MXPA01000908A - Short oligonucleotides for the inhibition of vegf expression - Google Patents

Abstract

The present invention relates to a short oligonucleotide or a derivative thereof which has a sequence that corresponds to a particular part of a nucleic acid sequence which encodes VEGF (vascular endothelial growth factor) and which has a length of maximum 15 nucleotides, the invention further relates to a method of making the oligonucleotide and the use thereof. A short oligonucleotide or a derivative thereof, which has a length of 10 to 15 nucleotides and which corresponds to a part of a VEGF encoding sequence, wherein the part of the VEGF encoding sequence to which the oligonucleotide corresponds to has one of the sequences SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6 or a part thereof, wherein SEQ ID NO. 1 is 5'-CCCGGCCCCGGTCGGGCCTCCG-3', SEQ ID NO. 2 is 5'-CGGGCCTCCGAAACC-3', SEQ ID NO. 3 is 5'-GCTCTACCTCCACCATGCCAA-3', SEQ ID NO. 4 is 5'-GTGGTCCCAGGCTGCACCCATGGC-3', SEQ ID NO. 5 is 5'-CATCTTCAAGCCATCC-3', and SEQ ID NO. 6 is 5'-TGCGGGGGCTGCTGC-3'.

Description

0LIG0NUCLEÓT1D0S CORTOS FOR THE INHIBITION OF THE EXPRESSION OF THE VASCULAR ENDOTHELIAL GROWTH FACTOR (VEGF) The present invention relates to a short oligonucleotide, or one of its derivatives, which has a sequence corresponding to a particular part of a nucleic acid sequence, which encodes the vascular endothelial growth factor (VEGF) and which It has a maximum length of 15 nucleotides. The invention also relates to a method of obtaining the oligonucleotide and its use. Angiogenesis is defined as the growth of new capillary blood vessels and plays a key role in growth and development. In mature humans, the ability to initiate an angiogenic response occurs in all tissues, but remains under strict control. Angiogenesis is only mobilized in specific situations, cutting as in the repair of a wound and endometrial regulation. The regulation of angiogenesis depends on a fine balance between numerous inhibitory and stimulating factors. VEGF, also named VPF (vascular permeability factor), is a key regulator of angiogenesis and its mitotic effect is specific for endothelial cells (Ferrara, Trends Cardiovas, Med. (1993) 3, 244). VEGF exists in at least four different isoforms (VEGF, VEGF? 65, VEGF? 89 and VEGF206). that exercise similar biological activities and result from alternative splices. VEGF is expressed at abnormally high levels in human tumors and in the 5 diseased tissues, characterized by a high degree of vascularization or vascular permeability, such as in diabetic retinopathy, psoriasis, age-related macular degeneration, rheumatoid arthritis and others. inflammatory diseases. Therefore, 10 agents can be used that selectively lower VEGF levels to treat malignancies and other angiogenic diseases. It has been shown that monoclonal antibodies against VEGF can suppress the growth of several tumors in uncompensated mice (Kim et al., Nature (1993) 362, 841). Another possibility to reduce VEGF levels is the use of antisense oligonucleotides, which are modified, optionally, in order to improve their properties (E. Uhlmann and A. Peyman, Chemical Reviews 20 90, 543 (1990); S. Agrawal, TIBTECH 1996, 376). The anti-sensation oligonucleotides are thought to bind sequences specific to mRNA, which results in degradation of mRNA and / or inhibition of protein synthesis.

EP 0769 552 A1 discloses anti-detection oligonucleotides having a length of 8 nucleotides or greater,. directed against different regions of the sequence encoding VEGF. Some of these oligonucleotides are shown to inhibit VEGF expression at 30% or less. The oligonucleotides were tested in a cell-free system in the form of unmodified oligonucleotides (without modification of the phosphodiester internucleoside bridge). The selected anti-detection oligonucleotides, ranging in size from 16 to 20 nucleotides, were also tested in the form of all phosphorothioates (all internucleoside phosphodiester bridges were modified as phosphorothioate) (oligonucleotides A985R-S, A087P-S, A227- S, A287-S, A311-S and A419-S) showing 30 to 46% inhibition of VEGF expression at 20 μM of the entire oligonucleotide phosphorothiate in an A549 cell-based assay. The most effective phosphorothioate oligonucleotide (A418-S) is 20-mer and has the sequence SEQ ID NO. 100: 5'-TGGTGAGGTTTGATCCGCAT-3 '. The present invention provides a short oligonucleotide, or one of its derivatives, which corresponds to a part of a sequence encoding VEGF, in which the part of this sequence encoding the VEGF to which the oligonucleotide corresponds, has one of the sequences SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ED NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6, or a part thereof, and where: SEQ ID NO. 1 is 5 '-CCCGGCCCCGGTCGGGCCTCCG-3', SEQ ID NO. 2 is 5 »-CGGGCCTCCGAAACC-3 ', SEQ ID NO. 3 is 5 '-GCTCTACCTCCACCATGCCAA-3', SEQ ID NO. 4 is 5 '-GTGGTCCCAGGCTGCACCCATGGC-3', SEQ ID NO. 5 is 5 * -CATCTTCAAGCCATCC-3 'and SEQ ID NO. 6 is 5 '-TGCGGGGGCTGCTGC-3'.

The sequences SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID DO NOT. 3, SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6, are "core regions", which have been identified as extremely suitable for the design of short oligonucleotides. These sequences, SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6, are equivalent to nucleotides 30 to 51 (SEQ ID No. 1, which is named core region 1), nucleotides 42 to 56 (SEQ ID No. 2, which is named core 2 region) ), nucleotides 101 to 121 (SEQ ID No. 3, which is named the core region 3), nucleotides 122 to 145 (SEQ ID No. 4, which is named the core region 4), nucleotides 268 to 284 (SEQ ID No. 5, which is named core region 5) and nucleotides 303 to 317 (SEQ ID NO: 6, which is named core region 6). The numbering refers to the nucleotide sequence of human VEGF, SEQ ID NO. 93 (Table 1). The location of the core sequences within SEQ ID NO: 93 is shown in Figure 1. A nucleotide sequence for the human VEGF cDNA is given in Figure IB in Leung et al. (1989) Science 8, 1307. The sequence SEQ ID NO. 93 corresponds to the 5 'end (to nucleotides 1 to 480) of the sequence shown in Figure IB in Leung et al. The oligonucleotide has a sequence corresponding to a part of a nucleic acid encoding VEGF. The phrase "corresponds to" means that the base sequence of the oligonucleotide is complementary to a part of a nucleic acid sequence, which encodes VEGF (eg gene, cDNA, mRNA), and, therefore, allows the oligonucleotide hybridized to (bound to), which "detects" part of the nucleic acid encoding VEGF (which is preferably a mRNA of VEGF). This is why it is called "anti-detection oligonucleotide". Accordingly, in a preferred embodiment of the invention, the oligonucleotide is an anti-detection oligonucleotide. In another preferred embodiment of the invention, the oligonucleotide is a ribozyme. A ribozyme is a catalytic nucleic acid which unfolds the mRNA. Preferably, the ribozyme is selected from the group of 'hammerhead' type ribozymes (Uhl ann and Peyman, 1990).

An oligonucleotide, according to the invention, is equivalent to one of the sequences SEQ ID NO. 7 to SEQ ID NO. 12, or a part of them, respectively, where: SEQ ID NO. 7 is 3'- GGGCCGGGGCC? GCCCGGAGGC-5 '; 5'- CGGAGGCCCGACCGGGGCCGGG-3 '(corresponds to SEQ ID No. 1), SEQ ID NO. 8 is 3'- GCCCGGAGGCTTTGG -5 '; 5'- GGTTTCGGAGGCCCG-3 '(corresponds to SEQ ID NO 2), SEQ ID NO. 9 is 3- CGAGATGGAGGTGGTACGGTT -5 '; 5'- TTGGCATGGTGGAGGTAGAGC-3 '(corresponds to SEQ ID NO 3), SEQ ID NO. 10 is 3'- CACCAGGGTCCGACGTGGGTACCG -5 '; 5'- GCCATGGGTGCAGCCTGGGCAACA-3 '(corresponds to SEQ ID No. 4), SEQ ID NO. 11 is 3'- GTAGAAGTTCGGTAGG -5 '; 5'- GGATGGCTTGAAGATG-3 '(corresponds to SEQ ID NO 5), SEQ ID NO. 12 is 3 * - ACGCCCCCGACGACG -51; 5'- GCAGCAGCCCCCGCA-3 '(corresponds to SEQ ID No. 6). - - The part of the nucleic acid sequence encoding VEGF, to which the oligonucleotide corresponds, has a length of 10, 11, 12, 13, 14 or 15 nucleotides, preferably the oligonucleotide corresponds to a length of 12 nucleotides of a sequence that encodes VEGF. Therefore, an oligonucleotide, according to the invention, has a length of 10 (lOmer), ll (llmer), 12 (12mer), 13 (13mer), 14 (14mer) or 15 (15mer) nucleotides. In a preferred embodiment of the invention, the oligonucleotide has a length of 12 nucleotides, these oligonucleotides can, for example, have one of the sequences: SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 29, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID NO. 52, SEQ ID NO. 55 and SEQ ID NO. 56, where: SEQ ID NO.1 is 3'- CCAGCCCGGAGG -5 '; 5'- GGAGGCCCGACC-3 '(is equivalent to a part of ¡EQ ID NO.7), SEQ ID NO.16 is 3'- CGGAGGCTTTGG -5'; 5'- GGTTTCGGAGGC-3 '(is equivalent to a part of SEQ ID NO.8), SEQ ID NO.27 is 3'- GATGGAGGTGGT -5'; 5'-TGGTGGAGGTAG-3 '(is equivalent to a part of -.EQ ID NO.9), SEQ ID NO.28 is 3'- GGAGGTGGTACG -5'; 5'-GCATGGTGGAGG-3 '(is equivalent to a part of SEQ ID NO.9), SEQ ID NO.29 is 3'- GGTGGTACGGTT -5'; 5'-TTGGCATGGTGG-3 '(is equivalent to a part of SEQ ID NO.9), SEQ ID NO.33 is 3 * - CACCAGGGTCCG -5'; 5'-GCCTGGACCAC-3 '(is equivalent to a part of SEQ ID NO.10), SEQ ID NO.34 is 3'- CCAGGGTCCGAC -5'; 5'-CAGCCTGGGACC-3 '(is equivalent to ur> = part of SEQ ID NO.10), SEQ ID NO.35 is 3'- AGGGTCCGACGT -5'; 5'-TGCAGCCTGGGA-3 '(is equivalent to a part of SEQ ID NO.10), SEQ! D NO. 36 is 3'- GGGTCCGACGTG -5 *; 5'-GTGCAGCCTGGG-3 '(is equivalent to a.? Part of f SEQ ID NO.10), SEQ ID NO. 37 i? S 3'- GGTCCGACGTGG -5 '; 5'-GGTGCAGCCTGG-3 '(is equivalent to a part of SEQ ID NO: 10) ^ SEQ ID NO. 38 i is 3-. CCGACGTGGGTA -5 '; ATGGGTGCAGCC-3 '(is equivalent to a part of SEQ ID No. 10), SEQ ID NO. 52 i is 3'- GTAGAAGTTCGG -5 '; 5'-GGCTTGAAGATA-3 '(is equivalent to a part of SEQ ID No. 11), SEQ ID NO. 55 is 3'- ACGCCCCCGACG -5 '; GCAGCCCCCGCA-3 '(is equivalent to a part of SEQ ID NO. 12), and SEQ ID NO. 56 is 3'- CCCCCGACGACG -5 '; GCAGCAGCCCCC-3 '(is equivalent to a part of SEQ ID No. 12).

In another embodiment of the invention, the oligonucleotide has a length of 13 nucleotides; these oligonucleotides can, for example, have one of the sequences SEQ ID NO. 73, SEQ ID NO. 74 or SEQ ID NO. 75, in which SEQ ID NO. 73 is 3'- GGAGGTGGTACGG -5 '; 5'-GGCATGGTGGAGG (is equivalent to a part of SEQ ID NO 9), SEQ ID NO. 74 is 3 '. GGGTCCGACGTGG -5 '; 5'-GGTGCAGCCTGGG (is equivalent to a part of SEQ ID NO: 10), and SEQ ID NO. 75 s 3 .. GCCCCCGACGACG - 5 '; S'-GCAGCAGCCCCCG (is equivalent to a part of SEQ ID No. 12). * - - * a * + ^, - -t? rp? - -JiifiiMiiiM In another embodiment of the invention, the oligonucleotide has a length of 14 nucleotides; these oligonucleotides can, for example, have one of the sequences SEQ ID NO. 76, SEQ ID NO. 77, SEQ ID NO. 78 or SEQ 5 ID NO. 79, in which SEQ ID NO 76 is 3'- CCCGGAGGCTTTGG -5 '; 5, -GGTTTCGGAGGCCC-3 • (is equivalent to a part of SEQ ID No. 8), SEQ ID NO. 77 is 3'- CGAGATGGAGGTGG -5 '; 5'-GGTGGAGGTAGAGC-3 '(is equivalent to a part of SEQ ID NO 9), SEQ ID NO. 78 is 3'- GGGTCCGACGTGGG -5 *; S'-GGGTGCAGCCTGGG-S '(is equivalent to a part of SEQ ID NO: 10), and SEQ ID NO 79 is 3'- CGCCCCCGACGACG-5'; 5'-GCAGCAGCCCCCGC-3 '(is equivalent to a part of SEQ ID No. 12).

In another embodiment of the invention, the oligonucleotide has a length of 15 nucleotides, these oligonucleotides can, for example, have one of the sequences SEQ ID NO. 80 to SEQ ID NO. 88, in which SEQ ID NO. 80 is S'-GGGCCGGGGCCAGCC-d'.d'-CCGACCGGGGCCGGG-S '15 (is equivalent to a part of SEQ ID No. 10), SEQ ID NO. 81 is 3, -CCGGGGCCAGCCCGG-5,, 5, -GGCCCGACCGGGGCC-3 \ (is equivalent to a part of SEQ ID No. 10), SEQ ID NO. 82 is 3'- GGCCGGGGCCAGCCC -5 '; 5'-CCCGACCGGGGCCGG-3 '(is equivalent to a part of SEQ ID No. 10), SEQ ID NO. 83 is 3r-CCCCGGAGGCTTTGG -5 '; 5'-GGTTTCGGAGGCCCC-3 '(is equivalent to a part of SEQ ID NO: 10), SEQ ID NO. 84 is 3'- ATGGAGGTGGTACGG -5 '; 5 * -GGCATGGTGGAGGTA-3 '(is equivalent to a part of SEQ ID No. 10), SEQ ID NO. 85 is 3'- GGAGGTGGTACGGTT-5 '; 5'-TTGGCATGGTGGAGG-3 '(is equivalent to a part of SEQ ID NO: 10), SEQ ID NO. 86 is 3'- CCAGGGTCCGACGTG-5 '; 5 * -GTGCAGCCTGGACC-3 '(is equivalent to a part of SEQ ID No. 10), SEQ ID NO. 87 is 3'- GTAGAAGTTCGGTAG -5 '; 5, -GATGGCTTGAAGATG-3 '(is equivalent to a part of SEQ ID No. 10), and SEQ ID NO. 88 is 3 * - TAGAAGTTCGGTAGG -5 '; 5'-GGATGGCTTGAAGAT-3 '[is equivalent to a part of SEQ ID NO. 10).

The sequences SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 29, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID NO. 52, SEQ ID NO. 55 and SEQ ID NO. 56, and SEQ ID NO 73 to SEQ ID NO. 88, correspond to one of the core sequences, or a part of them (they are equivalent to one of the sequences SEQ ID No. 7 to SEQ ID No. 12, or a part thereof). For the sequences SEQ ID NO. 13, SEQ ID NO. 15, SEQ ID NO. 17 to SEQ ID NO. 26, SEQ ID NO. 30 to SEQ ID NO. 32, SEQ ID NO. 39 to SEQ ID NO. 51, SEQ ID NO. 53, SEQ ID NO. 54, SEQ ID NO. 57 to SEQ ID NO. 72, do not correspond to one of the core regions (oligonucleotides in Example 1, Figure 1). All sequences are derived from the sequence SEQ ID NO. 93 of the human VEGF cDNA or the VEGF sequence that was reported, for example, by Leung et al (Science (1989) 246, 1306). The invention also relates to the derivatives of the oligonucleotides, for example their salts, in particular their physiologically tolerated salts. Salts and in particular physiologically tolerated salts are described, for example, in Remingtons Pharmaceuticals Science (1985) Mack Publishing Company,. Easton, PA (page 1418). Derivatives also refer to modified oligonucleotides, which have one or more modifications (for example, at the particular positions of the nucleosides and / or in the particular bridges of internucleosides, oligonucleotide analogs (for example Polyamine-Nucleic Acids (APN) ), monoester of phosphonic acid nucleic acids (PHONAs = PMENAs), oligonucleotide chimeras (for example consisting of a DNA and a part of APN or consisting of a part of DNA and a part of PHONA)). The invention relates to an oligonucleotide, which has a sequence corresponding to one of the sequences SEQ I NO 1 to SEQ ID NO 6, or a portion thereof (a sequence that is equivalent to one of the sequences SEQ ID NO 7 to SEQ ID NO: 12, or a part thereof), preferably one of the sequences SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 27, SEQ ID No. 28, SEQ ID NO. 29, SEQ ID No. 33, SEQ ID No. 34, SEQ ID No. 35, SEQ] D NO 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID NO. 52, SEQ ID NO. 55 and SEQ ID NO. 56, and SEQ ID NO. 73 to SEQ ID NO. 88, and that it was modified to a certain extent. More preferably, an oligonucleotide is modified in order to improve its properties, for example, in order to increase its resistance to nucleases or to make it resistant against nucleases, respectively, to improve its binding affinity to a complementary nucleic acid encoding the VEGF, for example the mRNA, or in order to increase its cellular admission. Therefore, the present invention preferably relates to an oligonucleotide which has a particular sequence, as outlined above, and which also has one or more chemical modifications, in sympathy with the "natural" DNA, which is composed of the deoxyadenosine from "natural" nucleosides (adenine + ß-D-2 '-desoxyribose), deoxyguanosine (guanine + ß-D-21-deoxyribose), deoxycytidine (cytosine ß-D-2'-deoxyribose) and thymidine (thymine + ß -D-2'-deoxyribose) linked by phosphodiester internucleoside bridges. The oligonucleotide may have one or more modifications of the same type and / or modifications of a different type; each type of modification can be selected, independently, from the types of known modifications that are used to modify oligonucleotides. Those skilled in the art are aware of examples of chemical modifications and are described, for example, in E. Uhlmann and A. Pey an, Chemical Reviews 90 (1990) 543 and "Oligonucleotide and Analog Protocols", Synthesis and Properties & Synthesis and Analytical Techniques, S. Agrawal, Ed. Humana Press, Totowa, USA 1993 and S. T. Crooke, F. Bennet, Ann. Rev. Pharmacol. Toxicol 36 (1996) 107-129; J. Hunziker and C. Leuman (1995) Mod. Synt. Methods, 7, 331-417. For example, in comparison to natural DNA, an internucleoside phosphodiester bridge, a β-D-1 '-deoxytribose unit and / or a natural nucleoside base (adenine, guanine, cytosine, thymine) can be modified or replaced, respectively. An oligonucleotide, according to the invention, may have one or more modifications, wherein each modification is located on the particular phosphodiester internucleoside bridge, and / or on a particular β-D-2 '-deoxytribose unit and / or in a particular natural nucleoside base position, as compared to an oligonucleotide of the same sequence, which is composed of natural DNA. For example, the invention relates to an oligonucleotide, which comprises one or more modifications . ^^ and where each modification is selected independently from: (a) the replacement of a phosphodiester internucleoside bridge, located at the 3 'and / or 5' end of a nucleoside, by a modified internucleoside bridge; (b) replacement of a phosphodiester bridge located at the 3 'and / or 5' end of a nucleoside by a phosphodiester bridge; 10 (c) the replacement of one unit of sugar phosphate from the sugar phosphate backbone by another unit; (d) the replacement of a unit of β-D-2 '-deoxyribose, by a unit of modified sugar; (E) replacement of a natural nucleoside base with a modified nucleoside base; (f) conjugation to a molecule, which influences the properties of the oligonucleotide; (g) conjugation to a 2 ', 5'-linked oligoadenylate or a derivative thereof, optionally by an appropriate linkage, and (h) the introduction of a 3' -3 'and / or 5' -5 'inversion. at the 3 'and / or 5' end of the oligonucleotide.

More detailed examples of the chemical modification an oligonucleotide are: (a) the replacement of a phosphodiester internucleoside bridge, located at the 3 'and / or 5' end of a nucleoside by a modified internucleoside bridge, in which this bridge of modified internucleoside is, for example, selected from phosphorothioate, phosphorodithioate, NR1R1'- phosphoramidate, boranophosphate, phosphate- (C? -C2?) -0- alkyl ester, phosphate- [(C6-C? 2) aryl- ((C? -C2?) -0- alkyl [-ester, (C? -C8) alkyl phosphonate and / or (C6-Ci2) arylphosphonate, (C7-C? 2) -a-hydroxymethylaryl (e.g. , that described in WO 95/01363), in which the (C6-C? 2) aryl, (C6-C2o) aryl and (C6-C?) aryl are optionally substituted by halogen, alkyl, alkoxy, nitro, cyano and wherein R1 and R1 'are, independently of each other, hydrogen, (C? -C? 8) -alkyl, (C6-C20) -aryl, (C6-C? 4) -aryl- (C? -8) -alkyl, preferably hydrogen, (C? -C8-) -alkyl, preferably (C1-C4) -alkyl and / or met oxyethyl; or R1 and R1 'form, together with the nitrogen atom carrying them, a heterocyclic ring, which may additionally contain a heteroatom plus the group of 0, S and N; (b) the replacement of a phosphodiester bridge, located at the 3 'and / or 5' end of a nucleoside, by a defosfo bridge (the dephosphine bridges are described, for example, in Uhlmann, E. and Pey an , A, in "Methods in Molecular Biology", Vol. 20, "Protocols for Oligonucleotides and Analogs", S. Agrawal, Ed. Humana Press, Totowa 1993, Chapter 16, 355 et seq.), In which a defosfo bridge is , for example, selected from the dephosphory bridges of formacetal groups, 3'-thioformacetal, methylhydroxylamine, oxime, methylenedimethyl-hydrazo, dimethylenesulfone and / or silyl; (c) the replacement of a sugar phosphonate unit (the ß-D-2'-deoxyribose bridges and the phosphorus-ester internucleoside, together form a sugar phosphate unit) from the sugar phosphate backbone ( The sugar phosphate skeleton is composed of sugar phosphate units, by another unit, in which this other unit is, for example, suitable for forming a "morpholino derivative" oligomer (as described, for example, in EP). Stirchak et al., Nucleic Acids Res. 17 (1989) 6129), which is, for example, replacement by the unit derived from morpholino; - polyamide-nucleic acid ("NPA") (as described, for example, in PE Nielsen et al, Bioconj, Chem. 5 (1994) 3 and in EP 0672677 A2) which is, for example, replacement by unit of the NPC skeleton, for example by the 2-aminoethylglycine; -the nucleic acid of the phosphonic acid monoester ("PHONA") (as described, for example, in Peyman et al., Angew, Chem. Int. Ed. Engl. 35 (1996) 2632-2638 and in EP 0739898 A2 ), which is, for example, replacement by a PHONA skeleton unit; (d) the replacement of a unit of β-D-2 '-deoxyribose by a unit of modified sugar, in which this modified sugar unit is, for example, selected from ß-D-ribose, aD-2 '-deoxyribose, L-2' -deoxyribose, 2'-F-2'-deoxyribose, 2'-0- (C? -C6) alkyl- ribose, preferably 2'-0- (C? -6) alkyl-ribose is 2'-O-methyl-ribose, is 2 '-0- (C2-C6) alkenyl-ribose,, 2' - [ O- (C? -C6) alkyl-0- (Ci- C6) alkyl ribose, 2'-NH2-2 'deoxyribose,? -D-silofuranose, a-arabinofuranose, 2,4-dideoxy-β- D-erythro-hexo-pyranose and carbocyclic (described, for example, in Froehler, J. Am. Chem. Soc. 114 (1992) 8320) and / or open-chain sugar analogues (described, for example, in Vandendriessche et al., Tetrahedron 49 (1993) 7223) and / or bicyclo sugar analogues (described, for example, in M. Tarkov et al., Helv. Chim. Acta 76 (1993) 481); (e) the replacement of a natural nucleoside base with a modified nucleoside base, in which this modified nucleoside base is, for example, selected from uracil, hypoxanthine, 5- (hydroxymethyl) uracil, N2-dimethylguanosine, pseudouracil, - (hydroxymethyl) uracil, 5-aminouracil, dihydrouracil, 5-fluorouracil, 5-fluorocytosine, 5-chlorouracil, 5-chlorocytoxine, 5-bromouracil, 5-bromocitoxin, 2,4-diaminopurine, 8-azapurine, 7-deazapurine substituted, preferably the 7-deaza-7-substituted purine and / or 7-deaza-8-substituted or other modifications of natural nucleoside bases (modified nucleoside bases are, for example, described in EP 0 710 667 A2 and EP 0 680 969 A2); (f) the conjugation of a molecule, which has an influence on the properties of the oligonucleotide, where the conjugation of the oligonucleotide to one or more molecules that (favorably) have an influence on the properties of the oligonucleotide (for example the ability of the oligonucleotide to penetrate the cell membrane or entering a cell, stability against nucleases, affinity stopped an objective sequence encoding VEGF, the pharmacokinetics of the oligonucleotide, the ability of an anti-detection oligonucleotide / ribozyme or a molecule conjugated to the oligonucleotide, respectively, to attacking the target sequence qre encodes VEGF, eg, the ability to bind to, and / or interleave, when the oligonucleotide hybridizes to an objective sequence encoding VEGF), where examples of molecules that can be conjugated to an oligonucleotide are the polylysine, intercalating agents, such as pyrene, acridine, phenazine or phenanthridine, agent fluoresceins, such as fluorescein, crosslinking agents, such as psoralen or azidoproflavin lipophilic molecules, such as alkyls (C? 2- C20) ~ lipids, such as 1,2-dihexadecyl-rac-glycerol, steroids, such as cholesterol or testosterone, vitamins, such as vitamin E, poly- or oligo-ethylene glycol, preferably linked to the oligonucleotide, by means of a phosphate group (for example, triethylene glycol phosphate, hexaethylene glycol phosphate), phosphate diesters of alkyl (C? 2-C? 8) and / or 0-CH2-CH (OH) -O-alkyl (C? 2-C? 8), these molecules can be conjugated at the 5 'end and / or the end 3 'and / or within the sequence, for example to a nucleoside base, in order to generate a conjugate of oligonucleotide; The processes for preparing an oligonucleotide conjugate are known to those skilled in the art and are described, for example, in Uhlmann, E. & Peyman, A., Chem. Rev. 90 (1990) 543, M. Manoharan in "Antisense Research and 10 Applications", Crooke and Lebleu, Eds. CRC Press, Boca Ratón, 1993, Chapter 18 p. 303 et seq., And E-A-0 552 766. (g) conjugation to a 2 ', 5'-linked oligoadenylate, preferably by means of a linkage molecule.

Appropriate, in which this 2 ', 5'-linked oligoadenylate is, for example, selected from molecules of the 2', 5'-linked triadenylate, 2 ', 5'-linked tetraadenylate, 2', 5'-linked pentaadenylate, 2 ', 5'-linked hexaadenylate or linked 2', 5'-20 heptaadenylate, and derivatives thereof, wherein a 2 ', 5'-linked oligoadenylate derivative is, for example, Cordicepin (3'-deoxy-adenylate 2 ', 5' -linked) and where an example of an appropriate linker is triethylene glycol and where the 5 'end of the 2', 5'-linked oligoadenylate must carry a residue of phosphate, diphosphate or triphosphate, where one or several oxygen atoms can be replaced, for example, by sulfur atoms, in which substitution by a phosphate or thiophosphate residue is preferred; and (h) introducing a 3 '-3' and / or 5 '-5' reversal of the 3 'and / or 5' end of the oligonucleotide, where this type of chemical modification is known to those skilled in the art, and it is described, for example, in M. Koga et al., J. Org. Chem. 56 (1991) 3757, EP 0 464 638 and EP 0 593 901.

The replacement of a sugar phosphate unit from the sugar phosphate backbone, on the other hand, which is, for example, a backbone unit of the APN or a PHONA backbone unit, is preferably the replacement of a nucleotide, for example, an APN unit or a PHONA unit, the lime already comprises natural nucleoside bases and / or modified nucleoside bases, for example one of the modified nucleoside bases of uracil, hypoxanthine, 5- (hydroxymethyl) uracil, N2-dimethylguanosine, pseudouracil, 5- (hydroxymethyl) uracil, 5-aminouracil, pseudouracil, dihydrouracil, 5-fluorouracil, 5-fluorocytosine, 5-chlorouracil, 5-chlorocytosine, 5-bromouracil, 5-bromocytosine, 2,4 -diamino- ^^, mr. -i-T-rtMÉ-f ^ M -fíaj --- > - ** ---- '* -! «^^ > ** ^ * > .. ^ purine, 8-azapurine, a substituted 7-deazapurine, preferably 7-deaza-7-substituted and / or 7-deaza-8-substituted purine, or other modifications of a natural nucleoside base (modified nucleoside bases) they are described, for example, in EP 0 710 667 A2 and EP 0 680 969 A2). The modifications of oligonucleotides described in EP 0 710 667 A2, EP 0 680 969 A2, EP 0 464 638, EP 0 593 901, WO 95/01363, EP 0 672 677 A2, EP 0 739 898 A2 and EP 0 552 766 they are incorporated here as a reference. In a special embodiment of the invention, one or more phosphodiester internucleoside bridges, within the oligonucleotide sequence, are modified, preferably one or more phosphodiester internucleoside bridges are replaced by phosphorothioate internucleoside bridges and / or internucleoside bridges. of aryl phosphonate (C6-C2), preferably by a-hydroxybenzyl phosphonate bridges, in which the benzyl group is preferably substituted, for example with nitro, methylc, halogen. In an all-phosphorothioate oligonucleotide, the all phosphodiester internucleoside bridges are modified by the phosphorothioate. Preferably, the invention relates to an oligonucleotide in which the internucleoside bonds not all of phosphodiester are uniformly modified with the phosphorothioate (phosphorothioate internucleoside bridges). Preferably, at least one internucleoside bridge has a different type of modification or is not modified. In particular, the invention relates to an oligonucleotide, which also comprises at least one other type of modification. In another special embodiment of the invention, one or more nucleosides (base of β-D-2'-deoxyribose and / or nucleoside) within the oligonucleotide sequence are modified, preferably β-D-2 '-deoxyribose is substituted by the 2 '-O- (C? -C6) -alkyl-ribose, preferably by the 2'-O-methylribose and / or the nucleoside base is replaced by the 8-aza-purine, the purine of 7-deaza-7 -substituted and / or the 7-deaza-8-substituted purine (purine, adenine, guanine). Preferably, the invention relates to an oligonucleotide in which not all nucleosides ee modify uniformly. Preferably, the invention relates to an oligonucleotide which further comprises at least one other type of modification. In another special embodiment of the invention, one or more sugar phosphate units, from the sugar phosphate backbone, are replaced by NPC backbone units, preferably by 2-aminoethylglycine units. Preferably, the sugar phosphate units, which are replaced, are connected together, at least to some extent. Preferably, the invention relates to an oligonucleotide in which not all units of sugar phosphate are replaced uniformly. In particular, the invention relates to chimeric oligonucleotides, for example, compounds of one or more parts of PNA, and one or more parts of DNA. For such chimeric oligonucleotides, for example, the following non-limiting examples of modification patterns are possible: DNA-APN, APN-DNA, DNA-APMN-DNA, APMN-DNA-NPC, DNA, APN-DNA-NPC, APN- DNA-APN-DNA. Comparable patterns will be possible for chimeric molecules composed of parts of chimeric molecules composed of parts of DNA and parts of PHONA, for example DNA-PHONA, PHONA-DNA, DNA-PHONA-DNA, PHONA-DNA-PHONA, DNA-PHONA- DNA-PHONA, PHONA-DNA-PHONA- DN. In addition, of course, chimeric molecules comprising three different parts, such as DNA parts, PHONA parts and APN parts, are possible. Preferably, the invention relates to an oligonucleotide which also comprises at least one other type of modification. In another special embodiment of the invention, the oligonucleotide is connected at its 3 'and / or 5' end to an alkyl residue (C 2 -C 8), preferably a C 6 alkyl residue., a triethylene glycol residue or a hexaethylene glycol residue - these residues are preferably connected to the oligonucleotide by means of a phosphate group. Preferably, the invention relates to an oligonucleotide in which both ends (3 'and 5') are modified (unmly). Preferably, the invention relates to an oligonucleotide which further comprises at least one other type of modification. In a preferred embodiment of the invention, only particular positions within an oligonucleotide sequence are modified (eg, lignonucleotide.; partially modified). These partially modified oligonucleotides are also named as oligonucleotides modified in minimal form in some documents. Within the sequence, a modification can be located in particular positions (in particular nucleotides, in particular nucleosides, in particular nucleoside bases, in particular internucleoside bridges). In a particular embodiment of the invention, a partially modified oligonucleotide is prepared by only replacing some of the phosphodiester bridges with modified internucleoside bridges, for example bridges of phosphorothioate and / or a-hydroxybenzyl phosphonate bridges. In particular, the invention comprises these oligonucleotides that are only modified to a certain extent. In particular, the invention relates to an oligonucleotide, in which the nucleotide units of the -to, A ^ 'teiA? ftrii terminal 1 or 5 at the 5' end and or 3 'end of the oligonucleotide, are protected by modifying the internucleoside bridges located at the 5' end. and / or 3 'of the corresponding nucleosides, preferably by the replacement of the phosphodiester internucleoside bridges by the phosphorothioate bridges and / or a-hydroxybenzyl phosphonate bridges. More preferably, 1 to 5 terminal nucleotide units at the 3 'end of the oligonucleotides are protected by modifying the bridges of internucleotides, located at the 5 'and / or 3' end of the corresponding nucleosides. Optionally, the units of 1 to 5 terminal nucleotides at the 5 'end of the oligonucleotides are further protected by modifying the internucleoside bridges located at the 5' and / or 3 'end. of the corresponding nucleosides. Optionally, the oligonucleotide may comprise additional modifications at other positions. Also, the invention relates to an oligonucleotide, in which at least one pyrimidine nucleoside Internal and / or a nucleoside bridge, located at the 5 'end and / or the 3' end of this pyrimidine nucleoside (a nucleoside with a pyrimidine base, such as cytosine, uracil, thymine) is modified, preferably by replacement of one or more internucleoside bridges , ^: .. ^ a ^ jt ^ se ^ á .. r. The phosphodiester, one or more phosphorothioate bridges and / or one or more phosphonate bridges of a-hydroxybenzyl. In a preferred embodiment of the invention, 1 to 5 terminal nucleoside units at the 5 'and / or 3' 5 end of the oligonucleotide are protected by modifying the internucleoside bridges located at the 5 'and / or 3' end of the corresponding nucleosides, and wherein it is modified in addition to at least one internal pyrimidine nucleoside and / or an internucleoside bridge at the 5 'end of this pyrimidine nucleoside and / or located at the 3' end of this pyrimidine nucleoside. The principle of oligonucleotides, partially modified, is described, for example, in A. Peyman, E. Uhl ann, Biol., Chem. Hoppe. Seyler, 377 (1966) 67-70 and in 15 EP 0 653 439. These documents are incorporated herein by reference. In this case, the 1-5 terminal nucleotide units at the 5 'end and / or the 3' end are protected, for example the phosphodiester internucleoside bridges located at the 3 'and / or 5' end of the 20 nucleosides corresponding ones are, for example, replaced by phosphorothioate internucleoside bridges. In addition, preferably, at least one position of an internal pyrimidine nucleoside (or nucleotide, respectively) is modified; preferably, one or more 3 'and / or 5' internucleoside bridges of a nucleoside of pyrimidine are modified / replaced, for example by one or more phosphorothioate internucleoside bridges. The oligonucleotides, partially modified, exhibit particularly advantageous properties; for example they exhibit a particularly high degree of nuclease stability, in association with minimal modification. They also have a propensity, significantly reduced, for non-anti-detection effects, which are often associated with the use of all phosphorothioate oligonucleotides (Stein and Krieg (1994) Antisense Res. Dev. 4, 67). Oligonucleotides, partially modified, also show a higher binding affinity than the all phosphorothioate compounds. The invention relates, in particular, to partial / minimally modified oligonucleotides. Examples of such oligonucleotides having one of the sequences: SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 29, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID NO. 52, SEQ ID NO. 55 and SEQ ID NO. 56 and in which the particular internucleoside bridges are modified are ON1, ON4, ON15, ON17, ON21, ON22, ON23, ON24, ON25, ON26, ON32, ON39, ON40, ON58; and ON100 to ON 113: ON 2 3'-C * C * AGC * C * C * GGAG * G-5 (example for SEQ ID NO.14), ON4 3"-C * G * G AGG C * T * T * TG * G-5 (example for SEQ ID No.16), ON 15 3'-G * A * TGGAG GTG G * T -5 '(example for SEQ ID NO: 27), ON 16 3"-G * G * A G G * T G G * T A C * G -5 '(example for SEQ ID NO: 23), ON100 3'-G * G * A G G * T * G GT A C * G -5 (example for SEQ ID NO: 28), ON101 3'-G * G * A G G * T G G * T A * C * G -5 (example for SEQ ID NO: 28), ON102 3'-G * G * A G GTG G * T A * C * G -5 (example for SEQ ID NO: 28), ON103 3'-G * G * A G G * T G G * A C * G -5 (example for SEQ ID NO: 2B), ON 17 3'-G * G * T * G G T * A C * G G T * T -5 '(example for SEQ ID NO: 29), ON 21 3'-C * A * C * C A G G G T * C * C * G -5 '(example for SEQ ID NO: 33), ON 22 3'-C * C * A G G G T * C * C G A * C -5 '(example for SEQ ID NO: 34), ON 23 3 * -A * G * G G T * C * C G A C * G * T -5 '(example for SEQ ID NO: 35), ON24 3'-G * G G * T * C * C G A C * G T * G -5 '(example for SEQ ID NO 36), ON104 3'-G * G * G T * C * C G A C * G T * G -5 '(example for SEQ ID NO 36), ON105 3'-G * G * G T * C * C G A C * G * T * G -5 '(example for SEQ ID NO 36).

ON106 3'-G * G * G T * C * C G A C * G * T G -5 '(example for SEQ ID NO 36), ON107 3'-G * G G * T * C * C G A C * G * T * G -5 '(example for SEQ ID NO 3ß), ON108 3'-G * G * G * T * C * C G A C * G T * G -5 '(example for SEQ ID NO 36), ON 109 3'-G * G * G * T * C * C G A C * G * T * G -5 '(example for SEQ ID NO 36), ON110 3'-G * G * G T * C * C G A C * GTG -5 (example for SEQ ID NO 36), ON111 3'-G * G * G T * C * C * G A C * G T * G -5 (example for SEQ ID NO 33), ON112 3'-G * G * G * T * C * C G A C * G T * G -5 '(example for SEQ ID NO 36), ON113 3'-G * G * GTC * C G A C * G * T * G -5 (example for SEQ ID NO 36), ON 25 3'-G * G * TC * C * GAC * GT * GG -5 '(example for SEQ ID NO: 37), ON 26 3'-C * C * GA * CG * TGGG * T * A - 5 '(example for SEQ ID NO: 38), ON 58 3 * -G * T * AGAAG * TT * C * G * G -5' (example for JEQ ID NO: 52), ON 39 3'-A * C * GC * C * CC * CGAC * G -5 '(example for SEQ ID NO: 55), ON 40 3'-C * C * C * CC * GA * CGAC * G -5' (example for SEQ ID NO: 5 (i), where "*" denotes the location of an internucleoside bridge modification; preferably "*" is an intermediate bridge. -nucleosides of phosphorothioate.

Another example for a special embodiment of the invention relates to a partially modified oligonucleotide, which has a modification of a nucleoside, for example a modification of a nucleoside base and / or a modification of a unit of a β-D-2 '-deoxyribose. Preferably, a ß-D-2 '. Deoxyribose is replaced by a 2' -O- (C? -C6) alkyl ribose, more preferred is replacement by a 2 '-O-methylribose (replacement of ß-D-2' - deoxyribonucleoside by the 2'-O-methylribonucleoside). Examples of such oligonucleotides having, for example, one of the sequences: SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 29, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID NO. 52, SEQ ID NO. 55 and SEQ ID NO. 56, 15 exhibit the following pattern of nucleoside modification, shown in oligonucleotides ONU4 through ON138 (only modification "N", not modification of "*" internucleoside). According to the invention, the oligonucleotide 20 can have, in addition to one type of modification, also other types of modification. Therefore, in another embodiment of the invention, the oligonucleotides comprise modified internucleoside bridges, at particular positions and in addition the modification of a nucleoside at particular positions, ^^^^^ i ^ j ^ ¡¡á¡j | ¡^ preferably the replacement of ß-D-2 '-deoxyribose. In a preferred embodiment of the invention, the modification of the internucleoside is the replacement of a phosphodiester bridge by a phosphorothioate bridge and the modification of the β-D-2'-deoxyribose is the replacement by the 2'-O-methylribose; in this case, the oligonucleotide is a chimeric oligonucleotide, which is composed of modified and unmodified parts of DNA and RNA - which comprise the 2"-O-methyl-ribonucleosides and the β-D-2 '-deoxyribonucleosides and phosphodiester and phosphorothioate internucleoside bridges Examples of such oligonucleotides, having the sequence: SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID NO 33, SEQ ID No. 34, SQ ID No. 35, SEQ ID No. 36, SEQ ID No. 37, SEQ ID No. 38, SEQ ID No. 52, SEQ ID No. 55 and SEQ ID No. 56 and modifications in particular internucleoside bridges and also in particular nucleoside positions, are ON114 to ON138 (examples of modification patterns): ON114 3'-C «C * AGC * C * C * GGAG * G-5 (example for SEQ ID NO.14), ON115 3'-C« G »GAGG CTTT G * G- * 5 (example for SEQ ID No. 16), ON116 3'-G * AT GGAG GT * G GT-'5 (example for SEQ ID No. 27), ON117 3'-G * G »AGGG GT AC * G-'5 (example for SEQ ID No. 28), ON118 3'-G * GTG GT »AC * GG TT-'5 (example for SEQ ID No. 29), ON119 3'-C * A * C * CAGGGT * C * C * G -'5 (example for SEQ ID No. 33), ON120 3'-C * C * AGGGT * C * CGA * C-'5 (example for SEQ ID No. 34), ON121 3'-A * G * GGT * C * CGAC * GT-'5 (example for SEQ ID No. 35), ON122 3'-G * G GT * C * CGAC * GT * G-'5 (example for SEQ ID NO 36), ON123 3 '-G * GT C * C * GAC * GT * G G-'5 (example for SEQ ID No. 37), ON124 3'-C * C * GA * C GT GG GT * A-'5 (example for SEQ ID No. 38), ON125 3'-C * C * C * CC * GA * CGAC * G-'5 (example for • SEQ ID No. 56), ON126 3'-G * G »GT * C * CGAC * GT * G-'5 (example for SEQ ID NO 36), ON127 3'-G * G * GT * C * CGAC * GT * G-'5 (example for SEQ ID NO 36), ON128 3 '-G * G * GT * C * CGAC * GT ^ G-'5 (example for SEQ ID NO 36), ON 130 3'-G ^ * G T * C * C G A C * G ÜG-'5 (example for SEQ ID NO. 36), ON131 3'-G * G «G T * C G A C * G T * G-'5 (example for SEQ ID NO 36), ON132 3'-G * G * AGG * TGG * TAC * G-'5 (example for SEQ ID NO.28), ON133 3'-G * G «AG GT G GT AC * G-'5 (example for SEQ ID NO.28), ON134 3'-G * G * AG GT G GT AC * G-'5 (example for SEQ ID NO.28), ON135 3'-G * G * AG GT G GT AC * G- '5 (example for SEQ ID NO.28), ON136 3'-G * G * AG GT G GT AC ^ G-'5 (example for- SEQ ID NO.28), ON137 3'-G * G * AG GT G GT AC * G-'5.e. Example for- SEQ ID NO. 28), ON138 3'-G * G * A G GT G GT A C * G-'5. mplo para- SEQ ID NO. 28), wherein "*" shows the position of a modification of an internucleoside bridge and where the "N" underlined is a modified nucleoside (eg, modification of the nucleoside base and / or modification of the β-D-2 '-deoxyribose). Preferably "*" is a phosphorothioate bridge and "N ^ 1 indicates the position of 2" -0- (C? -C6) alkylribonucleoside, preferably a 2'-O-methylribonucleoside. fee ULjth¿Í > < , WÍ, W - *, i ^ ¡• fZfig, if-? Iffrtj¡¡i Additional examples are the oligonucleotides in which each nucleotide is replaced by 2'-0-alkyl ribonucleosides (compounds totally of the 2 '-0 - alkylribonucleosides; 2 '-0- to the quil-RNA). Such oligonucleotides can be further stabilized against nucleases by the partial replacement of the phosphodiester internucleoside bridges by phosphorothioate bridges: ON139 3'-C * C * AGC * C * C * GGAG * G-5 '(examples for SEQ ID NO.14), ON140 3'-C * G * GAGG CTTT G * G-5' (example for SEQ ID NO.16), ON141 3'-G * AT GGAG GT * G GT-5 '(example for SEQ ID NO.27), ON1 2 3'-G »G * AG? 3T G GT AC * G-5' (example for SEQ ID NO.28), ON143 3'-G * GT * QG T * AC * GG TT-5 '(example for SEQ ID NO.29), ON1 4 3'-C * A »C» CAGGGT * C * C * G-5 '(example for SEQ ID No. 33), ON145 3'-C * C * AGGGT * C * CGA * C-5' (example for SEQ ID No. 34), ON146 3'-A * G »GGT» C * CGAC * GT-5 '(example for SEQ ID NO.35), ON147 3'-G * G GT * C * CGAC * GT * G-5' (example for SEQ ID NO. ), ON148 3'-G * GT C * C * GA C'G T * G G-5 '(example for SEQ ID NO 37), ON149 3'-C * C * GA * C GT GG GT * A -5 '(example for SEQ ID No. 38), ON150 3'-A * C * GC * C * CC * CGAC * G-5' (example for SEQ ID No. 55), ON151 3'-C * CX * C j * GA * CGAC * G-5 '(example for- SEQ ID No. 56), ON152 3'-GT * AGAA GT T »C * G * G-5' (example for SEQ ID NO.52) , where "*" shows the position of an internucleoside bridge modification and where the underlined "N" is a modified nucleoside (e.g., modification of the nucleoside base and / or modification of the β-D- 2'-deoxyribose). Preferably "*" is a phosphorothioate bridge and "N" indicates the position of a 2 '-O-alkylribonucleoside, ngmin - * & amp; < R > E3i ^^ g ^ j | ^^^ gg | g ^ g preferably a 2'-O-methylribonucleoside (in this case T is 2'-O-methyluridine). A more preferred embodiment of the invention provides an oligonucleotide which has one or more alkyl residues (C? 2-C? 8), preferably a C? 6 alkyl residue at its 3 'and / or 5' end. An alkyl residue (C 2 -C 8) can, for example, be attached as a phosphodiester, as described in patent EP 0 552 766 A2 (EP 0 552 766 A2 is incorporated herein by reference) or as a 3'-phosphodiester of 0-CH2-CH (0H) -0-alkyl (C? 2-C?). Preferred is an oligonucleotide having a C? 8 alkyl residue attached at its 3 'and / or 5' end. Examples of such oligonucleotides are ON153 to ON164 (having one of the sequences SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 33 , SEQ ID No. 34, SEQ ID No. 35, SEQ ID No. 36, SEQ ID No. 37, SEQ ID No. 38, SEQ ID No. 52, SEQ ID No. 55 and SEQ ID No. 56 and modifications in particular internucleoside bridges, such as, for example, ON1, ON4, 0N15, ON16, ON17, ON21, ON22, ON23, OPN24, ON25, ON26, ON22, ON39, ON40 and ON58 and in addition a bound C16 alkyl residue or at its 5 'end or at its 3' end) (such oligonucleotides may also have another sequence and modification pattern): ON153 3'-C * C * AGC * C * C * GGAG * G-C16-5 ', ON154 3'-C * G * GAGG CTTT G * G-C16-5', ON155 3'-G * AT GGAG GT * G GT-C16-5 ', ON156 3'-G * G * AG GT G GT AC * G-C16-5 \ ON157 3'-G * GT * GGT * AC * GG TT-C16-5', ON158 3'-C * A * C * CAGGGT * C * C * G-C16-5 ', ON159 3'-C * C * AGGGT * C * CGA * C-C16-5', ON160 3'-A * G * GGT * C * CGAC * GT-C16-5 \ ON161 3'-G * G GT * C * CGAC * GT * G-C16-5 \ ON162 3'-G * GT C * C * GAC * GT * G G-C16-5 ', ON163 3'-C * C * GA * C GT GG GT * A-C16-5', ON164 3'-C * C * C * CC * GA * CGAC * G-C16- 5*, wherein "*" shows a position of the modification of the internucleoside bridge, preferably the location of a phosphorothioate internucleoside bridge and where "-C16" indicates the position of a modification at the 5 'end by hexadecyl phosphate. The invention also relates to an oligonucleotide in which the 3 'and / or 5' end is connected to a residue of oligoethylene glycol, preferably a tri-ethylene glycol or a hexaethylene glycol, more preferably by means of a phosphodiester (tri- or hexa- ethylene glycol-phosphatc-ester). Of course, such oligonucleotide can also comprise additional modifications. Non-limiting examples for such oligonucleotides having the sequence SEQ ID NO 36 are ON165, ON166 and ON167.

ON165 3'-teg-G * G * GT * C * C GA C * GT * G -5", ON166 3'-teg-G» G * G TC'C GAC * GT * G -5 '. ON167 3 '-teg-G * G * GT * C * CGAC * GT * G -5', wherein: "teg" is a residue of oligoethylene glycol linked as a phosphate ester to the oligonucleotide, preferably "teg" is a triethylene glycol or hexaethylene glycol phosphate ester, "*" shows the position of the modification of the internucleoside bridge and in that a " N "underlined is a modified nucleoside (e.g., modification of the nucleoside base and / or modification of β-D-2 '-deoxytribose). Preferably, "*" is a phosphorothioate bridge and "N" indicates the position of 2'-O-alkylribonucleoside, preferably a 2'-O-methylribonucleoside (in this case "T" is 2'-O-methyluridine). In another specific embodiment of the invention, the oligonucleotide is connected by a linker to a 2 '. 5'-linked oligoadenylate-5'- (thio) phosphate. The linker can, for example, be an oligo-ethylene glycol-phosphate, preferably the residue of triethylene glycol-phosphate, tetra-ethylene glycol-phosphate or hexa-ethylene glycol-phosphate. The 2 ', 5'-linked oligoadenylate is preferably attached via its 2' end as a tetra- or as a penta-adenylate, whose 5'-hydroxy function is substituted by a phosphate or thiophosphate residue. The 2 ', 5' -oligoadenylate is known to induce RNase L to unfold the target mRNA (Torrence et al., Proc. Nati, Acad. Sci. U.S.A. (1930) 90, 1300). The 2 ', 5' -oligoadenylate serves in order to activate the ribonuclease L (RNase L) which then degrades the mRNA of VEGF, instead of a 2'.'5'-linked adenylate, for example a 3'-deoxy adenylate 2 ', 5' -linked, derived from the nucleic acid analogue cordycepin, can be introduced. In this case, the part of the oligonucleotide, which is complementary to the target nucleic acid, is preferably modified at particular positions by the 2'-0- (C? -C6) alkylribonucleoside (preferably the 2'-0-methylribonucleoside) or by the APN. An example of such oligonucleoside, having the sequence SEQ ID NO. 36 is ON168 (Such oligonucleotide can also have any other sequence of an oligonucleotide according to the invention): ON168 5'-p * - (2'5'-rA * rA * rA * rA) * (teg) G * TG * CAGC * C * T * GG * G-3 'where "teg" is a residue of oligoethylene glycol, preferably a triethylene glycol residue. "N" is a β-D-2 '-deoxyribonucleoside substituted by a 2'-O-alkyl residue, preferably by a 2'-0-CH 3 ("T" is 2'-0-methyluridine). "rA" is a ribo-A; Co = 3'-deoxy-A (Cordicepin) "p" is a 5'-thiophosphate, 11 * "is a modified internucleoside bridge, preferably a phosphorothioate internucleoside bridge Another preferred embodiment of the invention involves the replacement of a or more natural nucleoside bases by non-natural or modified nucleoside bases, respectively, preferably by 8-aza-purines and / or 7-deaza-7-substituted purines and / or 7-deaza-8-substituted purine, for example, as described in EP 0 171 066 and in EP 0 680 969. Examples of such oligonucleotides are ON 169 and ON 170 (both have the sequence of SEQ ID No. 36 and in addition to the modification of the nucleoside base, other types of modifications).

ON169 3'-G * G * GT * C * C GA C * gT * G-5 ', and ON170 3'-teg-G * G * GT * C * C CG C * GT * G-5', in that "g" is an 8-aza-deoxyguanosine, "J ^" is an 8-aza-deoxyadenosine "teg" is an oligoethylene glycol phosphate ester, preferably a triethylene glycol phosphate ester, • y ^^ É ^^^ "N" is a 2'-O-alkylribonucleoside, preferably a 2'-O-methylribonucleoside, in which "T" is a 2'-O-alkyluridine, preferably a 2'-O- methyluridine. In another preferred embodiment of the invention, the oligonucleotide can exhibit 3 '3' and / or 5 '5' inversions at the 3 'and / or 5' end, for example as described in EP 0 464 638 and EP 0 593 901. An example of such oligonucleotides is 0N171, having the sequence SEQ ID NO.36 and in addition to the 3 '3 inversion at the 3' end also another type of modification: ON171 3'-G (3'3 ') G * GT * C * C GAC * GT * G-5 where "(3'3) is a 3'3-phosphodiester bond and 15" * "is a bridge of modified internucleoside, preferably a phosphorothioate internucleoside bridge Another preferred embodiment of the invention relates to the replacement of one or more phosphodiester bridges 20 by a-hydroxybenzyl phosphonate bridges, as described in WO 95/01363. of such oligonucleotide> is ON172, having the sequence of SEQ ID No. 36 and in addition to the replacement of a phosphodiester bridge by an internucleoside bridge of a-hydroxybenzyl phosphonate, the ^^^ | j ^ A J *****. *. ** , replacement of phosphodiester bridges by phosphorothioate internucleoside bridges: ON172 3'-G (hbp) G * GT * C * C GA C * GT * G-5 'where "hbp" is a bridge of a-hydroxybenzyl phosphonate, preferably an a-hydroxy (o-nitrophenyl) bridge ) methylphosphonate and "*" is a phosphorothioate bridge. In another preferred embodiment of the invention, the oligonucleotide comprises a modification of the sugar phosphate backbone, preferably by APN units. Examples of such APN-DNA chimeras, having the sequences: SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 29, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID NO. 52, SEQ ID NO. 55 and SEQ ID NO. 56 may have the following patterns of modifications (standard: APN-DNA) (for the synthesis and properties of the APN-DNA chimeras, see EP 0 672 677): ccagcccGGAG G-5 '(example for SEQ ID NO.14), cggaggcTTTG G-5' (example for SEQ ID NO.16), gatggaGGTGG T-5 '(example for SEQ ID NO.27), ggaggtGGTAC G-5' (example for SEQ ID NO.28), ggtggtaCGGT T-5 '(example for SEQ ID NO.29), caccaggGTCC G-5' (example for SEQ ID No. 33), ccagggtCCGA C-5 * (example for SEQ ID NO.34), agggtcc GACG T-5 '(example for SEQ ID NO.35), gggtccGACGT G-5' (example for- SEQ ID NO.36), ggtccgaCGTG G-5 '(example for- SEQ ID NO. 37), ccgacgtGGGT A-5 '(example for SEQ ID NO.38), cccccgaCGAC G-5' (example for- SEQ ID NO.56), in which: the lowercase letters indicate units of the APN, the underlined letters indicate units of hydroxy-ethyl-5-glycine-APN, the uppercase letters indicate the DNA. Likewise, other patterns of modifications are possible, for example: DNA-APN-DNA, APN-DNA. Comparable patterns of modification are also possible for PHONA / DNA chimaeras. These patterns of modifications can be combined with any other type of modification and, of course, similar patterns of modification are also possible for other oligonucleotides, according to the invention. Examples of oligonucleotides, which are derived from oligonucleotides ON173 through ON184, but which also have the replacement of sugar phosphate backbone units ^^ j ^^^^ g ^ s ^^^ jg ^^^^ by skeletal units of the APN, modifications of phosphodiester internucleosides from a particular position within the DNA part of the oligonucleotides are: ON185 (3 ') - c c a g c c c G G * A G * G-5' (example for SEQ ID NO.14), ON186 (3 ') - c g g a g g c TTT G * G-5' (example for- SEQ ID No. 16), ON187 (3 ') - g a t g g a G GT * G GT-5' (example for- SEQ ID No. 27), ON188 (3 ') - g g g g t G GT A C * G-5' (example for SEQ ID NO.28), ON189 (3 ') - g g t g g t a C * G G TT-5' (example for SEQ ID No. 29), ON190 (3 ') - c a c c a g g G T * C * C * G-5' (example for- SEQ ID No. 33), ON191 (3 ') - c c a g g g t C * C * G A * C-5' (example for- SEQ ID NO 34), O 192 (3 ') - a g g g t c s G A C * GT-5' (example for SEQ ID NO 35), ON193 (3 ') - g g g t c c G A C * G T * G-5' (example para- SEQ ID NO 36), ON194 (3 g g t c c g a C * G T * G G-51 (example para- SEQ ID NO 37), ON195 (3 ') - c c g a c g t G G GT * A-5' (example for SEQ ID No. 38), ON196 (3 ') - c c c c g g C'G A C * G-5' (example for- SEQ | D N0 56j in which: the lower case letters indicate units of the APN, the underlined letters indicate units of hydroxy-ethyl-glycine-APN, the capital letters indicate the DNA, "*" is a modified internucleoside bridge, preferably a phosphorothioate bridge. The above specific oligonucleotides - particular sequences, particular types of modifications and particular positions (specific "modification pattern") are only examples of the different embodiments of the invention. The invention is not limited to these particular oligonucleotides. Also other -j * a áÁak, combinations of sequences and patterns of modifications are possible. An oligonucleotide, according to the invention, specifically inhibits the expression of the target protein 5 (which is VEGF) or the target sequence (a nucleic acid encoding VEGF, preferably the mRNA of VEGF) respectively. Preferably, an oligonucleotide, according to the invention, specifically inhibits the expression of VEGF. This results in a reduction in the VEGF protein level compared to the untreated expression. The specificity can, for example, be demonstrated by determining the effect of an oligonucleotide, according to the invention, on the expression of VEGF, as compared to the effect of the same oligonucleotide on the expression of beta-actin, on the mRNA and / or the level of protein: in the treatment with an oligonucleotide, according to the invention, only the mRNA of the VEGF and / or the protein of the VEGF is reduced, while, for example, the mRNA of the beta-actin ( a local maintenance protein) and / or the level of beta-actin protein, remained unchanged. In particular, the effect of an oligonucleotide can be demonstrated by determining the mRNA of the VEGF and / or the amount of the VEGF protein (for example in compassion with a parallel experiment without the oligonucleotide). For example, the inhibitory effect of the oligonucleotides can Jj ^ &jfe be determined in vi tro by treating cell cultures with the oligonucleotide. Then, for example, the level of the mRNA can be determined in preparations of the cell lysate, for example as described in Example 4. The level of VEGF protein (for example the absolute amount of the VEGF protein in grams or, for example, compared to an untreated cell in percent) can be determined from the supernatant (for example the culture medium) (the amount of the secreted VEGF) and / or the membrane preparations (the amount of the binding VEGF). membrane) and / or cell lysates. The amount of the secreted VEGF protein can, for example, be determined by the ELISA assay, for example, as described in Example 3. In a particular embodiment of the invention, an oligonucleotide can inhibit the expression of VEGF mRNA and / or reducing the level of VEGF protein, respectively, for example in a cell culture with an IC 50 of about 1 μM or less, for example 500 nM, 200 nM, 100 nM or less. Also, the inhibition is specific for an oligonucleotide, according to the invention, since only an oligonucleotide which has a particular sequence, reduces the VEGF protein and / or the mRNA level of VEGF. This level is not significantly reduced when an oligonucleotide with an inequality or a disordered sequence is used. Such oligonucleotides are used as a control, such as the oligonucleotides ON200, ON 201, ON 203 and ON205, the ON200 and ON201 have two and four inequalities respectively, with respect to the sequence of ON16 (SEQ ID NO.; but all three oligonucleotides have the same phosphorodithioate modification pattern ("*" positions) ON203 and ON204 have two and four inequalities respectively, with respect to the ON24 sequence (SEQ ID NO. 36), but again all all three oligonucleotides have the same phosphorothioate modification pattern ("*" positions). These four nucleotides are used, for example, in comparative experiments, in 0N16 and ON24, respectively. The control oligonucleotides do not exhibit the expression of VEGF mRNA in the cell culture at a concentration of 1 μ-. and less (table 3). 0N16 3'-G * G * A GG * T GG * TA C * G-5 antisense oligonucleotide 20 ON200 3'-G * G * A GT * G GG * TA C * G-5 2 inequalities ON201 3'-G * F * C GT * GG * TAA * G-5 4 inequalities ON24 3'-G * GG * TC * C GAC * GT * G-5 'antisense oligonucleotide ON203 3'G * GG * T * C * C AG C * GT * G-5 '2 inequalities and 25 ON204 3'-G * GG * C * C * C AG T * GT * G-5 * 4 inequalities in which: the position of the "inequalities" - with respect to 0N16 for ON200 and ON201 and with respect to ON24 for ON203 and ON204, are underlined, ON200 has the sequence SEQ ID NO. 89: 3 '-GGAGTGGGTACG-5' ON201 has the sequence SEQ ID NO. 90: 3 '-GGCGTGGGTAC-5' ON203 has the sequence SEQ ID NO. 91: 3 '-GGGTCCAGCGTG-5', ON204 has the sequence SEQ ID NO. 92: 3 '-GGGCCCAGTGTG-5'.

An oligonucleotide, according to the invention, efficiently inhibits the synthesis of the VEGF protein in L? cell culture, in relation to the control oligonucleotides. Figure 2 shows the inhibition of VEGF protein secretion by U87 cells, treated with one of 52 different 12 mer antidetection oligonucleotides, at a concentration of 3 μM for each oligonucleotide. The corresponding antidetection oligonucleotide sequences are summarized in Table 2, which also gives the IC5o values of some oligonucleotides. An oligonucleotide, according to the invention, inhibits the expression of the VEGF protein by about 55%, preferably about 65% or more, more preferably about 75% or more, relative to the control cells, for example the amount of secreted VEGF is reduced by about 55%, 65%, 75% or more, When the cell is treated with an oligonucleotide, according to the invention, at a concentration of 3 μM, preferably still at a lower concentration, such as 1 μM or less, preferably 0.5 μM or less (see Figure 2). ). Preferably, an oligonucleotide, according to the invention, can efficiently inhibit the expression of VEGF (isoforms) in a human cell and / or has the ability to inhibit tumor growth in vertebrates. Preferably, an oligonucleotide, according to the invention, reduces the level of the VEGF mRNA and / or protein in tumors of the treated individuals, relative to the untreated individuals. Preferably, an oligonucleotide, according to the invention, reduces the volume of the tumor in a vertebrate, for example a mouse, compared to an untreated mouse or in relation to the tumor volume of the same animal, determined before treatment. The invention also relates to a method for the preparation of an oligonucleotide, according to the invention. A method for the preparation comprises the chemical synthesis of the oligonucleotide. Preferably, the chemical synthesis is carried out by a known standard method, which is used in the synthesis of the oligonucleotides, for example the phosphoramidite method, according to Caruthers (1983) Tetrahedron Letters 24, 245, the H-phosphonate method (Todd et al (1957) J. Chem. Soc. 3291 or the phosphotriester method (Sonveaux (1986) Bioorg, Chem. 24, 274; Gait, MJ "Oligonucleotide Synthesis: A practical Approach", IRL Press, Oxford, 1984 ) or improved or varied methods, derived from these standard methods.An oligonucleotide, according to the invention, can, for example, be prepared as described in example 1. Preferably, an oligonucleotide, according to the invention, is synthesized on a solid support, by suitably condensing protected monomers (eg, nucleosides) in order to form the internucleoside bridges between these monomers The invention relates, for example, to a method for preparing an oligonucleotide. or one of its derivatives, wherein a nucleotide unit with a 3 'or 2' terminal of a phosphorus group (V), and a free 5 '-hydroxyl or mercapto group, is reacted with one more nucleotide unit with a phosphorus (II) or phosphorus (V) grouping in the 3 'position, or their activated derivatives, and in which the optional protective groups are used, which can be temporarily introduced into the oligonucleotide, in order to protect other functions and that are removed after the synthesis, and the oligonucleotide which has been unfolded from the solid support, can, optionally, be converted into a salt urtttyti jgj ^ gg physiologically tolerated. In order to synthesize a modified oligonucleotide, standard methods vary to a certain extent. Such variations are known to those skilled in the art and are described, for example, in Agrawal S. "Protocols for oligonucleotides and analogs" '(1993, Human Press Inc. Totowa, New Jersey) .The preparation of modified oligonucleotides it is also described in patents EP 0 710 667, EP 0 680 969, EP 0 464 638, EP 0 593 901, WO 95/01363, EP 0 672 677, EP 0 739 898 and EP 0 552 766. The methods of preparing modified oligonucleotides, described in the above documents, are incorporated herein by reference The invention further relates to a method for inhibiting the expression of VEGF and / or modulating the expression of a nucleic acid encoding VEGF, in which an oligonucleotide, of In accordance with the invention, it is contacted with a nucleic acid encoding VEGF (for example mRNA, cDNA) and the oligonucleotide is hybridized to (bound to) this nucleic acid encoding VEGF. it refers to a method in which The oligonucleotide is contacted with a nucleic acid encoding VEGF (for example mRNA, cDNA), for example, by introducing the oligonucleotide into a cell by known methods, for example by incubating the cells with said oligonucleotide or a formulation - Such a formulation may comprise admission enhancers, such as lipofectin lipofectamine, cellular fectin or polycations (eg, polylysine). For example, an oligonucleotide, which has been previously incubated with the cellular fectin, for example, for 30 minutes, at room temperature, and then incubated for about 5 hours or less, with a cell in order to introduce the oligonucleotide within the cell. The invention further relates to the use of the oligonucleotide, preferably as an antisense oligonucleotide (attached to the oligonucleotide to a mRNA encoding VEGF) or as a ribozyme (which binds to an RNA encoding a VEGF and cleavage of this mRNA) . IN In another special embodiment of the invention, the oligonucleotide can be used to induce the cleavage of H RNAse from the mRNA encoding VEGF, thus resulting in a reduction of VEGF expression. The invention also relates to the use of the oligonucleotide to modulate and, in whole or in part, inhibit the expression of VEGF (eg, VEGFi2 ?, VEGF165 / VEGFisg, VEGF20e and or its splice variants and / or its mutants, eg inhibit totally or partially, the translation of the mRNA that encodes the VEGF.

A, ^^, »^^^^^ --- ^; ^ r TirtÉttiii ?? The invention relates to the use of an oligonucleotide to inhibit, prevent or modulate angiogenesis, neovascularization, growth and metastasis of tumors, in particular in vertebrates. The invention, in general, refers to the use of an oligonucleotide, according to the invention, for the treatment or prevention of diseases, in which VEGF is overexpressed. Such diseases in which VEGF is overexpressed are, for example, cancer, age-related macular degeneration, diabetic retinopathy, psoriasis, rheumatoid arthritis and other inflammatory diseases. The invention also relates to the use of oligonucleotides as pharmaceuticals and to the use of these oligonucleotides in the preparation of pharmaceutical compositions. In particular, the oligonucleotide can be used in a pharmaceutical composition, which is used to prevent and / or treat diseases that are associated with expression or overexpression (increased expression) of VEGF and to treat diseases in which VEGF or its 20 overexpression is the causative factor or is involved in it. The invention further relates to a pharmaceutical composition which comprises an oligonucleotide and / or its physiologically tolerated salts, in addition to pharmaceutically suitable excipients or auxiliaries.

The invention also relates to a pharmaceutical composition, which comprises at least one oligonucleotide, according to the invention, which can be used for the treatment of diseases, which is associated with abnormal vascular permeability, cell proliferation, permeation cellular, angiogenesis, neovascularization, growth of tumor cells of neoplastic cells. The invention further relates to a method for preparing a pharmaceutical composition, which comprises mixing one or more oligonucleotides, according to the invention, with an excipient, physiologically acceptable and optional additional substances, for example, if appropriate, with additives and / or suitable auxiliaries. The invention relates, in particular, to the use of an oligonucleotide or a pharmaceutical composition prepared therefrom, for the treatment of cancer, for example by inhibiting tumor growth and metastasis of this tumor, and for the treatment of diabetic retinopathy, macular degeneration related to age, psoriasis, rheumatoid arthritis and other inflammatory diseases. For example, the oligonucleotide or its pharmaceutical composition prepared therefrom, can be used for the treatment of solid tumors, such as breast cancer, lung cancer, cancer of the head and neck, brain cancer, abdominal cancer, cancer of the colon, colorectal cancer, cancer of the esophagus, gastrointestinal cancer, glioma, liver cancer, tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor, multiple myeloma and for treatment of skin cancer, such as melanoma. for the treatment of lymphomas and blood cancer. The invention further relates to the use of an oligonucleotide, according to the invention, or to a pharmaceutical composition prepared therefrom, to inhibit the expression of VEGF and / or to inhibit the accumulation of ascites fluid and pleural effusion in different types of cancer. , for example breast cancer, lung cancer, head cancer, neck cancer, brain cancer, abdominal cancer, colon cancer, colorectal cancer, esophageal cancer, gastrointestinal cancer, glioma, liver cancer, cancer of the tongue, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, Retinoblastoma, Silm's tumor, multiple myeloma, skin cancer, melanoma, lymphomas and blood cancer. Due to the inhibitory effect on the expression of VEGF and / or the ascites fluid and pleural effusion, an oligonucleotide, according to the invention or a pharmaceutical composition prepared therefrom, can increase the quality of life. In a preferred embodiment of the invention, the oligonucleotide or its pharmaceutical composition can inhibit the accumulation of ascites fluids in ovarian cancer. The invention also relates to the use of an oligonucleotide or its pharmaceutical composition, for example to treat cancer or to prevent tumor metastasis or to treat macular degeneration related to age, rheumatoid arthritis, psoriasis and diabetic retinopathy, in combination with other pharmaceuticals 10 and / or methods of therapeutics, for example with known pharmaceutical and / or therapeutic methods, such as, for example, those currently used to treat cancer and / or to prevent tumor metastasis. Preference is given to a combination with radiation therapy and chemotherapeutic agents, such as cis-platin, cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or tamoxifen. The oligonucleotides and / or their physiologically tolerated salts can be administered to an animal, preferably a mammal, and, in particular, to a human, either as such or in a mixture with other oligonucleotides (or their physiologically tolerated salts) or in the form of a pharmaceutical composition that allows topical, percutaneous, parenteral or enteral use, and which comprises, as the active constituent, an effective dose of at least one oligonucleotide, in addition to customary, pharmaceutically non-objectionable excipients and excipients, Such a pharmaceutical composition typically comprises about 0.1 to 90% by weight of therapeutically active oligonucleotides. The dose can vary within wide limits and will be adjusted to the individual circumstances in each individual case. In order to treat psoriasis, preference is given to topical use. In the case of cancer, preference is given to infusions, oral or rectal administration, or nasal application in an aerosol, preferable in the case of lung cancer, while in the case of diabetic retinopathy preference is given to topical, intravitreal and oral administration. A pharmaceutical composition can be prepared from In a manner known per se (for example, see Remingtons Pharamaceutical Sciences, Mack Publ.CO., Easton, PA (1985)) with the use of inert pharmaceutically, inorganic and / or organic excipients. For example, lactose, corn starch, and / or its derivatives, talc, stearic acid and / or its salts, etc. may be used, for example, to prepare pills, tablets, coated tablets and hard gelatine capsules. Examples of excipients for soft gelatine capsules and / or suppositories are fats, waxes, semi-solid and liquid polyols, natural and / or hardened oils, etc. Examples of suitable excipients for »- * i? > ,,? i ?? r) ¡h-rB ?? i, ..i »; prepare the solutions and / or syrups, are water, sucrose, invert sugar, glucose, polyols, etc. Suitable excipients to prepare injectable solutions are water, alcohols, glycerol, polyols, vegetable oils, etc. Suitable excipients for microcapsules, implants and / or bars are the mixed polymers of glycolic acid and lactic acid. In addition, liposome formulations are, for example, described in N. Weiner, (Drug Develop Ind Pharm.15 (1989) 1523). "Liposome Dermatics" (Springer Verlag 1992) and Hayashi (Gene Therapy 3 (1996) 878). The pharmaceutical composition may also comprise a formulation, which improves the oral availability of the oligonucleotide, such as intestinal permeabilization enhancers, for example mannitol, urea, bile salts, such as CDCA (chenodeoxycholate) (2%). Dermal administration can also be effected, for example, using iono-foretic methods, and / c by means of electroporation. Also, the use can be made of lipofectins and other carrier systems, for example, those that are used in gene therapy. Systems that can be used to introduce the oligonucleotides in a highly efficient manner in eukaryotic cells or in the nucleus of eukaryotic cells are particularly suitable. A pharmaceutical composition may also comprise two or more different oligonucleotides and / or their physiologically tolerated salts and, likewise, in addition to at least one oligonucleotide, one or more therapeutically different active ingredients. In addition to the active ingredients and excipients, a pharmaceutical composition may also comprise additives, such as fillers, diluents, disintegrating agents, binders, lubricants, wetting agents, stabilizing agents, emulsifiers, preservatives, sweeteners, dyes, flavoring and flavoring agents, thickeners, diluting or regulating substances, and, likewise, solvents and / or solubilizing agents and / or agents to achieve a slow release effect and also salts for altering the osmotic pressure, coating agents and / or antioxidants.

Figure 1: Figure 1 (parts A through E) show the location of the tested VEGF antisense oligonucleotides tested (SEQ ID NO: 13 to SEQ ID NO: 72) with respect to the cDNA sequence of the VEGF clone (both cords ), for which the nucleotide sequence is given in the table. Likewise, the location of the core regions 1 to 6 and of the sequences SEQ ID NO. 1 to SEQ ID NO. 12 are shown (underlined parts of the sequence).

Figure 2: Summarizes the inhibitory effects of different oligonucleotides (each used at a concentration of 3 μM) on the secretion of the VEGF protein in a cell culture (secretion by human U87-MG 5 cells). Inhibitory effects where shown in relation to the control cells that were not treated with the oligonucleotides (amount of VEGF secreted from the oligonucleotide-treated cells to the amount of the VEGF secreted from the cells not treated with the oligonucleotides). Oligonucleotides: The results show that 0N2, 0N4, ON15, 0N16, 0N21, ON22, ON23, ON24, 0N25, ON26, ONS39 and ON40 show the best inhibitory effect in relation to the control cells. Abbreviations: 1 is ON 300, 2 is ON 2, 3 is ON 301, 4 is ON 4, 5 is ON 302, 6 is ON 303, 7 is ON 304, 8 is ON 305, 9 is ON 306, 10 is ON 307, 11 is ON 308, 12 is ON 309, 13 is ON 310, 14 is ON 311, 15 is ON 15, 16 is ON16, 17 is ON17, 18 is ON 312, 19 is ON 313, 20 is ON314, 21 is ON 33, 22 res ON22, 23 is ON 23, 24 is ON 24, 25 is ON25, 26 is ON26, 27 is ON 315, 28 is ON 316, 29 20 is ON 317, 30 is ON 318, 31 is ON 319, 32 is ON 320, 33 is ON 321, 34 is ON 322, 35 is ON 323, 36 is ON324, 37 is ON 325, 38 is ON 326, 39 is ON 39, 40 is ON 40, 41 is ON 327, 42 is ON 328, 43 is ON 329, 44 is ON 330, 45 is ON 331, 46 is ON 332, 47 is ON 333, 48 is ON 34, 49 is ON 335, 50 is ON 336, 51 is ON 337 and 60 is ON 345. jjeu & ttetiill **** »» ^ ** Figure 3: Inhibition of tumor growth by ON24. Uncompensated mice bearing the U87-MG xenografts were treated with the ON24 in different concentrations ("0" 1 mg / kg, "t" 4 mg / kg, "w" 12 mg / kg (mg of the oligonucleotide per 5 kg of body weight)). On day 27, the tumor volume was analyzed (mm3). For comparison, the tumor volume of the untreated control mouse was determined ("").

EXAMPLES Example 1: Synthesis of oligonucleotide Oligonucleotides (ON) were synthesized using the synthesizer of Applied Biosystems 394 DNA (Perkin Elmer Applied Biosystems, Inc., Foster City, E.U.A.) and the standard chemistry of phosphoramidite. After coupling, the phosphorothioate linkages were introduced by sulfurization, using the Beauage reagent, followed by finishing with acetic anhydride and N-methylimidazole. After unfolding from the solid support and the final deprotection by the treatment with concentrated ammonia, the ONs were purified for polyacrylamide gel electrophoresis. ONs modified with 2'-0-methyl were prepared by replacing the standard phosphoramidites in the corresponding cycle with the 2'-0-methyl ribonucleoside phosphoramidites. All the ONs were analyzed by the mass spectroscopy of electro-spraying of negative ions (Fisons Bio-Q) which, in C j & aii IurtÉH «al-all cases, confirmed the calculated mass. The C16-modified oligonucleotides were synthesized using hexadecyloxy (cyanoethoxy) N, N-diisopropyl aminophosphate as the phosphotylating reagent in the last step of the synthesis of the oligonucleotides, instead of a standard amidite, or starting from a solid support derived correspondingly The triethylene glycol linker is commercially available from Geln Research Corporation. The 2'-adenosine phosphoramidite or cordycepin were obtained from Chem. Genes Corporation and Chemogen Corporation, respectively. The introduction of the 5'-phosphate or triphosphate residues was carried out as previously described (Uhlmann and Engels (1986) Tetrahedron Lett., 27, 1023). The APN / DNA chimeras were prepared as described in EP 0 672 677. The analysis of the oligonucleotides was done by: (a) Analytical gel electrophoresis in 20% acrylamide, 8M urea, 45 μM tris regulator - borate, pH 7.0 and / or (b) Analysis of HPLC chromatography: Waters GenPal column FAX, gradient CH3CN (400 ml), H20 (1.6), NaH2P04 (3.1 g), NaCl (11.7 g), pH 6.8 (0.1 M NaCl), then CH3 CN (400 mL), H20 (1.6), NaH, .P04 (3.1 g), NaCl (175.3 g), pH 6.8 (1.5 M, NaCl) and / or• * - • ** '"•' - (c) Capillary electrophoresis, using a Gel eCAP ™, Backmann capillary U100P Column 65 cm long, 100 mm internal diameter, window 15 cm from one end, regulator 140 uM Tris, 360 mM of borate, 7M of urea and / or (d) Negative ion electro-sputtering mass spectrometer, which, in all cases, confirmed the expected mass values.The methods for analyzing the oligonucleotides, according to a), b), c) and d), are known to those skilled in the art These methods are, for example, described in Schweitzer and Engel, in "Analysis of oligonucleotides" (in "Antisense - from technology to therapy ", a manual and laboratory text, Schlingensiepen et al., Eds. Biol., Science Vol. 6 (1997) pages 78-103).

The following oligonucleotides were prepared and tested: O O O O O O O O O O O O o o o o O o o O O O O O O O O O O O z z z z z z z z z z z z z z z z z z z z z z z z. z z. O O O O z z z z? ? ? ? ? ? ? ? ? N) r N-) t M t w? ? -TO -". - ^? ? u u u w? ? ? ? ? W M t w ^ o c ^ ^ ^ ^ F n -i! > . c- N) - »'-» -? »- M- * -j s) ü. O O O i. ) U? O t ---- p -j O oDo -J srt.- cun. - _ * -. O O O O o c-o (O 00 O) Ul ü) M o o - »o ¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡§ § * ¡¡¡¡¡¡¡¡¡! ¡¡1 | 1 s s Ifllliiii ¡ß.1 B 1 < - 1 »1 i» 1 B 1 B i B 1 ß.1 B 1 i) 1 ß 1 j ¡5'i ÍÜ- 1 sr 1 ñ 15 '1 S' 1 or. ' 1 E "1 d 'I 5' i 5 * i 5 io» 1 g- 1 gj- 1 »15- 15- s 5- S 5-? 5- i 55- Í? Ol (? WW Í? WW ( (/) M (? C? Ü) (fl 0. W «WO) O) ü) C? (? T) í0 MW tó W) C?? W? Mm rp mmmmmmmmmmmm rp rp rp mm rn mmmmm rn mmm D O D O D D O D D D O D O O D O O O D O O D D D O D O O D D O D D O or d s s s s s D s or s d p d o S o s s a s d s o o d d d d d s d d s z z z z z z z z z z z z z z z z z z z z z z z z z z z z z z z z z z z p p p p p p p p p cj p p p p p p p p p p p p p p p p p p p p p O O O O ^ ^ - ^ j- -u -N ^ o? ? ? ? ? ? ? o o r NJ M N-. M t N- M NJ Nj -. ---- - »_ .. _v _-. _-.

O O O O O O O O O O O O z z z z z z z z ozzzzzzzzzzzzzzzzzzzzzzz Oz Ozzz z zzz z z co co co co co co co co? co co co co o co co co co co S o o oo O) ül i O) Ul. { . ^ - 4- co t J- j- j- u u u u u u? ? ? ? M r ro (Jl? U M O O O O S O U L U- U K. -i o co 00 «^ 4 o (O K) N) I 0) cn -ti¬ C? «(O? To? Cn ww to w co ü) (o C? C? CO C? C? C? C? CO? C? Mmmmmmm rp rn mm rp m rn r r r r m r p mm mm DODOODOOOOODODOOOOOQO QOOO ddddsddoddadd dd dddddd dod zzzzzzzzz zzzz zz zzzzz zzzz i ppppppppppppppp pppppppppp Ül (? ül «(J.O) 0) (J) 0) fl > S S J O) 0. Ol Ol ul Ul Ul Ül ÜI ^ -t »*. ? t - »s) ui 4-? ? - 'f -'? (or co -? o (?? o -j s. cn o < o c-o OzOzOzOzOzOzOzOzOzOz OzO --zO O O O OzO O O O O O O O O O O O -iz - z - zz-- - z - z - z - z - ziz - z - 5 z z z z z z s? > s? - ts- s- »> . os &t < on csn) cn? with. What is it? Ui ü? - J- J- A 4- J-. 4 J-? N) J? (?) if l (J) OI J- U l J? (D ^ ^ W fO. Í? "^ cn j-- co M j, o to -fc- ON165 3'-teg-G! G ^ G T * C * C G A C * G T * G -5 ', ON166 3' - eg-G »G * -G T * C * C G A C * G T * G -5 '. ON167 3'-teq-G »G» GT * C * CGAC «GT * G -5 ', ON346 3'-C * C * A GC * C * C * GGAG * G-vitE -5', ON347 3 ' -G * AT GGAG GT * G GT-vitE -5 ', ON348 3'-G * G * AG GT G GT AC * Gv¡tE -5', ON349 3'-G * GT * GGT * AC * GG TT -vitE -5 ', ON350 3'-C * A * C * CAGGGT * C * C * G-vitE -5', ON351 3'-C * C * AGGGT * C * CGA * C-vitE -5 ', in which: "*" is an internucleoside bridge of phosphorothioate, a "N" underlined is a 2 '-O-methylribonucleoside (in this case II T "II is 2'-0-methyluridine), teg" is a triethylene glycol phosphate linker, C16"is a hexadecylphosphate, and vitE" is the glycerol phosphate of vitamin E.

Example 2: Treatment of cells with antidetection oligonucleotides The cells were placed in plates of 96 cavities at 20,000 cells / well, 150 μl of medium per well (the medium depends on the cell type). The next day, Cellfectin (Gibco-BRL) was diluted to 400 μg / ml in water (solution A). The oligonucleotides were diluted to 40X, the final desired concentration (solution B). Equal amounts 21 of solutions A and B were mixed, to give 1 desired volume of a 200 μg / ml solution. The Cellfectin and 20X oligonucleotide, and the mixture was left at room temperature for 30 minutes. After 30 minutes, 19 volumes of Optimem (Gibco-BRL) were added to give a final solution which is 20 μg / ml of Cellfectin and IX oligonucleotide (solution C): The medium was removed from the cells, the wells were washed 2X with Optimem, and 150 μl of the C solution was added to each well. The plates were then returned to the incubator. After 5 hours, the Cellfectin / oligonucleotide solution was removed and replaced with 150 μl of the regular growth medium. The VEGF protein and mRNA assays were performed, beginning 19 hours later.

Example 3; Inhibition of VEGF expression by antidetection oligonucleotides in cell culture (VEGF protein assay). Samples of the conditioned medium were taken from the desired cavities and assayed in the presence of human VEGF, using the ELISA kit of the human VEGF from R íc D Systems. The protocol the test is the one provided by the supplier with the equipment. The inhibition of VEGF expression in U87-MG cells by different 12-mer antisense oligonucleotides is shown in Table 2 and Figure 2. There are several antidetection oligonucleotides, modified as partial phosphorothioates, which inhibit the expression of VEGF at a concentration of 3 uM of oligonucleotides by about 80% (for example, ON2, ON4, ON15, ON16, ON17, ON24, ON40) while other oligonucleotides are virtually inactive under the same conditions (for example ON 315 and ON 316). The phosphorothioate pattern in the 12 mers may vary within the limits of the partially modified oligonucleotides, as outlined in the description. Thus, ON 24, ON 104, ON 105 and ON 106 show around the same inhibitory effect, although ON 104 proved to be somewhat more active than the other three oligonucleotides of the same sequence. Partial derivatization such as 2'-O-methyl-AR, for example as in ON 117, further increases the inhibitory activity compared to compound d DNA ON 16 of the same sequence.

Example 4: VEGF mRNA assay The medium was removed from the 96-well plates, described above, and the cell lysates were prepared from the remaining cells for quantification of the VEGF mRNA, by the Applied Biosystems 7700 Analyzer. the mRNA levels, the data were normalized to the amount of ß-actin levels, in the same samples. .jfeatsfca Example 5; Determination of the IC values (50) The values of the 50% Inhibitory Concentration, IC (50), were calculated based on a value of 100% for the amount of the VEGF protein or the mRNA in cells treated with Cellfectin , but not the oligonucleotide. For the ELISA assay, the amount of VEGF in the conditioned medium normalized to the number of cells in each sample. The number of cells was determined using the CYQuant assay (Molecular Probes, Inc.).

Example 6; In vivo studies In vivo experiments can be performed with female uncompensated mice 4-6 weeks of age, in which tumors have previously grown by subcutaneous implantation of cells (eg, 2,000,000 cells in 200 μl for U87-MG ). The oligonucleotides can be dissolved in a phosphate buffered saline solution and injected subcutaneously or intravenously (tail vein) in a volume of 100 μl of 2 x 106 U87-MG. For example, when the tumor cells were implanted subcutaneously (s.c.) on day 0, treatment of the drug can begin on days 1 to 4, administering the oligonucleotide daily by injection into the tail vein (i.v.).

Table 1: Nucleotide sequence of human VEGF (SEQ ID NO 93) CAGTGTGCTGGCGGCCCGGCGCGAGCCGGCCCGGCCCCGGTCGGGCCTCCGAAACC ATGAACTTTCTGCTGTCTTGGGTGCATTGGAGCCTCGCCTTGCTGCTCTACCTCCA CCATGCCAAGTGGTCCCAGGCTGCACCCATGGCAGAAGGAGGAGGGCAGAATCATC ACGAAGTGGTGAAGTTCATGGATGTCTATCAGCGCAGCTACTGCCATCCAATCGAG ACCCTGGTGGACATCTTCCAGGAGTACCCTGATGAGATCGAGTACATCTTCAAGCC ATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGACGAGGGCCTGGAGT GTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATTATGCGGATCAAACCTCAC C-AAGGCC-AGCACATAGGAGAGATGAGCTTCCTACAGCACAACAAATGTGAATGCAG ACCAAAGAAAGATAGAGCAAGACAAGAAAATC Table 2: Inhibitory effect of VEGF antidetection oligonucleotides on the secretion of VEGF protein ^^? Í¡¿ ^ itH- I Table 3: Inhibitory effect of oligonucleotides ON18 and ON 24, compared to oligonucleotides having 2 and 4 in-sequence inequalities, respectively, in sympathy with oligonucleotides ON 18 and ON 24, respectively, LIST OF SEQUENCES (1) GENERAL INFORMATION (i) APPLICANT: (A) NAME: Hoechst Marion Roussel Deutschland GMBH (B) STREET - (C) CITY: Frankfurt (D) STATUS: - (E) COUNTRY: Germany (F) POSTAL KEY (ZIP) ): 65926 (G) TELEPHONE: 069-305-7072 (H) TELEFAX: 069-35-7175 (I) TELEX: - (ii) TITLE OF THE INVENTION: SHORT OLIGONUCLEOTIDES FOR THE INHIBITION OF THE EXPRESSION OF THE VASCULAR ENDOTHELIAL GROWTH FACTOR (VEGF) (iii) NUMBER OF SEQUENCES: 93 (iv) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIUM: diskette (B) COMPUTER: IBM PC, compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Reléase # 1.0, Version # 1.30 (EPO) (2) INFORMATION FOR SEQ ID NO. 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 22 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: LINEAR • * £ - (ii) TYPE OF MOLECULE: DNA (genomic) (ix) CHARACTERISTICS: (A) NAME / KEY: exon (B) LOCATION: 1..22 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 1: CCCGGCCCCG GTCGGGCCTC CG 22 (2) INFORMATION FOR SEQ ID NO. 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: LINEAR (ii) TYPE OF MOLECULE: DNA (genomic) (ix) CHARACTERISTICS: (A) NAME / KEY: exon (B) LOCATION: 1..15 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 2: CGGGCCTCCG AAACC 15 (2) INFORMATION FOR SEQ ID NO. 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) FEATURE .At- A-S ¡fe ^ .Aaw-ie.

(A) NAME / KEY: exon (B) LOCATION: 1 ..21 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 3: GCTCTACCTC CACCATGCCA A 21 (2) INFORMATION FOR SEQ ID NO. 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..24 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 4: GTGGTCCCAG GCTGCACCCA TGC 24 (2) INFORMATION FOR SEQ ID NO. 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 16 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1. . 16 • jfXSstii (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 5: CATCTTCAAG CCATCC 16 (2) INFORMATION FOR SEQ ID NO. 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..15 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 6: TGCGGGGGCT GCTGC 15 (2) INFORMATION FOR SEQ ID NO. 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 22 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / DESC = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..22 (xi) SEQUENCE DESCRIPTION: SEQ ID NO . 7: CGGAGGCCCG ACCGGGGCCG GG 22 (2) INFORMATION FOR SEQ ID NO. 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / DESC = "synthetic" (iv) ANTI-DETECTION: YES (IX) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..15 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 8: GGTTTCGGAG GCCCG 15 (2) INFORMATION FOR SEQ ID NO. 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (ív) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..21 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 9: TTGGCATGGT GGAGGTAGAG C 21 (2) INFORMATION FOR SEQ ID NO. 10: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..24 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 10: GCCATGGGTG CAGCCTGGGC AACA 24 (2) INFORMATION FOR SEQ ID NO. 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 16 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..16 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 11 GGATGGCTTG AAGATG 16 (2) INFORMATION FOR SEQ ID NO. 12: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..15 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 12: GCAGCAGCCC CCGCA 15 (2) INFORMATION FOR SEQ ID NO. 13: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 13: AGGCCCGACC GG 12 (2) INFORMATION FOR SEQ ID NO. 14: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 14: GGAGGCCCGA CC 12 (2) INFORMATION FOR SEQ ID NO. 15: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 15: TTCGGAGGCC CG 12 (2) INFORMATION FOR SEQ ID NO. 16: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 16: GGTTTCGGAG GC 12 (2) INFORMATION FOR SEQ ID NO. 17:10 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 17: TCATGGTTTC GG 12 (2) INFORMATION FOR SEQ ID NO. 18: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 18: AAGTTCATGG TT 12 J ^^^^^ ftMMÉáw - ^ - í 11 (2) INFORMATION FOR SEQ ID NO. 19: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 19: GAAAGTTCAT GG 12 (2) INFORMATION FOR SEQ ID NO. 20: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 jxX &t * - ** 12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 20 AGCAGAAAGT TC 12 (2) INFORMATION FOR SEQ ID NO. 21: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 21: GACAGCAGAA AG 12 (2) INFORMATION FOR SEQ ID NO. 22: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (ív) ANTI-DETECTION: YES (ix) CHARACTERISTICS l ^^ ^ 13 (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (i) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 22 CCAAGACAGC AG 12 (2) INFORMATION FOR SEQ ID NO. 23: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 23: CACCCAAGAC AG 12 (2) INFORMATION FOR SEQ ID NO. 24: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" 14 (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 24 AATGCACCCA AG 12 (2) INFORMATION FOR SEQ ID NO. 25: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 25: AGGTAGAGCA CG 12 (2) INFORMATION FOR SEQ ID NO. 26: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear jg u l ^^ i 15 (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 26: TGGAGGTAGA GC 12 (2) INFORMATION FOR SEQ ID NO. 27: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 27: TGGTGGAGGT AG 12 (2) INFORMATION FOR SEQ ID NO. 28: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid 16 (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 28 GCATGGTGGA 12 (2) INFORMATION FOR SEQ ID NO. 29: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 29: TTGGCATGGT GG 12 (2) INFORMATION FOR SEQ ID NO. 30: 17 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 30: CACTTGGCAT GG 12 (2) INFORMATION FOR SEQ ID NO. 31: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc - "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 31: GACCACTTGG CA 12 && amp; -. ^^ r ^ a-ss 18 (2) INFORMATION FOR SEQ ID NO. 32: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 32 GGGACCACTT GG 12 (2) INFORMATION FOR SEQ ID NO. 33: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (IV) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 19 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 33 GCCTGGGACC AC 12 (2) INFORMATION FOR SEQ ID NO. 34: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 34: CAGCCTGGGA CC 12 (2) INFORMATION FOR SEQ ID NO. 35: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) FEATURE 20 (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 35: TGCAGCCTGG GA 12 (2) INFORMATION FOR SEQ ID NO. 36: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 36: GTGCAGCCTG GG 12 (2) INFORMATION FOR SEQ ID NO. 37: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" 21 (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 37 GGTGCAGCCT GG 12 (2) INFORMATION FOR SEQ ID NO. 38: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 38: ATGGGTGCAG CC 12 (2) INFORMATION FOR SEQ ID NO. 39: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear 22 (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 39: ATGAACTTCA CC 12 (2) INFORMATION FOR SEQ ID NO. 40: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 40: TCCATGAACT TC 12 (2) INFORMATION FOR SEQ ID NO. 41: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid fc «faf tiif - - A- t- ~ - -? áil? *? S ** m? Mt r ^^ '^ - ^ 23 (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 41 ACATCCATGA AC 12 (2) INFORMATION FOR SEQ ID NO. 42: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 42: TAGACATCCA TG 12 (2) INFORMATION FOR SEQ ID NO. 43: 24 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 43 GATAGACATC CA 12 (2) INFORMATION FOR SEQ ID NO. 44: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 44: CTGATAGACA TC 12 (2) INFORMATION FOR SEQ ID NO. 45: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 45: GCGCTGATAG AC 12 (2) INFORMATION FOR SEQ ID NO. 46: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 26 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 46; CTGCGCTGAT AG 12 (2) INFORMATION FOR SEQ ID NO. 47: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 47: GTAGCTGCGC TG 12 (2) INFORMATION FOR SEQ ID NO. 48: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) FEATURE 27 (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 48 CAGTAGCTGC GC 12 (2) INFORMATION FOR SEQ ID NO. 49: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 49: GGCAGTAGCT GC 12 (2) INFORMATION FOR SEQ ID NO. 50: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" 28 (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 50 GATGGCAGTA GC 12 (2) INFORMATION FOR SEQ ID NO. 51: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 51: AAGATGTACT CG 12 (2) INFORMATION FOR SEQ ID NO. 52: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear 29 (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 52 GGCTTGAAGA TG 12 (2) INFORMATION FOR SEQ ID NO. 53: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 53: GATGGCTTGA AG 12 (2) INFORMATION FOR SEQ ID NO. 54: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid lffÉiil-t ^^^? | ^ ¡¡i? ^ u i t? my 30 (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 54 ACACAGGATG GC 12 (2) INFORMATION FOR SEQ ID NO. 55: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 55: GCAGCCCCCG CA 12 (2) INFORMATION FOR SEQ ID NO. 56: 31 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 56: GCAGCAGCCC CC 12 (2) INFORMATION FOR SEQ ID NO. 57: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 57: CGTCATTGCA GC 12 ^ ^ M ^ ffi ^ ggrf ^ gg ^^^^^^^^^^^^ g ^^^^ 32 (2) INFORMATION FOR SEQ ID NO. 58: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (ív) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 58 CTCCAGGCCC TC 12 (2) INFORMATION FOR SEQ ID NO. 59: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 33 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 59; CACACTCCAG GC 12 (2) INFORMATION FOR SEQ ID NO. 60: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 60: CACACACTCC AG 12 (2) INFORMATION FOR SEQ ID NO. 61: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS 3. 4 (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 61 ATCTGCATGG TG 12 (2) INFORMATION FOR SEQ ID NO. 62: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 62: TAATCTGCAT GG 12 (2) INFORMATION FOR SEQ ID NO. 63: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 63; CGCATAATCT GC 12 (2) INFORMATION FOR SEQ ID NO. 64: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 64: ATCCGCATAA TC 12 (2) INFORMATION FOR SEQ ID NO. 65: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear ffMP ^ - ^^ - ^ • ^ • ^ '36 (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 65: GGTTTGATCC GC 12 (2) INFORMATION FOR SEQ ID NO. 66: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 66: GGTGAGGTTT GA 12 (2) INFORMATION FOR SEQ ID NO. 67: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid 37 (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 67 GTTGTGCTGT AG 12 (2) INFORMATION FOR SEQ ID NO. 68: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc - "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 68: CATTTGTTGT GC 12 (2) INFORMATION FOR SEQ ID NO. 69: HtwH- r-irn irMift 'f 38 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 69; GTCTGCATTC AC 12 (2) INFORMATION FOR SEQ ID NO. 70: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 70: TGGTCTGCAT TC 12 trfiir ^ '"T *** Aiirfrf 39 (2) INFORMATION FOR SEQ ID NO. 71: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 71: TCTTTGGTCT GC 12 (2) INFORMATION FOR SEQ ID NO. 72: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 ? tfÜÜ-i 40 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 72 CTTTCTTTGG TC 12 (2) INFORMATION FOR SEQ ID NO. 73: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..13 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 73: GGCATGGTGG AGG 13 (2) INFORMATION FOR SEQ ID NO. 74: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS 41 (A) NAME / KEY: exon (B) LOCATION: 1 ..13 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 74 GGTGCAGCCT GGG 13 (2) INFORMATION FOR SEQ ID NO. 75: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..13 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 75: GCAGCAGCCC CCG 13 (2) INFORMATION FOR SEQ ID NO. 76: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 14 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" • ^^ * fc * ^ ll > aM < Mt "A? - -GÉMMMIÍI 42 (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..14 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 76: GGTTTCGGAG GCCC 14 (2) INFORMATION FOR SEQ ID NO. 77: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 14 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..14 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 77: GGTGGAGGTA GAGC 14 (2) INFORMATION FOR SEQ ID NO. 78: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 14 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear . ^ ^ ^^^^^^^^^^^^^^^^^^^^ (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..14 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 78 GGGTGCAGCC TGGG 14 (2) INFORMATION FOR SEQ ID NO. 79: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 14 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..14 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 79: GCAGCAGCCC CCGC 14 (2) INFORMATION FOR SEQ ID NO. 80: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid 44 (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..15 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 80; GGGCCGGGGC CAGCC 15 (2) INFORMATION FOR SEQ ID NO. 81: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..15 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 81: CCGGGGGCCAG CCCGG 15 (2) INFORMATION FOR SEQ ID NO. 82: 45 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..15 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 82 CCCGACCGGG GCCGG 15 (2) INFORMATION FOR SEQ ID NO. 83: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..15 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 83: GGTTTCGGAG GCCCC 15 * t ^^ ¡~ ~? »> * ^^, mm 1itf1igMíg | ^ - - - * ~ * - ** 46 (2) INFORMATION FOR SEQ ID NO. 84: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..15 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 84 GGCATGGTGG AGGTA 15 (2) INFORMATION FOR SEQ ID NO. 85: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 .. 15 47 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 85: TTGGCATGGT GGAGG 15 (2) INFORMATION FOR SEQ ID NO. 86: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..15 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 86: GTGCAGCCTG GGACC 15 (2) INFORMATION FOR SEQ ID NO. 87: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) FEATURE 48 (A) NAME / KEY: exon (B) LOCATION: 1 ..15 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 87 GATGGCTTGA AGATG 15 (2) INFORMATION FOR SEQ ID NO. 88: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..15 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 88: GGATGGCTTG AAGAT 15 (2) INFORMATION FOR SEQ ID NO. 89: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" 49 (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 89; GCATGGGTGA GG 12 (2) INFORMATION FOR SEQ ID NO. 90: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 90: GAATGGGTGC GG 12 (2) INFORMATION FOR SEQ ID NO. 91: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear 50 (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 91 GTGCGACCTG GG 12 (2) INFORMATION FOR SEQ ID NO. 92: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 basic pairs (B) TYPE: nucleic acid (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids ( A) DESCRIPTION: / desc = "synthetic" (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) NAME / KEY: exon (B) LOCATION: 1 ..12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO . 92: GTGTGACCCG GG 12 (2) INFORMATION FOR SEQ ID NO. 93: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 480 basic pairs (B) TYPE: nucleic acid 51 (C) CHAIN STYLE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acids (A) DESCRIPTION: / desc = "synthetic" i (iv) ANTI-DETECTION: YES (ix) CHARACTERISTICS (A) ) NAME / KEY: exon (B) LOCATION: 1 ... 480 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 93: CAGTGTGCTG GCGGCCCGGC GCGAGCCGGC CCGGCCCCGG TCGGGCCTCC GAAACCATGA 60 ACTTTCTGCT GTCTTGGGTG CATTGGAGCC TCGCCTTGCT GCTCTACCTC CACCATGCCA 120 AGTGGTCCCA GGCTGCACCC ATGGCAGAAG GAGGAGGGCA GAATCATCAC GAAGTGGTGA 180 AGTTCATGGA TGTCTATCAG CGCAGCTACT GCCATCCAAT CGAGACCCTG GTGGACATCT 240 TCCAGGAGTA CCCTGATGAG ATCGAGTACA TCTTCAAGCC ATCCTGTGTG CCCCTGATGC 300 GATGCGGGGG CTGCTGCAAT GACGAGGGCC TGGAGTGTGT GCCCACTGAG GAGTCCAACA 360 TCACCATGCA GATTATGCGG ATCAAACCTC ACCAAGGCCA GCACATAGGA GAGATGAGCT 420 TCCTACAGCA CAACAAATGT GAATGCAGAC CAAAGAAAGA TAGAGCAAGA CAAGAAAATC 480 ^ aaa ^ .-, .. ^

Claims (15)

73
1. CLAIMS 1. A short oligonucleotide, or a derivative thereof, having a length of 10 to 15 nucleotides and corresponding to a portion of the sequence encoding vascular endothelial growth factor (VEGF), where part of the sequence encoding VEGF , to which the oligonucleotide corresponds, has one of the sequences: SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6, or a part thereof, and where: 10 SEQ ID NO. 1 is 5 '-CCCGGCCCCGGTCGGGCCTCCG-3', SEQ ID NO. 2 is 5 '-CGGGCCTCCGAAACC-3', SEQ ID NO. 3 is 5 '-GCTCTACCTCCACCATGCCAA-3 *, SEQ ID NO. 4 is 5 '-GTGGTCCCAGGCTGCACCCATGGC-3', SEQ ID NO. 5 is 5 '-CATCTTCAAGCCATCC-3' and 15 SEQ ID NO. 6 is 5 '-TGCGGGGGCTGCTGC-3'. 2 . An oligonucleotide, as claimed in claim 1, which has one of the sequences: SEQ ID NO. 7 to SEQ ID NO. 12, or a part of them, where:
2. SEQ ID NO. 7 is 3'- GGGCCGGGGCCAGCCCGGAGGC-5 'SEQ ID NO. 8 is 3'- GCCCGGAGGCTTTGG -5 ', SEQ ID NO. 9 is 3'- CGAGATGGAGGTGGTACGGTT -5 ', SEQ ID NO. 10 is 3'- CACCAGGGTCCGACGTGGGTACCG -i SEQ ID NO. 11 is 3'- GTAGAAGTTCGGTAGG -5 ', and SEQ ID NO. 12 is 3'- ACGCCCCCGACGACG -5 '20 74
3. 3. An oligonucleotide, as claimed in one or more of claims 1 or 2, wherein this oligonucleotide has a length of 12 nucleotides.
4. 4. An oligonucleotide, as claimed in one or more of claims 1 to 3, wherein this oligonucleotide has one of the sequences: SEQ ID NO. ÍA, SEQ ID NO. 16, SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 29, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID NO. 52, SEQ ID NO. 55 and SEQ ID NO. 56, where: SEQ ID NO.14 s 3'- CCAGCCCGGAGG -5 ', SEQ ID NO.16 s 3'- CGGAGGCTTTGG -5 \ SEQ ID NO.27 s 3'- GATGGAGGTGGT-5', SEQ ID NO. 28 s 3'- GGAGGTGGTACG -5 ', SEQ ID NO.29 s 3'- GGTGGTACGGTT-5', SEQ ID NO.33 s 3'- CACCAGGGTCCG -5 ', SEQ ID NO.34 s 3'- CCAGGGTCCGAC -5 ', SEQ ID NO.35 s 3'-AGGGTCCGACGT-5', SEQ ID NO.36 s 3'- GGGTCCGACGTG -5 ', SEQ ID NO.37 s 3'- GGTCCGACGTGG -5', SEQ ID NO.38 s 3'- CCGACGTGGGTA-5 *. SEQ ID NO.52 s S'-GTAGAAGTTCGG-d ', SEQ ID NO.55 s 3'-ACGCCCCCGACG -5? SEQ ID NO.56 s 3'- CCCCCGACGACG -5 '. 75
5. 5. An oligonucleotide, as claimed in one or more of claims 1 to 4, wherein this oligonucleotide has one or more modifications and where each modification is located in a particular bridge of 5 phosphodiester internucleoside and / or a particular unit of the β-2'-deoxyribose and / or a particular position of a natural nucleoside, in sympathy with an oligonucleotide of the same sequence, which is composed of a natural DNA.
6. 6. An oligonucleotide, as claimed in one or more of claims 1 to 5, wherein each modification is independently selected from: (a) replacement of a phosphodiester internucleoside bridge, located at the 3 'and / or 5' end of a nucleoside, by a modified internucleoside bridge; (b) replacing a phosphodiester bridge located at the 3 'end and / or 51 of a nucleoside by a phosphodiester bridge; (c) the replacement of one unit of sugar phosphate, 20 from the sugar phosphate backbone, by another unit; (d) the replacement of a unit of β-D-2 '-deoxyribose, by a unit of modified sugar; i ^ ^ l ^ léí ^ ¡^^^^ í1 ^ iS ^^ t iWí? ^ tW ^ ÉI &¡¡¡¡¡Utateíto --- < --¡ --- 76 (e) replacing a natural nucleoside base with a modified nucleoside base; (f) conjugation to a molecule, which influences the properties of the oligonucleotide; (g) conjugation to a 2 ', 5'-linked oligoadenylate, or a derivative thereof, optionally, by an appropriate linkage, and (h) the introduction of a 3' -3 'and / or 5' -5 inversion. 'at the 3' and / or 5 'end of the oligonucleotide.
7. 7. An oligonucleotide, as claimed in one c of claims 1 to 6, wherein each modification is independently selected from: (a) the replacement of a phosphodiester internucleoside bridge, located at the 3 'and / or 5' end of a nucleoside, by a modified internucleoside bridge, wherein this modified internucleoside bridge is selected from phosphorothioate, phosphorodithioate, NR1R1'-phosphoramidate, boranophosphate, phosphate- (C? -C2i) -O-alkyl ester, phosphate- [(C6-C? 2) aryl- ( (C? ~ C2?) -0-alkyl) -ester, (C .-- C? 2) -a-hydroxymethylaryl (C? -8) -alkylphosphonate, where R1 and R1 'are, independently of each other, hydrogen, (C? -C? 8) -alkyl, (C6-C20) -aryl, (C6-C? 4) ~ 25 aryl- (Ci-Cβ) -alkyl, preferably hydrogen, (C '? - ^^^^^^^^ Kk ^ í ^ ^^ gH ^ g ^ g 77 C8-) -alkyl and / or meththyl; or R1 and R1 'form, together with the nitrogen atom carrying them, a heterocyclic ring, which may additionally contain a heteroatom more than group 5 of 0, S and N; (b) the replacement of a phosphodiester bridge, located at the 3 'and / or 5' end of a nucleoside, by a defosfo bridge, in which this defosp bridge is selected from the dephosphory bridges of groups of 10 formatetal, 3 '-thioformacetal, methylhydramine, oxime, methylenedimethyl-hydrazo, dimethylenesulfone and silyl; (c) the replacement of a sugar phosphonate unit from the sugar phosphate skeleton by another 15 unit, is selected from morpholino derived units, polyamide nucleic acid backbone units, and phosphonic acid monoester nucleic acid backbone units; (d) the replacement of a unit of β-D-2 '-deribose 20 by a unit of modified sugar, in which this modified sugar unit is selected from the β-D-ribose, aD-2' -deibose, L -2'-deibose, 2'-F-2'-deibose, 2'-0- (C? -C6) alkyl-ribose, 7'-0- (C? -C6) alkyl-ribose, 2'-0 - (C2-C6) alkenyl-ribose, 25 2 '- [0- (d-Cealkyl-O- (d-C6) alkyl-ribose, 2' -NH2- ^ .. i.A ^ MA ^ a--. 2 'deibose, β-D-xylo-furanose, α-arabinofuranose, 2,4-dideβ-D-erythro-hexo-pyranose and carbocyclic and / or the open-chain sugar analogs and / or bicyclo-sugar analogues ( e) replacement of a natural nucleoside base with a modified nucleoside base, in which this modified nucleoside base selects from uracil, hypoxanthine, 5- (hydrethyl) uracil, N2-dimethylguanosine, pseudouracil, 5- (hydrethyl) - uracil , 5-aminouracil, dihydrouracil, 5-fluorouracil, 5-fluorocytosine, 5-chlorouracil, 5-chlorocytoxine, 5-bromouracil, 5-bromocytoxin, 2,4-diaminopurine, 8-azapurine, 7-deaza-7-purine substituted and 7-deaza-8-substituted. (f) the conjugation of a molecule, which has an influence on the properties of the oligonucleotide, where the molecule that influences the property of the oligonucleotide is selected from polylysine, intercalating agents, fluorescent agents, lacing agents, lipophilic molecules, lipids, steroids, vitamins, poly- or oligo-ethylene glycol, preferably linked to the oligonucleotide by means of a phosphate group, an alkyl phosphate diester (C? 2-C? 8) and groups of 0-CH2-CH (OH) -0- (C 2 -C 8) -alkyl. 79 (g) conjugation to a 2 ', 5'-linked oligoadenylate, preferably by means of an appropriate linker molecule, in which this 2', 5'-linked oligoadenylate is selected from linked triadenylate 2 ', 5'-5 molecules , 2'-tetraadenylate, 5'-linked, 2'-pentaadenylate, 5'-linked, 2'-hexaadenylate, 5'-linked and 2'-heptaadenylate, 5'-linked, and their derivatives, and (h) the introduction of an inversion 3 '-3' and / or 5 '-5' of the 10 3 'and / or 5' end of the oligonucleotide.
8. 8. A method for obtaining an oligonucleoside, as claimed in one or more of claims 1 to 7, by condensing appropriately protected monomers on a solid support.
9. 9. The use of an oligonucleotide, as claimed in one or more of claims 1 to 7, to inhibit the expression of VEGF.
10. 10. A method for inhibiting VEGF expression, wherein an oligonucleotide, as claimed in one or more of claims 1 to 7, is contacted with a nucleic acid encoding VEGF. fefeíg < ^ * ^^^ «^^ f ^^ tn '(^ - ~ 80
11. 11. The use of an oligonucleotide, as claimed in one or more of claims 1 to 7, for preparing a pharmaceutical composition.
12. 12. A method for obtaining a pharmaceutical composition, by mixing one or more oligonucleotides, as claimed in one or more of claims 1 to 7, with a physiologically acceptable excipient and, optionally, additional substances.
13. 13. A pharmaceutical composition, which comprises at least one oligonucleotide, as claimed in one or more of claims 1 to 7.
14. 14. The use of a pharmaceutical composition, which comprises at least one oligonucleotide, as claimed in claims 1 to 7, for the treatment of diseases, which are associated with abnormal vascular permeability, cell proliferation, cell permeation, angiogenesis, neovascularization , cell growth and / or tumor metastasis.
15. 15. The use of a pharmaceutical composition, which comprises at least one oligonucleotide, as claimed in one or more of claims 1 to 7, in combination with other pharmaceutical products and / or therapeutic methods.