MXPA01000910A - Antisense oligonucleotides for the inhibition of vegf expression - Google Patents

Abstract

The present invention relates to an oligonucleotide or a derivative thereof which has a sequence that corresponds to a part of a nucleic acid which encodes VEGF (vascular endothelial growth factor) and which has the ability to inhibit tumor growth in animal tumor models, the invention further relates to the preparation of such oligonucleotide and the use thereof. An oligonucleotide or a derivative thereof which has the sequence SEQ ID NO. 4 or a part thereof, wherein SEQ ID NO. 4 is 3'-GTACCTACAGATAGTCGCGTCGATGACGGTAGG-5', with the first proviso, that not all internucleoside bridges in the oligonucleotide are phosphodiester internucleoside bridges and not all phosphodiester internucleoside bridges are replaced by phosphorothioate internucleoside bridges and/or the second proviso, that the oligonucleotide contains no modified nucleosides selected from C5-propynyl uridine, C5-propynyl cytidine, C5-hexynyl uridine, C5-hexynyl cytidine, 6-aza uridine and 6-aza cytidine.

Description

ANTI-SUITENTIAL OLIGONUCLEOTIDES FOR VEGF EXPRESSION INHIBITION The present invention relates to an oligonucleotide or its derivative having a sequence corresponding to a part of a nucleic acid encoding vascular endothelial growth factor (VEGF = Vascular Endothelial Growth Factor) and has an ability to inhibit tumor growth in animal tumor models, the invention further relates to the preparation of this oligonucleotide and its use. Angiogenesis is defined as the growth of new capillary blood vessels and plays a key role in growth and development. In mature humans the ability to initiate an angiogenic response is present in all tissues, but is kept under strict control. Angiogenesis is only mobilized in specific situations, such as wound repair and endometrial regulation. The regulation of angiogenesis is based on a fine balance between numerous inhibitory and stimulation factors. VEGF, also demonized vascular permeability factor (VPF = Vascular Permeability Factor), is a key regulator of angiogenesis and its mitogenic effect is specific for endothelial cells (Ferrara, Trends Cardiovasc, Med. (1993) 3, 244). VEGF exists in at least four different forms that exert similar biological activities and results from alternative splicing. VEGF is expressed at abnormally high levels in human tumors and in diseased tissues characterized by a high degree of vascularization or vascular permeability, such as diabetic retinopathy, psoriasis, age-related macular degeneration, rheumatoid arthritis and other inflammatory diseases. Therefore, agents that selectively lower VEGF levels can be used to treat malignancies and other angiogenic diseases. It has been shown that monoclonal antibodies to VEGF can suppress the growth of several tumors in nude mice (Kim et al., Nature (1993) 362, 841). Another possibility to reduce VEGF levels is the use of antisense oligonucleotides which are optionally modified in order to improve their properties (E. Uhlmann and A. Peyman, Chemical Reviews 90, 543 (1990); S. Agrawal, TIBTECH 1996, 376; EP 0653439 A2). Antisense oligonucleotides are considered to bind to specific mRNA sequences that result in mRNA degradation and / or inhibition of protein synthesis. EP 0769 552 A1 claims antisense oligonucleotides of 8 nucleotides or longer directed against VEGF, which can inhibit VEGF expression at 30% or less. Oligonucleotides were tested in a system «< & , cell-free in the form of phosphodiesters, which would not be stable under in vivo conditions. Selected antisense oligonucleotides were also tested in the form of all phosphorothioates (A085R-S, A087P-S, A227-S, A287-S, A311-S, and A419-S) showing 30-46% inhibition of VEGF expression at 20 μM of all phosphorothioate oligonucleotide in an A549 cell-based assay. WO 97/39120 discloses antisense oligonucleotides against VEGF mRNA that reduces the production of cellular VEGF in cells treated at concentrations less than about 1 micromolar. In a special embodiment, the antisense oligonucleotide has the sequence (SEQ ID NO: 1) 5'-GCGCTGATAGACATCCATG-3 ', wherein the oligonucleotide comprises phosphorothioate groups either in all internucleotide bridges or in particular internucleotide positions, and in the latter case also in particular positions a modified nucleoside residue selected from C5-propynyl uridine, C5-propynyl cytidine, C5-hexinyl uridine, C5-hexinyl cytidine, 6-aza uridine, or 6-aza cytidine (Table 1 in WO 97 / 39120). At a meeting of the "American Association for Cancer Research 1998" (American Association for Cancer Research 1998) data were shown concerning the activity of an antisense oligonucleotide VEGF - for which the sequence is not described, "(abstract published in the AACR Vol. 39, p.95) It was shown that oligonucleotide has the ability to inhibit the growth of gliobastome xenografts in nude mice The present invention provides an oligonucleotide or its derivative having the sequence corresponding to the sequence SEQ ID NO: 2 or a portion thereof in which SEQ ID NO: 2 is 5 '-CATGGATGTCTATCAGCGCAGCTACTGCCATCC-3' The SEQ ID NO: 2 sequence is part of a nucleic acid sequence encoding VEGF The portion of the nucleic acid to which the oligonucleotide (hereinafter "ON") corresponds, preferably has a length of from 10 to 33 nucleotides, more preferably from 17 to 20 nucleotides, in particular a Thus, an oligonucleotide of the invention preferably has a length of 10 (10 mero) to 33 nucleotides (33 mero), more preferably 17 to 20 nucleotides, in particular a nucleotide of 17, 18, 19 or 20 nucleotides. length of 17, 18, 19 or 20 nucleotides (17 mere, 18 mere, 19 mere, 20 mere). In a special embodiment of the invention, the oligonucleotide has a length of 19 nucleotides. The oligonucleotide has a sequence corresponding to a part of a nucleic acid encoding VEGF. The phrase "corresponds to" means that the base sequence of the oligonucleotide is complementary to a part of a nucleic acid sequence, which encodes VEGF (eg, gene, cDNA, mRNA) and therefore allows the oligonucleotide to hybridize to (bind to a) that "sense" part of the nucleic acid coding VEGF (which is preferably a VEGF mRNA). This is the reason why it is called "antisense oligonucleotide". In a preferred embodiment of the invention, the oligonucleotide is an antisense oligonucleotide. In another preferred embodiment of the invention, the oligonucleotide is a ribozyme. A ribozyme is a catalytic nucleic acid that cleaves mRNA. Preferred ribozymes are chosen from the group of hammerhead ribozymes (Uhlmann and Peyman, 1990). The nucleic acid sequence encoding VEGF and to which the oligonucleotide corresponds has the sequence (I D D E S E C. N O. 2) '-CATGGATGTCTATCAGCGCAGCTACTGCCATCC-3'. This sequence is equivalent to nucleotides 185-217 of the human VEFG cDNA described in Figure IB of Leung et al.

(Science (1989) 246, 1306). The sequence SEQ ID. DO NOT. 2 is also equivalent to nucleotides 185-217 of human VEGF mRNA, when the nucleotides are numbered as by Leung et al. (Science (1989) 246, 1306). In a preferred embodiment of the invention, the oligonucleotide is equivalent to nucleotides 185-203 of human VEGF mRNA. A part of the human VEGF cDNA is also given in Table 3 (SEQ ID NO.19); SEC ID DO NOT. 2 also corresponds to a part of SEQ ID. NO.19 Therefore, the present invention relates to an oligonucleotide or its derivative having the sequence SEQ ID NO. DO NOT . 4 or a part thereof, wherein SEQ ID. NO. 4 is 3 '-GTACCTACAGATAGTCGCGTCGATGACGGTAGG-5'; 5 '-GGATGGCAGTAGCTGCGCTGATAGACATCCATG-3' with the first condition, that not all internucleoside bridges in the oligonucleotide are internucleoside phosphodiester bridges and not all internucleoside phosphodiester bridges are replaced by internucleoside phosphorothioate bridges and / or the second condition, which the oligonucleotide does not contain modified nucleoside selected from the modified C5-propynyl uridine, C5-propynyl cytidine, C5-hexinyl uridine, C5-hexinyl cytidine, 6-aza uridine and 6-aza cytidine. The oligonucleotide corresponds to the sequence SEQ ID NO. DO NOT. 2 or a part of it. In a preferred embodiment, the oligonucleotides correspond to (SEQ ID NO: 3) or a portion thereof. Preferably an oligonucleotide corresponding to a part of SEQ ID NO. DO NOT. 3 has a length of 17, 18 or 19 nucleotides.

SEC ID DO NOT. 3: 5 '-CATGGATGTCTATCAGCGC-3' Thus, the oligonucleotide has for example one of the sequences SEQ ID NO. DO NOT . 4 to SEQ ID NO. 16, where SEC ID NO.4 is 3 '-GTACCTACAGATAGTCGCGTCGATGACGGTAGG -5' (33mer), 5'-GGATGGCAGTAGCTGCGCTGATAGACATCCATG-3 'SEC ID. DO NOT. 5 is 3 '-CCTACAGATAGTCGCGTCGATGACGG-5'; (26 mer), 5 '-GGCAGTAGCTGCGCTGATAGACATCC-3' SEC ID. DO NOT. 6 is 3 '-CAGATAGTCGCGTCGATGACGG-5'; (22 mer), 5 '-GGCAGTAGCTGCGCTGATAGAC-3 • SEC ID. DO NOT. 7 is 3 '-AGTCGCGTCGATGACGG-5'; (17 mer), 5 * -GGCAGTAGCTGCGCTGA-3 'SEC ID. DO NOT. 8 is 3 '-CTACAGATAGTCGCGTCG-5'; (18 mer), 5 '-GCTGCGCTGATAGACATC-3' SEC ID. DO NOT. 9 is 3 '-GTACCTACAGATAGTCGCGTCGATGACGG-5'; (29 mer), 5 '-GGCAGTAGCTGCGCTGATAGACATCCATG-3' SEC ID. DO NOT. 10 is 3 '-GTACCTACAGATAGTCGCGT-5'; (20 mer), 5 '-TGCGCTGATAGACATCCATG- 3' SEC ID. DO NOT. 11 is 3 '-GTACCTACAGATAGTCGCG-5'; (19 mer), 5 '-GCGCTGATAGACATCCATG-3' SEC ID. DO NOT. 12 is 3 '-GTACCTACAGATAGTCGC-5'; (18 mer), 5 '-CGCTGATAGACATCCATG-3' SEC ID. DO NOT. 13 is 3 '-ACCTACAGATAGTCGCG-5'; (17 mer), 5 '-GCGCTGATAGACATCCA-3' SEC ID. DO NOT. 14 is 3 '-GTACCTACAGATAGTCG-5'; (17 mer), 5 '-GCTGATAGACATCCATG-3' SEC ID. DO NOT. 15 is 3 '-TACCTACAGATAGTCGCG-5'; (18 mer), and 5 '-GCGCTGATAGACATCCAT-3' SEC ID. DO NOT. 16 is 3 '-TACCTACAGATAGTCGC-5'; (17 mer), 5 '-CGCTGATAGACATCCAT-3'. SEC ID. DO NOT. 4 is the sequence corresponding to or is complementary to the sequence ID DE SEC. DO NOT. 2, respectively. The sequences SEQ ID. DO NOT. to 16 correspond to part of the sequence SEQ ID. DO NOT. 2. The sequences SEQ ID. NO .5 to 16 are equivalent to part of the sequence SEQ ID. DO NOT. 4. In a preferred embodiment of the invention the oligonucleotide has the sequence SEQ ID. DO NOT. 11 (corresponds to a part of the VEGF coding sequence having the sequence ID DE SEC. NO.3). The invention also relates to derivatives of the oligonucleotides, for example their salts, in particular their physiologically tolerated salts. Salts and physiologically tolerated salts are for example described in Remington's Pharmaceuticals Science (1985) Mack Publishing Company, Easton, PA (page 1418). Derivatives are also related to modified oligonucleotides having one or more modifications (for example at particular nucleoside positions and / or at particular internucleoside bridges, oligonucleotide analogs (e.g., Polyamide-nucleic acids (APNs), phosphono-nucleoside nucleic acids (APHONs = APMENs ), oligonucleotide chimeras (for example consisting of a part DNA- and an APN part or consisting of a part DNA- and an APHON).) A preferred object of the invention relates to an oligonucleotide having a corresponding sequence. SEQ ID NO: 2 or a part thereof (a sequence designated SEQ ID NO: 4 or a part thereof respectively) and which is modified.More preferably, an oligonucleotide is modified in order to improve its properties, for example in order to increase their resistance to nucleases or to make them resistant against nucleases, respectively, to improve their binding affinity to a nucleic acid. or complementary, or in order to increase cellular absorption. Therefore, the present invention preferably relates to an oligonucleotide having a particular sequence as set forth above and which further has one or more chemical modifications compared to a "natural" DNA, composed of the "natural" nucleosides deoxyadenosine ( adenine + ß-D-2 '-deoxyribose), deoxyguanosine (guanine + ß-D-2' -deoxyribose), deoxycytidine (cytosine + ß-D-2 '-deoxyribose) and thymidine (thymine + ß-D-21 - deoxyribose) linked by internucleoside phosphodiester bridges. The oligonucleotide may have one or more modifications of the same TYPE and / or modifications of a different TYPE; each TYPE of modification can be selected independently of the known types of modifications for use in modifying oligonucleotides. Examples of chemical modifications are known to the person skilled in the art and are described, for example, by E. Uhlmann and A. Peyman, Chemical Reviews 90 (1990) 543 in "Protocols for Oligonucleotides and Analogs Oligonucleotides and Analogs" (Protocols for Oligonucleotides and Analogs) Synthesis and Properties & Synthesis and Analytical Techniques (Synthesis and Properties and Synthesis and Analytical Techniques), S. Agrawal, Ed, Humana Press, New Jersey, USA 1993 and S.T. Crooke, F. Bennet, Ann. Rev. Pharmacol. Toxicol 36 (1996) 107-129; J. Hunziker and C. Leuman (1995) Mod. Synt. Methods 7, 331-417. For example, in comparison to natural DNA, an internucleoside phosphodiester bridge, a β-D-2'-deoxyribose and / or a natural nucleoside base (adenine, guanine, cytosine, thymine) can be modified or replaced. An oligonucleotide according to the invention may have one or more modifications, wherein each modification is located at the particular internucleoside phosphodiester bridge and / or a β-D-2 '-deoxyribose unit and / or at a particular natural nucleoside base position in comparison with an oligonucleotide of the same sequence composed of natural DNA. For example, the invention relates to an oligonucleotide comprising one or more modifications and wherein each modification is independently chosen from: a) the replacement of an internucleoside phosphodiester bridge located at the 3'- and / or 5'- end of a nucleoside by a modified internucleoside bridge. b) the replacement of the phosphodiester bridge located at the 3 '- and / or 5' - end of a nucleoside by a defosfo bridge, c) the replacement of one sugar phosphate unit of the phosphate sugar main structure by another unit, d) the replacement of a β-D-2 '-deoxyribose unit with a modified sugar unit, e) replacement of a natural nucleoside base with a modified nucleoside base, f) conjugation to a molecule that influences the properties of the oligonucleotide, g) conjugation to a 2 '5'-linked oligoadenylate or its derivative, optionally by an appropriate linker, and h) the introduction of an inversion 3-3' and / or 5'-5 'at the 3' and / or 5 'end of the oligonucleotide. More detailed examples for the chemical modification of an oligonucleotide are a) the replacement of an internucleoside phosphodiester bridge located at the 3'- and / or 5'- end of a nucleoside by a modified internucleoside bridge, where the modified internucleoside bridge for example it is chosen from phosphorothioate, phosphorodithioate, NR ^ 'R1' -phosphoramidate, boranophosphate, phosphate- (1-21 carbon atoms) -0-alkyl ester, phosphate- [(6-12 carbon atoms) -aril- (( 1-21 carbon atoms) -0-alkyl] ester, (1-8 carbon atoms) alkyl phosphonate and / or (6-12 carbon atoms) - ar i 1 f ona to, (7-12 carbon atoms) -hydroxymethyl-aryl (for example described in WO 95101363), wherein (6-12 carbon atoms) -aryl, (6-20 carbon atoms) -aryl and (6-14 carbon atoms) -aryl are optionally substituted by halogen, alkyl, alkoxy, nitro, cyano, and wherein R1 and R1 'independently are hydrogen, (1-18 carbon atoms) o) -alkyl, (6-20 carbon atoms) -aryl, (6-14 carbon atoms) -aryl- (1-8 carbon atoms) -alkyl, preferably hydrogen, (1-8 carbon atoms) -alkyl and / or methoxyethyl, preferably hydrogen in particular, (1-4 carbon atoms) -alkyl and / or methoxyethyl, or R1 and R1 'form, together with the nitrogen atom they transport, a 5-6-membered heterocyclic ring which also may contain an additional heteroatom of group 0, S and N, b) replacement of the phosphodiester bridge located at the 3 '- and / or 5' - end of a nucleoside by a defosfo bridge (Defective bridges are described, for example, by Uhlmann, E. and Peyman, A. in "Methods in Molecular Biology"), Vol. 20, "Protocols for Oligonucleotides and Analogs" ("Protocols for Oligonucleotides" and Analogs "), S. Agrawal, Ed., Humana Press, Totowa 1993, Chapter 16, 355ff), wherein the defosfo bridges are chosen for example from the formacetal dephosphonate bridges, 3 '-thioformacetal, methylhydroxylamine, oxime, methylenedimethyl- hydrazole, dimethylenesulfone and / or silyl groups; c) the replacement of a sugar phosphate unit (β-D-2 '-deoxyribose and internucleoside phosphodiester bridge, together form a sugar phosphate unit) of the main sugar phosphate structure (main structure sugar phosphate is composed of sugar phosphate units) by another unit, where the other unit for example is suitable for constructing a "morpholino derivative" oligomer (as described, for example, in EP Stirchak et al., Nucleic Acids Res. 17 (1989) 6129), ie, for example the replacement of a unit derived from morpholino; - polyamide nucleic acid ("APN") (as described, for example, in PE Nielsen et al., Bioconj Chem. 5 (1994) 3 and in EP 0672677 A2), this is for example the replacement by a main structure of APN, for example by 2-aminoethylglycine; phosphorus mono acid acidic nucleic acid ester ("APHON") (as described, for example, by Peyman et al., Angew, Chem. Int. Ed. Engl. 35 (1996) 2632-2638 and in EP 0739898 A2), this is for example the replacement of a PHONA main structure; d) the replacement of a β-D-2 '-deoxyribose unit with a modified sugar unit, wherein the modified sugar unit is, for example, selected from β-D-ribose, -D-2' -deoxyribose, L-2 ' -deoxyribose, 2'-F-2'-deoxyribose, 2'-0- (1-6 carbon atoms) alkyl ribose, preferably 2'-0- (1-6 carbon atoms) alkyl-ribose is 2 '-O-methylribose, 2'-0- (2-6 carbon atoms) alkenyl-ribose, 2'- [O- (1-6 carbon atoms) alkyl-O- (1-6 carbon atoms) alkyl ] -ribose, 2'-NH2-2'-deoxyribose, β-D-xylo-furanose, -arabinofuranose, 2,4-dideoxy-β-D-erythro-hexo-pyranose, and carbocyclic analogues (described, for example, in Froehler, J. Am. Chem. Soc. 114 (1992) 8320) and / or open chain sugar (described for example, in Vandendriessche et al., Tetrahedron 49 (1993) 7223) and / or bicyclo sugar analogues (described for example, in M. Tarkov et al., Helv. Chim. Acta 76 (1993) 481); e) the replacement of a natural nucleoside base with a modified nucleoside base, wherein the modified nucleoside base is, for example, selected from uracil, hypoxanthine, 5- (hydroxymethyl) uracil, N2-Dimethylguanosine, 5- (hydroxymethyl) uracil , 5-aminouracil, pseudouracil, dihydrouracil, 5-fluorouracil, 5-fluorocytosine, 5-chlorouracil, 5-chlorocytosine, 5-bromouracil, 5-bromocytosine, 2,4-diaminopurine, 8-azapurine, 7-deazapurine substituted, preferably a 7-deaza-7-substituted and / or 7-deaza-8-substituted purine or other modifications of natural nucleoside bases, for example modified nucleoside bases described in EP 0 710 667 A2 and EP 0 680 969 A2; f) the conjugation to a molecule that influences the properties of the oligonucleotide, where the conjugation of the oligonucleotide to one or more molecules that (favorably) influence the properties of the oligonucleotide (for example the ability of the oligonucleotide to penetrate the cell membrane or enter to a cell, the stability against nucleases, the affinity for a target sequence of VEGF coding, the pharmacokinetics of the oligonucleotide, the ability of an antisense / ribozyme oligonucleotide to attack the target VEGF coding sequence, for example the ability to bind to and / or interlace, when the oligonucleotide or the molecule conjugated to the oligonucleotide respectively hybridizes to the target coding sequence of VEGF), wherein the examples for molecules that can be conjugated to an oligonucleotide are polylysine, intercalating agents such as pyrene, acridine, phenazine or phenanthridine, fluorescing agents such as fluorescein, crosslinking agents such as psoralen or azidoproflavin, lipophilic molecules such as (12-20 carbon atoms) -alkyl, lipoxy such as 1,2-dihexadecyl-rac-glycerol, spheroids such as cholesterol or testosterone, vitamins such such as vitamin E, poly- or oligoethylene glycol, preferably linked to the oligonucleotide by a phosphate group (for example triethylene glycol phosphate), diesters (12-18 carbon atoms) -alkyl phosphate and / or 0-CH2-CH (OH) -O- (12-18 atoms) and / or oligoethylene glycol, d) with vitamin E, e) intercalating agent such as pyrene, f) (14-18 carbon atoms) -alkyl phosphate diester and / or g) 0-CH 2 -CH (OH) -O- ( 12-18 carbon atoms) -alkyl. The processes for the preparation of a conjugated oligonucleotide are known to the person skilled in the art and are described, for example, in Uhlmann, E. & Peyman, A., Chem. Rev. 90 (1990) 543 and / or M. Manoharan in "Antisense Research and Applications", Crooke and Lebleu, Eds., CRC Press, Boca Raton, 1993, Chapter 17, p. 303ff, and / or EP-A 0 552 766; g) conjugation to a 2'5'-linked oligoadenylate preferably by an appropriate linker molecule, wherein the 2'5'-linked oligoadenylate is for example selected from 2'5'-linked triadenylate, 2'-5'-linked tetraadenylate, linked pentaadenylate 2 '5', 2'-5'-linked hexaadenylate or 2'-5'-linked heptaadenylate molecules and their derivatives, wherein a 2'5'-linked oligoadenylate derivative for example is cordycepin (3'-deoxy linked adenylate 2'5 ') and wherein an example for the appropriate linker is triethylene glycol and wherein the 5 'end of the linked 2'5' oligoadenylate should contain a phosphate, diphosphate or triphosphate residue wherein one or more oxygen atoms can be replaced, for example, by j ^ im ^ i ^ sulfur atoms, where substitution by a phosphate or thiophosphate residue is preferred; and h) introducing a 3 '-3' and / or a 5 '-5' reversal at the 3 'and / or 5' end of the oligonucleotide, where this type of chemical modification is known to the person skillfully in the art. specialty and is described for example in M. Koga et al., J. Org. Chem. 56 (1991) 3757, EP 0 464 638 and EP 0 593 901. The replacement of a phosphate unit of the main structure phosphate sugar by another unit, which for example is a unit of main structure APN, or a unit structure main APHON, preferably it is the replacement of a nucleotide for example by an APN unit or an APHON unit, which already comprises natural nucleoside bases and / or modified nucleoside bases, for example one of these modified nucleoside bases (listed under e. )) of uracil, hypoxant a, 5- (hydroxymethyl) uracil, N2-Dime ti lguanos ina, 5- (hydroxymethyl) uracil, 5-aminouracil, pseudouracil, dihydrouracil, 5-fluorouracil, 5-fluorocytosine , 5-chlorouracil, 5-chlorocytosine, 5-bromouracil, 5-bromocytosine, 2,4-diamino-purine, 8-azapurine, a substituted 7-deazapurine, preferably 7-deaza-7- substituted purine and / or 7- deaza-8-substituted or other modifications of a natural nucleoside base, (bases of modified nucleosides, for example, are described in EP 0 710 667 A2 and EP 0 680 969 A2). The modifications described in EP 0 710 667 A2, EP 0 680 969 A2, EP 0 464 638, EP 0 593 901, WO 95/01363, EP 0 672 677 A2, EP 0 739 898 A2 and EP 0 552 766, hereby incorporated by reference. Incorporate by reference. An Example for an oligonucleotide having a sequence SEQ ID NO. NO: 11, modified internucleoside bridges and an inversion 3 '3'- at the 3'-end is ON 57: 5' -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T (3 '3') G-3 ', wherein (3' 3 ') is a 3' 3 '-phosphodiester bond as described in EP 0 464 638 and "*" is a modified internucleoside bridge. Examples of oligonucleotides having the sequence SEQ ID NO. NO: 11 and where a phosphodiester bond is replaced by an arylphosphonate bridge are ON 58: 5'-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T (NBP) G- 3 ', and ON 59: 5' -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T (NBP) G-3 ', where "NBP" is a link - hydroxybenzyl phosphonate, preferably an α-hydroxy-2-nitrobenzyl phosphonate bond as described in WO 95/01363 and "N" is a 2'-O-alkylribonucleoside, preferably a 2'-O-methylribonucleoside (in this case " T "is 2 '-O-alkyluridine, preferably 2' -O-methyluridine). Examples of oligonucleotides having the sequence SEQ ID NO. NO: 11 and wherein a nucleoside base is replaced by a modified nucleoside base as described in EP 0 710 667 and EP 0 680 969, are ON 60: 5 '-G * C * GC * TG a * T * aga * C * a T * C * C * A * T * G-3', and ON 61. 5 '-G * C * GC * TGA * T * AG to * C * to T * C * C * AYG-3 ', where a letter "a" is an 8-aza-deoxyadenosine or an optionally substituted 7-deaza-deoxyadenosine and a letter " g "is an optionally substituted 8-aza-deoxyguanosine or 7-deaza-deoxyguanosine (examples by base modifications as described in EP 0 710 667 A2 and EP 0 680 969 A2) and wherein" N "is 2'-O-alkylribonucleoside, preferably 2'-O-methylribo-nucleoside (in this case "T" is 2'-O-alkyluridine, preferably 2'-O-methyluridine). In a special embodiment of the invention, at least one or more internucleoside bridges within the oligonucleotide sequence are modified, preferably with phosphorothioate. In an all phosphorothioate oligonucleotide, all the internucleoside phosphodiester bridges are modified by phosphorothioate. Preferably, the invention relates to an oligonucleotide wherein not all The internucleoside phosphodiester bridges are uniformly modified with phosphorothioate (internucleoside phosphorothioate bridges), especially not, if the oligonucleotide has the sequence SEQ ID NO: 1. DO NOT. 11. Preferably, at least one internucleoside bridge has a different TYPE of modification or is not modified. In a preferred embodiment of the invention, only particular positions within an oligonucleotide sequence are modified (eg, partially modified oligonucleotide). Partially modified oligonucleotides are also referred to as minimal modified oligonucleotides in some documents. Within the sequence, a modification can be located in particular positions (in particular nucleotides, in particular nucleosides, in particular nucleoside bases, in particular internucleoside bridges). In a particular embodiment of the invention, an oligonucleotide is prepared by only replacing some of the phosphodiester bridges with modified internucleoside bridges, for example phosphorothioate bridges. In particular, the invention comprises these oligonucleotides that only change in a certain proportion. Oligonucleotides ON 1 and ON 62-73 are examples for the location of modified internucleoside bridges - .1 with respect to sequences SEQ ID. DO NOT. 4 a SEC ID. DO NOT: 16: ON 62: 3 '-GVA * C * C * TAC * AGA * TAGT * C * GC * GT * C ~ GAT * GAC * GGT * AGG-5' (example for SEQ ID NO.4), ON 63: 3 '-C * C * T * AC * AGAT * AGT * C * GC * GT * C * GAT * GAC * G * G-5' (example for SEC ID NO. 5), ON 64: 3 '-C * A * GA * TAGT * C * G * CGT * C * GAT * GAC * G * G-5' (example for SEC ID NO. 6), ON 65: 3 '-A * G * T * CGC * GT * C * GA * T * GAC * G * G-5' (example for SEC ID No. 7), ON 66: 3 '-CVA * CAGA * TAGT * C * GC * GT * C * G-5' (example for SEC ID NO.8), ON 67: 3 '-G * T * AC * C * TAC * AGAT * AGT * C * GC * GT * C * GAT * GAC * G * G-5 '(example for SEC ID NO 9), ON 68: 3' -G * T * AC * C * TAC * AGAT * AGT * C * GC * G * T-5 '(example for SEC ID NO 10), ON 1: 3' -G * T * A * C * C * TA * C * AGA * T * AGT * CG * C * G-5 '(example for SEC ID NO 11), ON 69: 3' -G * T * A * C * C * TA * C * AGA * T * AGT * C * G * C-5 '(example for SEQ ID NO.12), ON 70: 3'-A * C * C * T * AC * AGA * T * AGT * C * G * C * G-5' (example for SEQ ID NO.13), ON 71: 3 '-G * T * A * C * C * TA * C * AGA * T * AGVC * G-5' (example for SEQ ID NO. ), ON 72: 3 '-T * A * C * C * TAC * AGA * T * AG * T * CG * C * G-5' (example for SEC ID NO.15) and ON 73: 3 '-T * A * C * C * TAC * AGA * T * AG * T * C * G * C -5 '(example for SEC ID. DO NOT. 16), where "*" shows the location of the internucleoside bridge modification within the sequence. In a preferred embodiment of the invention the type of modification is the replacement of phosphodiester bridges by phosphorothioate bridges, in this case "*" shows the position of an internucleoside phosphorothioate bridge. A preferred embodiment of the invention refers to ON 1, where "*" is a phosphorothioate bridge: ON 1: 3 '-G ~ T * A * C * C * TA * C * AGA * T * AGT * CG * C * G-5 ', where "*" is a phosphorothioate bridge. In a particular embodiment, the invention relates to an oligonucleotide, wherein the terminal 1 to 5 nucleotide units at the 5 'end and / or at the 3' end of the oligonucleotide are protected by modifying internucleoside bridges located at the 5 'end and / o 3 'of the corresponding nucleosides. More preferably, the terminal units nucleotide 1 to 5 at the 3 'end of the oligonucleotide are protected by modifying internucleoside bridges located at the 5' and / or 3 'end of the corresponding nucleosides. Optionally, the terminal units 1 to 5 nucleotide at the 5 'end of the oligonucleotide are further protected by modifying internucleoside bridges located at the 5' and / or 3 'end of the corresponding nucleosides. Optionally, the oligonucleotide may comprise additional modifications at other positions. An example of an oligonucleotide having the sequence SEQ ID NO. DO NOT. 11 and this modification pattern is ON 2: 5'- G * CG * C * T * G * A * T * AG * A * C * A * T * C * C * A * T * G -3 'in where "*" indicates the location of interucleoside bridge modifications, preferably "*" is a phosphorothioate bridge. In addition, the invention relates to an oligonucleotide, wherein at least one internal pyrimidine nucleoside and / or an internucleoside bridge located at the 5 'end of this nucleoside pyrimidine and / or located at the 3' end of this pyrimidine nucleoside is modified. . In a preferred embodiment of the invention, the terminal 1 to 5 nucleotide units at the 5 'end and / or the 3' end of the oligonucleotide are protected by modifying internucleoside bridges located at the 5 'and / or 3' end of the nucleotide. the corresponding nucleosides and where ..... ... * * ..,. "*? | Rf in addition at least one internal nucleoside pyrimidine and / or internal internucleoside bridge located at the 5 'end of this nucleoside pyrimidine and / or located at the 3 'end of this pyrimidine nucleoside. The principle of partially modified oligonucleotides is described in A. Peyman, E. Uhlmann, Biol. Chem. Hoppe-Seyler, 377 (1996) 67-70 and in EP 0 653 439. This document is incorporated herein by reference. In this case, terminal nucleotide units 1-5 at the 5 'end and / or at the 3 'end are protected, for example the internucleoside phosphodiester bridges located at the 3' and / or 5 'end of the corresponding nucleosides, for example, are replaced by internucleoside phosphorothioate bridges. In addition, preferably at least one position pyrimidine internal nucleoside (or nucleotide respectively) is modified; Preferably, the 3 'and / or 5' internucleoside bridge of a pyrimidine nucleoside is modified, for example by phosphorothioate. Partially modified oligonucleotides exhibit properties Particularly advantageous; for example they exhibit a particularly high degree of nuclease stability in association with minimal modification. They also have significantly reduced propensity for non-antisense effects that are often associated with the use of oligonucleotides all phosphotothioate (Stein and Krieg (1994) ú ^ eita ^ Antisense Res. Dev. 4, 67). Partially modified oligonucleotides also show a higher binding affinity than all phosphorothioates. The invention relates in particular to partially / minimally modified oligonucleotides. Examples for the internucleoside modification pattern of partially modified oligonucleotides having the sequence SEQ ID NO. 11 are: ON 3: 5 -G * C * GC * T * GA * T * AGA * C * AT * C * C * A * T * G-3, OR ONN 44 :: 5 5 '-G * C * G * C * T * GA * T * AGA * C * AT * C * C * A * T * G-3 ', ON 5: 5 -G * CGC * T * GAVAGA * C * AT * C * C * A * T * G-3, ON 6: 5 -G * CGC * TGA * T * AGA * C * AT * C * C * A * T * G-3, ON 7: 5 -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3, ON 8: 5 '-GC * GC * TGA * TAG * C * AT * C * CA * T * G-3 , OR ONN 99 :: 5 5 '' -G * C * GC * TGA * T * AGA * C * AT * C * CA * T * G-3, ON 10: 5 '-G * C * GC * TGA * T * AGA * C7A7T * CC7A7T * G-3, ON 11: 5 '-G * CC * TGA * T * AGA * C * AT * C * G * A * T * G-3, ON 12: 5' -G * C * G * C * TGA * T * AGA * CA * T * C * C * A * T * G-3, ON 13: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3, OR ONN 1144 :: 5 5 '' -G * C * G * C * TGA * T * AGA * C * A * T * C * C * A * T * G-3 and ON 15: 5 '-G * CG * C * T * G * A * T * A * G * A * C * A * T * C * C * A * T * G-3 , where "*" denotes the location of the internucleoside bridge modification; preferably "*" is a phosphorothioate bridge. • a & * - ^ - *% k- ~ «faith, -Tá ^ - ^ jt ^^ afcr Similar patterns of internucleoside bridge modifications are also possible for other oligonucleotides according to the invention, which have a different sequence, for example one of the sequences SEQ ID NO. 4 to SEQ ID NO. 16. According to the invention, the oligonucleotides can have, in addition to one type of modification, also other types of modification. For example, a partially modified oligonucleotide having modifications in particular internucleoside bridges may also have a further modification, for example modification of a β-D-2'-deoxyribose or modification of a natural nucleoside base. Therefore, another example for a special embodiment of the invention relates to a partially modified oligonucleotide, having a modification of a nucleoside, for example a modification of a nucleoside base and / or a modification of a β-D-2 unit. '- deoxyribose. Preferably, a β-D-2'-deoxyribose is replaced by 2'-O- (1-6 carbon atoms) alkylribose, further replacement by 2'-O-methylribose (replazo de β-D-2) is preferred. '-deoxyribonucleoside by 2' -O-methyribonucleoside). Examples of these oligonucleotides having for example the sequence SEQ ID v 3S * B "to gat-ag ^ NO.11 may exhibit the following patterns of nucleoside modifications: ON 16: 5 '-GCGCTGATAGACATCCATG-3 ON 17: 5' -GCGCTGATAGACATCCATG-3 ON 18: 5 '-GCGCTGATAGACATCCATG-3 ON 19: 5 '-GCGCTGATAGACATCCATG-3 ON 20: 5' -GCGCTGATAGACATCCATG-3 ON 21: 5 '-GCGCTGATAGACATCCATG-3 ON 22: 5' -GCGCTGATAGACATCCATG-3 ON 23: 5 '-GCGCTGATAGACATCCATG-3 ON 24: 5' -GCGCTGATAGACATCCATG-3 ON 25: 5 '-GCGCTGATAGACATCCATG-3 ON 26: 5' -GCGCTGATAGACATCCATG-3 ', and ON 27: 5' -GCGCTGATAGACATCCATG-3 where "N" indicates the position of a modified nucleoside (for example modification of the nucleoside base and / or modification of β-D-2 '-deoxyribose, preferably 2'-O-alkyryukonucleoside, especially 2'-O-methylribo-nucleotides (in this case "T" is 2-O-alkyluridine, preferably 2"'-O-methyluridine.) Similar patterns of nucleoside modifications are also possible for other oligonucleotides according to the invention, having a different sequence, for example one of the sequences SEQ ID NO. 4 to SEQ ID NO 16. In another preferred embodiment of the invention the oligonucleotide comprises internucleoside bridges modified at particular positions (preferably a phosphorothioate bridge) and further modification of a nucleoside at particular positions, preferably the replacement of β-D -2'-deoxyribose by 2 '-O- (1-6 carbon atoms) alkyl ribose In a preferred embodiment of the invention, the internucleoside modification is the replacement of a phosphodiester bridge by a phosphorothioate bridge and the modification of β-D -2'-deoxyribose is the replacement for 2'-O-methylribose, in this case, the oligonucleotide is a chimeric oligonucleotide, which is composed of parts of DNA and RNA modified adas and unmodified - comprising phosphorodiéster and internucleoside phosphorothioate bridges and the 2'-O-met il-ribonucleoside and β-D-2 '-deoxyribonucleoside nucleosides. Examples of these oligonucleotides, having the sequence SEQ ID NO. 11 and modifications in particular internucleoside bridges and also have particular nucleoside positions are (examples for patterns of modifications): ON 28: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 ', ON 29: 5' -G * C * GC * TGAVAGA * C * AT * C * C * A * T * G-3 ', ON 3 0: 5' - G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 ', ¿¡L¡áß ÍÍa & ON 31: 5 '-G * C * GC * TGA * T * AGA * c7AT * C * C * A * T * G-3' ON 32: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 'ON 33: 5' -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 ' ON 34: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * CA * T * G-3' 5 ON 35: 5 '-G * C * GC * TGA * T * AGA * C7AT * C * c7A * T * G-3 'ON 36: 5' -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 'ON 37: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3' ON 38: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 'where 10"*" shows the position of the internucleoside bridge modification and "N" is a modified nucleoside (eg, modification of the nucleoside base and or modification of β -D-2 '-deoxyribose); preferably, "*" is a phosphorothioate bridge and 15"N" indicates the position of a 2'-O-alkylribonucleoside, preferably 2'-O-methylribonucleoside (in this case "T" is 2-O-alkyluridine, 2 '-O-methyluridine preference). Comparable modification patterns are also possible for other oligonucleotides according to the invention, which have a different sequence, for example one of the sequences SEQ ID NO. 4 to SEQ ID NO. 16. The invention also relates to derivatives, wherein the last nucleotide at the 3'-end is a 2'-deoxynucleotide, for example. - »* 'rí -" *' - - - - -g-Aaaa- ^. S¿¿t tm¡í ¡¡¡ONá 39: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 ', where "*" and "N" have the same meanings as above In another preferred embodiment of the invention the oligonucleotide comprises a modification of the sugar main structure phosphate, preferably by APN units.

Examples of these APN-DNA chimeras, which have the sequence SEQ ID NO. 11 exhibit the following modification patterns (for general design see EP 0 672 677): ON 40: 5 '-GCGCTGATAgacatccatg-3' (Pattern: DNA-PNA), ON 41: 5 '-GCGCTGatagacatccatg-3' (Pattern: DNA-PNA) and ON 42: 5 '-gcgctgATAGACAtccatg-3' (Pattern: PNA-DNA-PNA), where the letters with lowercase indicate units APN. Other patterns of modifications are also possible, for example DNA-APN-DNA, APN-DNA. Comparable patterns of modification are also possible for APHON / DNA chimeras. These modification patterns can be combined with any other type of modification and of course similar patterns of modification are also possible for other oligonucleotides according to the invention, which may have a different sequence, for example one of the sequences SEQ ID NO. 4 or SEQ ID NO. 16. In another preferred embodiment of the invention the oligonucleotide comprises the replacement combination by mß ^^^^ m APN units with the replacement of deoxyribonucleosides, for example by 2'-O-alkyl ribonucleosides. Examples for these oligonucleotides that all have the sequence SEQ ID NO. 11 are ON 43: 5 '-GCGCTGATAGACatccatg-3', ON 44: 5 '-GCGCTGATAGACATCCATG-3', ON 45: 5 '-GCGCTGATAGACATCCAtg-3', ON 46: 5 '-GCGCTGATAGACATCCAtg-3' or ON 47: 5 '-GCGCTGATAGACAtccatg-3' wherein "N" indicates the position of a modified nucleoside, for example a 2'-O- (1-6 carbon atoms) alkylribonucleoside, preferably a 2'-O-methylribonucleoside (in this case "T" is 2 '-O-alkyluridine, preferably 2' -O-methyluridine) and where the lower case letters indicate APN units. Of course, these oligonucleotides can also have modifications of internucleoside bridges in their DNA part. For example, the above oligonucleotides ON40, ON41, ON42, ON43, ON44, ON45, ON46 and ON47 may have the internucleoside bridge modifications illustrated in the oligonucleotides ON1, 0N2, 0N3, ON4, ON5, ON6, ON7, ON8, 0N9, ON10, ONU, ON12, ON13, ON14 and ON15 (combination of the modification pattern of the •• j-. oligonucleotides ON40-ON47 with one of the modification pattern of 0N1-0N15). Similar modification patterns are possible for oligonucleotides according to the invention, which have a different sequence, for example in the sequences SEQ ID NO. 4 to SEQ ID NO.16. A further preferred embodiment of the invention provides an oligonucleotide having one or more alkyl residues (12-18 carbon atoms), preferably an alkyl residue with 16 carbon atoms at the 3 'and / or 5' end. An alkyl residue (12-18 carbon atoms) for example can be bonded as a phosphodiester as described in EP 0 552 766 A2 or a 3'-phosphodiester of 0-CH2-CH (OH) -O-alkyl (12- 18 carbon atoms). A preferred embodiment is an oligonucleotide having an alkyl residue with 16 carbon atoms attached to 3 '- and / or 5' - ends. EP 0 552 766 A2 is incorporated herein by reference. Examples for these oligonucleotides are ON48 and ON49 (both have the sequence SEQ ID No. 11 and the internucleoside modifications at particular positions, for example in 0N1 and in addition an alkyl with 16 carbon atoms, linked either to its 5 'end or its 3 'end) (this oligonucleotide can also have any other sequence and modification pattern): ON 48: 5' -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G -C16 -3 'ON 49: 5' -C16-G * C * GC * TGA AGA * C * AT * C * C * A * T * G-3 'The invention also relates to derivatives, wherein the term 3 '- is modified as a triethylene glycol (TEG) phosphodiester, an example for this oligonucleotide, having the sequence SEQ ID NO. 11 and the modification pattern of ON39; is ON 50: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * Gp-TEG-3'. In another specific embodiment of the invention, the oligonucleotide is connected via a linker to a linked 2 '5' oligoadenylate-5 '- (thio) phosphate. The linker can, for example, be an oligo-ethylene glycol residue, preferably triethylene glycol phosphate, tetraethylene glycol phosphate or hexaethylene glycol phosphate. The 2'-5'-linked oligoadenylate is preferably connected by its 2'-end as a tetra- or as a penta-adenylate whose 5'-hydroxy function is substituted by a phosphate or thiophosphate residue. The 2 '5' oligoadenylate is known to induce RNase L to cleave the target mRNA (Torrence et al., Proc. Nati Acad. Sci. U.S.A. (1993) 90, 1300). The 2'5'-oligoadenylate serves the purpose of activating ribonuclease L (RNase L) which then degrades the VEGF mRNA. Instead of a linked 2 '5' adenylate, a bound 3 '-deoxyi 2'5' adenylate, derived from the nucleoside analog cordycepin, may also be introduced. In this case; the part -2j * ¡¡^ ^ ¿g! ^ * J ^ ¿? oligonucleotide, which is complementary to the target nucleic acid, is preferably modified at particular positions by 2'-O- (1-6 carbon atoms) -alkyryl nucleoside (preferably 5 2'-O-methylribonucleoside) or by APN. Examples for these oligonucleotides, which may have for example the sequence SEQ ID NO. 11 are 0N51 and ON52 (this oligonucleotide can also have any other sequence of an oligonucleotide according to the invention): 10 ON 51: 5 '-p * (2' 5 '-CoCoCoCo) (teg) GCGCTGATAGACATCCATG-3' ON 52 : 5 '-p * - (2' 5 '-rArArArA) (teg) GCGCTGATAGACATCCATG-3' where "teg" is triethylene glycol (linked), "rA" is ribo-A (2 '5' -adenylate linked), 15"Co" is 3 '-deoxi-A (Cordicepin) (3'-deoxi adenylate 2' 5 'linked) and "p *" is 5'-thiophosphate. In addition, this oligonucleotide may have additional modifications, for example the oligonucleotide may have ON modification pattern 38 (this oligonucleotide may also have any other modification pattern). Examples are ON 53: 5 '-p * (2' 5 '-CoCoCoCo) (teq) G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G -3', 25 and ON 54: 5 '-p * - (2' 5 '-rA * rA * rA * rA) * (teg) G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G -3 ', where "teg" is triethylene glycol (bonded), 5"N" is a modified nucleoside, preferably a 2' -O-methylribonucleoside (in this case "T" is 2'-0-alkylur idine, preferably 2'-O-methyluridine), "rA" is ribo-A (adenylate 2 '5' -linked), 10"Co" is 3'-deoxy-A (Cordicepin) (3 '-deoxy adenylate 2 '5' linked), "p *" is 5'-thiophosphate, and "*" is a modified internucleoside bridge, preferably an internucleoside bridge 15 phosphorothioate. In a preferred embodiment of the invention, an oligonucleotide according to the invention can inhibit the expression of the target protein (which is VEGF) or the target sequence (a nucleic acid encoding VEGF, preferably VEGF mRNA), respectively. Preferably, an oligonucleotide according to the invention specifically inhibits the expression of VEGF. This results in a reduction in the level of VEGF protein compared to the untreated expression. The specificity for example 25 can be demonstrated by determining the effect of a ? & ** At oligonucleotide according to the invention against VEGF expression compared to the effect of the same oligonucleotide on beta-actin expression in the mRNA and / or protein level: upon treatment with an oligonucleotide according to the invention only the levels of VEGF and / or protein mRNA were reduced, while for example beta-actin (a maintenance protein) mRNA and / or protein levels remained unchanged. In particular, the effect of an oligonucleotide can be demonstrated by determining the VEGF mRNA and / or the amount of VEGF protein (for example compared to a parallel experiment without the oligonucleotide). For example, the inhibitory effect of the oligonucleotide can be determined in vitro by treating cell cultures with the oligonucleotide. Then, for example, the level of mRNA can be determined in preparations of cell lysate, for example as described in example 6. The level of VEGF protein (for example absolute amount of VEGF protein in grams or for example relative in comparison with a cell not treated in percent) for example can be determined from the supernatant (for example the culture medium) (the amount of secreted VEGF) and / or membrane preparations (the amount of membrane bound VEGF) and / or cell lysate. The amount of secreted VEGF protein for example can be determined by ELISA, for example as described in Example 5. In a particular embodiment of the invention, an oligonucleotide can inhibit the expression of VEGF mRNA and / or reduce the level of VEGF protein, respectively, for example in a cell culture with an IC50 of approximately lμM and / or 500 nM, 200 nM, 100 nM or less. In another particular embodiment of the invention, the inhibition is specific for an oligonucleotide according to the invention; in these cases, only the oligonucleotide having the sequence according to the invention reduces the level of VEGF protein and / or VEGF mRNA. In comparison with these specific oligonucleotides, these levels do not change in the same proportion, nor do they change significantly in fact, when an oligonucleotide with a mismatch or mixed sequence is used. These oligonucleotides are used as control oligonucleotides, such as oligonucleotides ON 55 and ON 56. ON 55 is a mismatch control with respect to SEQ ID NO. eleven; has the sequence SEQ ID NO. 17 and phosphorothioate modifications at particular positions ("*") ON 56 is a mismatch control with respect to SEQ ID NO. eleven; has the sequence SEQ ID NO. 18 and phosphorothioate modifications in particular positions ("*"). These two oligonucleotides are used, for example, in comparative experiments with ON 1 (Table 1 and Figure 2). The control oligonucleotides do not inhibit the expression of VEGF mRNA in cell culture at a concentration of 1 μM and below. SEQ ID NO. 17 with phosphorothioate modifications in particular positions (ON55): ON 55: 5 '-G * C * GA * CGA * T * AGA * T * CT * C * C * A * T * G-3' SEQ ID NQ. 18 with phosphorothioate modifications at particular positions (ON56): ON 56: 5 '-C * G * AA * GC * A * C * TG * TA * CG * C7AT * T * G-3' In addition, the partial oligonucleotide phosphorothioate ON 1 having natural nucleoside bases, shows a different pharmacological profile than the partial phosphorothioate oligonucleotide which also has replacements of C5-propynyl uracil and C5-propynyl cytosine bases. These base analogs C5-propynyl uracil and C5-propynyl cytosine for example are described in WO97 / 39120: 5 '- G * C * GC * TGA * T * AGA * C * A * T * CC * A * T * G- 3 'underlined C: 5-propinyl dC, T 5-propinyl dU, "*" phosphorothioate bridges Several oligonucleotides were tested with different types of modifications (ON 1, ON 28, ON 29, ON 53 and ON 54). The results in Table 1 demonstrate that oligonucleotides according to the invention (right sequence and different types of modifications) inhibit -fe1. efficiently synthesis of VEGF protein in cell culture with respect to the control oligonucleotides (ON 55, ON 56). As described in example 4, the cells were treated with the oligonucleotides ON1, ON28, ON29, ON53, ON54, ON55 and ON56 and then the supernatant was assayed for the amount of secreted VEGF protein. In this cell-based assay, oligonucleotide ON54 showed the lowest value of IC50, which was approximately 230 nM. Also ON1 and ON29 showed very good IC50 values, which were approximately 300 nM and for ON29 and ON53 IC50 values of 500nM and 1500nM were determined, respectively. All the modified oligonucleotides according to the invention that were tested showed much better results than the control oligonucleotides 0N55 and ON56 (IC50> 3 μM). For ON1 the effect of the mRNA level was also tested. For ON1 the IC 50 value of approximately 100 nM is determined to reduce the mRNA concentration by approximately 50%. In comparison, ON55 and ON56 having a different sequence, but the same TYPE of modification and a similar modification pattern, the effect on the mRNA level was not found. Also all three oligonucleotides (ON1, ON55 and ON56) had no effect on the level of β-actin mRNA. Therefore, the effect of ON1 is specific for VEGF mRNA and the effect on VEGF mRNA is specific for a particular oligonucleotide sequence. Also, this is h ^ ^ a mechanism guide by which 0N1 acts. Since the level of VEGF mRNA is specifically reduced before treatment with 0N1, bridging from 0N1 to mRNA VEGF most likely activates RNase H or the binding provides a substrate for RNase H, respectively. For other types of oligonucleotides with different types of modifications, the mechanism of action that ultimately leads to a decrease in the level of VEGF protein may be different. An oligonucleotide according to the invention, When administered to a vertebrate, it inhibits the expression of VEGF. Therefore, an oligonucleotide according to the invention has the ability to inhibit tumor growth in vertebrates, in particular in humans and in mice in a certain proportion. The specificity of inhibition Expression of VEGF can for example be determined by measuring the levels of VEGF and / or VEGF mRNA protein in tumors of treated individuals relative to untreated individuals. The inhibition of tumor growth, for example, can be determined by measuring the tumor volume reduction of animals treated against untreated animals. The oligonucleotide can be used to treat a vertebrate at a concentration of 20 mg / kg body weight, preferably at a concentration of 12 mg / kg body weight or less, more preferably at a concentration of approximately 4 mg / kg body weight Ud-M - • a *** - * ^ - ^ .., ^ - r ^ fc., .. or less (table 2, figure 3). In a special embodiment of the invention, the oligonucleotide or a pharmaceutical composition thereof in the capacity to reduce a tumor volume by at least 30%, preferably more than 50% compared to untreated individuals after 17 days of administering an oligonucleotide according to the invention to the individual, at a concentration of 4 or 12 mg / kg of body weight. In order to determine the ability of the oligonucleotide to inhibit human tumor growth in a vertebrate, a study can be performed with a non-human vertebrate, which is preferably a mouse. In this study, a tumor xenograft for example may develop from 1 to 4 days in a non-human vertebrate prior to administration of the oligonucleotide. The oligonucleotide or a pharmaceutical composition thereof can be administered to this non-human vertebrate. Preferably, the effect of an oligonucleotide on the tumor volume is determined by using a nude mouse with a U87-MG xenograft made by implanting 2 x 10 6 human U87-MG cells on day 0. Xeno-grafts U87-MG they develop rapidly in nude mice and the growth of xenografts of U87-MG depends on VEGF. The invention also relates to a method for the preparation of an oligonucleotide according to the invention. A method for the preparation comprises the -Wfc .. »* _ *« »» ± chemical synthesis of the oligonucleotide. Preferably, the chemical synthesis is carried out by a known standard method, which is used for the synthesis of oligonucleotides, for example the phosphoramidite method according to Caruthers (1983) Tetrahedron Letters 24, 245, the H-phosphonate method (Todd et al. collaborators (1957) J. Chem. Soc. 3291 or the phosphotriester method (Sonveaux (1986) Bioorg, Chem. 14.274; Gait, MJ "Oilgonucleotide Synthesis, A practical Approach" (Oligonucleotide Synthesis, A Practical Approach), IRL Press , Oxford, 1984) or improved or varied methods derived from these standard methods An oligonucleotide according to the invention for example can be prepared as described in Examples 1, 2 and 3. Preferably, an oligonucleotide according to the invention, it is synthesized on a solid support by condensing conveniently protected monomers (for example nucleosides) in order to form internucleoside bridges between these monomers. to a method for preparing an oligonucleotide or its derivative, wherein a nucleotide unit with a phosphorus (V) 3 '- or 2'-terminal group and a mercapto or free 5' hydroxyl group, is reacted with an additional nucleotide unit with an phosphorus (III) or phosphorus (V) grouping at the 3 'position, or its activated derivatives and where protective groups are ? ^ ^ ^ ^^^ i ^ | * í * g ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ optionally, they can be temporarily introduced into the oligonucleotide in order to protect other functions and that they are removed after synthesis, that the oligonucleotide that has been excised from the solid support can optionally be converted into a physiologically tolerated salt. Standard methods in a certain proportion These variations are known to a person skilled in the art and are for example described in Agrawal S. "Protocols for oligonucleotides and analogs" (1993, Human Press Inc., Totowa, New Jersey, USA) The preparation of modified oligonucleotides is also described in EP 0 710 667, EP 0 680 969, EP 0 464 638, EP 0 593 901, WO 95/01363, EP 0 672 677, EP 0 739 898 and EP 0 552 766. The methods for preparing modified oligonucleotides described in the above documents, are hereby Incorporate by reference. The invention further relates to a method for inhibiting the expression of VEGF and / or modulating the expression of a nucleic acid encoding VEGF, wherein an oligonucleotide according to the invention is contacted with a nucleic acid encoding VEGF (eg. example mRNA, cDNA) and the oligonucleotide is hybridized to (bind to) this nucleic acid encoding VEGF.

^^. ^ Ay ^ apT -., '. Therefore, the invention also relates to a method, wherein the oligonucleotide is contacted with nucleic acid encoding VEGF (eg, mRNA, cDNA), for example by introducing the oligonucleotide in a cell by known methods, for example by incubation of cells with the oligonucleotide or a formulation thereof - the formulation may comprise absorption enhancers, such as lipofectin, lipofectamine, cellfectin or polycations (eg polylysine). For example, an oligonucleotide that was previously incubated against cellfectin for example 30 minutes at room temperature is then incubated at about 5 hours or less with a cell in order to introduce the oligonucleotide into the cell. The invention further relates to the use of the oligonucleotide, preferably as an antisense oligonucleotide (which binds the oligonucleotide to an mRNA encoding VEGF) or as a ribozyme (which binds to an mRNA that encodes VEGF and cleaves this mRNA). In another special embodiment of the invention, the oligonucleotide can be used to induce RNAse H cleavage of the mRNA encoding VEGF, thereby resulting in a reduction in VEGF expression. The invention relates to the use of oligonucleotide to modulate and also to inhibit totally or partially the jirafas ^ JSStíag VEGF expression (for example VEGF121, VEGF165, VEGF189, VEGF206) and / or splicing their variants and / or their mutants, for example to completely or partially inhibit the translation of the mRNA that encodes VEGF. The invention relates to the use of an oligonucleotide to inhibit, prevent or modulate angiogenesis, neo-vascularization, tumor growth and metastasis, in particular in vertebrates. The invention in general relates to the use of an oligonucleotide according to the invention for the treatment or prevention of diseases, wherein VEGF is overexpressed. These diseases wherein VEGF is over-expressed are for example cancer, age-related macular degeneration, diabetic retinopathy, psoriasis, rheumatoid arthritis and other inflammatory diseases. The invention further relates to the use of the oligonucleotide as a pharmaceutical and the use of the oligonucleotide to prepare a pharmaceutical composition. In particular, the oligonucleotide can be used in a pharmaceutical composition, which is used to prevent and / or treat diseases that are associated with expression or overexpression (increased expression) of VEGF and for treatment of diseases wherein VEGF or its -expression is the causative factor or is involved.

The invention further relates to a pharmaceutical composition comprising an oligonucleotide and / or its physiologically tolerated salts in addition to pharmaceutically non-objectionable excipients or excipients. The invention relates to a pharmaceutical composition comprising at least one oligonucleotide according to the invention, which can be used for the treatment of diseases associated with abnormal vascular permeability, cell proliferation, cell permeation, angiogenesis, neo-vascularization, growth of tumor cells and the metastasis of neoplastic cells. The invention furthermore relates to a method for preparing a pharmaceutical composition, which comprises mixing one or more oligonucleotides according to the invention with physiologically acceptable excipient and optionally additional substances, for example, if appropriate with suitable additives and / or auxiliaries. The invention relates in particular to the use of an oligonucleotide or a pharmaceutical composition prepared therefor, for the treatment of cancer, for example to inhibit tumor growth and tumor metastasis, and for the treatment of diabetic retinopathy, macular degeneration related to age, psoriasis, rheumatoid arthritis and other inflammatory diseases. By ,.?. m, -4S5n «-», .... ^ _ -! ».-. . ufanen, SXX ^ ^ example, the oligonucleotide or a pharmaceutical composition prepared therefrom, can be used for the treatment of solid tumors, such as breast cancer, lung cancer, head and neck cancer, brain cancer, abdominal cancer, cancer colon, colorectal cancer, esophageal cancer, gastrointestinal cancer, glioma, liver cancer, tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor, multiple myeloma and for treatment of skin cancer, such as melanoma, for the treatment of lymphomas and blood cancer. The invention further relates to the use of an oligonucleotide according to the invention or a pharmaceutical composition prepared therewith, to inhibit VEGF expression and / or to inhibit accumulation of ascites fluid and pleural effusion in different types of cancer, eg cancer. breast, lung cancer, head cancer, neck cancer, brain cancer, abdominal cancer, colon cancer, colorectal cancer, esophageal cancer, gastrointestinal cancer, glioma, liver cancer, tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor, multiple myeloma, skin cancer, melanoma, lympholas and blood cancer. Due to the inhibitory effect of VEGF expression and / or fluid ascites and - i-a fe ~ --- A tel ^ - * - ~ -jeS ^ pleural effusion, an oligonucleotide according to the invention or a pharmaceutical composition prepared therewith, can improve the quality of life. In a preferred embodiment of the invention, the oligonucleotide or a pharmaceutical composition thereof, can inhibit the accumulation of ascites fluid in ovarian cancer. The invention further relates to the use of an oligonucleotide or a pharmaceutical composition thereof, for example for the treatment of cancer or to prevent tumor metastasis, or to treat age-related macular degeneration, rheumatoid arthritis, psoriasis and diabetic retinopathy, in combination with other pharmaceutical products and / or other therapeutic methods, for example with known pharmaceutical products and / or known therapeutic methods, such as for example those, which are currently used for the treatment of cancer and / or to prevent tumor metastasis. Preference is given to a combination with radiation therapy and chemotherapeutic agents, such as cis-platinum, cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or tamoxifen. The oligonucleotide and / or its physiologically tolerated salt can be administered to an animal, preferably a mammal and in particular a human alone, in admixture with another oligonucleotide (or its physiologically tolerated salt) or in the form of a pharmaceutical composition allowing use - ~ sa > * L i ... ^ - ^ .... Jk * &3 < > tií & »M? .-. H .... - * «. topical, percutaneous, parenteral or enteral, and which comprises as an active constituent, an effective dose of at least one oligonucleotide in addition to usual excipients and pharmaceutically acceptable non-objectionable substances. This pharmaceutical composition usually comprises about 0.1 to 90% by weight of the therapeutically active oligonucleotide (s). The dose can vary widely and will have to be adjusted to the individual circumstances in each individual case. In order to treat psoriasis, preference is given to topical use. In the case of cancer, preference is given to administration by infusions, oral, rectal or nasal application in aerosol, preferably in the case of lung cancer while in the case of diabetic retinopathy, preference is given to a topical, intravitreal administration and oral A pharmaceutical composition can be prepared in a manner known per se (for example Remington's Pharmaceutical Sciences, Mack Publ. Co., Easton, PA (1985)), with pharmaceutically inert organic and / or inorganic excipients employed. Lactose, corn starch and / or its derivatives, talc, stearic acid and / or its salts, etc. for example they can be used to prepare pills, tablets, coated tablets and hard gelatin capsules. Examples of excipients for soft gelatine capsules and / or suppositories are fats, waxes, semi-solid polyols and x ^ - "? ^ liquids, natural and / or hardened oils, etc. Examples of suitable excipients for preparing solutions and / or syrups are water, sucrose, invert sugar, glucose, polyols, etc. Suitable excipients for preparing injection solutions are water, alcohols, glycerol, polyols, vegetable oils, etc. Suitable excipients for microcapsules, implants and / or rods are mixed polymers of glycolic acid and lactic acid In addition, liposome formulations that are for example described in N. Weiner, (Drug Develop Ind. Pharm. 15 (1989) 1523), "Liposome Dermatics" (Dermatics of Liposomes) (Springer Verlag 1992) and Hayashi (Gene Therapy) (1996) 878. The pharmaceutical composition may also comprise a formulation, which comprises the oral availability of the oligonucleotide, such as intestinal permeabilization enhancers, for example mannitol, urea, bile salts, such as CDCA (chenodeoxycholate) (2%). ede dermal administration, for example using iontophoretic methods and / or by electroporation. In addition, lipofectins and other carrier systems can be used, for example those that are used in gene therapy. Systems that can be used to introduce oligonucleotides in a highly efficient form in eukaryotic cells, or in the nuclei of eukaryotic cells are particularly convenient. A pharmaceutical composition can also comprise two or more different oligonucleotides and / or their physiologically tolerated salts and in addition, additionally of at least one oligonucleotide, one or more different therapeutically active ingredients. In addition to active ingredients and excipients, a pharmaceutical composition may also comprise additives, such as fillers or fillers, spreaders, disintegrants, binders, lubricants, wetting agents, stabilizing agents, emulsifiers, preservatives, sweeteners, colorants, flavors or flavoring agents, thickeners , diluents or buffer substances, and in addition, solvents and / or solubilizing agents and / or agents to achieve a slow release effect, and also salts for altering the osmotic pressure, coating agents and / or antioxidants. The dose can vary widely and will have to be adjusted to the individual circumstances in each individual case. The pharmaceutical composition may also comprise a formulation, which improves the oral availability of the oligonucleotide, such as intestinal permeabilization enhancers, for example mannitol, urea, bile salts such as CDCA (2%). The invention relates to a pharmaceutical composition comprising at least one oligonucleotide according to the invention, which can be used for the treatment of diseases associated with abnormal cell proliferation, cell permeation, vascular permeability, angiogenesis, growth of tumor cells and the metastasis of neoplastic cells. This pharmaceutical composition can be used for the treatment and prevention of cancer and metastasis of cancer, the treatment and prevention of psoriasis, and the treatment of diabetic retinopathy. Description of the Figures Figure 1: Quantification of VEGF mRNA in U87-MG tumor xenograft developed in mice that were prepared with ON 1. Tumors were implanted by subcutaneously injecting (sc) 2 x 10 6 U87-MG tumor cells in the flank of each mouse on day 0. The iv treatment daily with ON 1 was started on day 4. Tumors were collected on day 18. In tumor sections, mRNA expression levels were assayed by in situ hybridization with a 35S VEGF cRNA probe. For quantification of VEGF cRNA, the percentage of the area with more than 111 dpm / mm2 of radioactive probe hybridized in a representative section of each tumor was determined. Except for two oul, there was a clear decrease in VEGF expression in tumors of the treated animals (with respect to control animals). Figure 2: Summarizes the results of the concentration dependent effect of different oligonucleotides at the VEGF mRNA level in cells treated with oligonucleotides 0N1, ON55 (uncoupling) and ON56 (mixed). VEGF mRNA was quantified using the ABI Prism 7700 Sequence Detector. The concentration-dependent effect on the amount of VEGF mRNA relative to control cells that were not treated with the oligonucleotides is illustrated as "1 / fold difference". (relative to untreated control) "against" 1 μM oligonucleotide concentration] "(from left to right: 0N1: bar 1 to 6; ON55: bar 7 to 12; ON56: bar 13 to 18; Control: bar 19 (without oligonucleotide) and 20 (only with cellfectin)). The decoupling (ON55) and the mixed controls (ON56) had no significant effect on VEGF mRNA levels at low or high oligonucleotide concentrations, while ON1 decreased the level of VEGF mRNA (i.e. leads to an increase in the number of cycles in PCR required to reach a threshold for the detection of a PCR product). The effect of ON1 on VEGF mRNA level was concentration dependent. n = 4 for each data point, error bars represent standard deviation. Figure 3: Figure 3 shows the in vivo results of ON1 in xeno-tumor lesions. This figure summarizes the tumor weights (grams) that were determined on day 18 (on day 0 U87-MG xenografts were implanted) - each point in this figure indicates the tumor weight that was determined for an individual nude mouse. Naked mice were treated i.v. Daily with 0N1, either at a concentration of 0 mg / kg, 4 mg / kg or 12 mg / kg of body weight. Figure 4: inhibition of VEGF secretion in HT-29 cells by ON50 after 24 hours (Example 9). The figure shows the effect dependent on the concentration of ON50 in VEGF secretion by HT-29 cells, 24 hours after treatment (...% inhibition of control determined by Elisa / Cyquant). Figure 5: inhibition of tumor growth by ON38. Daily oral treatment of nude mice that have xenografts U87-MG with ON39. The figure shows the volume-dependent reduction in tumor volume (mm3) after 27 days of oral administration of ON39. "*" control (without treatment); "O" treatment with 3 mg of ON 39 per kilogram of body weight (mg / kg); "T" treatment 3 mg with ON 39 per / kg, treatment "V" with 30 mg / kg. Examples: Example 1: oligonucleotide synthesis. Oligonucleotides (ONs) were synthesized using an Applied Biosystems 394 DNA DNA synthesizer (Perkin Elmer Applied Biosystems, Inc., Foster City, USA) and standard phosphoramidite chemistry (eg F. Eckstein, Ed "Oligonucleotides and Analogues A practical Approach "(Practical approach of oligonucleotides and analogues A) IRL Press, Oxford, 1991). After coupling, phosphorothiorate linkages were introduced by sulfurization using a Beaucage reagent followed by end termination with acetic anhydride and N-methyl imidazole. After cleavage of the solid support and final deprotection by treatment with concentrated ammonia, ONs were purified by polyacrylamide gel electrophoresis. The ONs modified with 2'-o-methyl were prepared by replacing the standard phosphoramidites in the corresponding cycle with 2'-o-methyl-ribonucleoside phosphoramidite. All the ONs were analyzed by electro dew mass spectroscopy with negative ion (Fisons Bio-Q), which in all cases confirmed the calculated mass. The C16-modified oligonucleotides were synthesized using hexadecyloxy (cyanoethoxy) N, -diisopropyl aminophosphane as a phosphorylating reagent in the last step of the oligonucleotide synthesis instead of a standard amidite, or starting from a derivatized solid support correspondent. The tetra ethylene glycol linker is commercially available from Glen Research Corporation. The 2'-adenosphosphoramidite or cordycepin were obtained from Chem Genes Corporation and Chemogen Corporation, respectively. The introduction of 5'-phosphate or thiophosphate residues was carried out as previously described (Uhlmann and Engels (1986) Tetrahedron Lett., 27, 1023). Analysis of the oligonucleotides was performed by: a) Analytical gel electrophoresis in 20% acrylamide, 8M urea, 45 μM tris-borate buffer, pH 7.0 and / or b) HPLC analysis: Waters GenPak FAX gradient CH3CN column (400 ml), H20 (1.61), NaH2P04 (3.1 g), NaCl (11.7 g), pH6.8 (0.1M NaCl) then CH3CN (400ml), H20 (1.6 1), NaH2P04 (3.1g), NaCl (175.3g), pH6 .8 (1.5M NaCl) and / or c) Capillary electrophoresis using a Beckmann eCAP ™ capillary, U100P, U100P gel column, length 65 cm, Dl 100 mm, window 15 cm from one end, damper [140 μM Tris, 360 mM borate, 7 M urea] and / or d) Mass spectrometry by electro negative ion spray, which in all cases confirmed the expected mass values. The methods for analyzing oligonucleotides according to a), b), c) and d) are known to a person skilled in the art. These methods for example * ¿E * ^ *, É g fyáJí & Si t, »» > .JS- S ^ ^ - "describe by Schweitzer and Engel" Analysis of oligonucleotides "(analysis of oligonucleotides) (Antisense - from technology to therapy" (Antisense-from technology to therapy), a laboratory manual and textbook Schlingensiepen and collaborators eds., Biol. Science Vol. 6 (1997) pp. 78-103) The following oligonucleotides were prepared (see description): ON 62: 3 '-G * T * A * C * C * TAC * AGA * TAGT * C * GC * GT * C * GAT * GAC * GGT * AGG-5 'ON 63: 3' -C * C * T * AC * AGAT * AGT * C * GC * GT * C * GAT * GAC * G * G-5 'ON 64: 3' -C * A * GA * TAGT * C * G * CGT * C * GAT * GAC * G * G-5 'ON 65: 3' -A * G * T * CGC * GT * C * GA * T * GAC * G * G-5 'ON 66: 3' -C * t7A * CAGA * TAGT * C * GC * GT * C * G-5 'ON 67: 3' - G * T * AC * C * TAC * AGAT * AGT * C * GC * GT * C * GAT * GAC * G * G-5 'ON 68: 3' -G * T * AC * C * TAC * AGAT * AGT * C * GC * G * T- 5 'ON 1: 3' -G * T * A * C * C * TA * C * AGA * T * AGT * CG * C * G ON 69: 3 '-G * T * A * C * C * TA * C * AGA * T * AGT * C * G * C-5 'ON 70: 3' -A * C * C * T * AC * AGAVAGT * C * G * C * G-5 'ON 71: 3' -G * T * A * C * C * TA * C * AGA * T * AG * T * C * G-5 'ON 72: 3' -T * A * C * C * TAC * AGA * T * AG * T * CG * C * G-5 'ON 73: 3 '-T * A * C * C * TAC * AGA * T * AGVC * G * C-5' ON 8: 5 '-GC * GC * TGA * TAG * C * AT * C * CA * T * G- 3' ON 9: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * CA * T * G- 3 'ON 10: 5' - G * C * GC * TGA * T * AGA * C7A7T * CC * AVG - 3 'ON 11: 5' -G * C * G * C * TGAVAGA * C * AT * C * C * A * T * G-3 'ON 12: 5' -G * C * G * C * TGA * T * AGA * CA * T * C * C * A * T * G-3 'ON 13: 5' -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 'ON 14: 5, -G * C * G * C * TGA * T * AGA * C * T * C * C * A * T * G-3l ON 15: 5 '-G * C * G * C * TGA * T * AGA * C * A * T * C * C * A * T * G-3 'ON 2: 5I-G * CG * C * T * G * A * T * AG', A * C * A * T * C * C * A * T * G -3I ON 28: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3' ON 29: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 'ON 30: 5' -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G- 3 'ON 31: 5' -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 'ON 32; 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3' ON 33: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 'ON 34: 5' -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 'ON 35: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3' ON 36: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 'ON 37: 5' -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3 'ON 48: 5' -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-C16-3 'ON 49: 5' -C16-G * C * GC * TGAVAGA * C * AT * C * C * A * T * G-3 'ON 53: 5' - p * (2 * 5 '- CoCoCoCo) (t eg) G * C * GC * TGA * T * AGA *AC IC * C * AYG-3 'ON 54: 5' -p * - (2 '5' - rA * rA * rA * rA) * (teg) G * C * GC * TGA * T * AGA * C * A T * C * C * A * T * G- 3 ' where «JÉs, Mf &# # 3? Mt *? "teg" is triptylene glycol (linker) "N" is 2 '-0-mepilribonucleosides? do "rA" is ribo-A (denilato-2' 5 'linked), "Co" is 3'-deoxy A (Cordicepin) ( 3'-deoxyadenylate-2 ', 5'-linked), "p *" is 5'-thiophosphate, "*" is phosphorothioate. Example 2: Detailed description of the synthesis of ON1 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3' (with "*" phosphorothioate) nucleoside The partially phosphorylated oligonucleotide ON1 with 12 internucleoside internucleoside phosphorothioate links, is prepared on an ABI 390Z DNA synthesizer and (Perkin Elmer - Applied Biosystems, Foster City, USA), using a controlled porous glass support (CPG).

The aminopropylated CPG was charged with 200 mmoles of 5'-0-dimethoxytrityl-N2-isobutyl-deoxyguanosine-3'-O-succinate.

After removal of the 5'-dimethoxy trityl group with 3% trichloroacetic acid in dichloromethane, the second base (T) is coupled using the corresponding 5'-0-dimethoxytrityl-thymidine-3 '-O- (β-cyanoethoxy) -N , N-diisopropylamino phosphoramidite, using a synthesis cycle as provided by the supplier (ABI). For the introduction of the phosphothioate bonds, 3H-, 1.2- - í ^ & ÍHú i? S * ». - - *, -6 * - M), which is used for the introduction of the phosphodiester bond. The end-termination reaction with acetic acid anhydride is carried out directly after the coupling reaction in the case of phosphodiesters, but after Beaucage sulfurization, in the case of phosphothioate bonds. After a complete chain elongation, the oligonucleotide is cleaved from CPG and deprotected by treatment with concentrated ammonia, 150 ml, for 16 hours at 50 ° C. The crude oligonucleotide (19200 OD260) is purified by precipitation from N-butanol and subsequent FPLC on a high performance Q Sefarose® column (60/100, Pharmacia) using a Pharmacia Biopilot system. The oligonucleotide is eluted with 0.45-1.0 M NaCl gradient in NaOH at pH 12 in 77 minutes. Fractions containing oligonucleotides were analyzed by HPLC on a Gen-Pak Fax column (Millipore-Waters) using a NaCl gradient (buffer A: 10 mM, 100 mM NaH2P04, 100 mM NaCl in acetonitrile / water = 1: 4 / v: v pH 6.8, buffer B: 10 mM NaH2P04 1.5 M NaCl 1.5 m in acetonitrile / water = l: 4 / v: v 5 a 40% B in 30 minutes). Homogeneous fractions were combined (5660 OD260) and desalted by ultrafiltration. After a second step of disaffiliation by precipitation from ethanol / isopropanol and lyophilization, the oligomer is obtained as a white foam (165 mg). The oligonucleotide was characterized by negative ion electrode mass spectrometry 6005.6; measured 6006.1). In addition, the oligomer was analyzed by capillary electrophoresis in polyacrylamide gels (capillary gel U 100P from Beckman Instruments, ID 100 μM, buffer: 7M urea, 140 mM tris / borate) when applying the compound (1 OD / ml) at 10 kV for 4 seconds and reveal the electropherogram at 11 kV const. By 40 minutes. Example 3: Detailed description of the synthesis of ON28 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3' (with "*" phosphorothioate and N = 2'-O-methylribonucleoside; T = 2 '-O-methyl-U The partially modified oligonucleotide with 2'O-methyl, is synthesized as described in Example 2, starting from a CPG support, which was loaded with 5'-O-Dimethoxytrityl-N2-isobutyroyl-2'-O-methyl-guanosanosine-3'-0-succinate. For the introduction of the 2'-O-methyl ribonucleosides, the corresponding nucleoside-2'-O-methyl-3'-phosphoramidites are coupled in place of the normal deoxynucleoside-3'-phosphoramidites. The crude oligonucleotide (18700 OD260) is precipitated from n-butanol (594 mg). The oligonucleotide is characterized by mass spectrometry with negative ion electrode (Cal 6293.9; measured 6292.9).

• Ji® • 8hs £ atSfri *. *! $ & i * &X- Example 4: Treatment of cells with antisense oligonucleotides. Cells are coated in 96 well plates at 30,000 cells / well, 150 ul medium per well (medium depends on cell type). On the next day, Cellfectin (Gibco-BRL) is diluted to 400 ug / ml in water (solution A). Oligonucleotides are diluted at 40X, the final desired concentration in water (solution B). Equal amounts of solutions A and B are mixed, to give the desired volume of a solution which is 200 μg / ml of Cellfectin and 20X of oligonucleotide, and the mixture is left at room temperature for 30 minutes. After 30 minutes, 19 volumes of Optimem (Gibco-BRL) are added to give a final solution which is 10 μg / ml of Cellfectin and IX of oligonucleotide- (solution C). The medium is removed from the cells, the wells are washed 2 × with Optimem, and 150 μl of solution C is added to each well. The plates are then returned to the incubator (37 ° C, 5% C02). After 5 hours, the Cellfectin / oligonucleotide solution is removed and replaced with 150 μl of regular growth medium. VEGF protein and mRNA assays are performed beginning 19 hours later. Example 5: VEGF Protein Assay Samples (from Example 4) of conditioned medium are taken from the desired cells and assayed for the presence of human VEGF using the human VEGF ELISA kit of R & D Systems. The test protocol is the one provided with the equipment. Example 6: VEGF mRNA Assay Of the cells of Example 4, medium is removed from the 96-well plates described above, and are prepared from the remaining cells for quantification of VEGF mRNA by the Applied Analyzer.

Biosystems 7700. The quantification of mRNA follows. The mRNA is purified from cells and cDNA is produced, using Promega's PolyATract 9600 cDNA and isolation mRNA synthesis system (Catalog # Z3790). The instructions that are provided with the equipment were followed. Quantitation of VEGF cDNA is measured using the ABI Prism 7700 sequence detection system from Perkin Elmer / Applied Biosystems. The TaqMan MR PCR reagent kit from Perkin Elmer / Applied Biosystems (Catalog # N808-0230) is used to configure the reactions. The TaqMan ß-actin reagent kit from Perkin Elmer / Applied Biosystems (Catalog # 401846) is used to configure the β-actin control reaction. The VEGF data is normalized against the β-actin data. The sequences of the fluorescent labeled probe and the primers designated for the VEGF reactions are: -? • > & C! i) go, 5 1"- ~ l ~ j- * SEC ID NO.20: Probe: 5 -6FAM-TCAGCGCAGCTACTGCCATCCAAT-TAMRA-3 (5'-3 ') SEC ID NO.21: Advance primer 1: 5 '-GGAGGGCAGAATCATCACGAA-3 (5'? 3 ') SEC. NO.22: Reverse primer 2: 5 '-AGGGTACTCCTGGAAGATGTCCAC-3' (5'-3 ') Example 7: Determination of IC values (50) IC (50) are calculated based on a value of 100% for the amount of VEGF protein or mRNA in cells treated with Cellfectin but without oligonucleotide. Example 8: In vivo studies Experiments are carried out with nude female mice of 4 to 6 weeks of age (nu / nu). Tumors develop by subcutaneous implantation of cells (2,000,000 in 200 μl per U87-MG). Oligonucleotides are dissolved in phosphate buffered saline and injected subcutaneously or intravenously (tail vein) in a volume of 100 μl. 2 x 106 U87-MG. Some oligonucleotides were also tested by oral administration. The tumor cells are implanted s.c. on day 0. The drug treatment is administered by injection into the vein of the tail i.v. daily Each treatment group contains 6 to 10 animals. When ON 1 is used for the treatment of mice, tumor growth was inhibited / reduced in mice at a concentration of 4 to 12 mg of oligonucleotide per kilogram of body weight. ON 1 significantly inhibits the growth of xeno-U87-MG tumor grafts developed subcutaneously in nude mice when administered daily by i.v. or s.c. in a dose-dependent manner. This is clearly demonstrated by the results shown in Table 2. At the end of the study, the tumors were embedded in paraffin, sectioned and evaluated for expression of VEGF mRNA by in situ hybridization. The amount of expression of VEGF mRNA varies in a tumor, with some regions showing very high expression and others that do not show detectable expression. Therefore, VEGF expression in the tumor sections is analyzed by quantification of the percentage of the area with a high level of expression. Treatment with ON 1 leads to a dramatic decrease in levels of VEGF mRNA in tumors, when analyzed by this method (Figure 1). Density of micro-vessels in the study tumors is assessed by factor VIII staining. There was only a slight decrease in the number of vessels / area in tumors of the treated animals. However, there was a large decrease in the size of the vessels in the tumors of the animals treated with the drug. Example 9: In vitro studies Cell culture. HT-29 cells were developed in RPMI-1640 medium supplemented with 10% FBS, 10 μg / ml gentamicin and 1 mM L-glutamine. Treatment of cells with antisense oligonucleotides (ONs). 96 well plates were coated at 30,000 cells / well on day 1. On day 2, the cell was treated with ONs using Cellfectin (GIBCO BRL) at 10 μg / ml as an absorption enhancer. The cellfectin / ON complexes were formed by first diluting Cellfectin and ONs to a concentration of 40X of the final desired concentration, then mixing these solutions in a 1: 1 ratio to give 20X of the final desired concentration of Cellfectin and ON. The dilutions were made in ddH20. After allowing the complexes to form at room temperature for 30 minutes, the mixtures were diluted to IX by adding 19 volumes of Optimem-1 (GIBCO BRL). Cells were washed twice with Optimem, and Cellfectin / ON complexes were added to the cells (150 μl / well). The plates were returned to the incubator for 5 hours. After 5 hours, the complexes were removed and the medium was replaced with the standard cell growth medium described above. ELISA assay for VEGF. The VEGF secreted into the culture medium by the cells was quantified using the R &amp's human VEGF immunoassay kit; D Systems. 100 μl of HT-29 cell medium was used for the assay, and 25 μl of "U87-MG cell medium was used for the assay." After removal of the ELISA medium, the remainder of the medium was removed from the plates. cells, the plates were frozen at -80 ° C, and the cell number was determined using the CyQUANT assay kit from Molecular Probes.Data analysis.The A450 ELISA readings were converted to pg / ml VEGF, using a curve The values were then normalized by dividing pg / ml of VEGF in each well by the value for the CyQUANT test well, the resulting values were then averaged (n = 3 for each test point). data except control, where n = 6), and standard deviations were calculated.The data was plotted as percent control (control = Cellfectin without ODN), with error bars representing standard deviation Example 10: In vivo studies Preparation of compounds Compound s were stored at -20 ° C as lyophilized solid in aliquots of 25 or 50 mg. Aliquots were dissolved in Hanks balanced salt solution (HBSS) at 1.25 mg / ml as required. Dissolved compounds were stored at 4 ° C for no more than 7 days. Treatment of animals. Cells for tumor implantation, were developed in flasks for tissue culture using the means described above. HT cells ^ j ^ ^ ^ ^ * ^^^ i "^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ j2 ^^^ 29 were harvested by EDTA treatment, U8-MG cells were harvested by trypsin / EDTA treatment, and tumors were implanted by subcutaneous injection of 5,000,000 cell / mouse in the side in a volume of 100 μl of HBSS. 200 μl dose per iv tail vein injection or oral administration Treatment was daily, starting the day after tumor implantation The animals in the control groups were untreated The animals were housed in micro insulative cages , a cage treatment group (n = 6 per group) Individual animals were sacrificed if the tumors were ulcerated, which typically occurred once the tumor volume reached 500-600 mm3 Table 1: Oligonucleotide Type IC50 for IC50 for IC50 for Secretion mRNA VEGF mRNA B-actma VEGF ON 1 Partial SP 300nM 100 nM no effect at mRNA level ON 28 gapmer 300nM 2 '-0-met? L ribonu cleósido, partial PS ON 29 chimera 500nM Table 1 (Cont. Oligo-nucleotide Type IC50 for IC50 for IC50 for Secretion mRNA VEGF mRNA B-actma of VEGF 2 '-O-methyl ribonucleoside partial PS 39 ON 39 300 nM ON 53 2'5 (Co) 4- 1500 nM conjugate all-2' -O-methyl ON 54 2 '5' (rA) 4- 230 nM conjugate all-2 '-0-met? Lo ON 55 4X lack of > 3μM without effect on no coinciding mRNA level level of mRNA with respect to 0N1 Control, partial PS ON 56 Sequence control > 3μM without effect in no effect in mixed, (with respect to mRNA level mRNA level to 0N1) PS partial PS: Mforucleotide phosphorothioate bridge -A »jxsAtgJ & * •• ** • * - Table 2: Tumor volume reduction during ON treatment 1. Tumors were implanted by s.c. of 2 x 106 U87-MG cells in a mouse on day 0. Then the drug treatment was started on day 4. The drug was administered by injection into the vein of the tail i.v. daily. Each treatment group contains 6 to 10 mice. The data are presented as average +/- SE (standard error).

Drug treatment started on day 4 in all cases. Drug administered by injection in the tail vein i.v. Tumor model: 2,000,000 U87-MG cells implanted subcutaneously on day 0 Tumor volume is determined on day 17.

Table 3: Nucleotide sequence of human VEGF (SEQ ID NO.19.) CAGTGTGCTGGCGGCCCGGCGCGAGCCGGCCCGGCCCCGGTCGGGCCTCCGAAACC ATGAACTTTCTGCTGTCTTGGGTGCATTGGAGCCTCGCCTTGCTGCTCTACCTCCA CCATGCCAAGTGGTCCCAGGCTGCACCCATGGCAGAAGGAGGAGGGCAGAATCATC ACGAAGTGGTGAAGTTCATGGATGTCTATCAGCGCAGCTACTGCCATCCAATCGAG ACCCTGGTGGACATCTTCCAGGAGTACCCTGATGAGATCGAGTACATCTTCAAGCC ATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGACGAGGGCCTGGAGT GTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATTATGCGGATCAAACCTCAC CAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAACAAATGTGAATGCAG ACCAAAGAAAGATAGAGCAAGACAAGAAAATC Table 4: Growth Inhibition HT-29 on nude mice after daily oral administration of VEGF antisense oligonucleotide ON 50 . a »» ts »*?" - **** ^ ^ ^ ^ "LIQUID STATUS (1) GENERAL INFORMATION (i) APPLICANT: (A) NAME: Hoechst Marion Roussel Deutschland GmbH (B) STREET: - (C) CITY: Frankfurt (D) STATUS: - (E) ) COUNTRY: Germany (F) POSTAL CODE: 65926 (G) TELEPHONE: 069-305-7072 (H) TELEFAX: 069-35-7175 (I) TELEX: - (i?) TITLE OF THE INVENTION: Oligonucleotides Antisense for the Inhibition of VEGF Expression (iii) NUMBER OF SEQUENCES: 22 (iv) LEGIBLE FORM BY COMPUTER: (A) TYPE OF MEDIA: Flexible disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SUPPORT LOGIC: Patentin Relay # 1.0, Version # 1.30 (EPO) (2) INFORMATION FOR SEC ID. NO .1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs »L« * < ^^^^^ 2 ^ ^^ (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic" ( iv) ANTICIPATION: YES (ix) FEATURE: (A) NAME / KEY: exon (B) LOCATION: 1..19 (xi) SEQUENCE DESCRIPTION: SEC ID. NO .1 GCGCTGATAG ACATCCATG 19 (2) INFORMATION FOR SEC ID. NO .2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (n) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "synthetic" (ix) FEATURE: (A) NAME / KEY: exon (B) LOCATION: 1..33 (xi) SEQUENCE DESCRIPTION: SEC ID. NO .2: CATGGATGTC TATCAGCGCA GCTACTGCCA TCC 33 (2) INFORMATION FOR SEC ID. NO .3: '(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid ( A) DESCRIPTION: / desc = "synthetic" (ix) CHARACTERISTICS: (A) NAME / KEY: exon (B) LOCATION: 1..19 (xi) SEQUENCE DESCRIPTION: SEC ID. NO .3: CATGGATGTC TATCAGCGC 19 (2) INFORMATION FOR SEC ID. NO .4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES (ix) FEATURE: (A) NAME / KEY: exon (B) LOCATION: 1..33 (xi) SEQUENCE DESCRIPTION: SEC ID. NO .4: £ fes &-GGATGGCAGT AGCTGCGCTG ATAGACATCC ATG 33 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES (ix) FEATURE: * (A) NAME / KEY: exon (B) LOCATION: 1.26 (xi) SEQUENCE DESCRIPTION: SEC ID NO .5 GGCAGTAGCT GCGCTGATAG ACATCC 26 (2) INFORMATION FOR SEC ID. NO .6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES (ix) FEATURE: * (A) NAME / KEY: exon (B) LOCATION: 1..22 (xi) SEQUENCE DESCRIPTION: SEC ID. NO .6 GGCAGTAGCT GCGCTGATAG AC 22 (2) INFORMATION FOR SEC ID. NO .7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES (ix) FEATURE: * (A) NAME / KEY: exon (B) LOCATION: 1..17 (xi) SEQUENCE DESCRIPTION: SEC ID. NO .7: GGCAGTAGCT GCGCTGA 17 (2) INFORMATION FOR SEC ID. NO .8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "synthetic" ift (iv) ANTICIPATION: YES (ix) FEATURE: * (A) NAME / KEY: exon (B) LOCATION: 1..18 5 (xi) SEQUENCE DESCRIPTION: SEC ID. NO .8: GCTGCGCTGA TAGACATC 18 (2) INFORMATION FOR SEC ID. NO .9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs 10 (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid ( A) DESCRIPTION: / desc = "synthetic" 15 (iv) ANTI-SENSE: YES (ix) CHARACTERISTICS: * (A) NAME / KEY: exon (B) LOCATION: 1..29 (xi) SEQUENCE DESCRIPTION: SEC ID . NO .9: 20 GGCAGTAGCT GCGCTGATAG ACATCCATG 29 (2) INFORMATION FOR SEC ID. NO.10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid 25 (C) HEBRA: simple (D) TOPOLOGY: lijtffai (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES 5 (ix) CHARACTERISTICS: * (A) NAME / KEY: exon (B) ) LOCATION: 1..20 (xi) SEQUENCE DESCRIPTION: SEC ID. NO.10: TGCGCTGATA GACATCCATG 20 10 (2) INFORMATION FOR SEC ID. NO.11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple 15 (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES (ix) FEATURE: * 20 (A) NAME / KEY: exon (B) LOCATION:! .. 19 (xi) SEQUENCE DESCRIPTION: SEC ID . DO NOT. 11: GCGCTGATAG ACATCCATG 19 (2) INFORMATION FOR SEC ID. DO NOT. 12: 25 (i) SEQUENCE CHARACTERISTICS: ? ^^^ g ^ g ^^^^^ g ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^? ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ base pair (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nuclèic acid (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES (ix) ) CHARACTERISTICS: * (A) NAME / KEY: exon (B) LOCATION: 1..18 (xi) SEQUENCE DESCRIPTION: SEC ID. NO.12: CGCTGATAGA CATCCATG 18 (2) INFORMATION FOR SEC ID. NO.13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES (ix) FEATURE: * (A) NAME / KEY: exon (B) LOCATION: 1..17 (xi) SEQUENCE DESCRIPTION: SEC ID. DO NOT. 13: t ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^ S ^? ^^ fe ^^ k GCGCTGATAG ACATCCA 17 (2) INFORMATION FOR SEC ID. NO .14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES (ix) FEATURE: * (A) NAME / KEY: exon (B) LOCATION: 1..17 (xi) SEQUENCE DESCRIPTION: SEC ID. NO .14: GCTGATAGAC ATCCATG 17 (2) INFORMATION FOR SEC ID. NO.15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES (ix) CHARACTERISTICS: * (A) NAME / KEY: exon (B) LOCATION: 1..18 (xi) SEQUENCE DESCRIPTION: SEC ID. NO.15: GCGCTGATAG ACATCCAT 18 (2) INFORMATION FOR SEC ID. NO.16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (li) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "synthetic" (ív) ANTI-SENSE: YES (ix) FEATURE: * (A) NAME / KEY: exon (B) LOCATION: 1..17 (xi) SEQUENCE DESCRIPTION: SEC ID. NO.16: CGCTGATAGA CATCCAT 17 (2) INFORMATION FOR SEC ID. NO.17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES (ix) FEATURE: * (A) NAME / KEY: exon 5 (B) LOCATION: 1..19 (xi) SEQUENCE DESCRIPTION: SEC ID. NO.17: GCGACGATAG ATCTCCATG 19 (2) INFORMATION FOR SEC ID. NO.18: (i) SEQUENCE CHARACTERISTICS: 10 (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid 15 (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES (ix) FEATURE: * (A) NAME / KEY: exon (B) LOCATION: 1..19 20 (xi) DESCRIPTION OF SEQUENCE: ID OF SEC. NO.18: CGAAGCACTG TACGCATTG 19 (2) INFORMATION FOR SEC ID. NO.19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 480 base pair 25 (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic" (iv) ANTICIPATION: YES (ix) CHARACTERISTICS: * (A) NAME / KEY: exon (B) LOCATION: 1.488 (xi) SEQUENCE DESCRIPTION: SEC ID. NO.19: CAGTGTGCTG GCGGCCCGGC GCGAGCCGGC CCGGCCCCGG TCGGGCCTCC GAAACCATGA 60 ACTTTCTGCT GTCTTGGGTG CATTGGAGCC TCGCCTTGCT GCTCTACCTC CACCATGCCA 120 AGTGGTCCCA GGCTGCACCC ATGGCAGAAG GAGGAGGGCA GAATCATCAC GAAGTGGTGA 180 AGTTCATGGA TGTCTATCAG CGCAGCTACT GCCATCCAAT CGAGACCCTG GTGGACATCT 240 TCCAGGAGTA CCCTGATGAG ATCGAGTACA TCTTCAAGCC ATCCTGTGTG CCCCTGATGC 300 GATGCGGGGG CTGCTGCAAT GACGAGGGCC TGGAGTGTGT GCCCACTGAG GAGTCCAACA 360 TCACCATGCA GATTATGCGG ATCAAACCTC ACCAAGGCCA GCACATAGGA GAGATGAGCT 420 TCCTACAGCA CAACAAATGT GAATGCAGAC CAAAGAAAGA TAGAGCAAGA CAAGAAAATC 480 (2) INFORMATION FOR SEC ID. NO.20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "synthetic" irZStet? (iv) ANTICIPATION: YES (ix) FEATURE: * (A) NAME / KEY: exon (B) LOCATION: 1..24 (xi) SEQUENCE DESCRIPTION: SEC ID. NO.20: TCAGCGCAGC TACTGCCATC CAAT 24 (2) INFORMATION FOR SEC ID. NO.21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "synthetic" (iv) ANTI-SENSE: YES (ix) FEATURE: * (A) NAME / KEY: exon (B) LOCATION: 1..21 (xi) SEQUENCE DESCRIPTION: SEC ID. NO.21: GGAGGGCAGA ATCATCACGA A 21 (2) INFORMATION FOR SEC ID. NO.22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple ^ »98á¿ ^ .fe & iáfe.» .. »(D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc =" synthetic "(iv) ANTISENTIDO: SI (ix) CHARACTERISTICS: * (A) NAME / KEY: exon (B) LOCATION: 1..24 (xi) SEQUENCE DESCRIPTION: SEC ID. NO.22: AGGGTACTCC TGGAAGATGT CCAC 24 > Me * 3r "f» »- fer»? - "and -. .... - < r? -. ~ a--

Claims (21)

1. © CLAIMS 1.- An oligonucleotide or its derivative having the sequence SEQ ID NO. NO .4 or a part of it, where SEC ID. NO.4 is 3 '-GTACCTACAGATAGTCGCGTCGATGACGGTAGG-5', with the first condition that not all internucleoside bridges in the oligonucleotide are internucleoside phosphodiester bridges and not all internucleoside phosphodiester bridges are replaced by internucleoside phosphorothiodate bridges and / or the second condition that the oligonucleotide does not contain modified nucleosides selected from C5-propynyl uridine, C5-propynyl cytidine, C5-hexyl uridine, C5-hexynyl, cytidine, 6-aza uridine and 6-aza cidine.
2. 2. An oligonucleotide according to claim 1, characterized in that it has a length of 17 to 33 nucleotides.
3. 3. - An oligonucleotide according to one or more of claims 1 and 2, characterized in that it has one of the sequences SEQ ID NO. NO.5 to SEC ID NO.16, where SEC ID. NO.5 is 3 '-CCTACAGATAGTCGCGTCGATGACGG-5', SEQ ID. NO.6 is 3 '-CAGATAGTCGCGTCGATGACGG-5', SEQ ID NO. NO.7 is 3 '-AGTCGCGTCGATGACGG-5', SEC ID. NO.8 is 3 '-CTACAGATAGTCGCGTCG-5', SEQ ID NO. NO .9 is 3 '-GTACCTACAGATAGTCGCGTCGATGACGG-5', SEQ ID. NO.10 is 3 '-GTACCTACAGATAGTCGCGT-5', SEQ ID. NO.11 is 3 -GTACCTACAGATAGTCGCG-5 ', SEC ID. NO.12 is 3 -GTACCTACAGATAGTCGC-5 ', SEC ID. NO.13 is 3 -ACCTACAGATAGTCGCG-5 ', SEC ID. NO.14 is 3 -GTACCTACAGATAGTCG-5 ', SEC ID. NO.15 is 3 -TACCTACAGATAGTCGCG- 5 'and SEC ID. NO.16 is 3 -TACCTACAGATAGTCGC-5 '.
4. 4. An oligonucleotide according to one or more of claims 1 to 2, characterized in that the oligonucleotide has one or more modifications and wherein each modification is located in a particular internucleoside phosphodiester bridge and / or a β-D- unit. 2 'particular deoxyribose and / or a particular natural nucleoside base position compared to an oligonucleotide of the same sequence composed of natural DNA.
5. 5. An oligonucleotide according to one or more of claims 1 to 4, characterized in that the 1 to 5 nucleotide units terminal at the 5 'end and / or at the 3' end of the oligonucleotide, are protected by modifying localized internucleoside bridges at the 5 'and / or 3' end of the corresponding nucleosides.
6. 6. An oligonucleotide according to one or more of claims 1 to 5, characterized in that at least one internal nucleoside pyrimidine and / or internucleoside bridge located at the 5 'end and / or the 3' end of this nucleoside pyrinidine, is modify.
7. 7. An oligonucleotide according to one or more of claims 1 to 6, characterized in that each modification is independently chosen from: (a) the replacement of an internucleoside phosphodiester bridge located at the 3 'and / or 5' end of a nucleoside by a modified internucleoside bridge, (b) the replacement of phosphodiester bridge located at the 3 'and / or 5' end of a nucleoside by a phospho bridge, (c) the replacement of a sugar phosphate unit from the main structure sugar phosphate by another unit, (d) replacement of a 13-D-2'-deoxyribose unit by a modified sugar unit, (e) replacement of a natural nucleoside base by a modified nucleoside base, (f) conjugation to a molecule that influences the properties of the oligonucleotide, (g) conjugation to a linked 2 ', 5' oligoadenylate molecule or its derivative, optionally by an appropriate linker molecule, and (h) the introduction of an inversion 3-3 'and / o 5 '- 5 'at the 3' and / or 5 'end of the oligonucleotide.
8. 8. An oligonucleotide according to one or more of claims 1 to 7, characterized in that each modification is independently chosen from: (a) the replacement of an internucleoside phosphodiester bridge located at the 3 'and / or 5' end of a nucleoside by a modified internucleoside bridge, where the modified internucleoside bridge is chosen from phosphorothioate bridges, phosphorodithioate, NR-'R1 '-phosphoramidate, boranophosphate, phosphate- (1 to 21 carbon atoms) -0-alkyl ester, phosphate- [(6 to 12 carbon atoms) aryl- ((1 to 21 carbon atoms) ) -O-alkyl ester, (7 to 12 carbon atoms) a-hydroxymethylaryl, (1 to 8 carbon atoms) alkylphosphonate and / or (6 to 12 carbon atoms) -arylphosphonate, wherein R1 and R1 'independently between them are hydrogen, (1 to 18 carbon atoms) alkyl, (6 to 20 carbon atoms) -aryl ((6 to 14 carbon atoms) aryl (1 to 8 carbon atoms) alkyl, or R1 and R1 'form, together with the nitrogen atom carrying them a heterocyclic ring of 5 to 6 members, which may additionally contain an additional heteroatom of the group O, S and N; (b) the replacement of phosphodiester bridge located at the 3 'and / or 5' end of a nucleoside by a phosphine bridge, wherein the phospho bridge is selected from formacetal, 3'-thioformacetal, methylhydroxylamine, oxime, methylenedimethyl groups -hydrazo, dimethylenesulfone and silyl; (c) the replacement of a sugar phosphate unit of the main sugar phosphate structure by another unit, where the other unit is chosen from units derived from morpholino, units of the main structure of polyamide nucleic acid and units of the main structure of nucleic acid ester acidic monophosphate; (d) replacement of a 13-D-2'-deoxyribose unit with a modified sugar unit, wherein the modified sugar unit is selected from β-D-ribose, aD-2 '- deoxyribose, L-2' -deoxyribose, 2'-F-2'-deoxyribose, 2'-0- (C1-C6) alkyl-ribose, 2'-0- (C2-C6) alkenyl-ribose, 2 '- [0- (the carbon atoms) alkyl -O- (1 to 6 carbon atoms) alkyl] -ribose, 2'-NH2-2 '-deoxyribose, β-D-xylo-furanose, -arabinofuranose, 2,4-dideoxy-β- D-erythro-hexo-pyranose, carbocyclic sugar analogs, open-chain sugar analogues and bicyclo-sugars; (e) replacement of a natural nucleoside base with a modified nucleoside base, wherein the modified nucleoside base is chosen from 5- (hydroxymethyl) uracil, 5-aminouracil, pseudoouracil, dihydrouracil, 5-fluorouracil, 5-fluorocytosine , 5-chlorouracil, 5-chlorocytosine, 5-bromo-uracil, 5-bromocytosine, 2,4-diaminopurine or 7-deaza-7-substituted and 7-deaza-8-substituted purines and 8-aza purines; (f) conjugation to a molecule that influences the properties of the oligonucleotide, wherein the molecule that influences the properties of the oligonucleotide is chosen from polylysine, intercalating agents, fluorescers, entanglement agents, lipophilic molecules, lipids, spheroids, vitamins, poly or oligo ethylene glycol, (12 to 18 carbon atoms), -alkyl phosphate diesters, groups 0-CH2-CH (0H) -0- (12 to 18 carbon atoms) -alkyl; (g) conjugation to a linked 2'5'-oligoadenylate molecule or its derivative, optionally by an appropriate linker molecule, wherein the linked 2'-5'-olyadenylate molecule is selected from triadenylath, tetraadenylate, pentaadenylate, hexaadenylate and heptaadenylate and their derivatives; and (h) the introduction of a 3 '-3' and / or 5 '-5' inversion at the 3 'and / or 5' end of the oligonucleotide.
9. 9. An oligonucleotide according to one or more of claims 1 to 8, characterized in that the oligonucleotide has the sequence SEQ ID NO. DO NOT. 11 and one of the following patterns of internucleoside bridge modifications ON 1: 3 '-G * T * A * C * C * TA * C * AGA * T * AGT * CG * C * G-5', ON 2: 5 '-G * CG * C * T * G * A * T * AG * A * C * A * T * C * C * A * T * G -3, ON 3: 5' -G * C * GC * T * GA * T * AGA * C * AT * C * C * A * T * G -3, ON 4: 5 '-G * C * G * C * T * GA * T * AGA * C * AT * C * C * A * T * G -3, ON 5: 5 '-G * CGC * T * GA * T * AGA * C * AT * C * C * A * T * G -3', ON 6 : 5 '-G * CGC * TGA * T * AGA * C * AT * C * C * A * T * G -3, ON 7: 5' -G * C * GC * TGAVAGA * C * AT * C * C * A * T * G -3, ON 8: 5 '-GC * GC * TGA * TAGA * C * AT * C * CA * T * G-3, ON 9: 5' -G * C * GC * TGA * T * AGA * C * AT * C * CA * T * G-3, ON 10: 5 '-G * C * GC * TGA * T * AGA * C * A * T * CC * A * T * G-3, ON 11: 5 '-G * C * G * C * TGA * T * AGA * C * AT * C * C * A * T * G-3', ON 12: 5 '-G * C * G * C * TGA * T * AGA * CA * T * C * C * A * T * G-3, ON 13: 5 '-G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G-3, ON 14: 5 '- GCGC TGA T AGA CATCCAT G-3 and ON 15: 5' - G * CG * C * G * AVA A * C * A * T * C * C * A * T * G-3, where "*" indicates the position of a modified internucleoside bridge.
10. 10. An oligonucleotide according to one or more of claims 1 to 9, characterized in that the oligonucleotide has the sequence SEQ ID NO. NO.11 and one of the following patterns of modifications of internucleoside ON 16: 5 '-GCGCTGATAGACATCCATG-3' ON 17: 5 '-GCGCTGATAGACATCCATG- 3 'ON 18: 5' -GCGCTGATAGACATCCATG-3 'ON 19: 5' -GCGCTGATAGACATCCATG- 3 'ON 20: 5' -GCGCTGATAGACATCCATG- 3 'ON 21: 5' -GCGCTGATAGACATCCATG- 3 'ON 22: 5' -GCGCTGATAGACATCCATG-3 'ON 23: 5' -GCGCTGATAGACATCCATG-3 'ON 24: 5' -GCGCTGATAGACATCCATG- 3 'ON 25: 5' -GCGCTGATAGACATCCATG- 3 'ON 26: 5' -GCGCTGATAGACATCCATG- 3 'AND ON 27: 5' -GCGCTGATAGACATCCATG- 3 'wherein "N" indicates the position of a modified nucleoside.
11. 11. An oligonucleotide according to one or more of claims 1 to 10, characterized in that one or more internucleoside phosphodiester bridges are replaced by phosphorothioate bridges and where "*" indicates the position of an internucleoside phosphorothioate bridge.
12. 12. - An oligonucleotide according to one or more of claims 1 to 11, characterized in that one or more β-D-2'-deoxyribose units are replaced by 2'-O-methylribose and where "N" indicates the position of a 2 '-0-methylribo-nucleoside (in this case "T" is 2' -0-methyluridine).
13. 13. - An oligonucleotide according to one or more of claims 9 to 11, characterized in that the alkyl group with 16 carbon atoms is linked at its 5 'and / or 3' end.
14. 14. - Method for producing an oligonucleotide according to one or more of claims 1 to 13, by condensing monomers conveniently protected in a solid support.
15. 15. The use of an oligonucleotide according to one or more of claims 1 to 13, to inhibit the expression of VEGF.
16. 16. Method for inhibiting the expression of VEGF, wherein an oligonucleotide according to one or more of claims 1 to 13, is contacted with a nucleic acid encoding VEGF.
17. 17.- The use of an oligonucleotide in accordance ^^ g ^ ^ jg &ari ^^^^^^ with one or more of claims 1 to 13, for preparing a pharmaceutical composition.
18. 18. Method for producing a pharmaceutical composition by mixing one or more oligonucleotides of According to one or more of claims 1 to 13, with a physiologically acceptable excipient and optionally additional substances.
19. 19. A pharmaceutical composition, characterized in that it comprises at least one oligonucleotide according to one or more of claims 1 to 13.
20. 20. The use of a pharmaceutical composition comprising at least one oligonucleotide according to claim 1. 13, for the treatment of diseases, which are associated with abnormal vascular permeability, cell proliferation, cell permeation, angiogenesis, neovascularization, tumor cell growth and / or metastasis.
21. 21. The use of a pharmaceutical composition, comprising at least one oligonucleotide in accordance 20 with one or more of claims 1 to 13, in combination with other pharmaceutical products and / or other therapeutic methods.