LT6214B - Antisense oligonucleotide for prevention of atherosclerosis and cardivascular infections - Google Patents

Abstract

The present invention relates to the field of microbiology. The invention provides isolated antisense oligonucleotides (ASO), pharmaceutical compositions comprising ASO, and methods for reducing, preventing or inhibiting biofilm formation in the human cardiovascular tissues and in the human blood medium to prevent and treat atherosclerosis and cardiovascular infections.

Description

The present invention is in the field of microbiology and relates to the emergence and growth of bacterial biofilms in human cardiovascular tissues and blood media. More particularly, the present invention relates to the prevention and treatment of atherosclerosis and cardiovascular infections caused by bacterial biofilms using antisense oligonucleotides and pharmaceutical compositions thereof.

Background of the Invention

Cardiovascular disease is one of the most common causes of death worldwide (S. Mendis, P. Pushka, B. Norrving. Global Atlas on Cardiovascular Disease Prevention and Control. World Health Organization, Geneva (2011), pp. 8-14). The spectrum of these diseases is very wide and includes such severe life-threatening conditions as coronary heart disease, myocardial infarction and stroke. The fundamental cause of this is atherosclerosis, which results in a narrowing of the lumen of the arteries due to the formation of atherosclerotic plaques. In turn, the causes of atherogenesis are complex including hyperlipidemia, increased blood coagulation, oxidative stress, vascular endothelial dysfunction as well as infection and inflammation affecting the vascular wall.

According to known and recognized scientific studies, the factor of infection in atherogenesis is very significant, especially with regard to those microorganisms that make up the normal human microflora (Koren et al., Human Air, Gut and Plaque Microbiota in Patients with Atherosclerosis. Proc. Nat. Acad. Sci. USA). 108 [Suppl. 1] (2011), pp. 4592-4598).

One of the sources of infection in the human cardiovascular system is streptococci, which make up the normal human microflora. Species among them are S. mutans and

S. sobnnus, commonly found in the human mouth. These types of streptococci are able, among other things, to form a water-insoluble bacterial biofilm on the surface of oral tissues. The structural backbone of the biofilm formed by these bacteria consists of insoluble polymer glucan, which is synthesized from sucrose by several types of glucosyltransferase (Gtf) isoenzymes, i. y. S. mutans GtfB and GtfC and S. sobrinus Gtfl (Bowen and Koo. Biology of Streptococcus Mutans-Denved Glucosyltransferases: Role in Extracellular Matrix Formation of Canogenic Biofilms. Caries Res. 45 (2011), pp. 69-86). Glucosyltransferases not only localize on the bacterial wall but are also released into the environment in free form. Due to the action of these enzymes, S. mutans, S. sobrinus, and other oral bacteria can attach to virtually any surface, including human tissues, because the glucan formed is a highly tacky substance by its physical properties. Therefore, Gtf enzymes have become an important target for the development of various pharmacologically active substances that inhibit the adhesion of S. mutans and S. sobrinus bacteria.

As a result of daily oral tissue damage, other pathological conditions, as well as oral interventions leading to significant bacteremia, S. mutans and S. sobrinus enter the human blood and cardiovascular system (Nakano et al., Streptococcus mutans and cardiovascular diseases. J. Dent. Sci. Rev. 44 (2008), pp. 29-37).

Human blood glucose monomers are found in pure form and can be used by S. mutans and S. sobrinus, as well as their glucosyltransferases, for the synthesis of glucans. Bacterial secreted glucosyltransferases from blood glucose can synthesize this adhesive polymer, which adheres to the walls of blood vessels and becomes a focal point for adhesion to platelets and their aggregation in cardiovascular tissues.

Known and widely accepted scientific studies have shown that S. mutans is found in very high frequencies in 65% and 75% of human heart valve tissues and atherosclerotic plaques, respectively (Nakano et al., Detection of Cariogenic Streptococcus Mutans in Extirpated Heart Valve and Atheromatous Plaque Specimens). J. Clin. Microbiol. 44 (2006), pp. 3313-3317; Detection of oral bacteria in cardiovascular specimens by Nakano et al., Weather Microbiol. Immunol. 24 (2009), pp. 64-68). In addition, S. sobrinus is also identified in atherosclerotic plaques, but at a lower frequency. This suggests that these oral streptococci are involved in the pathogenesis of atherosclerosis.

The role of S. mutans and S. sobrinus in the development of atherosclerosis is related to the activity of glucosyltransferases secreted by these bacteria - glucan synthesis. Studies have shown that S. mutans strains that have defects in the gtfB and gtfC genes exhibit markedly lower levels of platelet aggregation than normal ("wild") S. mutans bacteria (Taniguchi et al., Defect of glucosyltransferases causes platelet aggregation activity of Streptococcus). mutans: Analysis of clinical strains isolatedfrom orai cavities (Arch. Oral Biol. 55 (2010), p. 410416). Thus, inhibition of streptococcal glucosyltransferase expression is of practical importance not only for the prevention of dental caries but also for the prevention of cardiovascular disease.

The patented invention described herein provides a method of inhibiting and / or reducing bacterial film formation in S. mutans and S. sobrinus in human cardiovascular tissues and blood media, including serum. This method relies on the use of antisense oligonucleotides (POs) that selectively inhibit the expression of gtB and gtfC and S. sobrinus gtfl genes of S. mutans. This inhibits the synthesis of glucosyltransferases and, consequently, glucan. Inhibition of glucan synthesis prevents bacterial biofilm formation, which in turn results in the prevention and prevention of atherosclerosis and cardiovascular infections caused by S. mutans and S. sobrinus, as well as inhibition and reduction of atherosclerotic plaque formation.

In addition, the present invention provides a method of inhibiting the synthesis of PO and bacterial biofilms for treating various surfaces in contact with human blood and tissues, such as tubes, catheters, dialysis membranes, probes, valves, prostheses, implants, and the like. S. mutans and S. sobrinus bacteria on such surfaces. It should be noted that bacteria that adhere to these surfaces, such as catheters, implants or prostheses, are made by glucans synthesized and form bacterial biofilms, which limit the body's immune system's ability to destroy the bacteria. Bacterial biofilms on tubes, catheters, dialysis membranes, probes promote the formation of foci of atherosclerosis in the circulatory system, while bacterial biofilms on heart valves or bone or joint implants cause inflammatory processes and implant rejection, causing extremely complex and life-threatening conditions.

In summary, the patented PO and method address in a comprehensive way the prevention, prevention, and treatment of atherosclerosis, cardiovascular and related infections.

The essence of the invention

As discussed above, there is an urgent need to address the prevention, prevention, and treatment of atherosclerosis, cardiovascular and related infections caused by bacteria entering the circulatory system, cardiovascular tissues, and other objects that come into contact with blood and cardiovascular tissues. The present invention encompasses materials and methods that address these problems, in particular the development of atherosclerosis due to bacterial biofilms and bacterial glucans and infections of the cardiovascular system.

The main subject-matter of the invention is the material - isolated antisense oligonucleotides (PO) - which have the following features:

a) POs consisting of nucleotide sequences according to SEQ ID NO. 1,13.19;

b) the PO consists of the nucleotide sequences set forth in SEQ ID NO. Fragments of 1, 13, 19;

or

c) POs having at least 85% nucleotide sequences corresponding to SEQ ID NO. 1, 13.19.

The invention also relates to POs having nucleotide sequences different from SEQ ID NO. 1, 13, 19, one, two, three or four nucleotides, including PO fragments having nucleotide sequences selected from the group consisting of SEQ ID NO. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24.

The PO, in any of the above forms, may be conjugated to a peptide to facilitate penetration through the bacterial cell wall.

The invention also relates to PO, in any of the above forms, for use in the prophylaxis, prevention, inhibition and reduction of the formation of atherosclerotic plaques and / or foci in human cardiovascular tissues and / or blood serum as a component.

The invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts for biopharmaceutical and medical use.

The present invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other components including adjuvants and / or carriers used in biopharmaceuticals.

The present invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts wherein the carrier is a cationic polymer.

The invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts for the treatment or prevention of atherosclerosis.

The present invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts for the treatment or prevention of bacterial endocarditis.

The present invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts for contacting surfaces with human blood and tissues such as tubing, catheters, dialysis membranes, probes, valves, prostheses, implants and the like. etc., for treatment with antibacterial activity against S. mutans and S. sobrinus on such surfaces.

The present invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts for contacting surfaces with human blood and tissues such as tubing, catheters, dialysis membranes, probes, valves, prostheses, implants and the like. etc., for the treatment, prevention, prevention, suppression and reduction of the formation of atherosclerotic plaques and / or foci on such surfaces.

The present invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts for contacting surfaces with human blood and tissues such as tubing, catheters, dialysis membranes, probes, valves, prostheses, implants and the like. etc., to reduce the occurrence and growth of bacterial biofilms.

Finally, the invention encompasses a method of controlling bacterial colonies in S. mutans and S. sobrinus, which comprises inhibiting the ability of these bacteria to synthesize exopolysaccharides forming biofilm backbone by using PO specifically and simultaneously inhibiting gtfB and gtfC iRNA expression in S. mutans and gtfl iRNA expression in S. administration of the bacterium, thereby inhibiting simultaneously the ability of these bacteria to synthesize polymers of water-insoluble glucans and partially water-soluble glucans.

Description of illustrations

FIG. 1 shows nucleotide SEQ ID NO. Snippet 14:

5'UCUGUUAAGAUUAAGCAAUGGUCUGCCAAGUACUUUAAUGGGACAAAUAU

UUUAGGGCGCGGAGCAGGCUAUGUCUUAAAAGA-3 'presented in the original results of the Mfold program format predicting a S. mutans gtfB iRNA secondary structure model with a defined antisense oligonucleotide binding region. As can be seen in this model, the defined region has a ball loop that is composed of unpaired nucleotides (5'-UAAGCA-3 '), which means that the selected POs may be strong competitors for beteroduplex formation. Symbols "-

---- "and" \ "represent the relationship between their respective nucleotides and are used to better represent ball and pin loops. As shown in Figs. 1, the gtfB iRNA region starts at 3049 nt and the defined PO binding site starts at 3056 nt - which is the same as the S. mutans gtfB gene (see Example 1).

FIG. 2 (Figures 2a, 2b and 2c) shows the optical surface profile of a slide with S. mutans culture biofilm after 24 h. incubations with different effects in Todd Hewitt broth containing 1% sucrose:

FIG. 2a is the optical profile of the biofilm surface under the influence of PO1 + TurboFect ™;

FIG. 2b - optical profile of the biofilm surface under the influence of PO2 + TurboFect ™;

FIG. 2c - Biofilm surface optical profile at PO3 + TurboFect ™ exposure. Magnification * 50. Table 1 also presents data related to Figs. 2

FIG. Figure 3 shows the optical densities of S. mutans cultures grown in Todd Hewitt broth without sucrose (Fig. 3a) and with 1% sucrose (Fig. 3b, 3c, 3d) for 24 h. exposure to nuclease-free water (Fig. 3a, 3b, 3c), TurboFect ™ reagent (Fig. 3a, 3b), or both (Fig. 3b, 3d), PO alone (Fig. 3c) or a combination thereof with TurboFect ™ (fig. 3d).

Symbols: ♦ Bacteria-free medium; , unaffected bacteria; ▲, nuclease-free water; O, TurboFect ™; ·, Nuclease-free water + TurboFect ™; O, PO1 or PO1 + TurboFect ™; χ, PO2 or PO2 + TurboFect ™; *, PO3 or PO3 + TurboFect ™.

FIG. Figure 4 shows the morphology of Gram stained S. mutans bacteria after 24 h.

incubations in Todd Hewitt broth at different effects: FIG. 4a - bacteria growing in sucrose-free medium; FIG. 4b - bacteria growing in medium containing 1% sucrose;

FIG. 4c - Bacteria at PO1 + TurboFect ™ effect in Todd Hevvitt broth with

1% sucrose;

FIG. 4d - Bacteria at PO2 + TurboFect ™ effect in Todd Hevvitt broth with

1% sucrose;

FIG. 4e - Bacteria at PO3 + TurboFect ™ effect in Todd Hevvitt broth with

1% sucrose. Magnification * 100 (immersion system).

FIG. Figure 5 shows the optical densities of S. mutans cultures grown in Todd Hevvitt broth without sucrose for 24 h. in action with nuclease-free water (Fig. 5a, 5b), TurboFect ™ reagent (Fig. 5a), or both together (Fig. 5a, 5c), PO alone (Fig. 5b) or a combination thereof with TurboFect ™ (Fig. 5c) ).

Symbols: ♦ Bacteria-free medium; , unaffected bacteria; ▲, nuclease-free water; O, TurboFect ™; ·, Nuclease-free water + TurboFect ™; O, PO1 or PO1 + TurboFect ™; x, PO2 or PO2 + TurboFect ™; *, PO3 or PO3 + TurboFect ™.

FIG. Figure 6 shows multiple sequence comparisons of glucosyltransferase genes between different Streptococcus species and strains using MAFFT web server at Max Planck Institute for Developmental Biology. The conservative target region (consisting of 26 nucleotides: 5'-GTTAAGATTAAGCAATGGTCTGCCAA-3 'having SEQ ID NO: 16) is defined in a large rectangle and mismatches are defined in small rectangles. The species and strains of Streptococcus shown in the figure are as follows:

ENA | AAN58705 | AAN5870_0 / 1-4431 - Streptococcus mutans UA159 glucosyltransferase-1;

ENA | AAN58706 | AAN5870_1 / 1-4368 - Streptococcus mutans UA159 Glucosyltransferase-SI;

ENA | D88654 | D88654.1_2 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PYT216;

ENA | D88660 | D88660.1_3 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PYT223;

ENA | D89977 | D89977.1_4 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PTH1;

ENA | D88657 | D88657.1_5 / 1-5686 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PYT239;

ENA | M17361 | M17361.1_6 / 1-10029 - Streptococcus mutans glucosyltransferase (gtfB and gtfC) genes, complete coding sequences;

ENA | D88651 | D88651.1_7 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PSK6;

ENA | AB299801 | AB29980_8 / 1 -4410 - Streptococcus criceti gtfl glucosyltransferase I gene, full coding sequence;

ENA | AB273728 | AB27372_9 / 1-4930 - Streptococcus criceti gtfl glucosyltransferase I gene, full coding sequence, strain: GTC242;

ENA | AB355819 | AB35581_10 / 1-4602 Glucosyltransferase-l gene, full coding sequence;

ENA | AB275384 | AB27538_11 / 1-5423 Glucosyltransferase-l gene, full coding sequence;

Streptococcus dentirousetti gtfl gtfl

Streptococcus dentisuis

Streptococcus orisuis gtf

ENA | AB272987 | AB27298_12 / 1-4984 glucosyltransferase gene, full coding sequence;

ENA | D63570 | D63570.1_13 / 1-6838 - Streptococcus sodrinus glucosyltransferase-1 gene, full coding sequence;

ENA | M17391 | M17391.1_14 / 1-4995 - Streptococcus downei glucosyltransferase gene precursor, full coding sequence.

FIG. 7 shows multiple sequence comparisons of glucosyltransferase genes between various species of Streptococcus and strains found in the human body using the MAFFT web server at the Max Planck Institute for Developmental Biology. Conservative target region (consisting of 26 nucleotides: 5'9

CGCGTCATGTTTGAAGGTTTCTCTAA-3 'having SEQ ID NO. 18) is defined by a rectangle. FIG. The 7 species and strains of Streptococcus listed are:

ENA | AAN58705 | AAN5870_0 / 1-4431 - Streptococcus mutans UA159 glucosyltransferase-1;

ENA | AAN58706 | AAN5870_1 / 1-4368 - Streptococcus mutans UA159 Glucosyltransferase-SI;

ENA | D88654 | D88654.1_2 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PYT216;

ENA | D88660 | D88660.1_3 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PYT223;

ENA | D89977 | D89977.1_4 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PTH1;

ENA | D88657 | D88657.1_5 / 1-5686 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PYT239;

ENA | M17361 | M17361.1_6 / 1-10029 - Streptococcus mutans glucosyltransferase (gtfB and gtfC) genes, complete coding sequences;

ENA | D88651 | D88651.1_7 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PSK6;

ENA | D63570 | D63570.1_13 / 1-6838 - Streptococcus sobrinus glucosyltransferase-1 gene, full coding sequence.

FIG. Fig. 8 shows the optical surface profile of a slide with mixed S. mutans and S. sobrinus culture biofilm after 24 h. incubations with different effects in Todd Hewitt's broth containing 10% serum and 1% sucrose:

FIG. 8a - optical profile of the biofilm surface in the absence of effects;

FIG. 8b is the optical profile of the biofilm surface under the influence of PO1 + TF (TurboFect ™);

Fig.8c - Optical profile of biofilm surface under the influence of PO3 + TF (TurboFect ™). Magnification χ50.

FIG. 9 shows the amount of mixed biofilm of S. mutans and S. sobrinus cultures formed on the glass surface after 24 h. incubations with different effects

Todd Hewitt Broth with 10% Serum and 1% Sucrose:

FIG. 9a - surface roughness parameter of biofilm Rq; FIG. 9b is the thickness of the biofilm.

Control - glass surface after 24 hours. incubation in Todd Hewitt broth containing 10% blood serum and 1% sucrose but without bacteria; unaffected bacteria (Fig. 9a, 9b black column) - these are bacteria incubated for 24 hours. Todd Hewitt in broth with 10% serum but no sucrose and effects; unaffected bacteria (Fig. 9a, 9b white column) - these are bacteria incubated for 24 hours. Todd Hewitt in broth with 10% serum and 1% sucrose but no effects; PO + TF - This is the antisense oligonucleotide + TurboFect ™ reagent. Values (n = 6 [roughness Rqj; n = 5 [thickness]) are reported as means ± standard error of the mean. * p <0.05 versus unaffected bacteria (white column), ** p <0.05 versus PO3 + TF.

Definitions

As used herein, the term "antisense effect" refers to the effect of an oligonucleotide that results from the formation of a compound with an additional sequence contained in an iRNA that results in specific inhibition of gene expression and protein translation.

The term antisense oligonucleotides (PO), as used herein, refers to preparations that are chemically modified or unmodified single nucleic acid molecules (typically 15-30 nt in length) that can selectively bind to their target in the iRNA sequence according to the Watson-Crick mating principle. The formation of POiRNA heteroduplexes results in the following effects:

1) activation of RNase H endonuclease or bacterial endoribonuclease RNase III and RNase E - leading to degradation of the iRNA but leaving the PO intact;

2) caused by translational inhibition through spherical blocking of ribosome activity;

3) inhibiting iRNA binding;

4) destabilizing the iRNA precursor.

Which effect will occur depends on the chemical structure of the PO and the site of hybridization, but subsequent results are deregulation of specific gene-target expression and protein translation.

"Nucleotide sequence", "nucleic acid", "nucleic acid chain", and "nucleic acid sequence" means any one which binds or hybridizes through base fusion including oligomers or polymers based on naturally occurring nucleotides, such as DNA (deoxyribonucleotides). acid) or RNA (ribonucleic acid) and / or nucleic acid analogues consisting of non-standard nucleobases and / or non-standard backbones, such as peptide nucleic acid (PNR) or locked nucleic acid (UNR), or any derivative or modified nucleic acid, to increase the stability and resistance to nucleases.

As used herein, the term "peptide nucleic acid" or "PNR" means a synthetic oligomer or polymer based on a polyamide with attached nucleobases (whether naturally occurring or modified), including, but not limited to, any segments of oligomers or polymers designated or designated as U.S. Patient Nucleic Acids . No. 5539082, 5527675, 5623049, 5714331, 5718262, 5736336, 5773571, 5766855, 5786461, 5837459, 5891625, 5972610, 5986053, 6107470, 6201103, 6228982 and 6357163, all of which are incorporated by reference or incorporated by reference in WO096 / 04000 in the documents. A bound nucleobase, such as a PNR base of purine or pyrimidine, can be linked to the backbone by using one of the linkages described in PCT / US02 / 30573 or any other reference herein. It contains an N- (2-aminoethyl) -glycine) backbone. The PNR can be synthesized (and visually labeled) as mentioned in PCT / US02 / 30573 or references cited therein. PNR binds strongly and does so in a specific order, with DNA and RNA, since the PNA backbone is not charged. Thus, short PNR probes may exhibit similar specificities with longer DNA and RNA probes. PNR probes can also show greater detail in binding to additional DNA or RNA.

As used herein, the term "locked nucleic acid" or "UNR" refers to an oligomer or polymer composed of at least one or more UNR subunits.

As used herein, the term "UNR subunit" refers to a ribonucleotide containing a methylene bridge linking a 2'-oxygen ribose to a 4'-carbon (see Kurreck Antisense Technologies. Improvement through Novel Chemical Modifications. Eur J Biochem 270 (2003) 1628 Pp. -1644)).

Examples of nucleic acids and nucleic acid analogues used as isolated PO also include oligomeric and nucleotide monomer polymers, including double and single deoxyribonucleotides (DNA), ribonucleotides (RNA) between naturally occurring antisense RNA molecules (such as microRNAs). and small interfering RNAs (siRNAs) found in eukaryotic cells, as well as small antisense RNAs found in prokaryotic cells (bacteria), anomeric forms thereof, natural and synthetic analogs, and others. The nucleic acid chain may consist solely of, or mixed with, deoxyribonucleotides, ribonucleotides, peptide nucleic acids (PNRs), locked nucleic acids (UNRs), natural or synthetic analogs such as phosphorodiamidate morpholine and thiophosphoroamidate oligonucleotides. DNA, RNA and other natural or synthetic nucleic acids described herein may be used in the methods and compositions of the invention.

As used herein, the term "pharmaceutically acceptable", for example, "pharmaceutically acceptable carrier" or "pharmaceutically acceptable additive" is intended to mean that a substance that is not biologically or otherwise undesirable, e.g. the substance may be incorporated into pharmaceutical compositions for administration to the patient without causing adverse biological effects or in response to other components present in the composition without deleterious effects. In addition, the additives and carriers contained in said compositions are suitable for application in the cardiovascular tissue environment and / or blood medium without causing any undesirable biological effects and without causing any adverse reaction. This document provides examples of suitable carriers and additives, including nuclease-free water or any other reagent that forms a compact, stable, positively charged oligonucleotide complex to prevent degradation and facilitate the penetration of the oligonucleotide into bacterial cells, e.g. , a commercially available TurboFect ™ transfection reagent and a cationic polymer (Thermo Fisher Scientific, Enzyme).

As used herein, the term "nuclease-free water" refers to sterile deionized water that does not contain any type of nuclease capable of cleaving oligonucleotides.

As used herein, the term "biofilm" refers to a biofilm consisting of a polysaccharide matrix composed primarily of water-insoluble and partially soluble glucans and bacteria capable of synthesizing polysaccharide polymers forming an exopolysaccharide matrix from glucose monomers.

Detailed Description of the Invention

As mentioned in this document, bacterial cultures can be either in vivo or in vitro cultures unless specific culture is specified. Said cultures may be suspended on solid surfaces such as glass (in vitro sample in solid state) or vascular wall tissue (in vivo sample in solid state) or any other solid surface in the cardiovascular system, or implant or other surface in contact with human tissues and blood. .

As mentioned above, the present invention provides a novel method for reducing, inhibiting or inhibiting the formation of biofilms, such as biofilms formed from oral streptococci, especially S. mutans and S. sobrinus, and biofilm compounds on hard surfaces such as glass and vascular wall surfaces. way to prevent it.

This novel method exerts an effective effect of antisense oligonucleotides (POs) to simultaneously target and inhibit the expression of glucosyl transferase iRNA in several species of streptococci, particularly S. mutans and S. sobrinus, such as gtfB and gtfC glucosyltransferase iRNAs in S. mutans and gtfl. sobrinus, leading to the production of water insoluble and partially water soluble glucan polymers and inhibition of bacterial cell adhesion in S. mutans and S. sobrinus cultures, thereby leading to reduction, inhibition or inhibition of biofilm formation. Said cultures may be in vitro cultures or in vivo cultures, e.g., in the cardiovascular system or on other solid surfaces in contact with human tissues and blood.

A list and description of the novel PO sequences patented by the invention is provided in Annex 1.

Said POs may be chemically synthesized oligodeoxyribonucleotides in the form of phosphorothioates corresponding to nucleotides SEQ ID NO. 1, 13, 19, for displaying the antisense effect as exemplified, or any other form of PO described in this document, i.e., SEQ ID NO. 4, 5, 6, 7, 8, 9,10,11, 12, 20, 21,22, 23, 24, or PO fragments or modifications according to the conditions of the specification.

The measurement of glucans constituting the biopolymer exopolysaccharide matrix can be carried out as described in the second and fifth examples, where profilometric results clearly show that bacterial adhesion to the glass surface is strongly reduced with PO molecules having the nucleotide sequence of SEQ ID NO. 1.13 or

19th

Decrease in biofilm formation indicates a decrease in glucan polymer synthesis because glucans are essential for biofilm formation and the absence of glucans leads to biofilm formation.

Glucan concentration in bacterial cell cultures can also be measured using other methods described by Guo et al. Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibition of GtfB expression and function (FEMS Microbial Lett 264 (2006), pp. 8-14) and Masuko et al. Carbohydrate analysis by a phenol-sulfuric acid method in a microplate format (Anai Biochem 339 (2005) pp. 69-72).

Another aspect of the present invention and the present invention provides means for using only one type (single nucleotide sequence) of POs that effectively inhibit both water-soluble and partially water-soluble glucans in S. mutans encoded by gtfB and gtfC genes and also S. sobrinus gtfl.

This new technique allows the use of single POs in bacterial cultures to target two targets, gtfB and gtfC, iRNA in S. mutans and simultaneous glucosyltransferase-l iRNA in S. sobrinus.

Targets in the aforementioned S. mutans and S. sobrinus genes and, respectively, the iRNAs are conservative - the coding nucleotide sequences in these bacterial genes are constant. Therefore, the use of PO reduces the ability of bacteria to otherwise synthesize water-insoluble and partially soluble glucans to form a biofilm polymeric matrix. Target conservatism is shown and justified in Figs. 6 and FIG. 7th

In accordance with the present invention, novel POs that achieve the antisense effect may be chemically synthesized oligodeoxyribonucleotide sequences of phosphorothioates corresponding to the nucleotide sequences of SEQ ID NO. 1, 13, 19, or may be any other form of PO described herein, i.e. SEQ ID NO. 4, 5, 6, 7, 8, 9,10,11,12, 20, 21,22, 23, 24, or fragments or modifications thereof.

The shorter sequences (SEQ ID NOs: 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24) have the same nucleotide (nt) arrangement as the PO with SEQ ID NO: . 1, 13, 19, so they can be used independently for established bacterial genomic targets between gtfB and gtfC in S. mutans, as well as gtfl genes and iRNAs in S. sodrinus. Due to their thermodynamic properties (similar to those of PO SEQ ID NO: 1, 13,19), these shorter fragments can form heteroduplexes in the corresponding region of the bacterial genome.

Notably, the PO having SEQ ID NO. 1, binds to unpaired nucleotides in the S. loop of mutant iRNA gtfB as shown in FIG. 1 Similarly, longer sequences of PO (SEQ ID NO: 13) can form heteroduplexes in the intended region and complement and bind in a loop with unpaired nucleotides

S. mutans iRNA gtfB as defined in FIG. 1

The large number of literature studies in vitro and in vivo demonstrate that POs from 8 nt to 30 nt in length have antisense effects. Even PO with a single mismatched nucleotide also exhibits potent antisense activity (see Hamel et al., "Inhibition of gene expression by anti-sense C-5 propyne oligonucleotides detected by a reporter enzyme" (Biochem J 339 (1999), 547-553). Wagner et al., "Potent and selective inhibition of gene expression by an antisense heptanucleotide" (Nat Biotechnol 14 (1996), 840-844); Fakler et al., "Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration to be almost independent of the location of the target sequence "(J Biol Chem 269 (1994), 16187-16194); Woolf et al.," Specificity of antisense oligonucleotides in vivo "(Proc Natl Acad Sci USA 89 (1992)) , Pp. 7305-7309)).

PO Synthesis

The novel PO sequences of the present invention can be synthesized and modified in various ways. Oligodeoxyribonucleotides in the form of phosphorothioates as depicted in Example 2 can be used as different forms of PO. Such oligodeoxyribonucleotides in the form of phosphorothioates differ from unmodified oligodeoxyribonucleotides in that one of the oxygen atoms in the phosphodiester bond is replaced by a sulfur atom. Oligodeoxyribonucleotides in the form of phosphorothioates can be chemically synthesized, for example, by Metabion International AG (Germany) using an automated DNA synthesizer and a phosphoramidite method according to a well-known standard protocol (see G. Zon, Oligonucleoside Phosphorothioates, Ed. S. Agrawal, Protocols for Oligon). Synthesis and Properties (Methods Mol Biol 20 (1993), pp. 165-189, Humama Press Ine., Totovva, NJ); Guzaev, "Reactivity of 3H-1,2,4-diathiazole-3-thiones and 3H-. 1,2-dithiole-3-thiones as sulfurizing agents for oligonucleotide synthesis / s "(Tetrahedron Lett 52 (2011), pp. 434-437); Sanghvi," A Status Update of Modified Oligonucleotides for Chemotherapeutics Applications "(Curr Protoc

Nucleic Acid Chem Suppl. 46 (2011), Unit 4.1.1-4.1.22)).

Synthesis of phosphorothioate-form PO consists of 4-step synthetic cycles.

The synthetic cycle of oligodeoxyribonucleotides in the form of phosphorothioates begins with the unblocking of the nucleotide attached to the solid support (glass or polystyrene bead) at the 3'-position. This first step is called detritylation and is intended to remove the acid-resistant dimethoxytrityl protecting group from the 5'-hydroxyl backbone nucleoside group using an acid solution of dichloroacetic acid in dichloromethane or toluene.

The next step is the coupling of the 5'-hydroxyl nucleoside group with the incoming phosphoramidic reagent activated with 1H-tetrazole or 4,5-dicyanimidazole.

The resulting 3 ', 5'-internucleoside phosphite bond is sulfurized (third step) with Ν, Ν, Ν'Ν'-tetraethylthiouram disulfide to provide a thionic phosphotriester bond. On the other hand, sulfurization can be accomplished using other reagents, such as phenylacetyl sulfide with 3-picoline, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent) or N, N-dimethyl-N '. - (3-Thioxo-3H-1,2,4-ditazol-5-yl) methanimidamide.

In a fourth step, limitation of the unreacted 5'-hydroxyl nucleoside group to acetic anhydride and N-methylimidazole / 2,6-lutidine / acetonitrile is achieved.

The result of this four-step fusion cycle is an additional DNA base and the cycle is repeated until the entire sequence of the desired length is created according to the desired PO sequence.

After completion of the fusion cycles, the oligodeoxyribonucleotides remain attached to the backbone with all protecting groups. Therefore, in order to separate and remove the protection from these basic non-reactive groups (e.g., cyanoethyl group on phosphate triester), the solid support is treated with triethylamine acetonitrile solution followed by ammonium hydroxide.

The supports are then removed by filtration and the oligodeoxyribonucleotides are collected after evaporation of the ammonium hydroxide. Finally, purification of the synthesized oligodeoxyribonucleotides in the form of the phosphorothioates is accomplished by efficient liquid chromatography (HPLC), desalting and lyophilization.

PO carriers

The POs mentioned in this document can be more efficiently transported to S. mutans and S. sobrinus bacteria (i.e., penetrate the bacterial cell wall) using carriers. The carrier may be the transfection reagents and cationic polymers known in the art. Any form of PO with carrier or transfection reagent consisting of a cationic polymer such as TurboFect ™ (Thermo Fisher Scientific, Enzyme) can be used to increase bacterial PO uptake and to effectively inhibit biofilm formation in S. mutans and S. sobrinus.

Form of phosphorothioate PO SEQ ID NO. 1, 13, 19, are used to demonstrate the inhibition of biofilm formation on a solid surface by demonstrating the antisense effect they provide. The same effect is achieved with other forms of PO described in this document, such as SEQ ID NO. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24, or fragments thereof or modifications thereof.

Other carriers used for various forms of PO for insertion of PO into eukaryotic and prokaryotic cells may be various chemicals that can complex with isolated oligonucleotides to protect them from degradation and improve their cellular penetration. These include, but are not limited to, calcium salts (e.g., calcium phosphate, calcium chloride), cationic lipids (e.g., N- (2,3 dioleoyloxypropyl) N, N, N-trimethylammonium chloride, dioleoylphosphatidylethanolamine, cholesterol), cationic polymers (e.g. diethylaminoethyl dextran, polyethyleneimine, chitosan, cyclodextrin, polyamidoamine dendrimers, polypropyleneimine dendrimers), intracellular peptides (peptides typically containing less than 30 amino acids; e.g. penetratin) and different types of nanoparticles (see. et al., Chemical Methods for DNA Delivery, Ed., EC Heiser, Volume 1 of Gene Delivery to Mammalian Cells (Methods Mol Biol 245 (2004), pp. 3-23, Mumana Press Ine., Totovva, NJ); Zhu and Mahato, "Lipid and Polymeric Carrier-Mediated Nucleic Acid Delivery (Expert Opin Drug Deliv 7 (2010), 1209-1226); Bai et al.," Antisense Antibiotic: A Brief Revision of the Target Discovery and Delivery "(Curr Drug Discov Technol.7 (2010), p. 7685); Yu et al. Targeted Delivery Systems for Oligonueleotide Therapies (AAPS J 11 (2009), pp. 195-203); Aalinkeel et al. Quantum rods as nanocarriers ofgene therapy (Drug Deliv 19 (2012), pp. 220-231). All of these transfection reagents, except calcium phosphate, which forms calcium-phosphate-DNA precipitates, act in a similar way - they form compounds with oligonucleotides through electrostatic interactions between negative charge oligonucleotide molecules and positive charge reagent molecules. Because such complexes retain a positive charge, they may bind to the plasma membrane or bacterial cell wall of a negatively charged eukaryotic cell and may be absorbed by cells.

The most widely used transfection reagents for delivery of PO to bacterial cells are cationic polymers and intracellular peptides, which are used for all the POs mentioned in this document, different forms and modifications of the PO mentioned herein. It is important to emphasize that cell-penetrating peptides are capable of penetrating cells, not only through electrostatic interaction but also through the formation of transient pores in the cellular plasma membrane (see Guo et al., "Treatment of Streptococcal Mutans with Antisense Oligodeoxyribonucleotides to gtfB mRNA Inhibitors"). (FEMS Microbial Lett 264 (2006), pp. 8-14) Effective delivery of phosphorothioate-form PO to

S. mutans bacteria using a cationic polymer - So-Fast ™ (Taiyangma).

The known and commercially available transfection reagent TurboFect ™ (Thermo Fisher Scientific, Enzyme) was used in the assays to support the present invention. With the aid of this cationic polymer PO with SEQ ID NO. 1, 13, 19 were inserted into S. mutans and S. sobrinus bacteria to demonstrate the efficacy of this transfection reagent experimentally.

Application

The present invention provides, in all its expressions, means and methods for inhibiting biofilm formation on solid surfaces without significantly affecting the viability of S. mutans and S. sobrinus bacteria. The method and PO of the invention provide the ability to administer POs corresponding to SEQ ID NOs. 1, 13, 19 or fragments thereof corresponding to SEQ ID NO. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24, using an effective concentration to reduce adhesion, adhesion, and adhesion of S. mutans and S. sobrinus to the bacterial culture. biofilm formation but without bactericidal (bactericidal) effect, as clearly demonstrated with S. mutans FIG. 5

The invention allows the use of POs having the sequence of SEQ ID NO. 1, 13, 19, or the PO fragments or modifications of the PO described herein to achieve antispasmodic effect, in the prefecture and control of atherosclerosis and cardiovascular infections, without significant effect on the human microbiome.

As can be seen in FIG. In Tables 5 and 1, effective PO concentrations reduce adhesion, bacterial adhesion, and biofilm formation of S. mutans and S. sobrinus without any pronounced bacteriostatic and bactericidal activity. Example 5 specifically illustrates the effect of effective PO concentration in blood medium (serum), thereby demonstrating the effect on the formation of foci of atherosclerosis in the cardiovascular system, tissues, and blood medium.

With respect to all of the effects disclosed herein, the present invention provides a novel way of controlling and preventing biofilm foci in the cardiovascular system, tissues, and blood medium using POs set forth in SEQ ID NO. no. 1, 13,19, or any of the PO fragments or modifications of the PO disclosed herein, thereby achieving an antisense effect on glucosyltransferases of S. mutans and S. sobrinus. This new method provides a tool for inhibiting biofilm formation on various hard surfaces, including cardiovascular tissues, implants, and other surfaces in contact with human tissues and blood.

New POs having the sequence SEQ ID NO. no. 1, 13, 19, or any of the PO fragments or PO modifications referred to herein, may be used as part of biopharmaceutical compositions (solutions, suspensions, etc.), may be incorporated into biopharmaceutical formulations providing topical and systemic topical effects the body, human, or inanimate surfaces in contact with living body tissues and blood.

The present invention provides novel POs having the sequence SEQ ID NO. 1, 13, 19, or any of the PO fragments or modifications of the PO herein disclosed, is capable of binding to the respective portions of the Streptococcus mutans genome encoding glucosyltransferase B and glucosyltransferase C, and to the iRNA of these glucosyltransferases simultaneously, as well as the glucosyltransferase S1. inhibiting glucan production by reducing biofilm formation, thereby preventing the formation of atherosclerosis and infectious foci.

The present invention further provides novel POs having the sequence SEQ ID NO. 1, 13, 19, or any of the PO fragments or modifications of the PO herein, prevents bacterial adhesion and adherence to solid surfaces without at the same time reducing bacterial viability. This aspect allows the use of the POs provided as agents for combating atherosclerosis and cardiovascular infections, which do not significantly affect the microbiome of the bacterial ecosystem in the human body.

It is an object of the present invention to provide means and a method for inhibiting biofilm formation, particularly in the cardiovascular system and the blood medium. The object is achieved by the action of the PO molecules of the present invention which inhibit glucan production in S. mutans and S. sobrinus, targeting simultaneously both types of bacterial glucan synthesis, with a single type of PO molecule.

The claim "one type of antisense oligonucleotide molecule" is used to emphasize that the above antisense effect is achieved with one or more molecules having the oligonucleotide sequence first disclosed in the present invention.

POs are provided as one or more molecules of the sequences set forth below in the present invention, i.e. POs having the sequence of SEQ ID NO. 1, 13, 19, as well as fragments and modifications thereof (e.g., having the sequence of SEQ ID NOs: 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24) in an amount that is effective and sufficient with respect to the medium and the particular composition.

As a result of the present invention, new POs having the sequence SEQ ID NO. 1, 13, 19, or any of the PO fragments or modifications of the PO referred to herein (e.g., having the sequence of one of SEQ ID NOs: 4, 5, 6, 7, 8, 9,10, 11, 12, 20, 21 , 22, 23, 24), the effect in vitro was consistent with the in silico modeled effect on S.mutans and S.sobrinus. These PO sequences inhibit the ability of S. mutans and S.sobrinus to synthesize the glucans required for biofilm formation. Non-biofilm bacteria are more easily recognized and eliminated naturally by the human immune system.

Accordingly, the present invention provides a method and means for inhibiting or reducing biofilm, as well as preventing the formation of biofilm foci on solid surfaces in vitro and in vivo. If the in vivo solid surface is part of human tissues, such as a vascular wall, the method comprises administering an effective dose of PO, as described herein, to human blood, i.e., PO having the sequence of SEQ ID NO. 1, 13, 19, or any of the PO fragments or modifications of the PO referred to herein (e.g., having the sequence of one of SEQ ID NOs: 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21 , 22, 23, 24) as a component of a biopharmaceutical composition for use in the prevention and treatment of biofilm-mediated cardiovascular pathologies associated with atherosclerosis and / or S. mutans or S. sobrinus infections.

Technology

The antisense technology offers several advantages over other antibacterial technologies, among which the main advantages are:

specific and synchronous inhibition of gtf iRNA in S. mutans and S. sobrinus;

use of the PO sequences disclosed in the present invention for analogous targets in two species of streptococci (S. mutans and S. sobrinus), external use for inhibition of biofilms of S. mutans and S. sobrinus on dead surfaces such as catheters, prostheses or implants to minimize infection. or foreclosed risks as well as reducing systemic side effects.

The present invention discloses a method of using a PO and a PO having the sequence set forth in SEQ ID NO. 1, 13, 19, or any of the PO fragments or PO modifications (e.g., having the sequence of one of SEQ ID NOs 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24), inhibit biofilm formation and thereby the occurrence of diseases and pathologies caused by biofilm formation, e.g., atherosclerosis, infectious endocarditis, infectious and inflammatory reactions to implants or prostheses, their rejection reactions and the like.

Glucans forming exopolysaccharides of biofilms of S. mutans and S. sobrinus are composed of repeating units of glucose monomers and are synthesized by enzymatic reactions of glucosyltransferases. Glucans can be water insoluble, water soluble and partially water soluble. Glucans serve as a polysaccharide matrix for biofilm with several functions:

1) increases bacterial attachment and subsequent accumulation on tissues;

2) provides structural integrity and adhesion of biofilm;

3) increases the adhesive properties of the biofilm matrix.

S. mutans produces three types of glucan polymers, water-insoluble glucans with alpha (a) -1,3 glucosidic linkages, a partially water-soluble mixture of a-1,3 and a-1,6 glucosidic linkages, and also water-soluble glucans with a1 , 6 glucosidic linkages, which are synthesized by GtfB, GtfC and GtfD enzymes (proteins), respectively. There are three genes, gtfB, gtfC, and gtfD, which encode the GtfB, GtfC, and GtfD proteins, respectively.

A separate object and novelty of the present invention is the simultaneous and parallel inhibition of the expression of glucosyltransferase iRNA and gtf genes in S. mutans and S. sobrinus.

The effect of inhibiting the expression of glucosyltransferase iRNA and gtf genes, as well as the effect of inhibiting the synthesis of water-insoluble and partially soluble glucans and, respectively, of biofilm formation is achieved by using the following sequences:

SEQ ID NO: 1 (5'-GCAGACCATTGCTTAATCT-3 '), the action of which is the complete inhibition of the production of water-insoluble glucans and the resulting biofilm formation.

SEQ ID NO: 13 (5'-TTGGCAGACCATTGCTTAATCTTAAC-3 ') and / or SEQ ID NO: 19 (5-TTAGAGAAACCTTCAAACATGACGCG-3), the operating result is analogous to SEQ ID NO: 13. 1;

Likewise, an analogous effect as above is achieved by acting on PO sequence fragments and modified sequences (e.g., having one of SEQ ID NOs: 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22). , 23, 24).

The PO may be sequence specific as set forth in SEQ ID NO. 1, 13, 19 or portions or fragments of those sequences. There may also be POs having the sequence of SEQ ID NO. 1,13, paragraph 19, and a fragment selected from the following list:

5'-CAGACCATTGCTTAATCT-3 ' (SEQ ID NO: 4) 5'-AGACCATTGCTTAATCT-3 ' (SEQ ID NO: 5) 5'-GACCATTGCTTAATCT-3 ' (SEQ ID NO: 6) 5'-GCAGACCATTGCTTAATC-3 ' (SEQ ID NO: 7) 5'-GCAGACCATTGCTTAAT-3 ' (SEQ ID NO: 8) 5'-GCAGACCATTGCTTAA-3 ' (SEQ ID NO: 9) S'-CAGACCATTGCTTAATC-S ' (SEQ ID NO: 10) 5'-AGACCATTGCTTAATC-3 ' (SEQ ID NO: 11) S'-CAGACCATTGCTTAAT-S ' (SEQ ID NO: 12) 5-TTGGCAGACCATTGCTTAATCTTAAC-3 '(SEQ ID NO: 13) 5-GAAACCTTCAAACATGACGC-3 ' (SEQ ID NO: 20) 5-AAACCTTCAAACATGACGC-3 ' (SEQ ID NO: 21) 5'-GAAACCTTCAAACATGACGCG-3 ' (SEQ ID NO: 22) 5-GAAACCTTCAAACATGACG-3 ' (SEQ ID NO: 23)

5'-AGAAACCTTCAAACATGACGC-3 '(SEQ ID NO: 24)

POs having the sequence SEQ ID NO. 15 is derived from SEQ ID NO. 13, which is 100% complementary to the 26 nt S. mutans gtfB, S. mutans gtfC genes, and also to one of the mismatched nucleotides in the S. sobrinus gtfl region (see Example 1).

POs having the sequence SEQ ID NO. no. 1, is an optimized 19 nucleotide molecule with respect to the thermodynamic properties required for the inhibition of S. mutans gtfB and gtfC, S. sobrinus gtfl iRNA.

PO with SEQ ID NO. 1 are derived from SEQ ID NO. 13 and is composed of 19 nt:

5′-TTG-GCAGACCATTGCTTAATCT-TAAC-3 ′ (underlined and referenced in Example 1). SEQ ID NO: 4-12 are derived from SEQ ID NOs. 1.

PO with SEQ ID NO. 13 are isolated synthetic POs consisting of 26 nt:

5'-TTGGCAGACCATTGCTTAATCTTAAC-3 ', with which the antisense effect is achieved by naturally occurring DNA sequence SEQ ID NO. For 14 parts.

PO with SEQ ID NO. 19 are insulated synthetic POs consisting of 26pcs:

5'-TTAGAGAAACCTTCAAACATGACGCG-3 'with which the antisense effect on the native DNA sequence of SEQ ID NO. 18th

SEQ ID NO: 20-24 are derived from SEQ ID NOs. 19th

Therefore, any PO fragments, even shorter than 26 nt, will have the sequence of SEQ ID NO. 1 or SEQ ID NO. 13, or SEQ ID NO. 19, which also encompasses and corresponds to the coding regions for glucosyltransferases as defined herein, have antispasmodic effects and fall within the scope of the invention as defined (and claimed) in the PO forms having an effect consistent with the method and means disclosed herein.

The isolated POs of the present invention may be isolated from a natural or natural source by a purified restriction reaction, or may be synthesized by synthetic means, i.e., chemically synthesized or recombinantly produced, or by genetic engineering, or polymerization and amplification methods, e.g. PCR) and PCR amplification or any other method. The PO may also be prepared by known procedures or other methods described herein in accordance with the present invention.

The POs of the present invention may be any molecule based on the corresponding nucleotide sequences that bind or bind using basic nucleotide pairing, including oligomers or polymers based on naturally occurring nucleotides and / or nucleic acid analogs forming non-standard nucleobases and / or non-standard bases, such as peptide nucleic acid (PNR) or locked nucleic acid (UNR), or any derived form of nucleic acid as shown herein. The PO may have a partial, e.g., 10, 20, 30, 40, 50, 60, 70, 80, or even 90% naturally occurring nucleotides, and the rest, i.e. 90, 80, 70, 60, 50, 40, 30, 20 or even 10% are nucleic acid analogs consisting of non-standard nucleobases and / or non-standard bases as defined herein using PNR, UNR or any other derivative of the nucleic acid. The PO can be further chemically modified. Such modifications may be oligodeoxyribonucleotides in the form of phosphorothioates as shown herein. All PO sequences provided herein may be chemically synthesized as oligodeoxyribonucleotides in the form of phosphorothioates.

Phosphorothioate oligonucleotides are a variant of normal DNA in which one of the unbound oxygen atoms is replaced by a sulfur atom. Internal nucleotide linkages (sulfurization) significantly reduce the activity of endonucleases and exonucleoses, including 5 'to 3' and 3 'to 5' DNA pol 1 exonuclease, nuclease S1 and P1, RNase, serum nuclease and snake venom phosphodiesterase. POs in the form of phosphorothioates have an increased potential for penetration through the lipid bilayer.

Still other forms of PO may be based on nucleotides, wherein at least one nucleotide has a modified basis for enhancing binding properties and / or reducing endonucleases and exonucleases, including 5 'to 3' and 3 'to 5' DNA pol 1 exonuclease, nuclease S1. and P1, RNase, serum nuclease and snake venom phosphodiesterase.

Examples Example - Sequence Selection of Antisense Oligonucleotides for Inhibition of Glucosyltransferase Expression

Bioinformatics methods and results

In selecting the novel PO sequences disclosed herein, conservative homologous regions in the gtf genes of oral streptococci were first identified.

To this end, comparative amino acid sequences analysis was first performed between S. mutans GtfB protein and other Gtf proteins present in oral streptococci. The genome of S. mutans (strain UA159, Bratthall serotype c, American Type Culture Collection (ATCC) # 700610) is fully sequenced and the sequences are stored in the GenBank database at the National Center for Biotechnology Information (NCBI). Therefore, using the GtfB protein amino acid sequences of S. mutans (strain UA159) as a query, a BLAST (Basic Local Alignment Search Tool) homologue search was performed among all known proteins (BLAST service is available at http: //blast.ncbi.nlm.nih). gov / Blast.cgi, and March 2013). It has been revealed that S. mutans (strain UA159) GtfB protein has a high degree of identity to S. mutans GtfC protein (strain UA159) as well as other Gtf (ie Gtfl) proteins in S. criceti, S. dentirousetti, S. dentisuis , S. dovvnei and S. sobrinus in bacteria responsible for the synthesis of water-insoluble glucans. Finally, the amino acid sequences constituting these proteins were selected and multivariate sequence comparisons were performed using the MAFFT web server at the Max-Planck Institute for Developmental Biology (http://toolkit.tuebingen.mpg.de/mafft, March 2013). .). Using this method, a conserved region was identified in the S. mutans (strain UA159) amino acid sequence of the GtfB protein which is 100% homologous to the corresponding regions in S. mutans (strain UA159) GtfC, S. criceti Gtfl, S. dentirousetti Gtfl, S. dentisuis Gtfl and S. orisuis in Gtf proteins. The corresponding coding segment for this region in the S. mutans (strain UA159) gtfB gene has the following 26 nucleotide (nt) sequence:

5'-GTTAAGATTAAGCAATGGTCTGCCAA-3 '(SEQ ID NO: 16). As with the comparative amino acid sequence analysis, this segment of the gtfB gene of S. mutans (strain UA159) also has 100% homologous regions in S. mutans (strain UA159) gtfC, S. criceti gtfl, S. dentirousetti gtfl, S. dentisuis gtfl and In the gtf genes of S. orisuis. In addition, a region of very high identity with only two nucleotide mismatches in the genes of S. dovvnei gtf precursor and S. sobrinus gtfl was also found. Based on the best results of the Primer3 program (Primer3 service was used at http://frodo.wi.mit.edu/primer3/input.htm. To analyze thermodynamics and other features during heteroduplex formation in March 2013), 19 nt sequence complementary to the coding region above:

5'-AGATTAAGCAATGGTCTGC-3 '(coding region sequence [SEQ ID NO: 17]

1111111111111111111

3'-TCTAATTCGTTACCAGACG-5 '(complementary sequence) [SEQ ID NO. 1]

An oligonucleotide of the following sequence was used in the experimental work based on the following bioinformative results:

5'-GCAGACCATTGCTTAATCT-3 '[SEQ ID NO. 1]

The exact locations of this segment in the gtf genes of S. mutans (strain UA159) and S. sobrinus (strain SL1), together with data from the NCBI GenBank database, are presented in their original format below:

1. S. mutans (strain UA159) in the gtfB gene (referred to as gtfl) ·.

GenBank accession no. gb INAE014133.1A

Streptococcus mutans UA159, complete genome Length = 2030921

Features of this part glucosyltransferase-I of subject mix:

Query 1 1]

Sbjct 954167 1]

GCAGACCATTGCTTAATCT

GCAGACCATTGCTTAATCT [SEQ ID NO:

954149 [SEQ ID NO.

2. S. mutans (strain UA159) in the gtfC gene (herein referred to as gtfSI): GenBank accession no. gb INAE014133.1A

Streptococcus mutans UA159, complete genome

Length = 2030921

Features in this part of subject sequence:

glucosyltransferase-SI

GCAGACCATTGCTTAATCT 19 [SEQ ID

1] lllllllllllllllllll

GCAGACCATTGCTTAATCT 958853 [SEO ID no.

Query 1 no.

Sbjct 958871 1]

3. In the gtfl gene of S. sobrinus (strain SL1):

GenBank accession no. dbj TOD63570.1A

Streptococcus sobrinus gene for glucosyltransferase GTFI, complete cds

Length = 6838

Query 1 GCAGACCATTGCTTAATCT

Sbjct 4079 GCAGACCATTGTTTAATCT [SEQ ID NO. 1]

III III III II III III I

4061 [SEQ ID NO. 15]

Single nucleotide mismatch of SEQ ID NO. 1 is underlined.

Based on the above data, the effect of PO on the suppression of S. sobrinus glucosyltransferase iRNA expression was modeled, since the antisense effect remains independent of a single mismatched nucleotide approximately in the middle of the sequence. S. mutans gtfB iRNA secondary structure modeling was performed using the Mfold program on the Rensselaer Bioinformatics Web Server (http://www.bioinfo.rpi.edu/applications/mfold, used in March 2013) to evaluate selected POs. login location. As a result, one hundred iRNA models were generated from which the most robust construct showing the PO binding region was selected (Fig.1).

Various clinical strains of these bacteria were selected from the European Nucleotide Archive (ENA) to identify conservative homologous domains between the glucosyltransferase genes of oral mutant streptococci, S. mutans and S. sobrinus, and to select for their complementary PO sequences. and clonal gtf gene sequences encoding the synthesis of water-insoluble glucans (screened September 2013). Multiple comparative analysis of these sequences was then performed using the S. mutans (strain UA159) gtfB gene as a reference using the MAFFT program web server at the Max-Planck Institute for Developmental Biology (http://toolkit.tuebingen.mpg.de/ mafft, performed September 2013). Using this method, a conserved homologous region consisting of 26 nt: 5'CGCGTCATGTTTGAAGGTTTCTCTAA-3 '(SEQ ID NO: 18) was identified in the glucosyltransferase genes of S. mutans and S. sobrinus. The complementary antisense sequence for this region (i.e., the antisense oligonucleotide) has the following 26 nt sequence: 5'-TTAGAGAAACCTTCAAACATGACGCG-3 '(SEQ ID NO: 19). The exact locations of this segment in the gtf genes of S. mutans (strain UA159) and S. sobrinus (strain SL1), together with data from the NCBI GenBank database, are presented in their original format below:

1. S. mutans (strain UA159) in the gtfB gene (herein referred to as gtfiy.

GenBank accession no. gb INAE014133.2 To

Streptococcus mutans UA159, complete genome Length = 2032925

Features in this part of subject sequence:

glucosyltransferase-I

Query 1 TTAGAGAAACCTTCAAACATGACGCG 26 [SEQ

ID # 19] llllllllllllllllllllllllll

Sbjct 953618 TTAGAGAAACCTTCAAACATGACGCG 953593 [SEQ

ID # 19]

2. S. mutans (strain UA159) in the gtfC gene (herein referred to as gtfSI) ·.

GenBank accession no. gb INAE014133.2 To

Streptococcus mutans UA159, complete genome Length = 2032925

Feature in this part of subject seąuence: glucosyltransferase-SI

Query 1 TTAGAGAAACCTTCAAACATGACGCG 26 [SEQ

ID # 19] llllllllllllllllllllllllll

Sbjct 958322 TTAGAGAAACCTTCAAACATGACGCG 958297 [SEQ

ID # 19]

3. In the gtfl gene of S. sobrinus (strain SL1):

GenBank accession no. dbj TOD63570.1A

Streptococcus sobrinus gene for glucosyltransferase GTFI, complete cds

Length = 6838

Query 1 ID # 19]

TTAGAGAAACCTTCAAACATGACGCG 26 [SEQ

Sbjct 3530 ID no. 19]

TTAGAGAAACCTTCAAACATGACGCG 3505 [SEQ

Using the AntiSense Design program hosted on the Integrated DNA Technologies web server (http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx7source = menu. Performed September 2013), for the above area ( SEQ ID NO: 18) has been optimized for additional complementary antisense sequences of 19-21 nt (i.e., antisense oligonucleotides) as set forth in SEQ ID NO: 18). 19 Derivatives: 5'-GAAACCTTCAAACATGACGC-3 '(SEQ ID NO: 20) 5'-AAACCTTCAAACATGACGC-3' (SEQ ID NO: 21) 5-GAAACCTTCAAACATGACGCG-3 '(SEQ ID NO: 22) 5'-GAAACCTTCAAAC Example '(SEQ ID NO: 23) 5-AGAAACCTTCAAACATGACGC-3' (SEQ ID NO: 24) - Effect of antisense oligonucleotides on biofilm formation in S. mutans cultures

Laboratory methods and results

S. mutans strain UA159 (Bratthall serotype c) from American Type Culture Collection (ATCC No. 700610), 24 hrs. was cultured in Todd Hewitt (TH) broth (Difco) under anaerobic conditions (95% N2 and 5% CO2) at 37 ° C. The purity of the culture was tested on Mitis salivarius agar (Difco) and Columbia blood agar (E&O Laboratories). Subsequently, the optical density (OT) of the bacterial culture was adjusted to 0.2 using a microplate reading spectrophotometer (Dynex MRX) and a wavelength of 630 nm was selected.

Prior to bacterial growth, 24-well flat bottom polystyrene cell culture plates (Sarstedt) were filled with TH broth. Then, three phosphorothioate oligodeoxyribonucleotides of different sequences were added to plate wells (final concentration 10 μΜ) either alone or with the TurboFect ™ transfection reagent:

A PO1 having the sequence 5'-GCAGACCATTGCTTAATCT-3 '(SEQ ID NO: 1), which is used as a pilot molecule of PO.

2. PO2 having the sequence: 5'-ACGCACTTTCTTGTCCAT-3 '(SEQ ID NO: 2), which is used as a positive control molecule because of its known and proven efficacy in suppressing S. mutans gtfB gene expression (see Guo et al. . Treatment of

Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibitor

GtfB expression and function. FEMS Microbial. Lett. 264 (2006), pp. 8-14).

3. PO3 having the sequence 5'-ACTCGTATGCTACAGCTAT-3 '(SEQ ID NO: 3) and used as a negative control molecule different from the test molecule in that the nucleotide sequence in the sequence is shuffled randomly.

These POs were synthesized by Metabion International AG (Germany) as complete phosphorothioate form oligodeoxyribonucleotides using a 1 pmol synthesis scale and high performance liquid chromatography purification. Prior to the experiments, the lyophilized POs were dissolved in sterile distilled nuclease-free water (Thermo Fisher Scientific, Enzyme) to obtain stock solutions of 100 μΜ concentration. As required, POs were combined in combination with TurboFect ™ reagent according to the manufacturer's protocol - that is, using 2 µg of reagent 1 pg oligonucleotide template.

After addition of PO to the plates, S. mutans culture bacteria were plated in wells to obtain a final dilution of 1: 100. Immediately, sterile 1 mm thick glass slides cut from standard microscope slides (76 * 26 mm; Thermo Fisher Scientific) were placed vertically in the wells and incubated under anaerobic conditions for an additional 2 hours. At 37 ° C. The sterile sucrose solution was then added to the appropriate wells to a final concentration of 1%, and the plates were again incubated under anaerobic conditions (95% N2 and 5% CO2) at 37 ° C for an additional 22 hours. In this experiment, the volume of liquid medium (TH broth) per well was 1 mL; wells containing only medium (broth) without bacteria were used as a "blank" control; o untreated S. mutans bacteria and S. mutans bacteria treated with nuclease-free water alone or TurboFect ™ reagent were used as experimental controls.

24 hours later. for a total incubation period, glass slides were removed from the wells, dried and further used for analysis of S. mutans biofilm by MicroXAM ™ (ADE Phase Shift) optical profilometer. For this purpose, five measurements (200 200 260 µm each) were made through the center of the glass plate from the bottom to the top of the visible biofilm using a 50Χ objective lens with a magnification of 0.625. Additionally, a Gaussian filter (50 χ 50 pm) was selected and applied to eliminate surface shape errors and waviness. In this analysis, several important parameters of the surface roughness of the biofilm were evaluated: St the maximum difference between the upper and lower points of the surface (ie, the "vertices" and "valleys"), S _a - the average difference between the upper and lower points of the surface. "Valleys"), Sdr is the total surface area (if all surface irregularities are smoothed) according to Wennenberg and Albrektsson in "Suggested guidelines for the topographic evaluation of implant surfaces" (Int. J. Or. Maxillofac. Implants. 15 (2000), 331-344 p.). These surface parameters reflect the degree of maturity or "maturity" of the biofilm, which is the amount of bacterial attachment and the formation of micro-colonies. Statistical significance of the identified surface parameters was evaluated by applying the One-Way ANOVA method with Tukey's test. A p value of less than 0.05 was considered statistically significant.

Optical profilometry for S. mutans biofilm surface analysis revealed that 1% sucrose in TH broth significantly increased the surface roughness parameters Sa and St compared to the clean glass surface used in this experiment as a reference control (p <0.05). ) (Table 1). In this case, it indicates that 1% sucrose in the medium stimulated bacterial attachment (adhesion) to the glass plate surface and biofilm formation (Table 1). However, the PO1 test molecule (SEQ ID NO: 1), in combination with TurboFect ™ reagent, significantly reduced biofilm formation on the glass plate surface despite 1% sucrose in the broth (p = 0.06 [Sa parameter]). Most importantly, this effect was statistically significant compared to bacteria exposed to PO2 (SEQ ID NO: 2) and PO3 (SEQ ID NO: 3) in combination with TurboFect ™ reagent (p <0.05 [Sa and Sdr parameters]) as this is shown in Table 1 and FIG. 2a, 2b and 2c. Based on these results, it can be concluded that the test PO1 molecule (SEQ ID NO: 1) is effective in reducing adhesion of S. mutans and biofilm formation on a rigid surface (glass plate) in vitro.

Table 5 - Surface parameters of glass plates with S. mutans biofilm

Impact You pm St pm Sdr% Reference j FIG. 2 Clean glass plate (reference control) 0.01 (0.00) 0.92 (0.53) 0.05 (0.02) Sucrose-free bacteria 0.13 (0.03) 2.34 (1,12) 1.91 (1.38)

Unaffected bacteria + sucrose 0.13 (0.04) 8.44 (4.03) 1.57 (0.95) Unaffected bacteria + sucrose + nucleases water free + TurboFect ™ 0.05 (0.03) 3.80 (2.25) 0.57 (0.40) Bacteria + sucrose + PO1 0.27 (0.01) 7.27 (1.91) 10.09 (0.90) Bacteria + sucrose + PO2 0.45 (0.04) 13.03 (1.93) 18.60 (2.24) Bacteria + sucrose + PO3 0.14 (0.05) 5.74 (2.62) 1.11 (0.71) Bacteria + Sucrose + PO1 + TurboFect ™ 0.07 (0.04) 6.94 (5.81) 0.99 (1.37) FIG. 2a Bacteria + Sucrose + PO2 + TurboFect ™ 0.31 (0.02) 7.99 (1.67) 10.08 (1.13) FIG. 2b Bacteria + Sucrose + PO3 + TurboFect ™ 0.31 (0.02) 7.18 (0.64) 9.19 (0.82) FIG. 2c

The table shows the surface parameters of glass plates with S. mutans biofilm after 24 h. incubations under different effects. Data are presented as means of 5 measurements and standard errors are given in parentheses.

Example 1 - Effect of antisense oligonucleotides on bacterial aggregation in S. mutans cultures

Laboratory methods and results

The experimental design and conditions were the same as described in Example 2 except that no 24-well glass plates were inoculated. After sucrose addition, bacterial aggregation was checked spectrophotometrically for 3 h. at intervals of up to 14 hours, followed by 24 hours. For this purpose, the optical density (OD) of the samples taken was measured using a microplate reading spectrophotometer (Dynex MRX) and a wavelength of 630 nm. In addition, at the end of the experiment (after a total incubation period of 24 hours), additional samples were taken from the wells of the plate to assess the morphology of S. mutans bacteria and their aggregation using a Gram staining method and light microscopy with a Leica DM500 microscope.

Spectrophotometric examination of bacterial cultures growing in plate wells revealed that addition of sucrose significantly increased OT for 14 h. is 24 or. compared to bacteria grown without sucrose (Figs. 3a and 3b). This indicates that 1% in sucrose medium caused the formation of bacterial aggregates due to glucan synthesis. Neither nuclease-free water nor TurboFect ™ reagent had any significant effect on this process (Fig. 3b). However, exposure to bacteria with the test PO1 molecule (SEQ ID NO: 1), alone or in combination with TurboFect ™ reagent, resulted in an approximately 1.5-fold reduction in OT compared to untreated bacteria for 24 hours, indicating reduced bacterial aggregate formation (FIG. 3c and 3d). This effect of the PO1 test molecule (SEQ ID NO: 1) was further confirmed by staining for 24 h. samples taken by the Gram method. As shown in Figures 4b and 4c, the test PO1 molecule (SEQ ID NO: 1) inhibited the formation of bacterial aggregates, as well as reduced the length of bacterial chains (more individual bacterial cells were observed) compared to unaffected bacteria. In contrast, neither PO2 (SEQ ID NO: 2) nor PO3 (SEQ ID NO: 3) molecules had this effect on bacteria growing in TH broth with 1% sucrose (Figs. 3c and 3d, Figs. 4d and 4e). Therefore, in agreement with these results, it can be concluded that the test PO1 molecule (SEQ ID NO: 1) reduces S. mutans bacterial aggregation in the presence of 1% sucrose in the medium and even reduces bacterial chain elongation, indicating inhibition of glucan production.

Example 1 - Effect of antisense oligonucleotides on the viability of S. mutans bacteria

Laboratory methods and results

The experimental design and conditions were the same as described in Example 2 except that 24-well plates were inoculated with glass plates and no sucrose was added to the TH broth. After the initial 2 hours. for the incubation period, bacterial growth was further monitored spectrophotometrically for 3 h. at intervals of up to 14 hours, followed by 24 hours. For this purpose, the optical density (OD) of the samples taken was measured using a microplate reading spectrophotometer (Dynex MRX) and a wavelength of 630 nm.

Spectrophotometric examination of bacterial cultures growing in plate wells revealed that the nuclease-free water and TurboFect ™ reagent did not affect the normal bacterial growth process throughout the 24 hours. incubation period (Fig. 5A). Effects on bacteria with PO1 (SEQ ID NO: 1), PO2 (SEQ ID NO: 2), and PO3 (SEQ ID NO: 3) molecules, both alone and in combination with TurboFect ™, only slightly reduced bacterial growth curves (OT) ) as compared to unaffected bacteria (Figs. 5b and 5c). Based on these data, it can be concluded that none of the POs used significantly inhibits the growth of S. mutans, which does not impair bacterial viability.

Example 1 - Effect of antisense oligonucleotides on biofilm formation in mixed serum cultures of S. mutans and S. sobrinus

Laboratory methods and results

Mixed cultures of S. mutans and S. sobrinus were used to evaluate the effect of the PO1 test molecule (SEQ ID NO: 1) on bacterial biofilm formation in in vitro medium containing the main blood component, serum. S. mutans strain UA159 (Bratthall serotype c) and S. sobrinus strain SL1, obtained from the American Type Culture Collection (ATCC # 700610 and ATCC # 33478, respectively), 18 hrs. were cultured in Todd Hevvitt (TH) broth (Difco) containing 10% heat-inactivated horse serum under anaerobic conditions (95% N2 and 5% CO2) at 37 ° C. The purity of the cultures was tested on Mitis salivarius agar (Difco) and Columbia blood agar (E&O Laboratories). The optical density (OT) of the bacterial cultures was then adjusted to 0.2 using a microplate reading spectrophotometer (Dynex MRX) and a wavelength of 630 nm.

Prior to bacterial growth, 24-well flat bottom polystyrene cell culture plates (Sarstedt) were filled with TH broth with 10% heat-inactivated horse serum. Then, the phosphorothioate oligodeoxyribonucleotides PO1 (SEQ ID NO: 1) and PO3 (SEQ ID NO: 3) synthesized using a 1 pmol synthesis scale and high performance liquid chromatography purification were added to plate wells (final concentration - 10 μΜ) in combination with a transfection reagent, TurboFect ™.

After addition of PO, S. bacteria, S. mutans and S. sobrinus cultures were mixed in equal volumes and plated to a final dilution of 1: 100. Immediately, sterile 1-mm-thick glass slides from standard microscope slides (76 χ 26 mm; Thermo Fisher Scientific) were placed vertically in the wells and incubated under anaerobic conditions for an additional 4 hours. At 37 ° C. The sterile sucrose solution was then added to the appropriate wells to a final concentration of 1%, and the plates were again incubated under anaerobic conditions (95% N2 and 5% CO2) at 37 ° C for an additional 20 hours. In this experiment, the volume of liquid medium (TH broth) per well was 1 mL; wells with bacterial-only medium (broth) were used as the "blank" control and untreated mixed S. mutans and S. sobrinus bacteria were used as the experimental control.

24 hours later. for a total incubation period, glass slides were removed from the wells, dried and further used for analysis of mixed S. mutans and S. sobrinus biofilms on a Sensofar PLu 2300 optical confocal profilometer. For this purpose, six measurements of biofilm roughness and five measurements of biofilm thickness (measuring 180 χ 240 µm each) were made through the middle of the glass slide from the bottom to the top of the visible biofilm using a 50Χ confocal lens. The scanned and measured specimens were further processed by the Gvvyddion software (version 2.27, available online at http://gwyddion.net) to quantify the surface roughness and thickness parameters of the biofilm, reflecting the degree or "maturity" of the biofilm. Additionally, a Median filter (size 10 pixels or 3 pm) was selected and applied to eliminate surface shape errors and waviness. One of the most important surface parameters - Rq (mean height deviation) - was calculated by quantifying the surface roughness of the biofilm. Statistical significance of the identified surface parameters was assessed by applying the One-Way ANOVA method of the SPSS statistical program (version 20.0) with the LSD Post Hoc test. A p-value of less than 0.05 was considered statistically significant.

Optical confocal profilometry for surface analysis of glass slides with mixed S. mutans and S. sobrinus biofilms revealed that 1% sucrose and 10% serum TH in broth significantly increased the biofilm surface roughness parameter, Rq, and biofilm thickness compared to untreated bacteria grown with 10% serum but without sucrose (Figures 8a and 9a and 9b). In this case, it indicates that 1% sucrose in the medium stimulated bacterial attachment (adhesion) to the surface of the glass plate and biofilm formation. However, the PO1 test molecule (SEQ ID NO: 1), in combination with TurboFect ™ reagent, reduced the biofilm roughness (Rq) of mixed S. mutans and S. sobrinus cultures in TH broth containing 1% sucrose and 10% blood serum compared to bacteria, treated with PO3 (SEQ ID NO: 3) in combination with TurboFect ™ reagent (p <0.05) (Figs. 8b and 8c and 9a). In addition, the PO1 test molecule (SEQ ID NO: 1) in combination with TurboFect ™ reagent reduced the biofilm thickness of mixed S. mutans and S. sobrinus cultures in TH broth containing 1% sucrose and 10% serum compared to untreated bacteria and bacteria exposed to PO3 (SEQ ID NO: 3) in combination with TurboFect ™ reagent (p <0.05) (Figure 8 and Figure 9b). Based on these results, it can be concluded that the test PO1 molecule (SEQ ID NO: 1) is effective in reducing adhesion and biofilm formation of S. mutans and S. sobrinus on a rigid surface (glass plate) in a medium containing a major blood component, serum, in vitro. conditions.

Annex. List and Description of PO Sequences Sequence no. 1 (SEQ ID NO: 1): 5'-GCAGACCATTGCTTAATCT-3 '

Length: 19 nucleotides (nt)

Chemical structure: deoxyribonucleic acid (DNA)

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is SEQ ID NO. 13 derived by binding to the corresponding region of S. mutans gtfB and gtfC iRNA and S. sobrinus gtfl iRNA, resulting in an antisense effect. In existing experiments, this is a test sequence.

Track # 2 (SEQ ID NO: 2):

5'-ACGCACTTTCTTGTCCAT-3 '

Length: 18 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence binds by complementarity to the region within the S. mutans gtfB iRNA translation initiation region, resulting in an antisense effect according to Guo et al. Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibition of GtfB expression and function. FEMS Microbiol. Lett. 264 (2006), p. 8-14. It is used as a positive control in existing experiments.

Track # 3 (SEQ ID NO: 3):

5'-ACTCGTATGCTACAGCTAT-3 '

Length: 19 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is an analog of SEQ ID NO: 1 with the same molecular weight and nucleotide content but with a randomized nucleotide sequence. For the latter reason, it does not produce an antisense effect and is therefore used as a negative control in current experiments.

Track # 4 (SEQ ID NO: 4):

5-CAGACCATTGCTTAATCT-3 '

Length: 18 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is an analog of SEQ ID NO: 1, having the same nucleotide sequence order, but truncated by one nucleotide from the 5 'end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotide-mediated inhibition independent of location of the target mixture (J. Biol. Chem. 269 (1994), pp. 16187-16194).

Track # 5 (SEQ ID NO: 5):

5-AGACCATTGCTTAATCT-3 '

Length: 17 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is an analog of SEQ ID NO: 1, having the same nucleotide sequence sequence, but truncated by two nucleotides from the 5 'end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotide-mediated inhibition independent of location of the target mixture (J. Biol. Chem. 269 (1994), pp. 16187-16194).

Track # 6 (SEQ ID NO: 6): 5-GACCATTGCTTAATCT-3 '

Length: 16 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is an analog of SEQ ID NO: 1, having the same nucleotide sequence sequence, but truncated by three nucleotides from the 5 'end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration to be almost independent of location of the target mixture (J. Biol. Chem. 269 (1994), pp. 16187-16194).

Track # 7 (SEQ ID NO: 7):

5'-GCAGACCATTGCTTAATC-3 '

Length: 18 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is an analog of SEQ ID NO: 1 having the same sequence of nucleotide arrangement but truncated by one nucleotide from the 3 'end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration to be almost independent of location of the target mixture (J. Biol. Chem. 269 (1994), pp. 16187-16194).

Track # 8 (SEQ ID NO: 8):

5-GCAGACCATTGCTTAAT-3 '

Length: 17 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is an analog of SEQ ID NO: 1 having the same nucleotide sequence sequence but truncated by two nucleotides from the 3 'end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotide-mediated inhibition independent of location of the target mixture (J. Biol. Chem. 269 (1994), pp. 16187-16194).

Track # 9 (SEQ ID NO: 9):

5'-GCAGACCATTGCTTAA-3 '

Length: 16 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is an analog of SEQ ID NO: 1 having the same sequence of nucleotide arrangement, but truncated by three nucleotides from the 3 'end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotide-mediated inhibition independent of location of the target mixture (J. Biol. Chem. 269 (1994), pp. 16187-16194).

Track # 10 (SEQ ID NO: 10):

5-CAGACCATTGCTTAATC-3 '

Length: 17 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is an analog of SEQ ID NO: 1, having the same nucleotide sequence sequence, but truncated by two nucleotides, one from the 5'-end and one from the 3'-end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotidemediated inhibition is highly dependent on oligo length and concentration to be almost independent of location of the target sequence (J. Biol. Chem. 269 (1994), p. 1618716194).

Track # 11 (SEQ ID NO: 11):

5'-AGACCATTGCTTAATC-3 '

Length: 16 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is an analog of SEQ ID NO: 1, having the same nucleotide sequence sequence, but truncated by three nucleotides, two from the 5'-end and one from the 3'-end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotidemediated inhibition is highly dependent on oligo length and concentration to be almost independent of location of the target sequence (J. Biol. Chem. 269 (1994), p. 1618716194).

Track # 12 (SEQ ID NO: 12):

5-CAGACCATTGCTTAAT-3 '

Length: 16 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is an analog of SEQ ID NO: 1, having the same nucleotide sequence order, but truncated by three nucleotides, one at the 5'-end and two at the 3'-end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotidemediated inhibition is highly dependent on oligo length and concentration to be almost independent of location of the target sequence (J. Biol. Chem. 269 (1994), p. 1618716194).

Track # 13 (SEQ ID NO: 13):

5'-TTGGCAGACCATTGCTTAATCTTAAC-3 '

Length: 26 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence may, according to the complementarity principle, bind to the corresponding 26 nt region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, resulting in an antisense effect. It is complementary to sequence no. 16, which has 100% homologous regions in the S. mutans gtfB, gtfC, S. criceti gtfl, S. dentirousetti gtfl, S. dentisuis gtfl \ r S. orisuis gtf genes, as well as homologous regions with two nucleotide mismatches in S. dovvnei gtf. of the precursor and S. sobrinus gtfl genes.

Track # 14 (SEQ ID NO: 14):

5'UCUGUUAAGAUUAAGCAAUGGUCUGCCAAGUACUUUAAUGGGACAAA

UAUUUUAGGGCGCGGAGCAGGCUAUGUCUUAAAAGA-3 '

Length: 83 nt

Chemical structure: ribonucleic acid (RNA)

Origin: Natural sequence present in S. mutans gtfB iRNA

Function: Required for streaming; encodes amino acids in the corresponding region of the S. mutans GtfB protein. The corresponding region of this sequence can be joined by antisense oligonucleotides having the sequence no. 1 and No. 4-13, causing an antispasmodic effect.

Track # 15 (SEQ ID NO: 15): 5'-GCAGACCATTGTTTAATCT-3 '

Length: 19 nt

Chemical structure: DNA

Origin: Natural sequence present in the S. sobrinus gtfl gene

Function: Encodes a region of S. sobrinus gtfl iRNA to which antisense oligonucleotides (with a single nucleotide mismatch) having sequence no. 1 and No. 4-12, producing an antispasmodic effect.

Track # 16 (SEQ ID NO: 16):

5'-GTTAAGATTAAGCAATGGTCTGCCAA-3 '

Length: 26 nt

Chemical structure: DNA

Origin: Natural sequence present in the S. mutans gtfB gene

Function: Encodes a region of S. mutans gtfB iRNA to which antisense oligonucleotides having the sequence no. 1 and No. 4-13, causing an antispasmodic effect. This sequence has 100% homologous regions in the S. mutans gtfC, S. criceti gtfl, S. dentirousetti gtfl, S. dentisuis gtfl, and S. orisuis gtf genes, as well as homologous regions with two nucleotide mismatches in S. dovvnei gtf precursor and S. sobrinus in the gtfl gene.

Follows N r. 17 (SEQ ID NO: 17):

5'-AGATTAAGCAATGGTCTGC-3 '

Length: 19 nt

Chemical structure: DNA

Origin: Natural sequence present in the S. mutans gtfB gene

Function: Encodes a region of S. mutans gtfB iRNA to which antisense oligonucleotides having the sequence no. 1 and No. 4-12, producing an antispasmodic effect. This sequence is SEQ ID NO. 16 derivative.

Track # 18 (SEQ ID NO: 18):

5'-CGCGTCATGTTTGAAGGTTTCTCTAA-3 '

Length: 26 nt

Chemical structure: DNA

Origin: Natural sequence present in the S. mutans gtfB gene

Function: Encodes a region of S. mutans gtfB iRNA to which antisense oligonucleotides having the sequence no. 19-24, causing a counter-sensory effect. This sequence has 100% homologous regions in FIG. 7 in the genes for glucosyltransferases of Streptococcus species and strains.

Track # 19 (SEQ ID NO: 19):

5-TTAGAGAAACCTTCAAACATGACGCG-3 '

Length: 26 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence may, by complementarity, bind to the corresponding 26 nt region of the S. mutans gtfB and gtfC iRNA and the S. sobrinus gtfl iRNA, resulting in an antisense effect. It is complementary to sequence no. 18, which has 100% homologous regions in FIG. 7 in the genes for glucosyltransferases of Streptococcus species and strains.

Track # 20 (SEQ ID NO: 20):

5'-GAAACCTTCAAACATGACGC-3 '

Length: 20 nt

Chemical structure: DNA

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is SEQ ID NO. 19 derivative, binds to the corresponding region in the S. mutans gtfB and gtfC iRNAs and in the S. sobrinus gtfl iRNA according to the principle of complementarity, causing an antisense effect. This is a test sequence selected using Antisense Design (Integrated DNA Technologies:

http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).

Track # 21 (SEQ ID NO: 21):

5-AAACCTTCAAACATGACGC-3 '

Length: 19 nt

Chemical structure: deoxyribonucleic acid (DNA)

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is SEQ ID NO. 19 derivative, binds to the corresponding region of S. mutans gtfB and gtfC iRNA and S. sobrinus gtfl iRNA according to the principle of complementarity, causing an antisense effect. This is a test sequence selected using Antisense Design (Integrated DNA Technologies: http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).

Track # 22 (SEQ ID NO: 22):

5-GAAACCTTCAAACATGACGCG-3 '

Length: 21 nt

Chemical structure: deoxyribonucleic acid (DNA)

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is SEQ ID NO. 19 derivative, binds to the corresponding region of S. mutans gtfB and gtfC iRNA and S. sobrinus gtfl iRNA according to the principle of complementarity, causing an antisense effect. This is a test sequence selected using Antisense Design (Integrated DNA Technologies: http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).

Track # 23 (SEQ ID NO: 23):

5-GAAACCTTCAAACATGACG-3 '

Length: 19 nt

Chemical structure: deoxyribonucleic acid (DNA)

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is SEQ ID NO. 19 derivative, binds to the corresponding region of S. mutans gtfB and gtfC iRNA and S. sobrinus gtfl iRNA according to the principle of complementarity, causing an antisense effect. This is a test sequence selected using Antisense Design (Integrated DNA Technologies: http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).

Track # 24 (SEQ ID NO: 24):

5'-AGAAACCTTCAAACATGACGC-3 '

Length: 21 nt

Chemical structure: deoxyribonucleic acid (DNA)

Origin: an artificially synthesized isolated antisense nucleotide sequence

Function: This sequence is SEQ ID NO. 19 derivative, binds to the corresponding region of S. mutans gtfB and gtfC iRNA and S. sobrinus gtfl iRNA according to the principle of complementarity, causing an antisense effect. This is a test sequence selected using Antisense Design (Integrated DNA Technologies: http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).

Claims (13)

DEFINITION OF INVENTION 1. Antispasmodic oligonucleotides (PO) for the prevention of atherosclerosis and cardiovascular infections, having the following characteristics: a) POs consisting of nucleotide sequences according to SEQ ID NO. 1, 13, 19; b) The PO is composed of the sequences SEQ ID NO. 1, 13, 19 fragments: or c) POs having at least 85% nucleotide sequences matching SEQ ID NOs. 1, 13, 19. 2. The PO of claim 1, wherein the nucleotide sequences are set forth in SEQ ID NO. 1,13,19 differ by one, two, three or four nucleotides. 3. The PO of claim 1, wherein the nucleotide sequences comprise fragments or portions selected from the group consisting of SEQ ID NO. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24. The PO according to any one of claims 1 to 3, wherein the PO is conjugated to a peptide penetrating the cell membrane. The PO of any one of claims 1 to 4 for use in the prevention, prevention, inhibition and reduction of atherosclerotic plaque and / or focal formation on human cardiovascular tissues and / or human blood medium. A biopharmaceutical composition for medical use, comprising the active ingredient and adjuvants and / or carriers, wherein the active ingredient is a PO according to any one of claims 1-4. 7. The biopharmaceutical composition of claim 6, wherein the carrier used is a cationic polymer. A biopharmaceutical composition according to any one of claims 6.7 for the treatment or prevention of atherosclerosis. A biopharmaceutical composition according to any one of claims 6.7 for the treatment or prevention of bacterial endocarditis. A biopharmaceutical composition according to any of claims 6.7 for the treatment of surfaces in contact with human blood and tissues, tubes, catheters, dialysis membranes, probes, valves, prostheses, implants for antibacterial activity against S. mutans and S. sobrinus. on such surfaces. A biopharmaceutical composition according to any one of claims 6.7 for the treatment of surfaces in contact with human blood and tissues, tubes, catheters, dialysis membranes, probes, valves, prostheses, implants, prophylaxis of atherosclerotic plaques and / or foci. damping and reduction on such surfaces. A biopharmaceutical composition according to any one of claims 6.7 for the treatment of surfaces in contact with human blood and tissues, tubes, catheters, dialysis membranes, probes, valves, prostheses, implants to reduce the emergence and growth of bacterial biofilms. A method of controlling bacterial colonies in S. mutans and S. sobrinus, characterized in that the biopharmaceutical composition of claim 6.7 specifically and simultaneously inhibits gtfB and gtfC iRNA expression in S. mutans and gtfl iRNA expression in S. sobrinus, it also inhibits the ability of these bacteria to synthesize water-insoluble glucans and partially water-soluble glucans at the same time and reduces the ability of these bacteria to synthesize exopolysaccharides forming biofilm backbones.