regulatory portion that is active in oligodendrocyte cells in the brain (Readhead et al., 1987, Cell 48: 703-712); Myosin light chain-2 gene regulatory region active in bone muscle (Shani, 1985, Nature 314: 703-712); Gonadotropin releasing hormone gene regulatory region active in the hippocampus (Mason et al., 1986, Science 234: 1372-1378) Viruses capable of growing in mammalian cells (eg RSV, vaccinia virus 7.5K, SV40, Promoters isolated from the genome of the HSV, adenovirus MLP, MMTV LTR and CMV promoters) or promoters prepared by recombinant DNA or synthetic techniques.

In some cases, the promoter element may be a structural promoter or an inducible promoter, which may be used under appropriate conditions to result in large or controlled expression of the desired gene. Expression of a gene under the control of a constitutive promoter does not require a specific substrate to induce gene expression, which can occur under all cell growth conditions. In contrast, when genes are expressed under the control of an inducible promoter, a response occurs depending on the presence or absence of an inducible substance.

Certain initiation signals are required for sufficient transcription of the inserted protein coding sequence. Such signals include ATG codons and contiguous sequences. Additional translational control signals are not required when inserting the entire coding sequence, including the initiation codon and the contiguous sequence, into an appropriate expression vector. However, incorporation of only the coding sequence portion should provide an external translational control signal comprising the ATG codon. In addition, the start codon must be in the read structure of the protein coding sequence to ensure translation of the entire insert. Such external detoxification control signals and initiation codons can be obtained from natural and synthetic origin. Expression effects and regulation can be enhanced by including transcription attenuation sequences, enhancer elements.

In addition to the DNA sequences encoding the desired therapeutic protein, the scope of the present invention includes the use of ribozyme or antisense DNA molecules that can be delivered to mammalian repair cells. Such antisense or ribozyme molecules can be used to repair tissue by interfering with the translation of RNA encoding proteins of genes that interfere with disease progression or wound healing processes.

Expression of antisense RNA molecules may act to directly disrupt the translation of mRNA by binding to target mRNA and interfering with protein translation. Expression of ribozyme, an enzymatic RNA molecule capable of catalyzing the specific cleavage of RNA, interferes with protein translation. Ribozyme mechanisms of action are associated with specific hybridization and restriction enzyme cleavage of ribozyme molecules to complementary target DNA. The scope of the present invention includes engineered hammerhead motif ribozyme molecules that catalyze specific and effective restriction enzyme cleavage of RNA sequences. RNA molecules can be made by transcription of DNA sequences encoding RNA molecules.

The scope of the present invention also includes the use of multiple genes that are complexed to a single gene structure or prepared in the same or different forms of separate structures under the control of one or more promoters. Thus, an almost infinite combination of different genes and gene structures can be used. Certain gene complexes can be made synergistic with cell proliferation and regeneration and any or all combinations are within the scope of the present invention. In addition, many synergies are described in the literature and those skilled in the art can identify gene complexes with synergistic effects.

5.1.3. Preparation of Gene Activated Matrix

In a suitable embodiment, the matrix or implant material is immersed in the recombinant DNA stock and brought into contact with the DNA encoding the desired therapeutic product. Depending on the matrix type used, the amount of DNA, the contact time required for DNA to bind to the matrix, and the like can be varied, which can be easily determined by those skilled in the art without experimentation. Or encapsulate DNA in a synthetic polymer matrix, such as a polyratic-polyglycolic acid block interpolymer (See Langer and Folkman, 1976 Nature, 263: 797-800 which is incorporated herein by reference). Again, such variables can be readily determined by one skilled in the art without undue experimentation. For example, the amount of DNA structure applied to the matrix can be determined in consideration of various biological and medical factors. Consideration should be given to specific genes, matrices, wounds, age, sex, food, and various clinical factors that may affect wound healing such as hormones and hormones.

In a further embodiment of the invention the biological and synthetic composition and the DNA can be lyophilized together to form a dry pharmaceutical powder. Gene-activated matrices can be rehydrated prior to transplantation into the body, or gene-activated matrices can be transplanted into the body and naturally rehydrated.

In some cases, the nucleic acid composition of the present invention is coated with medical means such as implants, sutures, wound dressings, etc. using techniques known in the art. Such methods include, but are not limited to, dipping the device in the nucleic acid composition, rubbing the nucleic acid composition into the device, or spraying the nucleic acid composition of the present invention. The device can be dried at room temperature or under reduced pressure using a drying oven. Suitable methods of coating the sutures are provided in the Examples.

In the case of sutures coated with a polymer matrix comprising plasmid DNA, Applicants applied a coating composition comprising about 0.01-10 mg of plasmid DNA, suitably about 1-5 mg of plasmid DNA, to a 70 cm long suture, It has been found that a homogeneous coating with a therapeutic effect is achieved by providing from 100 to 100, suitably 5 to 50, most suitably about 15 to 30 times.

In a particularly suitable embodiment, the present invention provides sutures coated with a polymeric matrix comprising nucleic acids encoding therapeutic proteins that stimulate wound healing in vivo.

Sutures coated according to the methods and compositions of the present invention include any natural or synthetic suture. Typical suture materials include silk; Cotton, linen; Polyolefins such as polyethylene and polypropylene; Polyesters such as polyethylene terephthalate; Hydroxycarboxylic acid ester homopolymers and interpolymers; Collagen (plain or chromasized); Joists (plain or chromasized); Suture-substituents such as cyanoacrylate, and the like. Sutures may be provided in a braid or twisted form and have a variety of size ranges commonly available in the art.

The advantage of sutures coated with a polymeric matrix comprising nucleic acids encoding therapeutic proteins to stimulate wound healing can be used for all fields of surgical use in humans and animals.

5.2. Use of Gene Activated Matrix

The present invention can be used for healing various wounds in human medicine. This includes but is not limited to bone repair, tendon repair, ligament, repair, vascular repair, bone muscle repair and skin repair. For example, using gene-activated matrix technology, cytokine growth factors produced by transduced repair cells can affect other cells in the wound through the binding of cell surface signaling receptors to associate with wound healing. Can stimulate and amplify a series of physiological processes.

The present invention can also be used for the purpose of blocking the progression of the disease to cause natural tissue healing or to replace genetically bound protein function.

The wound may occur due to or as a result of trauma injury or surgery. The genetically activated matrix of the present invention can be delivered to a patient using a variety of techniques. For example, a medical device or coated device (eg, sutures, stents, coated implants, etc.) may allow the physician to deliver the matrix directly to the wound site. The matrix can be administered topically or surgically placed in normal tissue to treat diseased tissue.

The wound healing process is a series of systematic processes that involve bleeding, cohesion formation, removal of damaged tissues at the same time, dissolution of clots and deposition of particulate tissue as an initial repair material. Particulate tissue is a mixture of fibroblasts and capillaries. The wound healing process involves various cell populations including endothelial cells, liver cells, macrophages and fibroblasts. Regulatory factors involved in wound repair are known to include systemic hormones, cytokines, growth factors, extracellular matrix proteins and other proteins that regulate growth and differentiation.

The DNA delivery method and matrix composition of the present invention can be widely used as a drug transport method to stimulate tissue repair and regeneration in a variety of different tissues. This includes, but is not limited to bone repair, skin repair, connective tissue repair, organ regeneration or catheterization and angiogenesis. The use of genetically activated matrices can be used to treat patients with impaired treatment capacity due to aging or diabetes. The matrix is used to treat wounds that heal slowly, for natural reasons, such as those who do not respond to therapy in individuals with aging and chronic skin wounds.

One important feature of the present invention is that scar tissue formation at the wound site can be controlled by selectively using a gene activated matrix. The formation of scar tissue can be controlled by regulating the level of therapeutic protein expressed. It is particularly desirable to prevent the formation of scar tissue, for example in the treatment of burns or connective tissue damage.

The method of the invention involves implanting a matrix comprising the desired DNA into a host. Fixation to implant the matrix involves surgically placing or injecting the matrix into a host. When injecting the matrix, the matrix is placed in a syringe and injected into the wound of the patient. Multiple injections can be made at the wound site. Alternatively, the matrix can be surgically placed at the wound site. The amount of matrix required to achieve the purpose of the present invention, such as to stimulate wound healing and regeneration, depends on the age, height and weight of the host.

An essential feature of the present invention is sufficient to induce a wound healing process each time (regardless of injection or surgery) a gene activated matrix is delivered to the host. This is a requirement for inducing migration and proliferation of mammalian repair cells targeted to the gene activated matrix.

The following paragraphs describe specific embodiments.

5.3. Goal play

After fracture, the bones actually have the ability to regenerate. A series of processes for repairing fractures are complex but occur in sequence, including hemostasis, coagulation lysis, endogenous growth of particles, bone formation, and the remodeling of bone into optimal structures (AW Ham., 1930, J. Bone). Joint Surg. 12, 827-844). Cells participating in such a process include platelets, inflammatory cells, fibroblasts, endothelial cells, peripheral cells, osteoclasts, osteogenic progenitor cells and the like. Recently, several peptide growth and differentiation factors have been identified to regulate cellular processes associated with bone formation and repair (Erlebacher, A., et al., 1995, Cell 80, 371-378). For example, bone morphogenic proteins (BMPs) are soluble extracellular factors that regulate the fate of osteogenic cells; The BMP gene is normally expressed by cultured fetal osseous cells (Harris, SE, et al., 1994, J. Bone Min. Res. 9, 389-394) and is normally expressed during rat embryonic skeletal formation (Lyons, KM). , et al., 1989, Genes Dev. 3, 1657-1668; Lyons, KM, et al., 1990, Development 190, 833-844; Jones, MC, et al., 1991, Development 111, 531-542) , Recombinant BMP protein initiates cartilage and bone progenitor differentiation (Yamaguchi, A., et al., 1991, J. Cell Biol. 113, 681-687; Ahrens, M., et al., 1993, J. Bone Min.Res. 12, 871-880; Gitelman, SE, et al., 1994, J. Cell Biol. 126, 1595-1609; Rosen, V., et al., 1994, J. Cell Biol. 127, 1755-1766), delivering recombinant BMPs to induce bone formation processes similar to intrachondral bone formation (Wozney, JM, 1992, Mol. Reprod. Dev. 32, 160-167; Reddi, AH, 1994, Curr. Opin. Genet. Dev. 4, 737-744), BMP-4 gene expression is not initially regulated during fracture repair (Nakase, T., et al., 1994, J. Bone). Min. Res. 9, 651-659). Osteoblastic protein-1 (Ozkaynak, E., et al., 1990, EMBO J. 9, 2085-2093), a member of the family associated with BMPs, has similar effects in vitro and in vivo (Sampath, TK, et. al., 1992, J. Biol. Chem. 267, 20352-20362; Cook, SD, et al., (1994) J. Bone Joint Surg. 76-A, 827-838). TGF-β also appears to stimulate cartilage and bone formation in vivo (Centrella, M., et al., 1994, Endocrine Rev. 15, 27-38; Sumner, DR, et al., 1995, J. Bone Joint Surg. 77A, 1135-1147). Finally, parathyroid hormone (PTH) is a hormone of 84 amino acids that causes plasma and extracellular liquid Ca ²⁺ enrichment. In skeletal tissues, intermittent administration of PTH fragments structurally required for biological activity (aa 1-34) has a real anabolic effect; In many in vivo and in vitro studies, administration of PTH1-34 to animals (including rats) results in the formation of large amounts of unbound bone in combination with inhibitory effects on osteoclasts and stimulating effects on osteogenic cells (Dempster, DW, et al., 1993, Endocrine Rev. 14, 690-709). PTH1-34 peptides are known to interact synergistically with BMP-4, thereby up-regulating the expression of cell surface PTH receptors that function in osteoblast differentiation in vitro (Ahrens, M., et. al., 1993, J. Bone Min.Res. 12, 871-880.

As recombinant proteins, peptide growth and differentiation factors such as BMP and TGF-β1 provide another possible treatment for fracture repair (Wozney, JM, 1992, Mol. Reprod. Dev. 32, 160-167; Reddi , AH, 1994, Curr. Opin. Genet. Dev. 4, 737-744; Centrella, M., et al., 1994, Endocrine Rev. 15, 27-38; Sumner, DR, et al., 1995 J. Bone Joint Surg. 77-A, 1135-1147). However, since relatively large doses are required to stimulate significant new bone formation in animals (μg), future human therapies will be costly and at increased risk of toxicity.

In one embodiment of the invention the genetically activated matrix is surgically implanted in a 5 mm bone incision site in a rat (model of untreated complex fracture in humans). It was found in the present invention that genes can be delivered to repair cells in the bone incision gap.

Coupling in bone repair and regeneration processes is associated with significant complications in clinical orthopedic surgery. For example, fiber non-binding after bone fracture, interface failure of the graft, and large heterogeneity? Transplant failure. Many complex fractures are currently being treated using autograft, but this technique is not effective and has complications.

Originally, any new technology designed to stimulate bone repair can be a valuable means to treat bone fractures. Much of the fractured bone is still being treated by castings that allow for natural mechanisms that affect the healing of wounds. Significant progress has been made in recent years in the treatment of fractures, including the development of new processes to improve, stimulate and augment the device, but wound repair mechanisms will be an important step in this area.

The present invention can be used to deliver bone growth genes to promote fracture repair. Other important features of this technique are to treat patients with "weak bones" such as osteoporosis; To improve wound healing poorly due to unknown reasons such as fiber non-bonding; To promote implant binding; To stimulate healing of other skeletal tissues such as the Achilles tendon; And gene delivery is used to use as an adjuvant to repair large defects.

Bone tissue is known to possess the ability to repair and regenerate and there is a specific understanding of the cells and molecules of such a process. The initial process of building bone involves the responsible clonal expansion and differentiation of repair cells. Once initiated, bone formation is promoted by various polypeptide growth factors. Newly formed bone is maintained by a series of local and systemic growth factors and differentiation factors.

Several bone morphogenic protein genes have been cloned (Wozney et al., 1988; Rosen et al. 1989, Connect. Tissue Res., 20: 313: 319; summarized in Alper, 1994), and DNA sequence identity in this work. BMPs were identified as members of the transforming growth factor-β (TGF-β) superfamily based on the Separate BMP genes were cloned to designate each individual BMP gene and protein, with at least BMP-1 to BMP-8. BMPs 2-8 appear to be bone products and BMP-1 appears to be a comprehensive morphogenetic material (Shimell et al., 1991, Cell, 67: 469-481). BMP-3 is called osteogenic (Luyten et al., 1989, J. Biol. Chem., 264: 13377-13380) and BMP-7 is called OP-1 (Ozkaynak et al., 1990, EMBO J , 9: 2085-2093). TGFs and BMPs act on cells through complex, tissue-specific interactions with cell surface receptor families, respectively (Roberts & Sporn, 1989, MB Sporn and AB Roberts, Eds., Springer-Verlag, Heidelberg, 95 (Part 1); Aralkar et al., 1991).

Transforming growth factors (TGFs) also appear to play an important role in regulating tissue healing by affecting cell proliferation, gene expression and matrix protein synthesis (Roberts & Sporn, 1989, MB Sporn and AB Roberts, Eds., Springer). Verlag, Heidelberg, 95 (Part 1)). For example, both TGF-β1 and TGF-β2sms can be described as cartilage and osteogenic (Joyce et al., 1990, J. Cell Biol., 110: 195-2007; Izumi et al., 1992, J Bone Min.Res., 7: 115-11; Jingushi et al., 1992, J. Orthop.Res., 8: 364-371).

Other growth factors / hormones besides TGF and BMP can also be used in the present invention to influence the formation of new bone after fracture. For example, injecting fibroblast growth factors into rat fracture sites at a number of high doses (1.0 mg / 50 mL) significantly increases cartilage tissue in the fracture gap (Jingushi et al., 1990). Is not effective.

Calcium regulatory hormones such as parathyroid hormone (PTH) can be used in the present invention. PTH is a calcium-regulating hormone of 84 amino acids whose main function is to raise the Ca ²⁺ concentration in plasma and extracellular fluids. Intrinsic PTH has been shown to stimulate bone resorption in organ cultures for more than 30 years and hormones are known to increase the number and activity of osteoclasts. Studies on intrinsic hormones and synthetic peptides explain that the amino ends (aa 1-34) of molecules include structures for biological activity (Tregear et al., 1973; Hermann-Erlee et al., 1976, Endocrine Research). Communications, 3: 21-35; Riond, 1993, Clin. Sci., 85: 223-228).

In one embodiment of the invention the genetically activated matrix can be surgically implanted at the bone fracture site. Such surgical procedures include direct injection of GAM preparations at the fracture site, surgical repair of complex fractures, or arthroscopic surgery. When using genetically activated matrices to repair fractured bones, mammalian repair cells naturally migrate to and propagate bone damage.

The surprising finding found in the present invention is that the gene can be delivered to repair cells in regenerative tissue in the bone incision gap. Currently, suitable methods for gene delivery include plasmid DNA captured in synthetic matrices, such as block interpolymers such as PLGA, or using fibrous collagen implant material immersed in a DNA solution immediately before being placed in the desired site to promote bone growth. To use. As can be seen in the study presented here, the cells in the gap where the implant material is bone-dissected participate in bone regeneration / recovery by targeting the external plasmid structure as a target. After receiving the cell, the transgene directly expresses the recombinant polypeptide, which is confirmed by the expression of a functional marker gene product in vivo.

In addition, the study demonstrates that the delivery of genes with bone properties results in the expression of recombinant bone property molecules in the cell and such expression directly stimulates new bone formation. In particular, a gene transfer vector encoding BMP-4 and a gene transfer vector encoding human PTH1-34 fragments, alone or in combination, will stimulate new bone formation. After considering a relatively large number of recommended genes, a gene transfer vector encoding the human parathyroid hormone, hPTH1-34, stimulated new bone formation in Sprague-Dawley rats, which revealed that human peptides were found on PTH / PTH on the surface of rat osseous cells. It explains that it can bind to the receptor effectively.

5.4 Soft tissue

The present invention can be used to promote the growth or regeneration of soft tissues such as ligaments, tendons, cartilage and skin. Skeletal connective tissue injury due to trauma can be treated with a matrix containing genes encoding various growth factors. Connective tissue normally consists of cells organized extracellularly in a characteristic tissue structure and extracellular matrix. If the tissue is injured, this structure is destroyed and stimulates the wound healing process. The method of the invention is particularly suitable for stimulating the growth and regeneration of connective tissue, which is important because damaged tissue can regenerate without forming scar tissue because the scar tissue can interfere with the normal mechanical function of connective tissue. .

Various growth factors can be used to facilitate soft tissue repair. These include, but are not limited to, TGF-β superfamily components (including TGF-β itself), which can stimulate expression of genes encoding extracellular matrix proteins, and other cytokines such as EGF and PDGF. Other genes that may be used include, for example: (a) cytokines such as peptide growth and differentiation factors, interleukins, chemokines, intoferons, colony stimulating factors; (b) angiogenic factors such as FGF and VEGF; (c) extracellular matrix proteins such as collagen, laminin and fibronectin; (d) cell adsorption molecular components (eg, integrin, selectin, N-CAM, Group Ig components such as L1, and kahedrin); (e) cell surface cytokine signal generating receptors such as type I and II TGF-β receptors and FGF receptors; (f) cytoskeletal proteins such as Tallinn and vinculin; (i) cytokine binding proteins such as latent TGF-β binding protein families; And (j) nuclear trans-acting proteins such as transcription factors.

Once formed, this matrix is placed in the wound connective tissue of the host mammal. The gene activated matrix can be injected directly into the damaged connective tissue site. Alternatively, surgical techniques such as arthroscopic surgery may be used to transfer the matrix to the wound connective tissue site.

5.5. Organ regeneration

The invention can also be used to stimulate repair and regeneration of organ tissue. Traumatic wounds or traumatic organ damage due to surgery can be treated using the methods of the present invention. In the liver, the liver can be damaged by infection with various types of infectious agents, such as excessive alcohol intake or hepatitis virus. The kidneys may also be damaged due to kidney disease or the like and lose normal function. The mucous membranes of the esophagus, stomach or duodenum may have ulcers by pepsin in acids and stomach acids. Ulcers can also occur due to colony formation of gastrointestinal mucosa cells by Helicobacter pylori bacteria. Such organs and diseases are exemplary and the invention may be used to stimulate regeneration of a disease or organ in any other organ of the body.

A matrix having DNA encoding cytokines that stimulate cell proliferation and differentiation or regulate tissue morphogenesis can be implanted at appropriate organ sites. Such factors include, but are not limited to, transgenic growth factor family of proteins, platelet induced growth factor (PDGF), insulin-like growth factor (IGF), fibroblast growth factor (FGF), and the like. In some cases, it can be used to express growth factors or cytokines that stimulate the proliferation of cell types specific to a given organ, such as hepatocytes, kidneys and heart cells. For example, hepatic cell growth factors may be expressed in the liver to stimulate the wound healing process. To treat ulcers due to Helicobacter infection, the genetically activated matrix may include DNA encoding anti-microbial proteins.

The gene activated matrix of the present invention can be surgically implanted into the organ to be treated. Alternatively, a laparoscopic surgery procedure can be used to deliver the genetically activated matrix to the body. When treating tissue damage, the natural wound healing process will stimulate repair cells to migrate and propagate to the implanted matrix. Or delivery of a gene-activated matrix to an undamaged organ, for example, if the matrix is implanted to express a therapeutic protein unrelated to wound healing, inducing tissue damage that can stimulate the wound healing process have.

5.6. Regulation of vasculature

The invention can also be used to regulate the formation and expansion of blood vessels or angiogenesis and angiogenesis. This physiological process plays an important role in wound healing and organ regeneration.

First, particle tissue consisting of collagen, matrix and vascular mixture is deposited at the wound site, which provides durability to the wound during tissue repair. The formation of new blood vessels involves the proliferation, migration and infiltration of vascular endothelial cells, which are known to be regulated by various polypeptide growth factors. Several polypeptides with endothelial cell growth promoting activity have been identified, including acidic and basic fibroblast growth factor (FGF), vascular endothelial growth factor (VEGF) and placental induced growth factor (PDGF).

To stimulate the formation and extension of blood vessels, DNA encoding such growth factors is bound to a matrix and transplanted into the host. In some cases it is essential to induce wound healing processes through tissue damage.

It may be necessary to protect the growth of blood vessel formation as in angiogenesis associated with solid tumor growth that relies on angiogenesis for growth. Tumor angiogenesis can be interrupted by delivering DNA encoding a negative blocker of angiogenesis such as thrombospodine or angiostatin. In an embodiment of the invention DNA encoding thrombospodine or angiostatin is bound to a matrix and the matrix is implanted in a tumor site of a patient.

5.7. Repair of the skin

The present invention can be used to stimulate the growth and repair of skin tissue. In the case of wounds in which the skin is damaged, it is important to grow the skin quickly in order to prevent infection, to prevent fluid loss and to reduce potential scarring sites, especially in the case of large burns on the skin. Skin damage due to burns, cuts, cuts or abrasions can be treated using the genetically activated matrix of the present invention. Skin diseases such as psoriasis, atopic dermatitis or skin damage due to fungal, bacterial and viral infections or skin cancer treatment such as melanoma can be treated according to the methods of the present invention.

Treating skin damage and skin diseases using a matrix comprising DNA encoding cytokines that stimulate the proliferation and differentiation of skin cells, including central basal liver cells, keratinocytes, melanocytes, langerhanssam and Merkel cells . Gene-activated matrices have two functions, one to protect the skin from infection and dehydration, and the other to supply DNA to repair cells. Gene-activated matrices of the invention include U.S. Patent 4,505,266 or U.S. As described in Patent 4,485, 097, it includes a skin patch, dead skin, a band-aid, gauze pad, collagen lattice and the like. Before using the matrix at the wound site, damaged skin or dead tissue is removed. The DNA to be bound to the matrix can encode a variety of different growth factors, including keratinocyte-growth factor (KGF) or epidermal growth factor (EGF). As part of the treatment process, DNA encoding IL-1, a potent inducer of epithelial cell migration and proliferation, can be bound to the matrix of the invention.

6. Examples; Implants for Use in Bone Gene Delivery

Various implant materials have been used to deliver genes to bone repair and regeneration sites in vivo. Such substances are immersed in a solution containing DNA or genes delivered to the bone regeneration site. Alternatively, the DNA is bound to the matrix by an appropriate preparation method.

Particularly suitable as a suitable material is fibrous collagen, which may be sterilized and lyophilized after extraction from the tissue and partially purified. Another particularly suitable collagen is type II collagen, the least of which is recombinant type II collagen or mineralized type II collagen. The implant material is immersed in a DNA (or virus) solution under sterile conditions prior to placement at the bone incision site. Soak time is from 6 minutes to overnight. The DNA (eg plasmid) solution is a sterile solution such as sterile water or an acceptable buffer and the concentration is generally 0.5-1.0 mg / ml of the solution. Currently suitable plasmids are pGL2 (Promega), pSV40β-gal, pAD.CMV1acZ, and pcDNA3.

Example: Detection of Proteins in vitro after Transgene Expression

7.1. β-galactosidase transfer gene

Bacterial β-galactosidase can be detected immunohistochemically. Fix the bone incision sample in Bounis fixative, remove the minerals and then divide in half along the axial plane. Half of each sample is subsequently fixed in paraffin for identification by the immune tissue of the bacterial β-galactosidase protein.

For immunohistochemistry, the cuts (2-3 mm thick) are transferred to a poly-L-lysine coated microscope slide glass and fixed in acetone at 0 ° C. for at least 20 minutes. The part is rehydrated in PBS. Soak for 10 minutes at room temperature in 0.1% hydrogen peroxide (contained in 95% methanol) to stop the endogenous peroxidase activity, the stopped portion is washed 3X with PBS. In some cases, the cranial canal is immersed in 4% EDTA, 5% polyvinyl pyrrolidone, 7% sucrose, pH 7.4 at 4 ° C. for 24 hours to remove minerals. The demineralized portion is washed 3X before use as an antibody. Primary antibodies are used without dilution in hybridoma supernatant form. Purified antibody is used for the tissue portion at a concentration of 5 mg / ml. Primary antibodies are detected using binotinylated rabbit anti-rat IgG and peroxidase conjugated streptoavidin (Zymed Histostain-SPkit). After peroxidase staining, the parts are counterstained with hematoclinin.

Bacterial β-gal can be detected using a commercially available kit (eg, Promega) via a substrate utilization test as directed by the manufacturer.

7.2. Luciferase transgene

Luciferase can be detected using a commercially available kit (eg, Promega) through a substrate utilization test as directed by the manufacturer.

7.3. PTH Transgene

Recombinant PTH, such as the hPTH1-34 peptide, can be detected through homogenates of bone incision gap tissue using two commercially available radioimmunoassay kits (Nichols Institute Diagnostics, San Juan Capistrano, Calif.) as directed by the manufacturer.

One kit is the Intact PTH parathyroid hormone 100T kit. This radioimmunoassay uses the lower body to the C end of the native hormone, which is used to measure endogenous hormone levels in the bone incision gap tissue.

This test can be used to establish the lowest expression level of PTH in a rat bone incision model.

The second kit is a kit for measuring two-site immunoradioactivity for the determination of rat PTH. Such kits utilize the most potent purified antibody specific for the amino end of the native murine hormone (PTH1-34) and thus can measure endogenous PTH as well as recombinant protein. Previous studies have shown that such antibodies cross-react with human PTH, allowing the recognition of recombinant molecules in vivo.

Accurate sensitivity measurements can be obtained by subtracting the value obtained from kit # 1 (antibody to the C terminus) from the value obtained from kit # 2 (antibody to the amino terminus). Recombinant peptide levels correlate with the degree of new bone formation.

7.4. BMP Transgene

BMP proteins, such as the murine BMP-4 transgene peptide product, recognize HA epitopes (Majmudar et al., 1991, J. Bone and Min. Res. 6: 869-881), such as monoclonal antibodies available from Boehringer-Mannheim. It can be detected immunohistochemically using a specific antibody. Antibodies against BMP proteins can also be used. Such antibodies using various immunoassay methods are described in U.S. It is described in detail in Patent 4,857,456. Fix the bone incision sample in Bounis fixative, remove the minerals and then divide in half along the axial plane. Half of each sample is subsequently immobilized in paraffin for confirmation by immunohistochemistry of the recombinant BMP-4 molecule.

8. Example: Delivery of bone attribute genes stimulates bone regeneration and repair in vivo.

The next experiment is to investigate whether gene transfer can be used to make transduced cells that structurally express recombinant hPTH1-34 in vivo and whether these transgenes stimulate bone formation. The speed of new bone formation is analyzed as follows. Upon examination, the bone incision site is carefully separated for histological analysis. The size of bone tissue A-P and M-L is measured using a caliper. Samples are soaked in Bouins fixative, washed with ethanol, and minerals are removed with fric acid buffer. Due to the good stability of the methacrylate during the preparation and separation of the samples, plastics with fixed descaling materials are used.

The tissue block is dehydrated and fixed while increasing the alcohol concentration. Using a Reichert Polycot microtom, cut 5 mm thick sections from the parietal plane. The part is prepared centrally along the width of the bony cavity to prevent sampling from biasing to one side. Stain bone, bone, cartilage, and fibrous tissue by staining using modified Goldner's Trichrome staining to view parts under a light microscope. Cover the sections using Eukitt's payload media (Calibrated Instruments, Ardsley, NY). Histomorphological analysis is observed under light using a Nikon Optipot Research microscope. Stereoscopic analysis using a 10mm x 10mm eyepiece grating.

The total bone area at 125 × magnification is measured as an index of the overall intensity of the treatment response. Bone, cartilage, and fibrous tissue areas are measured at 250 × magnification, which examines the relative distribution of each tissue in bone formation. Since the size of the bone incision gap reflects the reference value (time 0), the bone area can be measured at regular intervals in succession to indicate the rate at which the bone is filled. Statistical significance is measured by analyzing the variables and comparing post-hoc data using Tukey's standardized range test.

As described above, in the 5 mm bone incision model, it was found that the PTH transgene could stimulate bone regeneration / recovery in living animals. This is an important finding that hPTH1-34 is a more potent assimilation agent, especially when provided intermittently as opposed to persistent, and that the gene transfer method used here is a continuous form of transport.

9. Examples; Direct gene transfer to regenerative bone in vivo

A gene activated matrix containing mammalian expression plasmid DNA is implanted into a large fragment gap made in the adult male thigh. Transplanting a gene activated matrix comprising a beta-galactosidase or luciferase plasmid allows repair cells growing in the gap to express DNA and accept a functioning enzyme. In addition, implanting a gene activated matrix comprising a bone morphogenic protein-4 plasmid or a plasmid encoding parathyroid hormone (amino acids 1-34) results in a biological response in which new bone fills the gap. Finally, transplanting two plasmid gene-activated matrices encoding bone morphogenetic protein-4 plasmids or parathyroid hormone (amino acids 1-34) fragments that appear to have synergistic effects in vitro are more likely than single grafts alone. New bones are made faster. For the first time, these studies demonstrated that repair cells in bone can be genetically manipulated in vivo. While acting as a useful tool in the study of the biology of repair fibroblasts and the wound healing process, the genetically activated matrix of the present invention also has a wide range of therapeutic activities.

9.1. Materials and methods.

For 5 mm bone incisions, four pins 1.2 mm in diameter are fixed to the femoral transverse tracheal joints of normal adult Spargue-Dawley rats with constant stimulation under general anesthesia. The surgical plate derived by placing the pins side by side was identified by fluorescence (the pins were set at 3.5 mm from the edge of the fixture and 2.5 mm apart). Secure the outer fixture plate (30X10X5mm) to the pin. The outer mounting plate is made of aluminum alloy in the CNC mill for high resistance. Pre-made straps with lock washers and threaded pins are made of stainless steel. All fixtures are sterilized with ethylene oxide gas prior to use in the surgery. 5 mm fractional defects are made at the center of the shaft using a Hall Micro 100 oscillating saw (Zimmer Inc., Warsaw, Ind.). Collagen sponge is placed and maintained in the bone incision gap until the clot is surrounded by blood; Preliminary studies have shown that such specimens anchor sponges to bone incisions. The incised skin is covered with fibers. The anchor is provided for stability so that the walking and movement of the mammalian host is not restricted for several weeks.

9.1.2. Immunohistochemistry

Tissues were prepared by light microscopy and immunohistochemistry as described above (Wong et al., 1992, J. Biol. Chem. 267: 5592-5598). Tissue sections are incubated with a commercially available anti-β-gal antibody (1: 200 dilution, 5 Prime → 3 Prime) and incubated with a commercially available anti-HA.11 polyclonal antibody (1: 500 dilution, BAbco).

9.1.3. Luciferase and β-gal Enzyme Test

Luciferase and β-gal activity are measured using a luciferase assay system (Promega) and a β-galactosidase enzyme assay system (Promega) according to the manufacturer's protocol.

9.1.4. pGAM1 expression plasmid

To incorporate pGAM1, 13.5 days p.c. using kit reagents and protocol (Poly AT Tract mRNA Isolation System I, Promega). Prepare mRNA from CD-1 rat embryos. cDNA can be made from commercially available reagents using mRNA (Reverse Transcriptase System, Promega). Full-length murine BMP-4 cDNA coding sequence can be generated by PCR reaction using the following conditions; 94 ° C., once every 4 minutes; 30 times of 94 degreeC, 1 minute, 65 degreeC, 1 minute, 72 degreeC 1 minute; Once at 72 ° C. for 8 minutes. PCR primers are based on the known murine BMP-4 sequence (GenBank); Upstream primer-5 ′ CCATGATTCCTGGTAACCGAATGCTG 3 ′; Downstream primer-5 ′ CTCAGCGGCATCCGCACCCCTC 3 ′. Agarose gel electrophoresis is used to purify a single PCR product of expected size (1.3 kb). The 5 'end of the BMP-4 insert is further modified by adding 27 nucleotide sequences encoding the HA-epitope (PCR), and the BMP-4 insert is cloned into the pcDNA3 expression vector (InVitrogen). Plasmid VII is prepared and sequenced (both strands) to ensure orientation and insertion of the BMP-4 insert.

The pGAM1 plasmid is expressed using an in vitro transcription and translation kit (TNT T7 bound Reticulocyte Lysate System, Promega) according to the manufacturer's protocol. Protein radiolabeling, immunoprecipitation, sample preparation and SDS-PAGE, autoradiographs, transient transfections and Western analysis are described in Yin et al., 1995, J. Biol. Chem. 270: 10147-10160, as described above.

9.1.5. pGAM2 expression plasmid

PCR is used to make human parathyroid hormone cDNA fragments encoding amino acid preprol-34. PCR primers are known human PTH sequence (GenBank): upstream primer-5 'GCGGATCCGCGATGATACCTGCAAAAGACATG 3'; Downstream primer-5 'GCGGATCCGCGTCAAAAATTGTGCACATCC 3'. In such a pair of primers, BamHI sites are made at both ends of the PCR fragment. The fragment is cleaved with BamHI and ligated into the BamHI cloning site of the PLJ retroviral vector (Wilson et al., 1992, Endocrinol. 130: 2947-2954). Inserted clones in the coding direction are isolated and characterized by DNA sequencing.

To make retroviral stocks, 10 μg of recombinant vector DNA was transfected into the φCRIP package cell line (Wilson, J.M., et al., 1992, Endocrinology 130: 2947-2954) using the calcium phosphate method. After overnight incubation, supplemented with 10% fetal calf serum, penicillin (100 U / ml), streptomycin (100 mg / ml) containing retroviral particles (all reagents are from Gibco-BRL Life Technologies, Inc.) Cultured medium (Dulbecco's Modified Eagle's Medium) is obtained and used for cultured Rat-1 cells. Individual clones of successfully transfected Rat-1 cells are obtained following standard insertion and selection procedures. Briefly, cultured Rat-1 cells are grown to join and selected at G418 at 1:10 (1 mg / ml. Gibco-BRL Life Technologies, Inc.). In some cases antibiotic resistant colonies are collected in a single culture. In other cases, a single colony of resistant cells is maintained. Similar methods are used to make colonies of RAT-1 cells transduced with BAGT retroviruses encoding bacterial β-gal enzymes.

Using a commercially available radioimmunoassay kit (INS-PTH Nichols), the concentration of hPTH1-34 is measured in the cell culture medium according to the protocol provided by the manufacturer. The biological activity of peptides encoded by pGAM2 is described by McCauley, et al., 1994, Mol. Cell. Endocrinol. 101: Evaluate as described above in 331-336.

9.1.6. Preparation of Gene Activated Collagen Sponges

Freeze-dried bovine organ collagen (10 mg, Sigma) in each bone incision gap is completely soaked in 0.5-1.0 mg plasmid DNA sterile solution and incubated for 1-16 hours at 4 ° C. prior to transplantation.

9.1.7. Radioactivity

A weekly planar film radiograph is taken with the mobile X-ray unit awake from the mammalian host (backward-forward direction). Exposure is 1 / 10th of a second at 57kV, 15ma.

9.2. result

9.2.1. Bone incision model

The system we used is a 5 mm bone incision in the central axis of the adult rat femur. In rats, the bone incision gap completes recovery 9 weeks after surgery, which depends on the size of the gap; The 2 mm gap is healed by bone bonding and the 5 mm gap is healed by lack of fiber adhesion (Rouleau, J. P., et al., Trans. Ortho. Res. Soc. 20 :). In controlled mammalian hosts maintained for up to 13 weeks after surgery, it was confirmed that the 5 mm gap is generally cured by the lack of fibrous adhesions. Weekly flat film radiographs and histological examinations (FIGS. 1A-D) showed plasmid DNA containing only 5 mm bone incisions (n = 3), 5 mm bone incisions and collagen sponges (n = 10) or 5 mm bone incisions and marker genes. In mammals containing the collagen sponge (n = 23) containing the bone is not formed. All 36 baseline gaps were treated by deposition of fibrous tissue. The reference thigh indicates the formation of new periosteal bone (mixed with where the pin is located). Transient inflammatory responses (lymphocytes and macrophages) in gap tissues were also observed after surgery.

9.2.2. Marker Gene Research

In a preliminary study, lacZ and β-gal expressing plasmid DNA were successfully delivered in vivo. The goal is to standardize the gene activated matrix preparation protocol and the hourly response after the procedure. Luciferase encoding GAM is placed in the fracture gap of one rat and a gene activated matrix encoding β-gal is placed in the gap of the second animal. After 3 weeks, the gap homogenate (consisting of granular tissue) is prepared after careful cutting of the surrounding bone, cartilage and skeletal muscle. For each homogenate, enzyme expression is assessed using the substrate utilization test. The expected enzyme activity in each homogenate sample is detected. Positive results are obtained in different experiments varying the conditions (DNA amount, time to examine protein expression, etc.).

9.2.3. BMP-4 gene delivery

Explaining that gap cells express functional enzymes after receiving plasmid DNA from the matrix, we questioned whether gene delivery could also be used to regulate bone regeneration. During fracture repair, BMP-4, an osteoinductive factor normally expressed by progenitor cells, was overexpressed. Full length murine BMP-4 cDNA was generated using PCR and subcloned with pcDNA3 (Invitrogen) eukaryotic expression vector (FIG. 2). To specifically detect only recombinant proteins, modifications are made by adding a hemagglutinin (HA) epitope at the 3 'end of the BMP-4 coding sequence. Recombinant BMP-4 was expressed from this construct (pGAM1) using in vitro electronic and translation protocols. Immunoprecipitation studies allow the recognition of HA epitopes recognized by anti-HA polyclonal antibodies. pGAM1 plasmid DNA was transiently transduced into cultured 293T cells followed by biosynthesis of recombinant BMP-4. As explained by immunoprecipitation, BMP-4 molecules are coalesced into homodimers, secreted and processed as expected. These results established that anti-HA polyclonal antibodies recognize HA-epitopes.

Collagen sponges containing pGAM1 DNA were placed in the gaps of nine adult mice maintained for 4-24 weeks. Four weeks after surgery, one mammalian host was killed and immunohistochemistry using anti-HA antibodies showed that repair fibroblasts in the gap expressed pGAM1. This is significant because there is no positive staining in the gap tissue of the gap tissue taken from 13 reference mammalian hosts. It can be observed in microscopic lesions or 4-week specimens of new bone resulting from the edge of the surgical part. Consistent with the description of bone formation by autoinduction (Urist, 1965, Science 150: 893-899), this focus is on cellular connective tissue, which is injured by large scleroblasts and composed of multifunctional spindle fibroblasts and capillaries. It consists of a corrugated plate supported by. In 7 mammalian hosts sacrificed 5-12 weeks after surgery, BMP-4 encoded by the transgene was not detected by the immune tissues, but the amount of new bones was constantly increased on radiographs (FIG. 3A). . New bone connections extending from the surgical edge across the bone incision gap were observed at around 9 weeks. The ninth mammal uncle survived without complications for 24 hours after surgery. Sufficient amount of new bone was formed around 18 weeks to remove external fixation and for an additional six weeks the mammalian host was able to walk well (FIG. 3A). The exception is when the die is filled with fresh bone that is actively reconstituted, and the thin strip is shiny by radiation near the end edge of the gap. If the mammalian host successfully walks without immobilization, such a strip appears to be partially mineralized. Consistent with the biomechanical hypothesis test (Frankenburg et al., 1994, Trans. Ortho. Res. Soc. 19: 513), indicating that the treated gap has the same dynamic strength as the immobile joints of the same mammalian host. Explain (6.3% difference, maximum torque test). In nine cases, the appearance of radiation on the opposite side did not change, indicating that the effects of gene transfer and BMP-4 overexpression are limited to the fracture gap.

9.2.4. Delivery and Expression of Plasmid Cocktail (BMP-4 + PTH1-34)

Normal bone formation is regulated by multiple factors in the regulated sequence, and therefore the question is whether the expression of several assimilation factors stimulates bone production than when one factor is expressed. To prove this hypothesis, we decided to deliver two plasmid GAMs that encode peptides of BMP-4 and parathyroid hormone (PTH) together. PTH, parathyroid hormone (PTH) is a hormone of 84 amino acids that causes plasma and extracellular liquid Ca ²⁺ enrichment. In skeletal tissues, intermittent administration of PTH fragments structurally required for biological activity (aa 1-34) has a real anabolic effect; In many in vivo and in vitro studies, administration of PTH1-34 to animals (including rats) results in a combination of inhibitory effects on osteoclasts and stimulation effects on osteogenic cells, resulting in large amounts of unbound bone formation (Dempster, DW, et al., 1993, Endocrine Rev. 14, 690-709). PTH1-34 peptides are known to interact synergistically with BMP-4, thereby up-regulating the expression of cell surface PTH receptors that function in osteoblast differentiation in vitro (Ahrens, M., et. al., 1993, J. Bone Min.Res. 12, 871-880.

CDNA fragments encoding human PTH1-34 are made using PCR. To find out its biological activity. Fragments were subcloned into PLJ retroviral vectors (Wilson et al., 1992, Endocrin, 130: 2947-2954) to create pGAM2 expression plasmids (FIG. 4A). Prepared retroviruses with replication defects are prepared and given to Rat-I cells in culture. Independent clones of the transduced Rat-I cells were obtained, and Southern and Northern analyzes were used to determine whether retroviral DNA was stably inserted and expressed. Radioimmunoassays are used to determine the concentration of human PTH1-34 in the conditioned medium of individual clones. ROS 17 / 2.8 cells possess a PTH cell surface receptor, which belongs to the G protein bound receptor superfamily (Dempster et al., 1993, Endocrin. Rev. 14: 690-709). Incubation of ROS 17 / 2.8 cells with conditioned medium obtained from stably transduced cell lines resulted in a 2.7-fold increase in CAMP response compared to baseline, indicating that the secreted PTH1-34 peptide is biologically active.

GAMs containing bone stimulating pGAM2 plasmid DNA and GAMs containing BMP-4 and PTH1-34 expressing plasmid DNA were transplanted together into a bone incision gap of three mammalian hosts. All three (one host killed at this time to study histology) had a linkage around 4 weeks, and in the remaining mammalian hosts a sufficient amount of new bone formed 12 weeks after transplantation to remove external anchorage (Fig. 5). Both mammalian hosts were able to walk well 15 to 26 weeks after transplantation, respectively. Based on planar film radiographs, it can be seen that the effects of gene transfer and overexpression are limited to bone incision gaps.

Subsequent studies with collagen sponges show that the plasmid DNA is delivered to the cells in a sustained manner after being captured in a block interpolymer preparation of polytic-polyglycol particles. It can be explained that the cultured cells are transfected with plasmid DNA released from polyratic-polyglycol particles. The results also indicate that in vivo repair fibroblasts (rat bone incision model) are capable of receiving and expressing plasmid DNA released from a block interpolymer preparation of polyratic-polyglycol particles. In FIG. 7 it is shown that repair fibroblasts (rat bone incision model) in vivo are capable of receiving and expressing pGAM2 plasmid DNA released from a block interpolymer preparation of polyratic-polyglycol particles. As can be seen in Figure 7, expression of PTH1-34 encoded in the plasmid is associated with significant new bone production in the bone incision gap.

Together, this study indicates that genetically activated matrix technology does not depend on collagen matrix for success. Thus, this technique includes that it can be combined with biological matrices and synthetic matrices.

10. Example: Delivery of genes for generating tendons and cruciate ligaments in vivo

Temporary stimulation of scar formation during repair of the Achilles tendon and ligaments (shoulder and knee) is needed to strengthen the physical capacity of the damaged tissue. Experimental models make partial defects in the Achilles tendon, and small intestinal mucosa or SIS is used as the gun implant / molecular delivery material. In this Example, the regeneration using SIS implants illustrates the transport and expression of marker gene constructs into the dry tissue.

10.1 Materials and Methods

Partial defects were made in the Achilles tendon and the SIS preparation was used as a gun transplant / molecular transport system. Plasmid (pSVogal, Promega) stock solutions are prepared according to standard methods (Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual Cold Spring Harbor Laboratory Press). SIS implant material is prepared from factory fragments of adult pigs (Badylak et al., 1989, J. Surg. Res. 47: 74-80). Intermediate tissue is removed and the fragments are inverted upon removal to remove mucosa and epithelial mucosa using mechanical friction techniques. The fragments are returned to their original orientation and sterilized with dilute peracetic acid and stored at 4 ° C. until use.

Hybrid studies (all studies) are anesthetized, tubes are inserted, lying on the right side horizontally on a heating pad and maintained anesthesia by inhalation. Achilles tendon is exposed using a lateral incision from the muscle and muscle contacts to the fascia. The central part of the gun is wrapped in a SIS double-thick sheet, sealed at both ends, and 1.5 cm of the gun piece is pulled out through the lateral openings of the graft material and then sealed the implant and surgical site. Legs should be fixed for 6 weeks and used freely after 6 weeks. The transplanted tissue is obtained at the time points indicated below and fixed in Bouins solution and buried in paraffin. A portion of the tissue (8 μm) is cut out and used for immunohistochemistry.

10.2 Results

In early studies, partial defects in mongrel dogs up to 6 months after surgery, followed by implantation of SIS material (SIS-only graft), promoted Achilles tendon regeneration. The reconstruction process involves the rapid formation of granular tissue and the degradation of the graft. No scar tissue was formed and no immune-mediated rejection was seen.

In a second study, SIS was immersed in plasmid DNA solution (SIS + plasmid graft) and implanted into Achilles tendon (n = 2) or cruciate ligament graft (n = 2) in normal hybrid dogs. pSVβgal plasmids using monkey virus 40 regulatory sequences to drive β-galactosidase activity can be immunohistochemically detected using specific antibodies in 4/4 mammalian hosts. The negative criterion is that β-gal activity does not appear in uncontrolled Achilles, tendon and cruciate ligaments of these mammals. Thus, SIS has been shown to receive and express plasmid DNA by new tendon cells in tendons and ligaments.

The third study measures the expression of β-gal transgenes over time. Transgenic gene expression was examined by immunohistochemistry by implanting SIS + plasmid grafts at 3, 6, 9, and 12 weeks (n = number of dogs per hour). The tissue fixed in Bounis and paraffin-embedded is cut crosswise (8 μm) and placed on a Probeon Plus Fisher. Immunohistochemistry was performed according to the protocol provided by Histonstain-SP kit (Zymed). Briefly, slides were incubated with well-characterized anti-β-galactosidase antibody (12:00 dilution, 5 Prime → 3 Prime), washed in PBS, incubated with a second biotinylated antibody , Washed, stained with the enzyme conjugated substrate-chromogen mixture and then counterstained with hematocillin and eosin.

Bacteria receiving SIS + plasmid grafts (8/8 mammalian hosts) detect bacterial β-gal activity. Transgene expression occurred around 9-12 weeks, although not in significant amounts. Bacterial β-gal gene expression was not detected in 35 mammalian hosts that received only SIS-grafts.

11.Examples: Gene Delivery by Adenoviruses to Regenerating Bone in Vivo

Another method of delivering in vivo genes to regenerative tissue is to use adenovirus-mediated delivery methods. Successful delivery of adenovirus genes from the marker gene construct to the bone repair cells in the rat bone incision model.

11.1 Materials and Methods

Adenovirus vector pAd. CAMlacZ is an example of a replication-defective adenovirus vector capable of replicating in acceptor cells (Stratford-Perricaudet et al., 1992, J. Clin. Invest. 90: 626-630). In this particular vector, an early enhancer / promoter of cytomegalovirus (CMV) is used to transcribe lacZ and the SV40 polyadenylation reaction sequence cloned downstream of the reporter gene (Davidson et al., 1993, Nature Genetics 3 : 219-223).

pAd.RSV4 has the same basic structure as pAdCMVlacZ, but the CMV promoter and single BglII cloning site were replaced with a cassette, which consists of the RSV promoter, multiple cloning site and poly (A ⁺ ) site. The large elasticity of this vector is considered useful for subcloning of osteogenic genes such as hPTH1-34 cDNA fragments for further study.

Immerse Ulter Fiber ^™ grafts in AdCMV lacZ virus solution (10 ¹⁰ -10 ¹¹ PFU / ml) for 6 minutes and place at the bone incision site. The defect can heal for three weeks, during which time the wound healing process is monitored by weekly radiographic examination. At 3 weeks, 40% of the bonds are filled with osteogenic tissue. Kill the mammalian host and fix the tissue in Bounis and remove the mineral from the standard formic acid solution for 7 days.

11.2 Results

The results obtained indicate that the marker gene product was expressed in the chondrocyte-cells of the bone incision gap (FIG. 6). Nuclear-targeted signals were also observed in glandular astrocytes.

12. Example: Delivery of Gene to Bone Muscle

In addition to Achilles tendons and ligaments (shoulders and knees), it is necessary to clinically stimulate scar formation during repair of soft tissues to enhance physical capacity in damaged tissues. An adult rat bone muscle is incised to prepare a model system that uses a suture preparation coated with a preparation capable of continuously releasing PLGA particles and plasmid DNA as a bone muscle / genetic well device. To illustrate the feasibility of the coating composition and the method of the invention, sutures are coated with marker DNA (encoding human placental alkaline phosphatase) and used to seal rat muscle tissue. Experiments demonstrate the successful delivery and expression of DNA in tissue repaired with coated sutures.

12.1 Materials and Methods

12.1.1. Preparation of DNA-PLGA Coating Composition

Human placental alkaline phosphatase (1 mg, 0.5 mM Tris-) in 1.5 ml PLGA / chloroform solution (3% (w / v) 50/50 polytic polyglycolic acid PLGA interpolymer, ave.MW 90,000, intrinsic viscosity 1.07) 0.2 ml of solution containing labeled DNA encoding EDTA, pH 7.3) is added. The solution was stirred for 2 minutes and emulsified by ultrasonic grinding at 0 ° C. for 30 seconds using a microtip probe type ultrasonic wave crusher at 55 Watt output. This process produces a milky emulsion.

12.1.2. Surgical Suture Cloth

A 22-gauge needle is used to puncture a piece of Teflon-coated foil (Norton Performance Plastic Corp., Akron, OH). Drop a drop (approximately 60 μl) of DNA-PLGA emulsion into the hole. A 70 cm long 3-0 chrome suture (Ethicon) is removed through the hole to cover the suture. When the suture passes through the pores, the suture is uniformly thinly coated (ca. 30 μm thick). The sutures are air dried for about 3 minutes and the coating process is repeated 15 times to allow each coating to air dry. Examination of the coated suture with an electron microscope (150X) shows that the DNA-PLGA is uniformly coated on the suture. In addition, the coating remained intact even after several suture passes through the tissue.

12.1.3. Repair of Bone Muscle with Coated Sutures

The sutures prepared above were used to suture the bone muscle tissue of two adult mice. Sutures have excellent bundled properties. After 1 week, the sutured muscles are dissected, flash frozen in liquid nitrogen and powdered. The powder is incubated in 200 μl lysis buffer and cleared by three freeze-thaw procedures. The clear liquid was incubated at 65 ° C. and then tested for alkaline phosphatase activity using standard methods.

12.2. result

In the results, the rat bone muscles sewn with coated sutures recovered alkaline phosphatase activity after 1 week, indicating that the labeled alkaline phosphatase gene was expressed in bone muscle. The baseline did not recover alkaline phosphatase activity. These data show that emulsions can be used to effectively coat sutures and transfer genes to propagate repaired cells in vivo.

13. Example Delivery of genes to blood vessels

There is a need to clinically prevent excessive fibrosis (restenosis) while the vessels are repaired after angioplasty. This can be done by delivering a gene encoding a lysyl oxidase blocker or by delivering a gene encoding a particular TGF-βs. In addition, it is necessary to control angiogenesis in diseases with insufficient vasculature, which aims to stimulate the formation of new blood vessels to prevent blood oxygen reduction and cell death of tissues. A model is prepared in which most blood vessels in rabbits are transfected with PLGA particles and plasmid DNA preparations which are continuously released. These rabbit blood vessels have repair cells because they have foam cell lesions that are clinically similar to atherosclerosis in humans. In this example, it is described that the marker gene construct can be delivered and expressed in large blood vessel ascites cells.

13.1. Materials and methods

Male and female New Zealand white rabbits of 3.1 to 3.5 kg were used in this study. Rabbits are anesthetized using ketamine (35 mg / kg) and silazine (5 mg / kg) as muscles, and ketamine (8 mg / kg) is administered intravenously to maintain anesthesia. Between the downward aortic branch and the groin ligament, about two centimeters of the two iliac arteries are separated, knotted and all small branches ligated. Heparin (100 mg) is administered locally to the ear vein to prevent thrombus formation locally. An angiogenic catheter (2.0 mm instrument) is inserted into the iliac artery fragment through the iliac arterial incision and the instrument is inflated at 8 atm pressure for 1 minute.

After instrumental incision, angiogenic catheter is removed and 20 mg heparin is injected into the artery to prevent terminal thrombus formation. Both ends of the iliac artery are tied with 10.0 silk and a 5 mg / ml DNA-nanoparticle suspension is injected into each iliac artery at 0.5 atm for 3 minutes. The wound is sealed. Rabbits are killed about two weeks after instrumental angiogenesis and nanoparticle transport. The iliac artery is separated through a vertical lower abdominal incision. Cut 2 cm fragments from both ends of the iliac artery. Rabbit carotid artery is used as a reference. Tissues are stored in liquid nitrogen for alkaline phosphatase testing.

13.2 Results

Phosphotase expression test results demonstrate that nanoparticles and DNA preparations can deliver nucleic acids to repair cells in the iliac arteries of adult rabbits damaged by instrumental catheter. The left and right iliac arteries were positive for phosphatase activity after exposure to nanoparticle and DNA preparations. The reference artery did not detect phosphatase activity. These positive results indicate that exposing the gene activated matrix to repair cells in large blood vessels accepts and expresses nucleic acid molecules.

The present invention is not intended to be limited to the illustrated embodiments, which are examples for explaining the present invention and may use any clone, DNA or amino acid, which is also within the scope of the present invention. In addition to the above description, those skilled in the art will recognize that various changes can be made to the present invention. Such modifications also fall within the scope of the present invention.

It will be appreciated that all base pairs of nucleotides are approximate and have been used for illustrative purposes.

Claims (11)

The wound healing active gene is included in the biocompatibility matrix, wherein the biocompatibility matrix is selected from collagen, metal, hydroxyapatite, bioglass, aluminate, and bioceramic, and the wound treatment gene is formed around the wound area. Fibroblasts, capillary endothelial cells, capillary pericytes, mono inflammatory cells, segmented inflammatory cells, granulated tissue cells Infiltrated by), the cells are wound healing matrix composition, characterized in that the recovery function to move from the surrounding tissue to the wound to heal the wound. 2. The wound healing matrix composition of claim 1, wherein the gene product is a protein. 2. The wound healing matrix composition of claim 1, wherein the gene product is antisense or ribozyme. 2. The wound healing matrix composition according to claim 1, wherein the gene product is a growth factor. 5. The wound healing matrix composition according to claim 4, wherein the growth factors are TGFβ, FGF, PDGF, IGF, BMP. 2. The wound healing matrix composition of claim 1, wherein the matrix comprises one or more molecules. The wound healing matrix composition according to claim 1, wherein the biocompatible matrix is collagen. 8. The wound healing matrix composition of claim 7, wherein the collagen is type II collagen. A wound healing kit comprising: the wound healing matrix composition according to claim 1 in a suitable container. A wound healing kit comprising: a DNA preparation encoding a wound healing matrix composition according to claim 1 and a therapeutic protein in a suitable container. A method of making a wound healing matrix according to claim 1 wherein the wound healing DNA is brought into contact with a biocompatible matrix to cause DNA to covalently bind to the matrix.