CZ2001419A3 - Oligonucleotides intended for inhibition of VEGF expression, process of their preparation and their use - Google Patents

Abstract

The present invention relates to an oligonucleotide or derivative thereof the sequence of the corresponding portion of the nucleic acid that it encodes VEGF (vascular endothelial growth factor) and which it has the ability to inhibit tumor growth in animal models . tumors. It further relates to a method for preparing such oligonucleotides and their uses. The subject is an oligonucleotide or a derivative thereof having the sequence id. No. 4 or part thereof where . sequence id. No. 4 is 3 GTACCTACAGATAGTCGCGTCGATGACGGTAGG-5 ', p the first condition that not all intemucleoside bridges in oligonucleotides are phosphodiester internucleoside bridges, and not all phosphodiester internucleoside bridges are replaced by phosphothioate intemucleoside and / or a second condition that the oligonucleotide does not contain modified nucleosides selected from the group containing C5-propynyluridine, C5-propynylcytidine, C5- hexinyluridine, C5-hexinylcytidine, 6-azauridine and 6-azacytidine.

Description

Technical field

The present invention relates to oligonucleotides or derivatives thereof having a sequence corresponding to a portion of a nucleic acid encoding VEGF (vascular endothelial growth factor) and having the ability to inhibit tumor growth in animal models. The invention further relates to a process for the preparation of such oligonucleotides and to their use.

BACKGROUND OF THE INVENTION

Angiogenesis, defined as the growth of new blood capillaries, plays a fundamental role in growth and development. In an adult, the ability to initiate an angiogenic response is present in all tissues but is kept under strict control. Angiogenesis is only mobilized in specific circumstances, such as the recovery of injured tissues or the regulation of the uterine mucosa. The regulation of angiogenesis is the result of a delicate balance between numerous inhibitory and stimulating factors.

also referred to as VPF (vascular factor is a key regulator of angiogenesis and is specific for endothelial Cardiovasc. Med. (1993) 3, 244).

in four different isoforms,

VEGF, sometimes permeability), mitotic effect (Ferrara, there is a different cell

VEGF which

Trends at least similar biological activity and result from mRNA splicing. VEGF is expressed at abnormally high levels in human tumors and diseased tissue, characterized by a high rate of vascularization or high vascular permeability, such as diabetic

- 2 retinopathies, psoriasis, age-dependent macular degeneration, rheumatoid arthritis and other inflammatory diseases. Thus, agents that selectively lower VEGF levels can be used to treat malignancies and other disorders of angiogenesis.

Monoclonal antibodies against VEGF have been shown to suppress the growth of some tumors in nude mice (Kim et al., Nature (1993) 362, 841). Another way to reduce VEGF is to use antisense oligonucleotides that are optionally modified to improve their properties (E. Uhlmann and A. Peyman, Chemical Reviews 90, 543 (1990); S. Agrawal, T1BTECH 1996, 376) EP 0653439 A2). Antisense oligonucleotides are believed to bind to specific mRNA sequences, leading to mRNA degradation and / or inhibition of protein synthesis.

EP 0769 552 A1 in the claims discloses oligonucleotides of 8 nucleotides or longer, directed against VEGF, which inhibit VEGF expression to 30% or less. These oligonucleotides were tested in a cell-free system in the form of phosphodiesters, but which are not stable in vivo. Selected oligonucleotides were also tested in the form of all-phosphothioates (A085R-S, A087P-S, A227-S, A287-S, A311-S and A419-S), which showed 30-46% inhibition of VEGF expression using 20 μΜ all -phosphothioate oligonucleotides in A549 cell assay.

WO 97J39120 discloses antisense oligonucleotides directed against VEGF mRNA that reduce cellular VEGF production in cells that have been treated with oligonucleotide at a concentration of less than 1 micromolar. In a particular embodiment of the invention, the oligonucleotide had the following sequence (SEQ ID NO: 1): 5'-GCGCTGATAGACATCCATG-3 ', wherein the oligonucleotide contained phosphothioate groups either at all inter-nucleotide bridges or at certain inter-nucleoside positions, and in the latter case contained positions still modified nucleoside residues 4 4 4 residues selected from: C5-propynyluridine, C5- propinylcytidine, C5hexinyluridine, C5-hexinylcytidine, β-azauridine and 6-azacytidine (see Table 1 in WO 97/39120).

Data on the activity of VEGF antisense oligonucleotides whose sequence was not published was presented at the American Association for Cancer Research 1998 conference (abstract of the presentation was published in AACR, Vol. 39, p. 95). Oligonucleotides were shown to have the ability to inhibit the growth of glioblastoma xenografts in nude mice.

SUMMARY OF THE INVENTION

The present invention provides an oligonucleotide or derivative thereof having a sequence corresponding to SEQ ID NO: 1. 2 or a portion thereof, wherein the sequence of SEQ ID NO. No. is as follows:

'-CATGGATGTCTATCAGCGCAGCTACTGCCATCC-3'.

SEQ ID NO. No. 2 is part of a nucleic acid sequence that encodes VEGF. The portion of the nucleic acid corresponding to the oligonucleotide (hereinafter abbreviated ON) is preferably 10 to 30 nucleotides in length, more preferably 17 to 20 nucleotides in length, most preferably 17, 18, 19 or 20 nucleotides in length. Thus, the oligonucleotides of the invention are preferably 10 to 33 nucleotides in length (10 to 33mer), more preferably 17 to 20 nucleotides, most preferably 17, 18, 19 or 20 nucleotides (17mer, 18mer, 19mer or 20mer). In a preferred embodiment of the invention, the oligonucleotide is 19 nucleotides in length.

The oligonucleotide has a sequence that corresponds to a portion of the nucleic acid that encodes VEGF. The term corresponding means that the base sequence of the oligonucleotide is complementary to the portion of the nucleic acid sequence that encodes VEGF (e.g., gene, cDNA, mRNA sequences), thus allowing the oligonucleotide to hybridize (ie, bind) to the sense portion of the VEGF encoding which is preferably VEGF mRNA).

- 4 ·· ··· ·· · · · · ·

Therefore, the name antisense oligonucleotide is also used. In a preferred embodiment of the invention, the oligonucleotide is just an antisense oligonucleotide. In another preferred embodiment of the invention, the oligonucleotide is a ribozyme. Ribozyme is a catalytic nucleic acid that cleaves mRNA. Preferred ribozymes are selected from the group comprising hammer ribozymes (see Uhlmann and Peyman, 1990).

The nucleic acid which encodes VEGF and which corresponds to the sequence of the oligonucleotide has the following sequence (SEQ ID NO: 2):

5'-CATGGATGTCTATCAGCGCAGCTACTGCCATCC-3 '.

This sequence is equivalent to nucleotide sequence 185-217 of the human VEGF cDNA described in Figure 1B of Leung et al. (Science (1989) 246,1306). SEQ ID NO. No. 2 is also equivalent to nucleotides 185-217 of human VEGF mRNA when the nucleotides are numbered identically to Leung et al. (Science (1989) 246,1306). In a preferred embodiment, the oligonucleotide is equivalent to nucleotides 185-203 of human VEGF mRNA. Part of the human VEGF mRNA is also shown in Table 3 (SEQ ID NO: 19), wherein the sequence of SEQ ID NO: 19 is shown in FIG. 2 also corresponds to a portion of SEQ ID NO. No 19.

The present invention relates to an oligonucleotide or derivative thereof having the sequence id. 4 or a portion thereof, wherein the sequence of SEQ ID NO. No. 4 is as follows:

'-GTACCTACAGATAGTCGCGTCGATGACGGTAGG-5' 5 '-GGATGGCAGTAGCTGCGCTGATxAGACATCCATG-3' all internucleoside with the first condition that not the oligonucleotide linkages are internucleoside linkages and not all internucleoside linkages are replaced by internucleoside linkages groups containing phosphodiester phosphodiester phosphosothioate • · • ·

- 5 ·· ··· ·· ···· ·· ···

C5-propynyluridine, C5-propynylcytidine, C5-hexinyluridine, C5-hexynylcytidine, 6-azauridine and 6-azacytidine.

The oligonucleotide corresponds to sequence id. 2 or parts thereof. In a preferred embodiment, the oligonucleotides correspond to SEQ. 3 or parts thereof. Preferably, the oligonucleotide corresponding to part of SEQ ID NO. No. 3 is 17, 18 or 19 nucleotides in length. The sequence of SEQ. No. 3 is as follows:

'-CATGGATGTCTATCAGCGC-3'.

Thus, the oligonucleotide of the invention has, for example, one of the following sequences of SEQ ID NO. 4 to id. 16, wherein: SEQ ID NO. No 4 is:

'-GTACCTACAGATAGTCGCGTCGATGACGGTAGG-5' ¹ -GGATGGCAGTAGCTGCGCTGATAGACATCCATG-3 '(3 3mer), SEQ ID NO. No 5 is:

'-CCTACAGATAGTCGCGTCGATGACGG-5' '-GGCAGTAGCTGCGCTGATAGACATCC-3' (26 mer), SEQ ID NO. No 6 is:

3'-CAGATAGTCGCGTCGATGACGG-5 '

5'-GGCAGTAGCTGCGCTGATAGAC-3 '(22 mer), SEQ ID NO. No 7 is:

'-AGTCGCGTCGATGACGG-5'

5'-GGCAGTAGCTGCGCTGA-3 '(17 mer), SEQ ID NO. No 8 is:

3'-CTACAGATAGTCGCGTCG-5 '

5'-GCTGCGCTGATAGACATC-3 '(18 mer), SEQ ID NO. No 9 is:

3'-GTACCTACAGATAGTCGCGTCGATGACGG-5 '

5'-GGCAGTAGCTGCGCTGATAGACATCCATG-3 '(29 mer), SEQ ID NO. No 10 is:

3'-GTACCTACAGATAGTCGCGT-5 '

5'-TGCGCTGATAGACATCCATG-3 '(20 mer)

- 6 of SEQ ID NO. No. 11 is:

3'-GTACCTACAGATAGTCGCG-5 '

5'-GCG.CTGATAGACATCCATG-3 '(19 mer), SEQ ID NO. No 12 is:

3'-GTACCTACAGATAGTCGC-5 '

5’-CGCTGATAGACATCCATG-3 ’(18 mer), sequence id. 13 is:

3'-ACCTACAGATAGTCGCG-5 '

5'-GCGCTGATAGACATCCA-3 '(17 mer), SEQ ID NO. No 14 is:

3’-GTACCTACAGATAGTCG-5 '

5'-GCTGATAGACATCCATG-3 '(17 mer), SEQ ID NO. No 15 is:

3 '-TACCTACAGATAGTCGCG-5' '-GCGCTGATAGACATCCAT-3' (18 mer), SEQ ID NO. No 16 is:

3'-TACCTACAGATAGTCGC-5 '

5'-CGCTGATAGACATCCAT-3 '(17 mer).

SEQ ID NO. 4 is a sequence corresponding to or complementary to SEQ ID NO. 2. Sequences 5 to 16 are sequences corresponding to portions of SEQ ID NO: 2. Sequences 5 to 16 are equivalent to portions of SEQ ID NO: 2. In a preferred embodiment of the invention, the oligonucleotide has the sequence of SEQ ID NO. No. 11 (corresponds to a portion of the VEGF coding sequence of SEQ ID NO: 3).

The present invention further relates to oligonucleotide derivatives, eg salts thereof, in particular physiologically tolerable salts. Salts and physiologically tolerable salts are described, for example, in Remingtons Pharmaceuticals Science (1985) Mack Publishing Company, Easton, PA (p. 1418). Derivatives also refer to modified oligonucleotides having one or more modifications (e.g., at a particular nucleoside position and / or at a particular internucleoside linkage, oligonucleotide analogs (e.g.

Polyamide-nucleic acids, PNA, nucleic acids with phosphomono acid esters, PHONA (= PMENA), oligonucleotide chimeras (eg, composite) from DNA and PNA portions or DNA and PHONA portions)).

A preferred aspect of the invention relates to an oligonucleotide having a sequence that corresponds to sequence id. Most preferably, the oligonucleotide is modified to improve its properties, e.g., to increase its nuclease resistance or to enhance its activity. it has become nuclease resistant, or to improve its binding affinity to the complementary nucleic acid or to increase the uptake of oligonucleotides by the cell.

Thus, the present invention preferably relates to oligonucleotides having in particular the sequence as mentioned above and which additionally have one or more chemical modifications as compared to natural DNA which is composed of natural nucleosides of deoxyadenosine (adenine-β-0-2 deoxyribose), deoxvguanosine (guanine + β-0-2'-deoxyribose), deoxycytidine (cytosine + β-ϋ-2'-deoxyribose) and thymidine (thymine + β-Ο-2'-deoxyribose) linked via phosphodiester internucleoside internucleoside . Oligonucleotides comprise one or more modifications of the same type and / or modifications of different types, each modification independently selected from all types of modifications known to be used to modify oligonucleotides. Examples of chemical modifications are known to those skilled in the art and have been described, for example, in E. Uhlmann and A. Peyman, Chemical Reviews 90 (1990) 543, Protocols for Oligonucleotides and Analogs Synthesis and Properties & Synthesis and Analytical Techniques, S. Agrawal, Ed, Humana Press, New Jersey, United States 1993, ST Crooke, F., Bennet, Ann. Roar. .Pharmacol. Toxicol. 36 (1996) 107-129, by J. Hunziker and C. Leuman (1995) Mod.

Synt. Methods, 7, 331-417.

• ·

- 8 «· ··· ·· ···· ·· ···

E.g. In comparison to natural DNA, the phosphophodiester internucleoside bridge, β-ϋ-2'-deoxyribose and / or the natural nucleoside base (adenine, guanine, cytosine, thymine) can be modified or replaced. The oligonucleotide of the present invention has one or more modifications, each modification being located in a single phosphodiester internucleoside bridge and / or in a certain β-ϋ-2'-deoxyribose unit and / or in a certain natural nucleoside base compared to an oligonucleotide with the same natural sequence DNA.

For example, the present invention relates to an oligo.nucleotide comprising one or more modifications, each of which is independently selected from the following:

a) replacement of the phosphodiester internucleoside bridge located at the 3'- and / or 5'-end of the nucleoside with a modified internucleoside bridge,

b) replacing the phosphodiester bridge located at the 3'-end of the nucleoside with a phosphate bridge, a sugar phosphate unit from the sugar-phosphate backbone by another unit, replacing the β-ϋ-2'-deoxyribose unit with a modified sugar unit, replacing the natural nucleoside base with a modified nucleoside base; which affects the properties of the oligonucleotide, conjugation to the 2'5'-linked oligoadenylate or derivative thereof, optionally via a suitable linker, inserting a 3'-3 'and / or 5'-5' inversion at the 3'- and / or 5'-end of the oligonucleotide .

and / or 5 replacements

d) g;

More detailed examples of chemical modifications of oligonucleotides are given below:

a) replacing the phosphodiester internucleoside bridge located at the 3'- and / or 5'-end of the nucleoside with a modified internucleoside bridge, wherein the modified internucleoside bridge is selected from eg the group comprising phosphothioate, phosphodithioate, NB / R ¹ phosphoramidite, borane phosphate, O-alkyl phosphate (C 1 -C 21) alkyl, (C 6 -C 12) aryl-O-alkyl phosphate ester (C 1 -C 21), C (C 1 -C 8) alkyl phosphonate and / or α-hydroxymethylaryl with an aryl group of 7 to 15 carbon atoms (as described in WO 95/01363), wherein the aryl group of 6 to 12 carbon atoms, the aryl group of 6 to 20 carbon atoms and the aryl group of 6 to 14 carbon atoms are optionally halogen, alkyl, alkoxy, nitro or not cyano and R ¹ and R ¹ are, independently of one another, hydrogen, C 1 -C 18 alkyl, C 6 -C 20 aryl, C 6 -C 14 aryl-alkyl and C 1 -C 6 alkyl C 8, preferably hydrogen, C 1 -C 8 alkyl and / or methoxyethyl, particularly preferably hydrogen, C 1 -C 4 alkyl or methoxyethyl, or R 1 and R ¹ together form an atom the nitrogen carrying them, a 5-6 membered heterocyclic ring, which may additionally contain another heteroatom selected from the group consisting of O,

S and N.

- 10 · · ·····························

b) replacement of the phosphodiester internucleoside bridge located at the 3'- and / or 5'-end of the nucleoside by a defrost bridge (the defrost bridge has been described, for example, in Uhlmann, E. and Peyman, A. in Methods in Molecular Biology, Vol. 20, Protocols for Oligonucleotides and Analogs, S. Agrawal, Ed., Humana Press, Totowa, 1993, Chapter 16, 355ff), wherein the defrost bridge is selected from, for example, the defrost bridge of formacetal, 3'-thioformacetal, methylhydroxylamine and oxime groups, methylenedimethylhydrazo groups, dimethylsulfone groups. and / or silyl groups,

c) replacing the sugar phosphate unit (β-ϋ-2'-deoxyribose and phosphodiester internucleoside bridge together to form a sugar-phosphate unit) in the sugar-phosphate backbone (the sugar-phosphate backbone consists of sugar phosphate units) with another unit capable of forming e.g.

- an oligomer with morpholine derivatives (as described, for example, in E.P. Stirchak et al., Nucieic Acids Res. 17 (1989) 6129), or replaced by a morpholine derivative unit,

polyamide nucleic acid (PNA) (as described, for example, in PE Nielsen et al., Bioconj. Chem. 5 (1994) 3 and in EP 0672677 A2), or replaced by a PNA unit in the backbone, eg 2-aminoethylglycine , phonomono acid esters nucleic acid (PHONA) (as described in Peyman et al., Angew. Chem. Int. Ed. Engl. 35 (1996) 2632-2638 and in EP 0739898 A2), or replacement of the unit in the backbone PHONA unit

d) replacing the β-ϋ-2'-deoxyribose unit with a modified sugar unit, wherein the modified sugar unit is selected from, for example, β-D-ribose-containing groups, and D-2'11 deoxyribose, L-2'-deoxyribose, 2 '-F-2'-deoxyribose,2'-O-alkylribose having an alkyl group of 1 to 6 carbon atoms, wherein the 2'-O-alkylribose having an alkyl group of 1 to 6 carbon atoms is preferably 2'-O-methylribose, 2 2'-O-alkenylribose having 2 to 6 carbon atoms, 2 '- [O- (alkyl-O-alkyl) -ribose having 1 to 6 carbon atoms, 2'-NH ₂ -2' deoxyribose, β-D-xylofuranose, α-arabinofuranose, 2,4a carbocyclic (described by Am. Chem. Soc. 114 (1992) dideoxy-β-D-erythrohexopyranose sugar analogs, e.g., Froehler, J 8320) sugar analogs and / or chain (described, e.g., in Vandendriessche et al., Tetrahedron 49 (1993) 7223) and / or bicyclosaccharide analogs (described in e.g. . In M. Tarkov et al., Helv. Chim. Acta (1993) 481),

e) replacing the natural nucleoside base with a modified nucleoside base, wherein the modified nucleoside base is selected from the group consisting of uracil, hypoxanthine, 5- (hydroxymethyl) uracil, N ² -dimethylguanosine 5- (hydroxymethyl) uracil, 5-aminouracil, pseudouracil, dihydrouracil, -fluorouracil, 5-fluorocytosine, 5-chlorouracil, 5-chlorocytosine, 5-bromouracil, 5-bromocytosine, 2,4-diaminopurine, 8-azapurine, substituted 7-deazapurine, preferably 7-deaza-7-substituted and / or 7-deaza -8-substituted purine or other modifications of the natural nucleoside base, such as the modified nucleoside bases described in EP 0 710 667 A2 and EP 0 680 969 A2,

f) conjugation to a molecule that affects the properties of the oligonucleotide, wherein conjugating the oligonucleotide to one or more molecules that (preferably) affect the properties of the oligonucleotide (eg, the ability of the oligonucleotide to cross the cell membrane or enter the cell, oligonucleotide stability against nucleases, affinity for VEGF encoded

the target sequence, the pharmacokinetics of the oligonucleotide, the ability of the antisense oligonucleotide / ribozyme to attack the VEGF encoded target sequence, i. the ability to bind and / or crosslink when the oligonucleotide or oligonucleotide hybridizes with a sequence), examples of molecules which may be conjugated to the oligonucleotide include polylysine, an intercalating molecule conjugated to a VEGF encoded target agent such as e.g.

pyrene, acridine, phenazine or phenanthridine, fluorescent agents such as fluorescein, crosslinkers such as azidoproflavin, lipophilic is eg psoralene or molecules such as C 12 -C 20 alkyls, lipids such as 1,2-di-hexadecyl-rac-glycerol, steroids such as cholesterol or is vitamin E, poles- or linked to an oligonucleotide e.g. trietnylentestosteron, vitamins such as oligoethylene glycol preferably via a phosphate group (glykolfosfát) alkyl phosphate diesters having an alkyl group containing 12 to 18 carbon atoms and / or O-CH ₂ -CH (OH) -O-alkyl having an alkyl group containing 12 to 18 carbon atoms. These molecules are conjugated to the 3'- and / or 5'-end or within the sequence, i. on a nucleoside basis. Preferred is conjugation of the oligonucleotide with a) lipophilic molecule such as an alkyl of 12 to 20 carbon atoms, b) a steroid such as cholesterol and / or testosterone, c) poles and / or oligoethylene glycol, d) vitamin E, e) intercalating an agent such as pyrene, f) an alkyl phosphate diester having an alkyl group containing from 14 to 18 carbon atoms, and / or g) O-CH-CH (OH) O-alkyl having an alkyl group containing from 12 to 18 carbon atoms. known and described, for example, in Uhlmann, E

A., Chem. Roar. 90 (1990) 543 and by M. Manoharan,

Crooke and Lebleu, Research and Applications,

Press, Boca Raton, 1993, Chapter 17, p. 303ff, EP-A 0 552 766, & Peyman,

Antisense Eds., CRC and patent.

• Φ · · φ φ φ φ φ · · φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ ΦΦ ΦΦ φ φ φ φ φ

g) conjugation to a 2'5'-linked oligoadenylate, preferably via a suitable linker molecule, wherein the 2'5'-linked oligoadenylate is selected from the group consisting of 2'5'-linked triadenylate molecules, 2'5'-linked tetraadenylate molecules, 2'5 'bonded pentaadenylate molecules, 2'5'-linked hexaadenylate molecules, and 2'5'-linked heptaadenylate molecules or derivatives thereof, wherein the derivative of the 2'5'-linked oligoadenylate is eg Cordycepin (2'5'-linked 3'deoxyadenylate) and an example of a suitable linker is triethylene glycol and wherein the 5'-ends of the 2'5'-linked adenylate must carry a phosphate, diphosphate or triphosphate moiety wherein one or more oxygen atoms can be replaced, e.g., sulfur atoms, with phosphate or thiophosphate substitution preferred. the rest,

h) insertion of the 3'-3 'and / or 5'-5' inversion at the 3'- and / or 5'-end of the oligonucleotide, which kind of modification is known to those skilled in the art and has been described, for example, in M. Koga et al.

J. Org. Chem. 56 (1991) 3757 and in EP 0 464 638 EP 0 593 901.

The replacement of a sugar phosphate unit from a sugar-phosphate backbone by another unit, such as a PNA or PHONA backbone forming unit, is preferably a replacement of a nucleotide such as a PNA or PKONA unit that already contains natural nucleoside bases and / or modified nucleoside bases, eg one from modified nucleoside bases (referred to in e)) from the group consisting of uracil, hypoxanthine, 5- (hydroxymethyl) uracil, N-dimethylguanosine, 5- (hydroxymethyl) uracil, 5-aminouracil, pseudouracil, dihydrouracil, 5-fluorouracil, 5- fluorocytosine, 5-chlorouracil, 5-chlorocytosine, 5-bromouracil, 5-bromocytosine, 2,4-diaminopurine, 8-azapurine, substituted 7-deazapurine, preferably 7-deazapurine substituted at position 7 and 7-deazapurine substituted at position 8, or other modifications of natural nucleoside bases (modified nucleoside bases have been described, for example, in the patent, EP 0 710 667 A2 and EP 0 680 969 A2). The modifications described in the patent, EP 0 710 667 A2, EP 0 680 969 A2, EP 0 464 638, EP 0 593 901, WO 95/01363, EP 0 672 677 A2, EP 0 739 898 A2 and EP 0 552 766 are by reference in the present application.

An example of an oligonucleotide having the sequence id. No. 11, modified internucleoside bridges and the 3'3'inversion at the 3'end is the following oligonucleotide:

ON 57: 5'-G * C * GC * TGA * T * AGA * C * AT ⁺ C * C * A * T (3'3 ') G-3' where (3'3 ') is 3' A 3'-phosphodiester linkage as described in the patent document EP 0 464 638 and denotes a modified internucleoside bridge.

An example of an oligonucleotide having the sequence id. No. 11, wherein the phosphodiester linkage has been replaced by an arylphosphonate bridge are the following oligonucleotides:

ON 58: 5'-G * C * G * T * A * T * A * A * C * A * T * C * A * T (NBP) G-3 '

ON 59: 5 '~ G * C * GC * TGA * T * AGA * C * AT * C * C * A * T (NBP) G ~ 3' where NBP is α-hydroxybenzylphosphonate bond, preferably (α-hydroxy- A 2-nitrobenzyl phosphonate linkage as described in WO 95/01363 and N is a 2'-O-alkylribonucleoside, preferably a 2'-O-methylribonucleoside (in this case T is a 2-O-alkyluridine, preferably a 2'-O- methyluridine).

An example of an oligonucleotide having the sequence id. No. 11, and wherein the nucleoside base has been replaced with a modified nucleoside base as described, for example, in the patent.

EP 0 710 667 and EP 0 680 969 disclose the following oligonucleotides:

ON 60: 5'-G * C * G C * T G a * T * a g a * C * a T * C * C * A * T * G-3 '

ON 61: 5'-G * C * GC * TGA * T * AG and * C * and T * C * C * A * T * G-3 'where lowercase a denotes 8-aza-deoxyadenosine or optionally substituted 7 -deaza-deoxyadenosine and the lowercase letter g stands for 8-aza-deoxyguanosine or optionally substituted 7-deazadeoxyguanosine (examples of base modifications have been described in patent, EP 0 710 667 A2 and EP 0 680 969 A2) and N is 2'-O- an alkylribonucleoside, preferably a 2'-O-methylribonucleoside (in this case T is 2-O-alkyluridine, preferably 2'-O-methyluridine).

In a particular embodiment of the present invention, at least one or more internucleoside bridges are modified, preferably with a phosphothioate. In all-phosphothioate oligonucleotides, all phosphodiester internucleoside bridges were modified with phosphothioate. Preferably, the invention relates to oligonucleotides wherein not all phosphodiester internucleoside bridges have been uniformly modified with a phosphothioate (phosphothioate internucleoside bridges), in particular, not all have been modified when the oligonucleotide has the sequence of SEQ ID NO: 2. Preferably, the at least one internucleoside bridge has another type of modification or is not modified at all.

In a preferred embodiment of the invention, only some particular positions in the oligonucleotide sequence are modified (i.e., a partially modified oligonucleotide). A partially modified oligonucleotide is also referred to in some publications as a minimal modified oligonucleotide. Within the sequence of the oligonucleotides, the modification is located at some specific positions (at a particular nucleotide, at a certain nucleoside, on a particular nucleoside basis, on a certain internucleoside bridge).

In a particular embodiment of the present invention, the oligonucleotide is prepared from phosphodiester bridges by internucleoside bridges, such that only some of them have been replaced with modified eg phosphorothioate bridges.

Thus, the invention particularly relates to oligonucleotides that are only modified to some extent.

The ON 1 and ON 62 to ON 73 oligonucleotides below are examples of localizing modified internucleoside bridges with respect to SEQ ID NOs. 4 to id. No 16.

ON 62: 3'-G * T * A * C * C * TAC * AGA * TAGT * C * GC * GT * C * GAT * GAC * GGT * AGG-5 '(Example for SEQ ID NO: 4)

ON 63: 3'-C * C * «AC * AGAT * AGT * C * GC * GT * C * GAT * GAC * G * G-5 '(example for SEQ ID NO: 5)

ON 64: 3'-C * A * GA * TAGT * C * G * CGT * C * GAT * GAC * G * G-5 '(Example for SEQ ID NO: 6)

ON 65: 3'-A * G * T * CGC * GT * C * GA * T * GAC * G * G-5 '(Example for SEQ ID NO: 7)

ON 66: 3'-C * T * A * CAGA * TAGT * C * GC * GT * C * G-5 '(Example for SEQ ID NO: 8)

ON 67: 3 '-G * T * AC * C * TAC * AG-AT * AGT * C * GC * GT * C * GAT * GAC * G * G ~ 5' (Example for SEQ ID NO: 9)

ON 68: 3 '-G * T * AC * C * TAC * AGAT * AGT * C * GC * G * T-5' (Example for SEQ ID NO: 10)

ON 1: 3'-G * T * A * C * C * TA * C * AGA * T * AGT * CG * C * G-5 '(Example for SEQ ID NO: 1i)

ON 69: 3'-G * T * A * C * C * TA * C * AGA * T * AGT * C * G * C-5 '(example for SEQ ID NO: 12)

ON 70: 3'-A * C * C * T * AC * AGA * T * AGT * C * G * C * G-5 '(Example for SEQ ID NO: 13)

ON 71: 3'-G * T * A * C * C * TA * C * AGA * T * AG * T * C * G-5 '(Example for SEQ ID NO: 14) • · · ·· · «·· · * · · · · · ·

ON 72: 3'-T * A * C * C * TAC * AGA * T * AG * T * CG * C * G-5 '(Example for SEQ ID NO: 15)

ON 73: 3'-T * A * C * C'TAC * AGA * T * AG * T * C * G * C-5 '(example for SEQ ID NO: 16), where * shows the location of the internucleoside bridge modification in sequence. In a preferred embodiment of the invention, it is a modification of the type of replacement of phosphodiester bridges with phosphothioate bridges, in which case it indicates the position of the phosphothioate bridges. A preferred embodiment of the invention relates to ON 1, denoting a phosphothioate bridge:

ON 1: 3 '-G * T * A * C * C * TA * C * AGA * T * AGT * CG * C * G-5', where there is a phosphothioate bridge.

A particular embodiment of the present invention relates to oligonucleotides wherein 1 to 5 terminal nucleotide units at the 3'- and / or 5'-end of the oligonucleotide are protected by modification of internucleoside bridges located 3 'and / or 5'-end of the corresponding nucleosides. Most preferably, 1 to 5 terminal nucleotide units at the 3'-end of the oligonucleotide are protected by modification of internucleoside bridges located at the 3'- and / or 5'-end of the corresponding nucleosides. Optionally, in addition, 1 to 5 terminal nucleotide units at the 5'-end of the oligonucleotide are protected by modification of internucleoside bridges located at the 3 '- and / or 5'-end of the corresponding nucleosides. Optionally, the oligonucleotides comprise additional modifications at other positions. An example of such an oligonucleotide having the sequence id. No. 11 and the given modification formula is ON 2:

ON 2: 5'- G * CG * C * T * G * A * T * AG * A * C * A * T * C * C * A * T * G -3 '• * φ · # · «φφ preferably the localization is where the internucleoside bridge indicates, the bridge.

phosphiothioate

The present invention further relates to an oligonucleotide wherein at least one internucleoside inner pyrimidine nucleoside and / or a bridge located at the 5'-end of the pyrimidine nucleoside and / or located at the 3'-end of the pyrimidine nucleoside is modified.

In a preferred embodiment of the invention, nucleotide units on the 3'-oligonucleotide are protected by bridges located by 3'modification of nucleosides, pyrimidine wherein at least the nucleoside and / or up to 5 terminal and / or 5'-ends of the internucleoside and / or 5'-ends correspond to at least one internal internucleoside the pyrimidine nucleoside located at the 5'-end of this and / or located at the 3'-end of this pyrimidine nucleoside is modified.

The principle of partially modified oligonucleotides has been described in A. Peyman, E. Uhlmann, Biol. Chem. HoppeSeyler, 377 (1996) 67-70 and EP 0 653 439, which is incorporated herein by reference). In this case, 1 to 5 terminal nucleotide units located at the 3'- and / or 5'-end of the oligonucleotide are protected, e.g., by replacing the phosphodiester internucleoside bridges located at the 3'- and / or 5'-end of the corresponding nucleosides, e.g. phosphothioate internucleoside bridges. In addition, preferably at least one internal pyrimidine nucleoside (or nucleotide) position is modified, preferably the 3'- and / or 5'-internucleoside bridge of the pyrimidine nucleoside is modified, eg with a phosphothioate. Partially modified oligonucleotides exhibit particularly advantageous properties, e.g. have a particularly high degree of nuclease stability in conjunction with minimal modification. They also have significantly lower gradients • · • «9 9 • ·

19 to non-antisense effects that are often associated with the use of all-phosphothioate oligonucleotides (Stein and Krieg, 1994, Antisense Res. Dev. 4, 67). Partially modified oligonucleotides also exhibit higher binding affinity than allphosphothioate oligonucleotides.

In particular, the present invention relates to partially / minimally modified oligonucleotides. Exemplary formulas for modification of such partially modified oligonucleotides having the sequence of SEQ ID NO: 2. No. 11 are as follows:

HE 3: 5’- G * C * G C * T * G a * t * a G A * C * A T * C * A * T * G -3 ' HE 4: 5'- G * C * G C * T * G A * T * A G A * C * A T * C * A * T * G -3 ' HE 5: 5 '- G * C G C * T * G A * T * A G A * C * A T * C * A * T * G -3 ' HE 6: 5’- G * C G C * T G A * T * A G A * C * A T * C * A * T * G -3 ’ HE 7: 5 ^T - G * C * G C * T G a * t * a G A * C * A T * C * A * T * G -3 ' HE 8: 5'- G C * G C * T G A * T A G A * C * A T * C * C * A * T * G -3 ’ HE 9: 5'- G * C * G C * T G A * T * A G A * C * A T * C * C * A * T * G -3 '

HE 10: 5'- G * C * G * C * T G * T * A HE 11 : 5 ’ - G * C * T G A * T * j HE 12: 5'- G * C * * G * C * T G * T * A HE 13: 5'- G * C * G * C * T G * T * A HE 14: 5'- g * _c * g * c * t G * T * A HE 15: 5'- G * C * G * C * T * _g * A * T * A '

-3 '

-3 '

-3 '

-3 '

-3 '

Where it indicates the location of the internucleoside bridge modification, preferably it is a phosphothioate bridge.

Similar patterns of internucleoside bridge modifications are also possible with other oligonucleotides of the invention having different sequences, e.g., one of SEQ ID NOs. No. 4 to 16.

The oligonucleotides of the invention may have other types of modifications in addition to one type of modification. For example, a partially modified oligonucleotide that has modified some 99 99 99 99 99 99 internucleoside bridges, may additionally have other modifications, such as a modification of the β-ϋ-2'-deoxyribose unit and / or a modification of the natural nucleoside base.

Thus, another example of a particular embodiment of the present invention. The invention relates to a partially modified oligonucleotide having a nucleoside modification, eg a modification of a nucleoside base and / or a modification of a β-ϋ-2'-deoxyribose unit. Preferably, β-ϋ-2'-deoxyribose is replaced by 2'-O-alkylribose having an alkyl group of 1 to 6 carbon atoms, most preferably it is replaced by 2'-O-methylribose (ie β-ϋ-2'deoxyribonucleoside is replaced by 2 (-O-methylribonucleoside). Examples of such oligonucleotides having the sequence id. No. 11 show the following formulas of nucleoside modifications:

HE 16: 5’-GCGCTGATAGACATCCATG-3 ’ HE 17: 5 '-GCGCTGATAGACATCCATG-3 ’ HE 18: 5'-GCGCTGATAGACATCCATG-3 ' HE 19: 5 '-GCGCTGATAGA.CATCCATG-3' HE 20: 5 '-GCGCTGATAGACATCCATG-3' HE 21: 5 '-GCGCTGATAGACATCCATG-3' QN 22: 5 ’-GCGCTGATAGACATCCATG-3 ' HE 23: 5'-GCGCTGATAGACATCCATG-3 ' HE 2 4: 5'-GCGCTGATAGACATCCATG-3 ' HE 25: 5'-GCGCTGATAGACATCCATG-3 ' HE 26: 5'-GCGCTGATAGACATCCATG-3 ' HE 27: 5'-GCGCTGATAGACATCCATG-3 '

wherein N denotes the position of the modified nucleoside by modification of the nucleoside base and / or modification of the β-ϋ-2'-deoxyribose unit, preferably 2'-O-alkylribonucleoside, most preferably 2'O-methylribonucleoside). (In such case, T is 2'-O-alkyluridine, preferably 2'-O-methyluridine).

• · · · ·

Similar nucleoside modification patterns are also possible with other oligonucleotides of the invention having different sequences, e.g., one of SEQ ID NOs. No. 4 to 16.

In another preferred embodiment of the invention the oligonucleotide comprises modified intemucleoside bridges at certain positions (preferably phosphothioate bridges) and additionally modification of the nucleoside at a certain position, preferably deoxyribose with 2'-O-alkylribose containing 1 to 6 carbon atoms. β-ϋ-2'-deoxyribose is replaced by 2'-O-methylribose, in which case the oligonucleotide is a chimeric oligonucleotide that is composed of modified and unmodified DNA and RNA replacement with a β-ϋ-2's alkyl group. '-O-methyl moiety, and which contains phosphodiester and intemucleoside bridges and nucleosides ribonucleoside and β-ϋ-2'-deoxyribonucleoside.

Examples of such oligonucleotides having the sequence id. No. 11 and modifications of certain certain internucleoside bridges and in addition to certain certain nucleoside positions are as follows (serve as examples of modification patterns):

HE 28: 5 '- G * C * G C * T G A * T * A G A * C * A * T * C * C * A * T * G -3 ' HE 29: 5'- G * C * G C * T G A * T * A G A * C * A * T * C * C * A * T * G -3 ' HE 30: 5 '- G * C * G C * T G a * t * and g A * C * A * T * C * A * T * G-3 ' HE 31 . NO. 1 - G + C * G ί C * T 3 A * T * A G * C-A * T * C * A * T * G-3 HE 32: C f G * C * G C * T G A * T * A G A * C * A * T * C * C * A * T * G -3 ' HE 33: 5'- G * C * G C * T G A * T * A G A * C * A * T * C * C * A * T * G -3 ' HE 34: 5'- G * C * G C * T G A * T * A G A * C * A * T * C * C * A * T * G -3 ' HE 35: 5'- G * C * G C * T G A * T * A G A * C * A * T * C * C * A * T * G -3 ' HE 36: 5'- G * C * G C * T G A * T * A G A * C * A * T * C * C * A * T * G -3 '

«· · · · ·

ON 37: 5'- G * C * G C * T G A * T * A G A * C * A T * C * C * A * T * G -3 '

ON 38: 5'- G * C * GC * TGA * T * AGA * C * A * T * C * C * A * T * G -3 'where denotes position of modification of internucleoside bridge and N denotes position of modified nucleoside (ie modification of the nucleoside base and / or modification of the β-0-2 deoxyribose unit), preferably is a phosphothioate bridge and N is the position of the 2'-O-alkylribonucleoside, preferably 2'-O-methylribonucleoside. (In that case, T is 2'-O-alkyluridine, preferably 2'-O-methyluridine).

Comparable formulas of nucleoside modifications are also possible with other oligonucleotides of the invention having different sequences, e.g. one of SEQ ID NOs. No. 4 to 16.

The present invention also relates to derivatives wherein at least the nucleotide at the 3'-end is 2'-deoxynucleotide, such as e.g.

ON 39: 5'-G * C * G C * T G A * T * A G A * C * A T * C * C * A * T * G -3 'where and N have the same meaning as in the previous example.

In another preferred embodiment of the invention the oligonucleotides comprise a sugar-phosphate backbone modification, preferably by means of PNA units. Examples of such PNA.-DNA chimeras having the sequence id. No. 11 show the following modification formulas (for a general suggestion of these modifications, see EP 0 672 677):

ON 40: 5'-GCGCTGATAgacatccatg-3 '(Formula: DNA.-PNA.)

ON 41: 5'-GCGCTGatagacatccatg-3 '(Formula: DNA-PNA.)

ON 42: 5 '-gcgctgA.TA.GACAtccatg-3' (formula: PNA.-DNA-PNA.) Where lowercase letters indicate PNA units.

Other modification patterns are also possible, eg of the DNAPNA-DNA or PNA-DNA type. Similar modification patterns are also possible in the form of PHONA / DNA chimeras. These modification formulas can be combined to form a combination of these modifications patterns: 0 · 0 · 0 · 0 · 0 · 0 · 0 · 0 · 0 · 0 · 0 · 0 · 0 · 0 · 0 · 0 · 0 · with another type of modification, and of course, similar modification patterns are possible for other oligonucleotides of the invention having a different sequence, e.g., one of SEQ ID NOs. No. 4 to 16.

In another preferred embodiment of the invention, the oligonucleotide comprises a combination of a PNA unit replacement with a deoxyribonucleoside replacement, eg, 2'-O-alkyl-ribonucleosides. Examples of such oligonucleotides having the sequence id. No. 11 are as follows:

ON 43: 5'-GCGCTGATAGACatccatg-3 '

ON 4 4: 5'-GCGCTGATAGACATCCATG-3 '

ON 45: 5'-GCGCTGATAGACATCCAtg-3 '

ON 46: 5'-GCGCTGATAGACATCCAtg-3 '

ON 47: 5'-GCGCTGATAGACAtccatg-3 'where N is the position of the modified nucleoside, eg 2'-Oalkylribonucleoside with an alkyl group containing 1 to 6 carbon atoms, preferably 2'-O-methylribonucleoside (in which case T is 2'-O alkyluridine, preferably 2'-O-methyluridine) and lowercase designate PNA. units.

These oligonucleotides may of course be in their DNA. the parts also contain modifications of internucleoside bridges. E.g. the above oligonucleotides ON 40, ON 41, ON 42, ON 43, ON 44, ON 45, ON 46, and ON 47 may include internucleoside bridge modifications listed for oligonucleotides ON 1, ON 2, ON 3, ON 4, ON 5, ON 6, ON 7, ON 8, ON 9, ON 10, ON 11, ON 12, ON 13, ON 14 and ON 15 (combination of ON 40 to ON 47 oligonucleotide modification formulas with ON 1 to ON 15 oligonucleotide modification formulas) . Similar modification patterns are also possible with other oligonucleotides of the invention having different sequences, e.g. No. 4 to 16.

Another preferred embodiment of the invention provides oligonucleotides having one or more alkyl moieties containing 12 to 18 carbon atoms, preferably having an alkyl moiety containing 16 carbon atoms at the 3'- and / or 5'-end. The alkyl moiety containing 12 to 18 carbon atoms can be bound, for example, as a phosphodiester as described in the patent, EP 0 552 766 A2 or as O-CH ₂ -CH (OH) -O-alkyl containing 12 to 18 alkyl groups carbon atoms. A preferred embodiment is an oligonucleotide having an alkyl residue of 16 carbon atoms attached to its 3'- and / or 5'end. Document EP 0 552 766 A2 is incorporated herein by reference.

Examples of such oligonucleotides are ON 48 and ON 49 (Both have SEQ ID NO: 11 and internucleoside modifications at certain positions, similar to ON 1, plus an alkyl group containing 16 carbon atoms attached to the 3'- and / or 5'end. Such oligonucleotides may have other sequences and other patterns of modifications):

ON 48: 5'- G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * GC ₁₆ -3 '

ON 49: 5'- C _1S -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G -3 '

The present invention also relates to derivatives wherein the 3'-terminus is modified to triethylene glycol phosphodiester (TEG). An example of such an oligonucleotide is the following oligonucleotide of SEQ ID NO: 2. No. 11 and the formula of modifications as ON 39:

ON 50: 5 '~ G * C * G C * T G A * T * A G A * C * A T * C * C * A * T * Gp-TEG ~ 3'

In another specific embodiment of the invention, the oligonucleotide is linked via a linker to a 2'5'-linked oligoadenylate-5 '- (thio) phosphate. The linker may be, for example, an oligoethylene glycol phosphate, preferably a triethylene glycol phosphate, a tetraethylene glycol phosphate or a hexaethylene glycol phosphate residue. The 2'5'-linked oligoadenylate is preferably attached via its 2'-end as a tetra- or pentaadenylate whose 5'-hydropxyl functionality is substituted with a phosphate or thiophosphate moiety. 2'5'-oligoadenylate is known to induce RNase L cleavage of the target mRNA (Torrence et al., Proc. Natl. Acad. Sci. U.S.A. (1993) 90, 1300). 2'5'-oligoadenylate serves to activate ribonuclease L (RNase L), which then degrades VEGF mRNA. Also, a 2'5'-linked 3'-deoxyadenylate, derived from a Cordycepin analog, may be used in place of the 2'5'-linked adenylate. In such a case, the moiety that is complementary to the target nucleic acid is preferably modified at certain positions by a 2'-O-alkylribonucleoside (preferably 2'-O-methylribonucleoside) or PNA. Examples of such oligonucleotides, which may have e.g. No. 11, are ON 51 and ON 52 (these oligonucleotides may also have any other oligonucleotide sequence of the invention):

from a nucleoside oligonucleotide

ON 51: 5'-p * (2'5'-Co Co Co.) (teg) GCGCTGATAGACATCCATG -3 '

ON 52: 5'-p * - (2'5'-rA rA rA rA) (teg) GCGCTGATAGACATCCATG-3 'where teg is triethyleneglycol (linker), rA ribo-A (2'5'-linked adenylate,

Co is 3'-deoxy-A (Cordvcepin) (2'5'-bound 3'-deoxy adenylate) and p * is 5'-thiophosphate.

In addition, these oligonucleotides may have other modifications, eg, the oligonucleotide may have the formula by modifying the oligonucleotide ON 38 (these oligonucleotides may have any other pattern of modifications). Examples are:

- 26 ON 53: 5'-ρ * (2'5'-Co Co Co Co) (Teg) G * C * G * G * T * A * T * A G

A * C * A * T * C * C * A * T * G -3 '

ON 54: 5'-p * - (2'5'-rA * RA * RA * RA) * (teg) G * C * GC * TGA * T * AGA * C * A * T * C * C * A * T * G 3 ', where teg is triethyleneglycol (linker),

N is a modified nucleoside, preferably 2'-O-methylribonucleoside (in which case T is 2'-O-alkyluridine, preferably 2'-O-methyluridine), rA is ribo-A (2'5'-linked adenylate),

What is 3'-deoxy-A (Cordycepin) (2'5'-linked 3'-deoxy adenylate), p * is 5'-thiophosphate and is a modified internucleoside bridge, preferably a phosphothioate internucleoside bridge.

In a preferred embodiment, the oligonucleotide of the invention inhibits the expression of a target protein (which is VEGF) or a target sequence (a nucleic acid that encodes VEGF, preferably VEGF mRNA), respectively. Preferably, the oligonucleotide of the invention specifically inhibits VEGF expression. This results in a decrease in the level of VEGF protein as compared to unaffected expression. For example, specificity can be demonstrated by detecting the effect of the oligonucleotide of the invention on VEGF expression compared to the effect of the same oligonucleotide on beta-actin expression on mRNA and / or protein levels: only mRNA and / or VEGF protein levels were reduced mRNA and / or beta-actin protein levels (structural protein of the basic metabolic pathways, i.e. house-keeping protein) remained unchanged. In particular, the effect of the oligonucleotide can be demonstrated by determining the amount of VEGF mRNA and / or VEGF protein (e.g., when compared in a similar experiment without

Relativně Φ φ φφ φφ φφ can be a culture oligonucleotide). For example, the inhibitory action of an oligonucleotide can be determined in vitro by treating tissue cultures with an oligonucleotide. Then, for example, the level of mRNA in cell lysates can be determined, for example as described in Example 6. Level of VEGF protein (e.g., the absolute amount of VEGF protein in grams or e.g.

for example, as determined from the supernatant (e.g.

medium (amount of secreted VEGF) and / or membrane preparations (amount of membrane bound VEGF) and / or cell lysates. For example, the amount of secreted VEGF protein can be determined by ELISA, eg as described in Example 5.

In a particular embodiment of the invention, the oligonucleotide can inhibit VEGF mRNA expression. and / or reduce the level of VEGF protein, eg, in a cell culture with an IC ₅ of about 1 μΜ and / or 500 nM, 200 nM, 100 nM or less.

In another particular embodiment of the invention, the oligonucleotide of the invention, if only the oligonucleotide having the sequence of the invention, reduces the level of VEGF protein and / or VEGF mRNA. Compared to these specific oligonucleotides, these levels do not change to the same extent, if any, demonstrably altered when an oligonucleotide with a sequence containing mismatched positions or a mixed sequence is used. These oligonucleotides are inhibitions in these used as control oligonucleotides, such as ON 55 and ON 56 oligonucleotides. ON 55 is a mismatch control with respect to SEQ ID NO. No. 11, having the sequence of SEQ ID NO. No. 17 and phosphorothioate modifications at specific positions ("*"). ON 56 is a scrambled control with respect to SEQ ID NO. No. 11, having the sequence of SEQ ID NO. 18 and phosphorothioate modifications at particular positions ("*"). These two oligonucleotides are used, for example, in comparative experiments with ON 1 (Table 1 and Figure 2). Control oligonucleotides do not inhibit VEGF mRNA expression in cell culture at concentrations of 1 μΜ or less.

SEQ ID NO C. 17 with phosphothioate modifications in concrete positions (HE 55 ): ON 55: 5'-G * C * G A * C A * T * A * A * T * C * T * C * C * A * T * G-3 ' SEQ ID NO C. 18 with phosphothioate modifications in concrete positions (HE 56 ): ON 56: 5'-C * G * A A * G C * A * C * G * T * C * G * C * A T * T * G-3 '

In addition, the partially phosphorothioate oligonucleotide ON 1, which has natural nucleoside bases, exhibits a different pharmacological profile than the partial phosphothioate oligonucleotide, which additionally has C5-propynyluracil and C5-propynylcytosine as base replacements. The following base analogs C5-propynyluracil and C5-propynylcytosine have been described in WO 97/39120:

5'-G * C * GC * TGA * T * AGA * C * A * T * CC * A * T * G-3 'where C: 5-propynyl dC, T: 5-propynyl dU, and are phosphorothioate · bridges

Several oligonucleotides with different types of modifications (ON 1, ON 28, ON 29, ON 53 and ON 54) were tested. The results in Table 1 show that the oligonucleotides of the invention (right sequence and various types of modifications) effectively inhibit VEGF protein synthesis in cell culture relative to control oligonucleotides (ON 55, ON 56). As described in Example 4, the cells were treated with ON 1, ON 28, ON 29 oligonucleotides,

ON 53, ON 54, ON 55 and ON 56, and the supernatant was then tested

29 to the amount of secreted VEGF protein. In this cell-based assay, the ON 54 oligonucleotide showed the lowest IC 50 value of approximately 230 nM. Also, ON 1 and ON 29 showed very good IC ₅₀ values that were approximately 300 nM and IC ₅₀ values of 500 nM and 1500 nM were determined for ON29 and ON 53. All of the modified oligonucleotides of the invention that were tested showed much better results than control oligonucleotides ON55 and ON56 (IC 50> 3 μΜ). In addition, ONI was tested for its effect on mRNA levels. To reduce the mRNA concentration by 50%, an IC 50 of about 100 nM was found for ON 1. By comparison, for ON 55 and ON 56 having different sequences but the same type of modification and a similar type of modification, no effect on mRNA levels was found. Also, all three oligonucleotides (ON 1, ON 55 and ON 56) had no effect on β-actin mRNA levels. Thus, the effect of ON 1 is specific for VEGF mRNA and the effect for VEGF mRNA is specific for a particular oligonucleotide sequence. Moreover, this is an indication of the mechanism by which ON 1 acts. Because the level of VEGF mRNA is specifically reduced when treated with ON 1, binding of ON 1 to VEGF mRNA is most likely to activate RNase H or binding provides a substrate for RNase H. the mechanism of action that ultimately leads to a decrease in the level of VEGF protein may be different.

The oligonucleotide of the invention, when administered to a vertebrate, inhibits VEGF expression. Thus, the oligonucleotide of the invention has the ability to inhibit to some extent tumor growth

at vertebrate, OligonukJ especially u people be and mice use for treating ob ratlovce Leotid can in concentration 20 May mg / kg physical weight, conveniently in concentration 12 mg / kg physical or smaller,

most preferably at a concentration of about 4 mg / kg body weight or less (Table 2, Figure 3). In a particular embodiment of the invention, the oligonucleotide or its pharmaceutical has 9 9 9 9

9

The formulation has the ability to reduce tumor volume by at least 30%, preferably more than 50% compared to untreated individuals after 17 days of administering the oligonucleotide of the invention to the individual at a concentration of 4 or 12 mg / kg body weight. In order to determine the ability of an oligonucleotide to inhibit human tumor growth in a vertebrate, a non-human vertebrate study, preferably mice, may be performed. In such a study, prior to administration of the oligonucleotide, the tumor xenograft may grow, for example, from 1 to 4 days on a non-human vertebrate. The non-human vertebrate may be administered an oligonucleotide or a pharmaceutical composition thereof.

Preferably, the effect of oligonucleotide on tumor volume is determined using nude mice, with a U87-MG xenograft generated by implanting 2 x 10 0 U87-MG human cells on day 0. U87-MG xenografts on nude mice grow rapidly and U87-MG xenograft growth is dependent on VEGF.

The invention also relates to a process for preparing the oligonucleotide of the invention. The method of preparation involves chemical synthesis of the oligonucleotide. Preferably, the chemical synthesis is carried out by a known standard method used for oligonucleotide synthesis, for example by the Caruthers phosphoramidite method (Tetrahedron Letters, 24, 245, 1983), by the H-phosphonate method (Todd et al., J. Chem. Soc., 3291, 1957). ) or by the phosphotriester method (Sonveaux, Bioorg. Chem., 14, 274, 1986, Gait, MJ, Oligonucleotide Synthesis, A Practical Approach, IRL Press, Oxford, 1984) or by improved or modified methods derived from these standard methods. For example, an oligonucleotide of the invention may be prepared as described in Examples 1, 2 and 3. Preferably, the oligonucleotide of the invention is synthesized on a solid support by condensation of suitably protected monomers (eg nucleosides) to form internucleoside bridges between these monomers.

The present invention relates to a process for the preparation of an oligonucleotide or a derivative thereof, wherein the nucleotide unit, having a 3'- or 2 '4

4 · 4 · · · ···

The phosphorus (V) group and the free 5'-hydroxyl or mercapto group react with another nucleotide unit with a phosphorus (III) or phosphorus (V) group. at the 3 'position or its activated derivatives, and optionally using protective groups that can be temporarily introduced into oligonucleotides to protect additional functions and which are removed after synthesis before the oligonucleotide that has been cleaved from the solid support can optionally be converted to a physiologically tolerated salt.

In order to introduce modifications, the standard methods have been modified to some extent. These variations are known to those skilled in the art and have been described, for example, by Agrawal S. ("Protocols for Oligonucleotides and Analogs, Human Press, Inc., Totowa, New Jersey, USA, 1993). The preparation of modified oligonucleotides is also described in EP 0 710 667, EP 0 680 969, EP 0 464 638, EP 0 593 901, WO 95/01363, EP 0 672 677, EP 0 739 898 and EP 0 552 766. Methods for preparation modified oligonucleotides described in the above documents are incorporated by reference.

The invention further relates to a method of inhibiting VEGF expression and / or modulating the expression of a VEGF-encoding nucleic acid, wherein an oligonucleotide of the invention is contacted with a VEGF-encoding nucleic acid (e.g., mRNA, cDNA) and the oligonucleotide hybridizes (binds) thereto. encoding VEGF.

Thus, the invention also relates to a method wherein the oligonucleotide is contacted with nucleic acids encoding VEGF (eg, mRNA, cDNA), for example by introducing oligonucleotides into a cell by known methods, for example by incubating cells with said oligonucleotide or a formulation thereof. cell cyanogenesis, such as lipofectin, lipofectamine, Cellfectin or polycations (eg polylysine).

0 0 0 · · 0 0 ·

0000 0 * · 0 0

000 00 00 «0

- 32,000 »00 00 00 000 0 · 0000 00

For example, to introduce an oligonucleotide into a cell, an oligonucleotide that has been pre-incubated with Cellfectin for 30 minutes at room temperature is incubated for about 5 hours or less with the cells.

The invention further relates to the use of an oligonucleotide, preferably as an antisense oligonucleotide (binding of the oligonucleotide to the mRNA encoding VEGF) or as a ribozyme (binding to the mRNA encoding VEGF and cleavage of the mRNA). In another particular embodiment of the invention, the oligonucleotide can be used to induce cleavage of mRNA encoding VEGF by RNase H, and thus result in a decrease in VEGF expression.

The invention relates to the use of the oligonucleotide for modulating and also a complete or partial inhibition of VEGF expression), e.g. VEGF ₁₂ i VEGFiss VEGF _1S9, VEGF ₂₀₆₎ and / or its splice variants and / or mutants thereof, such as complete or partial inhibition of the mRNA translation encoding VEGF.

We have discovered the use of oligonucleotides to inhibit, prevent or modulate angiogenesis, neovascularization, tumor growth and metastasis, particularly in vertebrates. The invention generally relates to the use of the oligonucleotide of the invention for the treatment or prevention of diseases in which VEGF is overexpressed. Such diseases in which VEGF is overexpressed are, for example, cancer, age-dependent macular degeneration, diabetic retinopathy, psoriasis, rheumatoid arthritis, and other inflammatory diseases.

The invention further relates to the use of an oligonucleotide as a medicament and to the use of an oligonucleotide for the preparation of a pharmaceutical composition. In particular, the oligonucleotide may be used in a pharmaceutical composition which is used for the prevention and / or treatment of diseases associated with the expression or overexpression (overexpression) of VEGF and for the treatment of diseases in which VEGF is involved or its overexpression is causal factor.

· · · · · · · · · · · · · · · · · · ·

The invention further relates to a pharmaceutical composition comprising an oligonucleotide and / or its physiologically tolerated salts in addition to pharmaceutically acceptable excipients or excipients.

The invention relates to a pharmaceutical composition comprising at least one oligonucleotide according to the invention, which can be used for the treatment of diseases which are associated with abnormal vascular permeability, cell proliferation, cell permeation, angiogenesis, neovascularization, tumor cell growth and neoplastic cell metastasis.

The invention further relates to a process for the preparation of a pharmaceutical composition which comprises mixing one or more oligonucleotides of the invention with a physiologically acceptable excipient and optionally other substances, e.g., if appropriate, with suitable additives and / or excipients.

In particular, the invention relates to the use of an oligonucleotide or a pharmaceutical composition prepared for the treatment of cancer, e.g. for inhibiting tumor growth and tumor metastases, and for the treatment of diabetic retinopathy, age-dependent macular degeneration, psoriasis, rheumatoid arthritis and other inflammatory diseases. For example, an oligonucleotide or a pharmaceutical composition prepared therefrom may be used to treat solid tumors such as breast cancer, lung cancer, head and neck cancer, brain cancer, abdominal cancer, colon cancer, colorectal cancer, esophageal cancer, gastrointestinal cancer, glioma, liver carcinoma, tongue carcinoma, neuroblastoma, osteosarcoma, ovarian carcinoma, pancreatic carcinoma, prostate carcinoma, retinoblastoma, Wilms' tumor, multiple myeloma, and for the treatment of skin cancer such as meianoma, for the treatment of lymphomas and blood cancer. The invention further relates to the use of an oligonucleotide of the invention or a pharmaceutical composition prepared therefrom for inhibiting VEGF expression and / or for inhibiting accumulation of ascites fluid and pleural effusion in various types.

Carcinomas such as breast cancer, lung cancer, neck cancer, brain cancer, abdominal cancer, colon cancer, colorectal cancer, gastrointestinal tongue cancer, neuroblastoma , cancer, oesophageal cancer, glioma, liver cancer, osteosarcoma, ovaries, prostate cancer, cancer

Due to the inhibitory fluid of pancreatic ascites, carcinoma retinoblastoma, Wilms' tumor, multiple myeloma, skin, melanoma, lymphomas and blood cancer. acting on VEGF expression and / or the formation and pleural effusion may enhance the oligonucleotide of the invention or the pharmaceutical composition prepared therefrom. In a preferred embodiment of the invention, the oligonucleotide of the invention or a pharmaceutical composition prepared therefrom may inhibit the accumulation of ascites fluid in ovarian cancer.

The invention further relates to the use of the oligonucleotides of the invention or a pharmaceutical preparation thereof, for example for the treatment of cancer or for the prevention of tumor metastasis, or for the treatment of age-dependent macular degeneration, rheumatoid arthritis, psoriasis, and diabetic retinopathy in combination with other drugs and / or other treatment methods, eg known drugs and / or known treatment methods, such as those currently used to treat cancer and / or to prevent tumor metastases. A combination of radiation therapy and chemotherapeutic agents such as cisplatin, cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or tamoxifen is preferred.

The oligonucleotide and / or its physiologically tolerated salt can be administered to the animal, preferably to a mammal, and in particular to a human, alone, in admixture with another oligonucleotide (or physiologically tolerated salt), or in the form of a pharmaceutical formulation that allows local, percutaneous, parenteral or enteral The method of the present invention comprises, as an active ingredient, an effective dose of at least one oligonucleotide in addition to the usual pharmaceutically acceptable excipients and excipients. This pharmaceutical composition normally contains about 0.1 to 90% (by weight) of the therapeutically active oligonucleotide (s). The dose may vary within wide limits and is adjusted to the individual situation in each individual case. In the treatment of psoriasis, topical use is preferred. In the case of cancer, infusions, oral and rectal administration or nasal aerosol administration, preferably in the case of lung cancer, are preferred, while in the case of diabetic retinopathy, local, vitreous and oral administration is preferred.

The pharmaceutical composition can be prepared in a known manner (eg Remingtons Pharmaceutical Siences, Mack Publ. Co., Easton, PA, 1985) using pharmaceutically inert inorganic and / or organic excipients. For the preparation of siloules, tablets, coated tablets and hardeners

For example, if sucrose, the capsule excipients may be lactose, corn starch and / or derivatives thereof, talc, stearic acid and / or salts thereof, and the like. Examples of excipients for soft gelatin capsules and / or suppositories are fats, waxes, semi-solid and liquid polyols, natural and / or hardened oils and the like. Examples of suitable excipients for preparing solutions and / or syrups are water, invert saccharide, glucose, polyols and the like. Suitable for preparing injectable solutions are water, alcohols, glycerol, polyols, vegetable oils and the like. Suitable excipients for microcapsules, implants and / or sticks are mixed polymers of glycolic acid and lactic acid. In addition, liposome formulations such as those described by N. Weiner (Drug Develop. Ind. Pharm., 15, 1523, 1989, "Liposome").

Dermatics, Springer Verlag, 1992) and Hayashi (Gene Therapy, 3, 878, 1996). The pharmaceutical composition may also include a formulation that enhances the oral availability of oligonucleotides, such as intestinal enhancers.

- 36 permeabilization, eg mannitol, urea, bile acids such as CDCA (chenodeoxocholate) (2%).

Cutaneous administration can also be performed, for example, using iontophoretic methods and / or by electroporation. In addition, lipofectins and other carrier systems, for example those used in gene therapy, may be used. Systems that can be used to introduce oligonucleotides in a highly efficient manner into eukaryotic cells or into nuclei of eukaryotic cells are particularly suitable. The pharmaceutical composition may also comprise two or more different oligonucleotides and / or their physiologically tolerated salts and, in addition to at least one oligonucleotide, one or more different therapeutically active ingredients.

In addition to the active ingredients and excipients, the pharmaceutical composition may also contain additives such as fillers, fillers, disintegrants, binders, lubricants, wetting agents, stabilizers, emulsifiers, preservatives, sweeteners, colorants, flavors or flavoring agents, thickeners, diluents or buffering agents, and in addition, diluents and / or solvents and / or agents for achieving a slow-release effect, as well as salts for varying the osmotic pressure, coating agents and / or antioxidants.

The dose may vary within wide limits and is adjusted to the individual situation in each individual case. The pharmaceutical composition may also include a formulation that enhances the oral availability of oligonucleotides, such as intestinal permeabilization enhancers, eg, mannitol, urea, bile acids, such as CDCA (2%).

The invention relates to a pharmaceutical composition comprising at least one oligonucleotide of the invention which can be used for the treatment of diseases associated with abnormal cell proliferation, cell permeation, vascular permeability, angiogenesis, vessel cell growth

37 and neoplastic cell metastases. These pharmaceutical compositions can be used to treat and prevent cancer and cancer metastasis, to treat and prevent psoriasis, and to treat diabetic retinopathy.

Description of the picture

Figure 1: Quantification of VEGF mRNA in U87-MG tumor xenografts grown in mice treated

ON 1.

Tumors were implanted by subcutaneous (sc) injection of x 10 0 U87-MG tumor cells in the flank of each mouse on day 0. Daily IV treatment with ON 1 began on day 4. Tumors were collected on day 18. In tumor sections, mRNA expression levels were tested by in situ hybridization with a ³⁵ S VEGF cRNA probe. In a representative section from each tumor, VEGF mRNA was quantified and expressed as a percentage of the region with a hybridized radioactive probe greater than 111 dpm / mm ^{* 2} . With two exceptions, there was a clear decrease in VEGF expression in tumors from treated animals (relative to control animals).

Figure 2: summarizes the results of the concentration-dependent effect of different oligonucleotides on VEGF mRNA levels in cells treated with ON 1, ON 55 (mismatch), and ON 56 (scrambled) oligonucleotides. VEGF mRNA. was quantified using an ABI Prism 7700 Sequence Detector. The concentration-dependent effect on the amount of VEGF mRNA relative to control cells not treated with oligonucleotides is shown as "1 / times the difference (relative to untreated controls) versus" oligonucleotide concentration [μΜ ] (from left to right: ON 1: column 1 to 6, ON 55: column 7 to 12, ON 56: column 13 to 18, controls: column 19 (no oligonucleotide) • φ • «• * · · φ

- 38 ·· φφφ φφ φφφφ φ · φφφ a 20 (Cellfectin only). The mismatch (ON 55) and the scarred (ON 56) controls had no significant effect on VEGF mRNA levels either at low or high oligonucleotide concentrations, while ON 1 reduced VEGF mRNA levels (i.e., reduced the number of PCR cycles necessary to reach the detection threshold). PCR product). The effect of ON 1 on VEGF mRNA levels was concentration-dependent. For each data point, n = 4, the vertical bars represent the standard deviation.

Figure 3: Figure 3 shows the in vivo results of ON 1 on tumor xenografts.

This figure summarizes the tumor weights (grams) found on day 18 (U87-MG xenografts were implanted on day 0) - each point in this figure shows the tumor weight that was found in each nude mouse. Nude mice were i.v. daily. treated with ON 1 at either a mg / kg, 4 mg / kg or r2 mg / kg concentration: tne str

Figure 4: Inhibition of VEGF secretion in HT-29 cells by ON 50 after 24 hours (Example 9).

The figure shows the effect of ON 50 concentration-dependent on VEGF secretion by HT-29 cells 24 hours after treatment (% inhibition of controls as determined by Elisa / Cyquant).

Figure 5: Inhibition of tumor growth by ON 38. Daily oral treatment of nude mice bearing U87-MG xenografts with ON 39. The figure shows a concentration-dependent reduction in tumor volume (mnvj after 27 days of oral administration of ON 39. "· control (no treatment), "the treatment with 3 mg 39 oN / kg body weight (mg / kg) ^of treatment with 10 mg / kg, <treatment with 30 mg / kg.

* · •

- 39 • · ··· · · ·······

DETAILED DESCRIPTION OF THE INVENTION

Example 1

Synthesis of oligonucleotides

Oligonucleotides (ONs) were synthesized using an automated DNA synthesizer Applied Biosystems 3'94 DNA Syntehetizer (Perkin ELmer Applied Biosystems, Inc., Foster City, USA) using standard phosphoramidite chemical synthesis techniques (see, e.g., F. Eckstein (Ed.) "Oligonucleotides and Analogues, A Practical Approach, IRL Press, Oxford, 1991). After condensation, the phosphothioate linkages were introduced by sulfurization with Beaucage reagent followed by blocking with acetic anhydride and N-methylimidazole. After cleavage from the solid support and final deprotection with concentrated ammonia, they were purified by gel electrophoresis. 2'-O-methyl-modified oligonucleotides by replacing standard cycles of 2'-O-methylribopolyacrylamide oligonucleotides were prepared by phosphoramidites in the corresponding nucleoside phosphoramidites. All oligonucleotides were analyzed by negative ion mass spectroscopy

Fisions BioQ), calculated by weight.

electrosprav mass spectroscopy, all cases confirmed by C16-modified oligonucleotides were synthesized using hexadecyloxy (cyanoethoxy) N, N-diisopropyaminophosphane as the phosphitlating agent in the last step of the oligonucleotide instead of the standard amidite, or or synthesis began on a solid derivative correspondingly derivatized. The tetraethyl glycol linker is available from Glenn Research Corporation. Adenosine or cordycepin 2'-phosphoamidite were obtained from Chem Genes Corp. and Cemogen Corp. The introduction of the 5'-phosphate or thiophosphate moiety was carried out according to the synthesis described above, such that

- 40 in Uhlman and Engels, 1986, Tetrahedron Lett. 27, 1023.

Oligonucleotide analysis was performed in several ways:

(a) analytical gel electrophoresis on 20% acrylamide with 8M urea, 45 μΜ Tris-borate buffer, pH 7,0 and / or

b) HPLC analysis on a Waters GenPak FAX column, gradient: CHLCH (400 mL), H ₂ O (1.6 L), NaH ₂ PO ₄ (3.1 g), NaCl (11.7 g), pH 6, 8 (0.1 M NaCl) followed by CH ₃ CH (400 mL), H ₂ O (1.6 L), NaH ₂ PO ₄ (3.1 g), NaCl (175.3 g), pH 6.8 (1.5M NaCl) and / or

(c) capillary electrophoresis using a Beckmann eCAP ™ U100P capillary gel column, 65 cm long, 100 mm internal diameter, 15 cm window from one end, buffer: 140 μΜ Tris, 360 mM borate, 7M urea) and / or

(d) Negative electron spray mass spectroscopy, which in all cases confirmed the expected molecular mass.

The methods of analysis of oligonucleotides a) to d) used are known to those skilled in the art. These methods have already been described (eg, in Scnweitzrt and Engel, Analysis of oligonucleotides, from Antisense-Technology Technology to Therapy, A Laboratory Manual and Textbook, Schlingensiepen et al., Eds., Biol. Science, Vol. 6 (1997) ), pp. 78-103).

The following oligonucleotides were prepared:

HE 62 HE 63 CN 64 HE 65 HE 6 6 HE 67 HE 68 HE 1: HE 69

'-G * T * A * C * C * TAC * AGA * TAGT * C * GC * GT * C * GAT' * GAC * GGT * AGG-5 '3'-C * C * T * AC * AGAT * AGT * C * GC * GT * C * GAT * GAC * G * G-5 '

3'-C * A * GA * TAGT * C * G * CG * GAT * GAC * G * G-5 '' -A * G '* T * CGC * GT * C * GA * T * GAC ^< G ' ^{: r} G-5'

3'-C * T * A * CAGA * TAGT * C * GC * GT * C * G-5 '' -G * T * AC * C * TAC * AGA.T * GA.T * GAC * G * G-5 '

3'-G * T * AC * C * TAT * AGAT * AGT * C * GC * G * T-5 '

3'-G * T * A * C * C * TA * C * AGA * T * AGT * CG * C * G ~ 5 '' -G * T * A * C * C * TA * C * AGA * T * AGT * C * G * C-5 '

- 41 ON 70: 3'-A * C * C * T * AC * AGA * T * AGT * C * G * C * G-5 '

ON 71: 3'-G * T * A * C * C * T * C * AGA * T * AG * T * C * G-5 '

ON 72: 3'-T * A * C * C * T * AGA * T * AG * T * CG * C * G-5 '

ON 73: 3'-T * A * C * C * T * AGA * T * AG * T * C * G * C-5 '

ON 8: 5'- G C * G C * T G A * T A G A * C * A T * C * C A * T * G -3 '

ON 9: 5'- G * C * G C * T G A * T * A G A * C * A T * C * C A * T * G -3 '

ON 10: 5'- G * C * GC * TGA * T * AGA * C * A * T * CC * A * T * G -3 'ON 11: 5'- G * C * G * C * TGA * T * AGA * C * AT * C * C * A * T * G -3 'ON 12: 5'- G * C * G * C * TGA * T * AGA * CA * T * C * C * A * T * G -3 '

ON 13: 5´- G * C * G * T * A * T * A * A * C * A * T * C * A * T * G -3 '

ON 14: 5'- G * C * G * C * T G A * T * A G A * C * A * T * C * C * A * T * G -3 '

ON 15: 5'- G * C G * C * T * G * A * T * A * G * A * C * A * T * C * C * A * T * G -3 '

ON 2: 5'- G * C G * C * T * G * A * T * A G * A * C * A * T * C * C * A * T * G -3 '

ON 28: 5'- G * C * G C * T G A * T * A G A * C * A T * C * C * A * T * G -3 '

HE 29: 5'- G * C * G * C * T G * T * A G A * C * A T * C * C * A * T * G -3 ' HE 30: 5’- G * C * G * C * T G * T * A G A * C * A T * C * A * T * G-3 ' HE 31 5 ' - G * C * G * T * A * T * A * A * C * A * T * C * A * T * G-3 ' HE 32: 5’- G * C * G * C * T G * T * A G A * C * A T * C * C * A * T * G -3 ' HE 33: 5'- G * C * G * C * T G * T * A G A * C * A T * C * C * A * T * G -3 HE 34: 5'- G * C * G * C * T G * T * A G A * C * A T * C * C * A * T * G -3 ' HE 35: 5'- G * C * G * C * T G * T * A G A * C * A t * c * C * A * T * G -3 ' HE 36: 5 i _ G * C * G * C * T G * T * A G A * C * A T * C * C * A * T * G -3 ' HE 37: 5’- G * C * G * C * T G * T * A G A * C * A T * C * C * A * T * G -3 ' HE 48: 5'- G * C * G * C * T G * T * A G A * C * A T * C * C * A * T * G-C ·;

ON 49: 5'- C _1S -G * C * GC * TGA * T * AGA * C * AT * C * C * A * T * G -3 '

ON 53: 5'-p * (2'5'-Whats What) (teg) G * C * G * G * T * A * T * A G

A * C * A * T * C * C * A * T * G

- 42 · »··· ·· ········

ON 54: 5'-r * - (2 ¹ 5'-rA * rA * rA * rA) * (teg) G * C * GC * TGA * T * AGA * C * A * T * C * C * A * T * G-3 'where teg is triethyleneglycol (linker),

N is a modified nucleoside, preferably 2'-O-methylribonucleoside (in which case T is 2'-O-alkyluridine, preferably 2'-O-methyluridine), rA is ribo-A (2'5'-linked adenylate),

What is 3'-deoxy-A (Cordycepin) (2'5'-linked 3'-deoxy adenylate), p * is 5'-thiophosphate and * is phosphothioate internucleoside bridge.

Example 2

Detailed description of oligonucleotide synthesis (01, τ 1)

ON 1: 5´- G * C * G * T * A * T * A * A * C * A * T * C * A * T * G -3 '(where is phosphothioate)

A partially phosphorothioate oligonucleotide ON 1 with 12 internucleoside phosphothioate linkages was synthesized using an Applied Biosystems 394 DNA Synthesizer (Perkin ELmer Applied Biosystems, Inc., Foster City, USA) using a sintered CPG (Controlled Pore Glass) carrier. The aminopropyl CPG was charged with 200 pmol of 5'-O-dimethoxytrityl-N ² -isobutyroldeoxyguanosine-3'-O-succinate. After removal of the 5'-dimethoxytrityl group by 3% trichloroacetic acid in dichloromethane, the second base (T) was condensed using the corresponding 5'-O-dimethoxytritylthymidine-3'-O- (cyanoethoxy) -N, N-diisopropylaminophosphoramidite in synthetic cycles according to the manufacturer's instructions (ABI). For the introduction of 3H-, 1,2-benzodithiol-3-one phosphothioate linkages •

- 43 ·· ··· ·· · · · ·

1,1-dioxod (0.075M Beaucage reagent) was used in the synthetic cycle instead of iodine / pyridine / water, which is used to introduce a phosphodiester bond. The blocking reaction with acetic anhydride was carried out immediately after the condensation reaction in the case of phosphodiesters, but in the case of phosphothioate linkages up to Beaucage sulfurization. After completion of the chain extension, the oligonucleotide was cleaved from CPG and deprotected by treatment with 150 ml of concentrated ammonia oligonucleotide for (19200 OD ₂₆₀ ) hours at 50 ° C. The crude was purified by precipitation from n-butanol and then using FPLC on a Q Sepharose® High Performance column (60/100, Pharmacia) on a Pharmacia BioPilot system.

The oligonucleotide was eluted with a gradient of 0.45 to 1.0 M NaCl in 10 mM NaOH pH 12.0 over 77 minutes. Fractions containing the oligonucleotide were analyzed by HPLC on a Gen column (Buffer

Ά: 10mM

Then FAX (Millipore-Waters) with NaCl NaH ₂ PO ₄ gradient, 100mM NaCl in acetonitrile / water = 1: 4 (v / v), pH 6.8, 10M NaH ₂ PO 4, 1.5M NaCl in acetonitrile / water = 1: 4 5 to 44% B in 30 minutes. The homogeneous fractions were (5660 OD ₂₆ °) and desalted by ultrafiltration. After the second desalting step by precipitation from ethanol / isopropanol and lyophilization, the oligonucleotide was obtained as a white foam (165 mg). The oligonucleotide was then characterized by electron mass spray buffer B: (v / v), pooled by negative spectroscopy 6005, 6, measured 6006, 1).

(calculated

Further, the oligonucleotide was characterized by capillary electrophoresis on a polyacrylamide gel (U100P gel capillary, Beckmann Instruments, ID 100 gm, buffer: 7M urea, 140mM Trisborate) by application (1 OD / ml) at 10 kV for 4 seconds and then the electrophoretogram was developed for 40 minutes at a constant voltage of 11 kV.

- 44 ·

Example 3

Detailed description of oligonucleotide 28 (ON 28) synthesis:

ON 28: 5'- G * C * G C * T G A * T * A G A * C * A T * C * C * A * T * G -3 '(where is phosphothioate, N is 2'-O-methylribonucleoside and T is

2'-O-methyl-U)

The partially 2'-O-methyl-modified oligonucleotide was synthesized as described in Example 2, starting from CPG carrier loaded with 5'-O-dimethoxytrityl-N ² isobutyroldeoxyguanosine-3'-O-succinate. To introduce 2'-O-methylribonucleosides, the corresponding 2'-O-methyl-3'-phosphoamidite was condensed instead of normal deoxynucleoside-3'-phosphoamidite. The crude oligonucleotide (18700 OD ₂ so) was purified by precipitation from n-butanol (594 mg). The oligonucleotide was then characterized by negative electron spray mass spectroscopy (calculated 6293.9 measured 6292.9).

Example 4

Treatment of cells with antisense oligonucleotides

Cells were plated in 96-well plates at 30000 cells / well in 150 μΐ well per well (type of cell-dependent media). The following day Cellfectin (GibcoBRL) was diluted to 400 pg / ml in water (solution A), oligonucleotides were diluted to a concentration 40 times higher than the desired (4OX) in water (solution B). Then equal amounts of solution A and solution B of the desired volume were mixed, so that the Cellfectin concentration was 200 µg / ml and the oligonucleotide concentration was 20X, and the mixture was left at room temperature for 30 minutes. Then 19 volumes of Optimem medium were added

45 (Gibco BRL) so that a solution with a concentration of Cellfectin of 10 pg / ml and oligonucleotide IX (solution C) was obtained. The media was removed from the cells, the wells were rinsed twice with Optimem medium and 150 μΐ of solution C was added to each well, and the plates were again incubated at 37 ° C and 5% CO ₂ . After 5 hours the Cellfectin / oligonucleotide solution was removed and replaced with 150 μΐ of normal growth medium. VEGF protein and VEGF mRNA analyzes were performed 19 hours later.

Example 5

VEGF Protein Assay

Samples (from Example 4) of conditioned media were taken from the desired wells and assayed for human VEGF using the human VEGF ELISA kit (from R&D Systems). The test protocol was included in the kit.

Example 6

VEGF mRNA assay

Media was removed from the 96-well plates of Example 4 and cell lysates were prepared to quantify VEGF mRNA using an Applied Biosystems 7700 Analyzer.

The mRNA quantification was performed as follows. The mRNA was isolated from the cells and cDNA was prepared using the PolyATract 9600 mRNA Isolation and cDNA Synthesis System (Promega, Catalog No. Z 3790). The procedure described by the manufacturer in the enclosed instructions has been followed.

• · · · ·

The quantity of VEGF mRNA was measured using the Perkin Elmer / Applied Biosystems ABI Prism 7700 Sequence Detection System. A PCR Applied Biosystems TaqMan ™ Reagent Kit (Catalog # N808-0230) was used to prepare the PCR reaction. A reagent kit was used to prepare a control reaction with β-actin

Elmer / Applied Biosystems β-actin # 401846). Resulting (catalog.

normalized to β-actin control PCR data by Perkin

PCR Control Reagents data for VEGF was The sequences of the fluorescently labeled probes and primers for VEGF were as follows:

SEQ ID NO. No. 20: Probe '- TCAGCGCAGCTACTGCCATCCAAT-TAMRA-3' (5 '3')

SEQ ID NO. No. 21: Direct primer

5'- GGA GGG CAG CAT CAT GAA -3 '(5' -> 3 ')

SEQ ID NO. No. 22: Reverse primer

5'- AGG GTA CTC CTG GAA GAT CAC -3 '(5' -4 3 ')

Example 7

Determination of _IC50 values

IC ₅₀ values were calculated based on 100% of the amount of VEGF protein or VEGF mRNA in cells treated with Cellfectin but without oligonucleotides.

Φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ

Example 8

Studies i vivo

Experiments were performed with 4-6 week old female nude (nu / nu) mice. Tumors were induced by subcutaneous cell implantation (2,000,000 U87-MG cells at 200 μΐ). The oligonucleotides were dissolved in phosphate buffered saline and injected subcutaneously or intravenously (into the tail) in a volume of 100 μΐ. some oligonucleotides were also tested by oral administration.

Tumor cells were implanted s.c. on day 0. Treatment was carried out daily iv. by administering (to the vessel in the tail) oligonucleotides. Each group contained 6 to 10 animals.

When used to treat ON 1 mice, tumor growth was inhibited / reduced at a concentration of 4-12 mg oligonucleotides per kg body weight. ON1 significantly inhibited, in a dose-dependent manner, the growth of U87-MG tumor xenografts growing subcutaneously in nude mice when the oligonucleotide was administered daily s.c. or i.v. injections. This is clearly demonstrated by the results presented in Table 2.

At the end of the study, tumors were embedded in paraffin, sectioned, and VEGF mRNA expression was evaluated by in situ hybridization. The amount of VEGE mRNA varied within the tumor, some regions showed very high expression, and in some regions it was not detectable. Therefore, VEGF mRNA expression in tumors was quantified by expressing the percentage of high expression area. Treatment with ON 1 resulted in a dramatic decrease in the level of VEGF mRNA in tumors when analyzed in this manner (Fig. 1). Tumor microvessel density in this study was evaluated by factor VIII staining. There was only a slight decrease in the number of vessels per unit area of tumor in treated animals. However, there was a marked reduction in the vessel size in tumors in treated animals.

9 9

9 9 9 t

Example 9

In vitro studies

Cell culture

HT-29 cells were cultured in RPMI-1640 medium with 10% FBS, 10 µg / ml gentamicin and 1 mM L-glutamine.

Treatment of cells with antisense oligonucleotides

On day 1, cells were plated in 96-well plates at 30,000 cells per well. On day 2, cells were treated with an oligonucleotide with 10 gg / ml Cellfectin (Gibco BRL) as a cell intake enhancing agent. Cellfectin / oligonucleotide complexes were prepared by first diluting Cellfectin and ON to a 40 concentration higher than desired (40X), then mixing these solutions at a ratio of 1: 1 so that both cellfectin and oligonucleotide concentrations were 20X. Dilution was performed with ddH ₂ O. The complex formation was then continued for 30 minutes at room temperature, then the mixture was diluted to a concentration of 1X by adding 19 volumes of Optimem medium (Gibco BRL). Cells were rinsed 2x with Optimem medium and 150 μΐ of cellfectin / oligonucleotide complex solution was added to each well. the plates were then incubated again at 37 ° C and 5% CO ₂ . After 5 hours the Cellfectin / oligonucleotide solution was removed and replaced with 150 μΐ of normal growth medium.

ELISA assay for VEGF

VEGF secreted by cells into the medium was quantified using the Quantikine ELISA kit of human VEGF (from R&D Systems). 100 μ bylo of HT-29 cell medium and 25 μΐ of U87-MG cell medium were used in the assay. After removing the medium for the ELISA test was from the remaining media were removed and the plates were frozen at -80 ° C and cell counts were determined using the CyQUANT Molecular Probes kit.

Data analysis

The A ₄₅₀ readings in the ELISA assay were converted to VEGF in pg / ml using a standard curve that was measured on the same ELISA. platičce. These values were normalized so that the VEGF value in pg / ml in each well was divided by the CyQUANT assay value for the same well. Then, the mean values (n = 3 for each step point, m of the controls where n = 6) and the standard deviations were calculated. Data were plotted as percent of control (with control = Cellfectin without oligonucleotide), the vertical bars in the graph represent the standard deviation.

Example 10

In vivo studies

Preparation of compounds

Compounds were stored at -20 ° C in a solid state lyophilized in 25 or 50 mg aliquots. When appropriate, an aliquot was dissolved in Balanced Hanks' Solution (HBSS) to a concentration of 1.25 mg / ml. Dissolved compounds were stored for up to 7 days at 4 ° C.

Animal treatment.

Tumor transplant cells were cultured in tissue culture flasks in the media described above. HT-29 cells were harvested by EDTA treatment, U87-MG cells were harvested by trypsin / EDTA treatment. Tumors were implanted by subcutaneous injection of 5,000,000 cells in the flanks of each mouse in 5 mice. t T 1 * u u u u u u u u u T T T T T T T ««

- 50 100 μΐ HBSS. Treatment oligonucleotides were administered in 200 μΐ doses by iv injection into the tail vessel or by oral gavage. The dose was administered daily starting on the day of tumor implantation. Animals in the control group were not treated. Animals were housed in micro-isolation cages, one group per group (n = 6 in each group). Individual animals were sacrificed when the tumors ulcerated, which is typical for tumors exceeding 500-600 mm ³ .

- 51 Table 1

oli tid gonukleo Type ic ₅₀ VEG5 secretion ic ₅₀ mRNA VEGF IC ₅₀ mRNA β-actin HE 1 partial PS 300 nM 100 ALIGN! hM HE 28 2'-0- methylribone ukleoside, partly PS 300 nM HE 29 2 '-O- methylribon ukleoside chimera, part tangentially PS 500 nM HE 39 300 nM HE 53 2'5 '(Co) ₄ conjugate all-2'-O-methyl 150C nM HE 54 2'5 '(rA) _4- 230nM all-2'-O-methyl conjugate HE 55 4XMatch > 3 μΜ without effect without effect due to on surface on surface control THEY, partly PS mRNA mRNA HE 56 mixed > 3 μΜ without effect without effect control on surface on surface sequence (relative to ONI), partially PS mRNA mRNA

PS stands for Phosphothioate Internucleoside Bridge

Table 2

Tumor volume reduction after ON 1 treatment:

Tumors were implanted into mice by sc injection of 2x10 ^with U87-MG cells on day 0. Oligonucleotide treatment began on day 4. the oligonucleotide was administered daily by iv injection into the tail vessel. Each group contained 6 to 10 mice. Data are presented as mean ± SE (standard deviation).

Day daily intravenous injection 0 mg / kg 4 mg / kg 12 mg / kg obj em ± SE obj em ± SE obj em ± SE 0 0 0 0 0 0 0 6 31 3 30 3 26 3 11 123 16 69 14 39 4 17 868 171 344 70 236 54

Drug administration started in all groups Day 4 Drug was administered i.v. by tail injection tumor model: 2,000,000 U87-MG cells implanted subcutaneously on day 0 tumor volume was determined on day 17

Table 3

Nucleotide sequence of human VEGF (SEQ ID NO: 19)

CAGTGTGCTGGCGGCCCGGCGCGAGCCGGCCCGGCCCCGGTCGGGCCTCCGAAACC

ATGAACTTTCTGCTGTCTTGGGTGCATTGGAGCCTCGCCTTGCTGCTCTACCTCCA

C CAT GCC AAG TGGTCCC AG GCTGC AC CC AT GGC AG AAG G AGG G CAG AAT CAT C AC GAAGT GG T GAAG Τ T CAT GGAT GTC TAT CAGC GCAGC TAC T GCCAT CCAATC GAG AC CCTGGTG GAC AT C Τ TC CAG G AG T AC CCTG G TC AAGC C

ATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGACGAGGGCCTGGAGT

GTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATTATGCGGATCAAACCTCAC

CAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAACAAATGTGAATGCAG

ACCAAAGAAAGATAGAGCAAGACAAGAAAATC

- 53 »4 4 4 λ

Table 4

Inhibition of HT-29 growth in nude mice after daily oral administration of VEGF antisense oligonucleotide ON 50

Days after Obj em tumor Obj em tumor Obj em tumor implan- untreated animals of animals treated of animals treated taci (± s.o.) 3 mg / kg ON 50 10 mg / kg ON 50 tumor (± s.o.) (± s.o.) 4 46 (5) 19 Dec (4) 22nd (3) 8 100 ALIGN! Italy (11) 32 (6) 27 Mar: (3) 11 136 (20) 70 Italy (9) 56 (5) 15 Dec 229 (29) 95 (14) 85 (5) 18 284 (41) 115 (18) '119 Italy (11) 21 364 (61) 136 (12) 146 (18)

- 54 Sequence List • 9 9 9 9 9 9

(2) INFORMATION FOR SEQUENCE WITH IDENTIFICATION NUMBER 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 bp (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic (iv) REVERSE ORIENTATION: yes (ix)

(A) NAME / LABEL: exon (B) POSITION: 1..19 (xi) SEQUENCE DESCRIPTION: SEQUENCE WITH IDENTIFICATION NUMBER 1:

GCGCTGATAG ACATCCATG 19

INFORMATION FOR THE SEQUENCE

IDENTIFICATION NUMBER 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 33 pairs of baffles (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic (ix) FEATURES:

(A) NAME / LABEL: exon (B) POSITION: 1..33 (xi) SEQUENCE DESCRIPTION: SEQUENCE WITH IDENTIFICATION NUMBER 2:

CATGGATGTC TATCAGCGCA GCTACTGCCA TCC (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 pairs of baffles (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid «· · · · · ········ * · L l l.....

• · · · · · · · · · · · · · · · · · · ·

- 55 (A) DESCRIPTION: / desc = "synthetic (ix) CHARACTERS:

(A) NAME / LABEL: exon (B) POSITION: 1..19 (xi) SEQUENCE DESCRIPTION: SEQUENCE WITH IDENTIFICATION NUMBER 3:

CATGGATGTC TATCAGCGC 19 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 33 pairs of baffles (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic (iv) REVERSE ORIENTATION: yes (ix)

(A) NAME / LABEL: exon (B) POSITION: 1..33 (xi) SEQUENCE DESCRIPTION: SEQUENCE WITH IDENTIFICATION NUMBER 4:

GGATGGCAGT AGCTGCGCTG ATAGACATCC ATG 33 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 bp (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic (iv) REVERSE ORIENTATION: yes (ix)

(A) NAME / LABEL: exon. (B) POSITION: 1..26 (xi) DESCRIPTION OF SEQUENCE: SEQUENCE WITH IDENTIFICATION NUMBER 5:

GGCAGTAGCT GCGCTGATAG ACATCC

- 56 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 pairs of baffles (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc - "synthetic (iv) REVERSE ORIENTATION: yes (ix)

(A) NAME / LABEL: exon (B) POSITION: 1..22 (xi) SEQUENCE DESCRIPTION: SEQUENCE WITH IDENTIFICATION NUMBER 6:

GGCAGTAGCT GCGCTGATAG AC 22 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 7:

(i) SEQUENCE CHARACTERISTICS:

(A.) LENGTH: 17 pairs (3) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic (iv) ) REVERSE ORIENTATION: yes (ix) CHARACTERS:

(A) NAME / LABEL: exon (B) POSITION: 1..17 (xi) SEQUENCE DESCRIPTION: SEQUENCE WITH IDENTIFICATION NUMBER 7:

GGCAGTAGCT GCGCTGA 17 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 pairs of baffles (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic

- 57 (iv) REVERSE ORIENTATION: yes (ix) CHARACTERS:

(A) NAME / LABEL: exon (B) POSITION: 1..18 (xi) SEQUENCE DESCRIPTION: SEQUENCE WITH IDENTIFICATION NUMBER 8:

GCTGCGCTGA TAGACATC 18 «(2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic" ( (iv) REVERSE ORIENTATION: yes (ix) CHARACTERS:

(A) NAME / LABEL: exon (El POSITION: 1..29 (xi) SEQUENCE DESCRIPTION: SEQUENCE WITH IDENTIFICATION NUMBER 9:

GGCAGTAGCT GCGCTGATAG ACATCCATG 29 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 pairs of baffles (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic" (iv) ) REVERSE ORIENTATION: yes (ix) CHARACTERS:

(A) NAME / LABEL: exon (B) POSITION: 1..20 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No. 10:

TGCGCTGATA GACATCCATG

- 58 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 11:

Φ Φ Φ φ φ φ φ φ φ • • • • Φ Φ Φ Φ φ φ φ φ φ φ φ

(and) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 pairs of cravings (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic (iv) ANOTHER ORIENTATION: yes (ix) FEATURES: (A) NAME / LABEL: exon (B) POSITION: 1..19 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No. 11:

GCGCTGATAG ACATCCATG »19 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 12:

and) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic (iv) ANOTHER ORIENTATION: yes (ix) FEATURES:

(A) NAME / LABEL: exon (B) POSITION: 1. .18 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No. 12:

CGCTGATAGA CATCCATG 18 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 pairs of baffles (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic" «« (Iv) REVERSE ORIENTATION: yes (ix) CHARACTERS:

(A) NAME / LABEL: exon (B) POSITION: 1..17 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No. 13:

GCGCTGATAG ACATCCA 17 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 pairs of baffles (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic (iv) REVERSE ORIENTATION: yes (ix)

(A) NAME / LABEL: exon (B) POSITION: 1..17 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No. 14:

GCTGATAGAC ATCCATG 17 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 15:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 pairs of baffles (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic (iv) REVERSE ORIENTATION: yes (ix)

(A) NAME / LABEL: exon (B) POSITION: 1..18 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No. 15:

GCGCTGATAG ACATCCAT

(2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 pairs of baffles (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear

(ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic ANOTHER ORIENTATION: yes < (iv) «» (ix) FEATURES:

(A) NAME / LABEL: exon (B) POSITION: 1..17 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No. 16:

CGCTGATAGA CATCCAT 17 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 bp (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic (iv) REVERSE ORIENTATION: yes (ix)

(A) NAME / LABEL: exon (B) POSITION: 1..19 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No. 17:

GCGACCGATAG ATCTCCATG 1 9 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 bp (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = 'synthetic

(iv) ANOTHER ORIENTATION: yes (ix) FEATURES: (A) NAME / LABEL: exon (B) POSITION: 1..19 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 18: CGAAGCACTG TACGCATTG 19 Dec

(2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 480 bp (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic (ix) FEATURES:

(A) NAME / 0LINK: exon (B) POSITION: 1..480 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No. 19:

CAGTGTGC7G <iCGGCCi_GGC GCGAGCCGGC CCGGCCCCGG TCGGGCCTCC GAAACCATGA 60 ACTTTCTGCT GTCTTGGGTG CATTGGAGCC TCGCCTTGCT GCTCTACCTC CACCATGCCA 120 AGTGGTCCCA GGCTGCACCC ATGGCAGAAG GAGGAGGGCA GAATCATCAC GAAGTGGTGA 180 AGTTCATGGA TGTCTATCAG CGCAGCTACT GCCATCCAAT CGAGACCCTG GTGGACATCT 240 TCCAGGAGTA CCCTGATGAG ATCGAGTACA TCTTCAAGCC ATCCTGTGTG CCCCTGATGC 300 GATGCGGGGG CTGCTGCAAT GACGAGGGCC TGGAGTGTGT GCCCACTGAG GAGTCCAACA 360 TCACCA7GCA GATTATGCGG ATCAAACCTC ACCAAGGCCA GCACATAGGA GAGATGAGCT 420 TCCTACAGCA CAACAAATGT GAATGCAGAC CAAAGAAAGA TAGAGCAAGA CAAGAAAATC 430

(2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 pairs of baffles (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear

(ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic t (iv) ANOTHER ORIENTATION: yes (ix) FEATURES:

(A) NAME / LABEL: exon (B) POSITION: 1..24 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No. 20:

TCAGCGCAGC TACTGCCATG CAAT 2 4 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 21:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 pairs (b) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic (iv) REVERSE ORIENTATION: yes (ix)

(A) NAME / LABEL: exon (B) POSITION: 1..21 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No. 21:

GGAGGGCAGA ATCATCACGA A 21 (2) INFORMATION FOR THE SEQUENCE WITH IDENTIFICATION NUMBER 22:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 bp (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: other nucleic acid (A) DESCRIPTION: / desc = "synthetic

- 63 (iv) REVERSE ORIENTATION: yes (ix) CHARACTERS:

(A) NAME / LABEL: exon (B) POSITION: 1..24 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. No. 22:

AGGGTACTCC TGGAAGATGT CCAC 24

Claims (20)

PATENT CLAIMS An oligonucleotide or derivative thereof having an id. 4 or a portion thereof, wherein the sequence of SEQ ID NO. No 4 is: 3'-GTACCTACAGATAGTCGCGTCGATGACGGTAGG-5 'with the first condition that not all internucleoside bridges in the oligonucleotide are phosphodiester internucleoside bridges, and that not all phosphodiester internucleoside bridges are replaced by phosphothioate internucleoside linkages and that the selected nucleotides are selected from oligos; containing C5-propynyluridine, C5-propynylcytidine, C5-hexinyluridine, C5-hexinylcytidine, 6-azauridine and 6-azacytidine. The oligonucleotide of claim 1 having a length of 17 to 33 nucleotides. An oligonucleotide according to claim 1 and / or 2, having one of sequences id. C. 5 to 16, wherein the sequences are: sequence id. C. 5: 3'-CCTACAGATAGTCGCGTCGATGACGG-5 ‘ sequence id. C 6: 3’-CAGATAGTCGCGTCGATGACGG-5 ', sequence id. C. 7: 3'-AGTCGCGTCGATGACGG-5 ‘ sequence id. C. 8: 3’-CTACAGATAGTCGCGTCG-5 ‘ sequence id. C. 9: 3'-GTACCTACAGATAGTCGCGTCGATGACGG-5 sequence id. C. 10 : 3’-GTACCTACAGATAGTCGCGT-5 ‘ sequence id. C. 11 : 3'-GTACCTACAGATAGTCGCG-5 ' sequence id. C. 12 : 3'-GTACCTACAGATAGTCGC-5 ' sequence id. C. 13 : 3'-ACCTACAGATAGTCGCG-5 ' sequence id. C. 14 : 3'-GTACCTACAGATAGTCG-5 ' sequence id. C. 15 Dec : 3'-TACCTACAGATAGTCGCG-5 sequence id. C. 16 : 3'-TACCTACAGATAGTCGC-5 An oligonucleotide according to any one of claims 1 to 3 having one or more modifications, wherein each modification is located in a certain phosphodiester bridge and / or in a certain β-ϋ-2'-deoxyribose unit and / or a certain natural nucleoside base, in comparison with a natural DNA oligonucleotide of the same sequence. The oligonucleotide of any one of claims 1 to 4, wherein the 1 to 5 terminal nucleotide units at the 5'-end and / or the 3'-end of the oligonucleotide are protected by modifying the internucleoside bridges located at the 5'-end and / or 3 of the corresponding nucleosides. The oligonucleotide of any one of claims 1 to 5, wherein the at least one internal pyrimidine nucleoside and / or the internucleoside bridge located at the 5'-end and / or the 5'-end of the pyrimidine nucleoside is modified. The oligonucleotide of any one of claims 1 to 6, wherein each of the modifications is independently selected from the group consisting of: a) replacement of the phosphodiester internucleoside bridge located at the 3'- and / or 5'-end of the nucleoside with a modified internucleoside bridge, b) replacement of the phosphodiester bridge located at the 3'- and / or 5'-end of the nucleoside with a defospho bridge, (c) replacement of a sugar-phosphate backbone unit with another unit; d) replacement of the β-0-2'-deoxyribose unit with a modified sugar unit, e) replacement of the natural nucleoside base with a modified nucleoside base, f) conjugation to a molecule which affects the properties of the oligonucleotide; - 66 g) conjugation with 2 '-5'-linked oligoadenylate or a derivative thereof, optionally via a suitable linker molecule, h) inserting a 3'-3 'and / or 5'-5' inversion at the 3'- and / or 5'-end of the oligonucleotide. The oligonucleotide of any one of claims 1 to 7, wherein each of the modifications is independently selected from the group consisting of: (a) replacing the phosphodiester internucleoside bridge located at the 3'- and / or 5'-end of the nucleoside with a modified internucleoside bridge, wherein the modified internucleoside bridge is selected, for example, from the group consisting of phosphothioate, phosphodithioate, NBrR ¹ -phosphoramidite, borane phosphate, phosphoric acid O-alkyl ester of 1 to 21 carbon atoms, aryl-O-alkyl phosphoric acid of 6 to 12 carbon atoms and alkyl of 1 to 21 carbon atoms, α- (C 7 -C 12) arylmethylaryl, (C 1 -C 8) alkylphosphonate and / or (C 6 -C 12) arylphosphonate, wherein R ¹ and R ¹ are, independently of one another, hydrogen, alkyl (C 1 -C 18), (C 6 -C 20) aryl, (C 6 -C 14) -aryl, (C 1 -C 8) -alkyl, or R ¹ and R ¹ together with the nitrogen atom form, which carries them, a 5-6 membered heterocyclic ring which may additionally contain a further heteroatom selected from the group consisting of obs containing O, S and N. b) replacing the phosphodiester internucleoside bridge located at the 3'- and / or 5'-end of the nucleoside with a defospho bridge, wherein the defospho bridge is selected from the group consisting of formacetal, 3'-thioformacetal, methylhydroxylamine and oxime, methylenedimethylhydrazo, dimethylenesulfonyl and / or c) replacing the sugar phosphate unit in the sugar-phosphate backbone with another unit, the other unit being selected from the group comprising a morpholino unit. derivatives, a polyamide nucleic acid backbone unit, and a phosphomono acid esters nucleic acid backbone unit, d) replacing the β-ϋ-2'-deoxyribose unit with a modified sugar unit, wherein the modified sugar unit is selected from the group consisting of β-D-ribose, c-D-2'-deoxyribose, L-2'-deoxyribose, 2'-F -2'-deoxyribose, 2'-Oalkylribose with an alkyl group containing 1 to 6 carbon atoms, 2'-O-alkenylribose with an alkenyl group containing 2 to 6 carbon atoms, 2 '- [O- (alkyl-O-alkyl) ribose C 1 -C 6 -alkyl, 2'-NH ₂ -2'-deoxyribose, β-D-xylofuranose, α-arabinofuranose, 2,1-dideoxy-β-D-erythrohexopyranose, carbocyclic sugar analogs and / or sugar analogs open chain and / or bicyclosaccharides, e) replacing the natural nucleoside base with a nucleoside base, wherein the modified base is selected from the group consisting of 5- (hydroxymethyl) uracil, 5-aminouracil, dihydrouracil, 5-chlorouracil, 5-bromocytosine, 5-fluorouracil, 5-chloro-cytosine, 2,4-diaminopurine, 5-modified nucleoside containing pseudouracil, fluorocytosine, 5-bromouracil, substituted oligoadenlate triadenylate, hexaadenylate derivatives, h) insertion of 3 '-3 7-deazapurine, preferably 7-deaza-7-substituted or 7-deaza-8-substituted purines and 8-azapurines, f) conjugation to a molecule that affects the properties of oligonucleotides, wherein the molecule that affects the properties of oligonucleotides is selected from the group consisting of polylysine, intercalating agents, fluorescent agents such as fluorescein, crosslinking agents, lipophilic molecules, steroids, vitamins, poles or oligoethylene glycol, alkyl phosphate esters of C 12 -C 18 alkyl and O-CH ₂ -CH (OH) -O-C 12 -C 18 alkyl, g) conjugation to a 2'5'-linked oligoadenylate molecule or derivative thereof, optionally via a suitable linker molecule, wherein the 2'5'-linked molecule is selected from the group consisting of tetraadenylate, pentaadenylate, and heptaadenylate molecules and and / or 5'- 5 'inversion to 3'- and / or 5'-end of oligonucleotides. The oligonucleotide of any one of claims 1 to 8, having the sequence of SEQ ID NO: 1. No. 11 and one of the following internucleoside bridge modification formulas: ON 1: 3'-G * T * A * C * C * T * C * A G * T * A * G * C * G * C * G -5 ', ON 2: 5'- G * C G * C * T * G * A * T * A G'A * C'A * T * C'C * A * T'G -3 ', ON 3: 5'- G * C * GC * T * G A'T * AG A'C'A T * C * C ^W A * T * G -3 ON 4: 5'- G * C * G * C * T * G A * T * A G A * C * A T * C * C * A‘T * G -3 ', ON 5: 5'- G * C G * T * G * T * A * G * C * A * T * C * A * T * G -3 ', ON 6: 5'- G * C G C * T G A * T * A G A * C * A T * C * C‘A * T‘G -3 ', 5'- G * C * G * T * A * T * A * G * C * A * T * C * A * T * G -3 ', 5'- G C * G C‘T G A * T A G A * C * A T * C * C A * T * G -3 ', 5'- G * C * G * T * A * T * A * A * C 'A * T * C * A * T * G -3', ON 7: ON 8: ON 9; HE 10 -3 ' ON 11 ON 12 5’- ON 13; 5'- G * C * G * T * A * T * A * G * C * A * T * C * A * T * G -3 ', ON 14; 5 '- G * C * G * C * T * A * T * A * A * C * A * T * C * C * A * T * G -3' ON 15: 5'- G'C G * C * T * G * A * T * A * G * A * C * A * T * C * C * A'T * G -3 'where indicates the position of the modified an internucleoside bridge. The oligonucleotide of any one of claims 1 to 9 having the sequence of SEQ ID NO: 1. No. 11 and one of the following internucleoside bridge modification formulas: O N 16: 5 '- GCGCTG A T A G A CA T C C ATG -3', ON 17: 5 '- GCGCTG A T A G A CA T C C T T -3'. ON 18: 5 '- G C G C T G ATAGACATCCATG -3'. ON 19: 5'-G C G C G AT AG ACATC C ATG -3 ', ON 20: 5 - GCGC i GATA G A C T C C A T G -3, ON 21: 5'-GCGCTGATAG A CA T C C T T -3 ', ON 22: 5'- G C G C T G ATAG A CA C C A T G -3 ’, ON 23: 5'-G C G C TG AT A G ACATC C AT G -3 '. ON 24: 5 '- G C G C T ATAG ACATCCATG -3', ON 25: 5 '- GCGC T G A T A G A CA T C C T T -3'. ON 26: 5'-G C G C TG AT A G ACAT C C ATG -3 '. ON 27: 5'-G CG CTG ATAG AND CATC C AT G -3 ', where N denotes the position of the modified nucleoside. tt 9 ·················· · 9 · 9 · 99,999 99 9 9 99 tt 9 ΊΟ The oligonucleotide according to any one of claims 1 to 10, wherein one or more phosphodiester bridges are replaced by phosphothioate bridges and wherein it indicates the position of the phosphothioate internucleoside bridge. The oligonucleotide of any one of claims 1 to 10, wherein one or more β-ϋ-2'-deoxyribose units are replaced by 2'-O-methylribose and wherein N denotes the position of the 2'-O-methylribonucleoside, in which case T is 2'-O-methyluridine. The oligonucleotide of any one of claims 9 to 11, wherein at the 5'-end and / or 3'-end of the oligonucleotide there is an alkyl group having 16 carbon atoms attached. A process for the preparation of an oligonucleotide according to any one of claims 1 to 13, comprising the step of condensing suitably protected monomers on a solid support. Use of an oligonucleotide according to any one of claims 1 to 13 for inhibiting VEGF expression. 16. A method of inhibiting VEGF expression comprising the step of contacting an oligonucleotide of any one of claims 1 to 13 with a nucleic acid encoding VEGF. Use of an oligonucleotide according to any one of claims 1 to 13 for the manufacture of a pharmaceutical composition. 18. A method of manufacturing a pharmaceutical composition comprising the step of mixing one or more oligonucleotides of the invention Any of claims 1 to 13 with a physiologically acceptable excipient and optionally other substances. A pharmaceutical composition comprising at least one oligonucleotide according to any one of claims 1 to 13. Use of a pharmaceutical composition comprising at least one oligonucleotide according to any one of claims 1 to 13 for the treatment of diseases that are associated with abnormal vascular permeability, cell proliferation, cell permeation, angiogenesis, neovascularization, tumor cell growth and / or metastasis. Use of a pharmaceutical composition comprising a single oligonucleotide according to any one of the claims in combination with other drugs and / or other methods is at least 1 to 13,