LT6214B - Antisense oligonucleotide for prevention of atherosclerosis and cardivascular infections - Google Patents

Antisense oligonucleotide for prevention of atherosclerosis and cardivascular infections Download PDF

Info

Publication number
LT6214B
LT6214B LT2013109A LT2013109A LT6214B LT 6214 B LT6214 B LT 6214B LT 2013109 A LT2013109 A LT 2013109A LT 2013109 A LT2013109 A LT 2013109A LT 6214 B LT6214 B LT 6214B
Authority
LT
Lithuania
Prior art keywords
seq
mutans
sequence
sobrinus
antisense
Prior art date
Application number
LT2013109A
Other languages
Lithuanian (lt)
Other versions
LT2013109A (en
Inventor
Ericson
Kačergius
Original Assignee
Uab "Bioseka"
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Uab "Bioseka" filed Critical Uab "Bioseka"
Priority to LT2013109A priority Critical patent/LT6214B/en
Priority to PCT/IB2014/065084 priority patent/WO2015052630A1/en
Publication of LT2013109A publication Critical patent/LT2013109A/en
Publication of LT6214B publication Critical patent/LT6214B/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3513Protein; Peptide

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Engineering & Computer Science (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Vascular Medicine (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to the field of microbiology. The invention provides isolated antisense oligonucleotides (ASO), pharmaceutical compositions comprising ASO, and methods for reducing, preventing or inhibiting biofilm formation in the human cardiovascular tissues and in the human blood medium to prevent and treat atherosclerosis and cardiovascular infections.

Description

Šis išradimas yra mikrobiologijos srities ir yra susijęs su bakterinių bioplėvėlių atsiradimu ir augimu žmogaus kardiovaskuliniuose audiniuose ir kraujo terpėje. Šis išradimas konkrečiai susijęs su bakterinių bioplėvėlių sukeltos aterosklerozės ir kardiovaskulinių infekcijų prevencija ir gydymu, panaudojant priešprasminius oligonukleotidus ir jų farmacines kompozicijas.The present invention is in the field of microbiology and relates to the emergence and growth of bacterial biofilms in human cardiovascular tissues and blood media. More particularly, the present invention relates to the prevention and treatment of atherosclerosis and cardiovascular infections caused by bacterial biofilms using antisense oligonucleotides and pharmaceutical compositions thereof.

Išradimo pagrindasBackground of the Invention

Širdies ir kraujagyslių ligos yra vienos iš dažniausių mirties priežasčių pasauliniu mastu (S. Mendis, P. Puška, B. Norrving. Global Atlas on cardiovascular disease prevention and control. VVorld Health Organization, Geneva (2011), p. 8-14). Šių ligų spektras yra labai platus ir apima tokias sunkias, gręsiančias gyvybei būkles kaip išeminę (koronarinę) širdies ligą, miokardo infarktą bei insultą. Fundamentinė to priežastis - aterosklerozė, kada dėl susidariusių aterosklerozinių plokštelių susiaurėja arterinių kraujagyslių spindis. Savo ruožtu, aterogenezės priežastys yra kompleksinės įskaitant hiperlipidemiją, padidėjusį kraujo krešėjimą, oksidacinį stresą, kraujagyslių endotelio disfunkciją, taip pat infekciją ir uždegimą, pažeidžiantį kraujagyslių sieneles.Cardiovascular disease is one of the most common causes of death worldwide (S. Mendis, P. Pushka, B. Norrving. Global Atlas on Cardiovascular Disease Prevention and Control. World Health Organization, Geneva (2011), pp. 8-14). The spectrum of these diseases is very wide and includes such severe life-threatening conditions as coronary heart disease, myocardial infarction and stroke. The fundamental cause of this is atherosclerosis, which results in a narrowing of the lumen of the arteries due to the formation of atherosclerotic plaques. In turn, the causes of atherogenesis are complex including hyperlipidemia, increased blood coagulation, oxidative stress, vascular endothelial dysfunction as well as infection and inflammation affecting the vascular wall.

Remiantis žinomais ir pripažintais moksliniais tyrimais infekcijos veiksnys aterogenezėje yra labai reikšmingas, ypač turint omeny tuos mikroorganizmus, kurie sudaro normaliąją žmogaus mikroflorą (Koren ir kt. Human orai, gut and plaque microbiota in patients with atherosclerosis. Proc. Nat. Acad. Sci. USA 108 [Suppl. 1] (2011), p. 4592-4598).According to known and recognized scientific studies, the factor of infection in atherogenesis is very significant, especially with regard to those microorganisms that make up the normal human microflora (Koren et al., Human Air, Gut and Plaque Microbiota in Patients with Atherosclerosis. Proc. Nat. Acad. Sci. USA). 108 [Suppl. 1] (2011), pp. 4592-4598).

Vienas iš žmogaus kardiovaskulinės sistemos infekcijų šaltinių yra normaliąją žmogaus mikroflorą sudarantys streptokokai. Tarp jų išskirtinos rūšys yra S. mutans irOne of the sources of infection in the human cardiovascular system is streptococci, which make up the normal human microflora. Species among them are S. mutans and

S. sobnnus, įprastai randami žmogaus burnoje. Šių rūšių streptokokai be kita ko geba suformuoti vandenyje netirpią bakterinę bioplėvelę ant burnos audinių paviršiaus. Šių bakterijų formuojamos biologinės plėvelės struktūrinį karkasą sudaro netirpus polimeras - gliukanas, kurį iš sacharozės sintezuoja kelių tipų gliukoziltransferazės (Gtf) izofermentai, t. y. S. mutans GtfB ir GtfC bei S. sobrinus Gtfl (Bowen ir Koo. Biology of Streptococcus mutans-denved glucosyltransferases: role in extracellular matrix formation of canogenic biofilms. Caries Res. 45 (2011), p. 69-86). Gliukoziltransferazės lokalizuojasi ne tik ant bakterijų sienelės, bet ir yra išskiriamos j aplinką laisvoje formoje. Dėl šių fermentų veiklos S. mutans, S. sobrinus ir kitos burnos bakterijos gali tvirtintis praktiškai prie bet kokių paviršių, tarp jų žmogaus audinių, nes susidarantis gliukanas savo fizinėmis savybėmis yra labai lipni medžiaga. Todėl Gtf fermentai tapę svarbiu taikiniu kuriant įvairias farmakologiškai aktyvias medžiagas, slopinančias S. mutans bei S. sobrinus bakterijų adheziją.S. sobnnus, commonly found in the human mouth. These types of streptococci are able, among other things, to form a water-insoluble bacterial biofilm on the surface of oral tissues. The structural backbone of the biofilm formed by these bacteria consists of insoluble polymer glucan, which is synthesized from sucrose by several types of glucosyltransferase (Gtf) isoenzymes, i. y. S. mutans GtfB and GtfC and S. sobrinus Gtfl (Bowen and Koo. Biology of Streptococcus Mutans-Denved Glucosyltransferases: Role in Extracellular Matrix Formation of Canogenic Biofilms. Caries Res. 45 (2011), pp. 69-86). Glucosyltransferases not only localize on the bacterial wall but are also released into the environment in free form. Due to the action of these enzymes, S. mutans, S. sobrinus, and other oral bacteria can attach to virtually any surface, including human tissues, because the glucan formed is a highly tacky substance by its physical properties. Therefore, Gtf enzymes have become an important target for the development of various pharmacologically active substances that inhibit the adhesion of S. mutans and S. sobrinus bacteria.

Dėl kasdienių burnos audinių pažeidimų, kitų patologinių būsenų, taip pat atliekant medicinines intervencijas burnoje, sukeliančias reikšmingą bakteriemiją, S. mutans bei S. sobrinus patenka j žmogaus kraują ir kardiovaskulinę sistemą (Nakano ir kt. Streptococcus mutans and cardiovascular diseases. J. Dent. Sci. Rev. 44 (2008), p. 29-37).As a result of daily oral tissue damage, other pathological conditions, as well as oral interventions leading to significant bacteremia, S. mutans and S. sobrinus enter the human blood and cardiovascular system (Nakano et al., Streptococcus mutans and cardiovascular diseases. J. Dent. Sci. Rev. 44 (2008), pp. 29-37).

Žmogaus kraujyje yra gryna forma randami gliukozės monomerai, kurią S. mutans bei S. sobrinus, taip pat jų išskiriamos gliukoziltransferazės gali panaudoti gliukanų sintezei. Bakterijų išskiriamos gliukoziltransferazės iš kraujo gliukozės gali sintezuoti šį lipnų polimerą, prilimpantį prie kraujagyslių sienelių ir tampantį adhezijos židiniais trombocitams ir jų agregacijai kardiovaskuliniuose audiniuose.Human blood glucose monomers are found in pure form and can be used by S. mutans and S. sobrinus, as well as their glucosyltransferases, for the synthesis of glucans. Bacterial secreted glucosyltransferases from blood glucose can synthesize this adhesive polymer, which adheres to the walls of blood vessels and becomes a focal point for adhesion to platelets and their aggregation in cardiovascular tissues.

Žinomais ir plačiai pripažintais moksliniais tyrimais nustatyta, kad žmogaus širdies vožtuvų audiniuose bei aterosklerozinėse plokštelėse S. mutans aptinkamas labai dideliu dažniu - 65% ir 75% atvejų atitinkamai (Nakano ir kt. Detection of cariogenic Streptococcus mutans in extirpated heart valve and atheromatous plaųue specimens. J. Clin. Microbiol. 44 (2006), p. 3313-3317; Nakano ir kt. Detection oforal bacteria in cardiovascular specimens. Orai Microbiol. Immunol. 24 (2009), p. 64-68). Be to, S. sobrinus taip pat identifikuojamas aterosklerozinėse plokštelėse, tačiau mažesniu dažniu. Tai rodo, kad šie burnos streptokokai yra susiję su aterosklerozės patogeneze.Known and widely accepted scientific studies have shown that S. mutans is found in very high frequencies in 65% and 75% of human heart valve tissues and atherosclerotic plaques, respectively (Nakano et al., Detection of Cariogenic Streptococcus Mutans in Extirpated Heart Valve and Atheromatous Plaque Specimens). J. Clin. Microbiol. 44 (2006), pp. 3313-3317; Detection of oral bacteria in cardiovascular specimens by Nakano et al., Weather Microbiol. Immunol. 24 (2009), pp. 64-68). In addition, S. sobrinus is also identified in atherosclerotic plaques, but at a lower frequency. This suggests that these oral streptococci are involved in the pathogenesis of atherosclerosis.

S. mutans ir S. sobrinus vaidmuo aterosklerozės raidoje susijęs su šių bakterijų išskiriamų gliukoziltransferazių veikla - gliukano sinteze. Tyrimais nustatyta, kad S. mutans padermės, turinčios defektus gtfB ir gtfC genuose, pasižymi ryškiai mažesnėmis savybėmis sukelti trombocitų agregaciją kraujyje palyginus su normaliomis („laukinėmis“) S. mutans bakterijomis (Taniguchi ir kt. Defect of glucosyltransferases reduces platelet aggregation activity of Streptococcus mutans: Analysis of clinical strains isolatedfrom orai cavities. Arch. Orai Biol. 55 (2010), p. 410416). Taigi streptokokų gliukoziltransferazių raiškos slopinimas praktiškai yra svarbus ne tik dantų ėduonies, bet ir širdies bei kraujagyslių ligų prevencijai.The role of S. mutans and S. sobrinus in the development of atherosclerosis is related to the activity of glucosyltransferases secreted by these bacteria - glucan synthesis. Studies have shown that S. mutans strains that have defects in the gtfB and gtfC genes exhibit markedly lower levels of platelet aggregation than normal ("wild") S. mutans bacteria (Taniguchi et al., Defect of glucosyltransferases causes platelet aggregation activity of Streptococcus). mutans: Analysis of clinical strains isolatedfrom orai cavities (Arch. Oral Biol. 55 (2010), p. 410416). Thus, inhibition of streptococcal glucosyltransferase expression is of practical importance not only for the prevention of dental caries but also for the prevention of cardiovascular disease.

Čia aprašytas patentuojamas išradimas pateikia būdą kaip užslopinti ir/arba sumažinti S. mutans ir S. sobrinus bakterinės plėvelės formavimąsi žmogaus kardiovaskuliniuose audiniuose ir kraujo terpėje, tame tarpe kraujo serume. Šis metodas remiasi priešprasminių oligonukleotidų (PO), selektyviai slopinančių S. mutans gftB ir gtfC bei S. sobrinus gtfl genų raišką, panaudojimu. Taip slopinant gliukoziltransferazių ir tolimesnėje pasėkoje gliukano sintezę. Gliukano sintezės inhibicija užkerta kelią bakterinės bioplėvelės susidarymui, kurie savo ruožtu sąlygoja aterosklerozės bei S. mutans ir S. sobrinus sukeltų kardiovaskulinių infekcijų, tokių kaip bakterinis endokarditas, profilaktiką bei prevenciją, taip pat aterosklerozinių plokštelių formavimosi slopinimą ir mažinimą.The patented invention described herein provides a method of inhibiting and / or reducing bacterial film formation in S. mutans and S. sobrinus in human cardiovascular tissues and blood media, including serum. This method relies on the use of antisense oligonucleotides (POs) that selectively inhibit the expression of gtB and gtfC and S. sobrinus gtfl genes of S. mutans. This inhibits the synthesis of glucosyltransferases and, consequently, glucan. Inhibition of glucan synthesis prevents bacterial biofilm formation, which in turn results in the prevention and prevention of atherosclerosis and cardiovascular infections caused by S. mutans and S. sobrinus, as well as inhibition and reduction of atherosclerotic plaque formation.

Be to, išradime pateikiamas PO ir bakterinių bioplėvėlių sintezės slopinimo būdas panaudojamas įvairių paviršių besiliečiančių su žmogaus krauju ir audiniais, pvz., vamzdelių, kateterių, dializės membranų, zondų, vožtuvų, protezų, implantų ir pan., apdorojimui, siekiant antibakterinio poveikio nukreipto į S. mutans ir S. sobrinus bakterijas, patekusias ant tokių paviršių. Paminėtina, kad bakterijos patekusios ant šių paviršių, pvz., kateterių, implantų ar protezų, sintezuojamų gliukanų pagalba tvirtai prilimpa ir suformuoja bakterines bioplėveles, kurios apriboja organizmo imuninės sistemos galimybes sunaikinti bakterijas. Bakterijų suformuotos bioplėvelės ant vamzdelių, kateterių, dializės membranų, zondų skatina aterosklerozės židinių formavimąsi kraujotakos sistemoje, tuo tarpu bakterinės bioplėvelės ant širdies vožtuvų arba kaulų ar sąnarių implantų sąlygoja uždegiminius procesus ir implantų atmetimą, taip sukeldamos ypatingai sudėtingas ir gyvybei pavojingas patologines būkles.In addition, the present invention provides a method of inhibiting the synthesis of PO and bacterial biofilms for treating various surfaces in contact with human blood and tissues, such as tubes, catheters, dialysis membranes, probes, valves, prostheses, implants, and the like. S. mutans and S. sobrinus bacteria on such surfaces. It should be noted that bacteria that adhere to these surfaces, such as catheters, implants or prostheses, are made by glucans synthesized and form bacterial biofilms, which limit the body's immune system's ability to destroy the bacteria. Bacterial biofilms on tubes, catheters, dialysis membranes, probes promote the formation of foci of atherosclerosis in the circulatory system, while bacterial biofilms on heart valves or bone or joint implants cause inflammatory processes and implant rejection, causing extremely complex and life-threatening conditions.

Apibendrinant išdėstytą, patentuojami PO ir būdas kompleksiškai sprendžia aterosklerozės, kardiovaskulinių ir susijusių infekcijų profilaktikos, prevencijos ir gydymo problemas.In summary, the patented PO and method address in a comprehensive way the prevention, prevention, and treatment of atherosclerosis, cardiovascular and related infections.

Išradimo esmėThe essence of the invention

Kaip aptarta aukščiau, yra aktualus poreikis spręsti aterosklerozės, kardiovaskulinių ir susijusių infekcijų profilaktikos, prevencijos ir gydymo problemas, kurias sukelia bakterijos patekusios į kraujotakos sistemą, į kardiovaskulinius audinius ir kitus objektus kurie kontaktuoja su krauju ir kardiovaskulinės sistemos audiniais. Šis išradimas apima medžiagas ir būdą, kurie sprendžia šias problemas, ypač bakterinių bioplėvelių ir bakterinių gliukanų sąlygojamą aterosklerozės vystymąsi bei kardiovaskulinės sistemos infekcijas.As discussed above, there is an urgent need to address the prevention, prevention, and treatment of atherosclerosis, cardiovascular and related infections caused by bacteria entering the circulatory system, cardiovascular tissues, and other objects that come into contact with blood and cardiovascular tissues. The present invention encompasses materials and methods that address these problems, in particular the development of atherosclerosis due to bacterial biofilms and bacterial glucans and infections of the cardiovascular system.

Pagrindinis patentuojamas išradimo objektas yra medžiaga - izoliuoti priešprasminiai oligonukleotidai (PO), atitinkantis šiuos požymius:The main subject-matter of the invention is the material - isolated antisense oligonucleotides (PO) - which have the following features:

a) PO sudaryti iš nukleotidų sekų pagal SEQ ID nr. 1,13,19;a) POs consisting of nucleotide sequences according to SEQ ID NO. 1,13.19;

b) PO sudaryti iš nukleotidų sekų, kurie yra SEQ ID nr. 1, 13, 19 fragmentai;b) the PO consists of the nucleotide sequences set forth in SEQ ID NO. Fragments of 1, 13, 19;

arbaor

c) PO, kurių nukleotidų sekos ne mažiau kaip 85% sutampa su sekomis nurodyta SEQ ID nr. 1, 13,19.c) POs having at least 85% nucleotide sequences corresponding to SEQ ID NO. 1, 13.19.

Taip pat išradimo objektas yra PO, kurių nukleotidų sekos skiriasi nuo SEQ ID nurodytos SEQ ID nr. 1, 13, 19, vienu, dviem, trim arba keturiais nukleotidais, tarp jų PO fragmentai, kurių nukleotidų sekos parinktos iš šių sekų grupės: SEQ ID nr. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24.The invention also relates to POs having nucleotide sequences different from SEQ ID NO. 1, 13, 19, one, two, three or four nucleotides, including PO fragments having nucleotide sequences selected from the group consisting of SEQ ID NO. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24.

PO, bet kuria iš aukščiau nurodytų formų, gali būti konjuguoti su peptidu palengvinančiu prasiskverbimą per bakterijos ląstelės sienelę.The PO, in any of the above forms, may be conjugated to a peptide to facilitate penetration through the bacterial cell wall.

Taip pat išradimo objektas yra PO, bet kuria iš aukščiau nurodytų formų, panaudojami aterosklerozinių plokštelių ir/ar židinių susiformavimo profilaktikai, prevencijai, slopinimui ir mažinimui žmogaus kardiovaskuliniuose audiniuose ir/ar kraujo terpėje, kurios komponentas yra kraujo serumas.The invention also relates to PO, in any of the above forms, for use in the prophylaxis, prevention, inhibition and reduction of the formation of atherosclerotic plaques and / or foci in human cardiovascular tissues and / or blood serum as a component.

Taip pat išradimo objektas yra biofarmacinė kompozicija, kurią sudaro PO, bet kuria iš aukščiau nurodytų formų, ir kitos dalys, skirta biofarmaciniam ir medicininiam panaudojimui.The invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts for biopharmaceutical and medical use.

Taip pat išradimo objektas yra biofarmacinė kompozicija, kurią sudaro PO, bet kuria iš aukščiau nurodytų formų, ir kitos dalys, tarp jų biofarmacijoje naudojami adjuvantai ir/ar nešėjai.The present invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other components including adjuvants and / or carriers used in biopharmaceuticals.

Taip pat išradimo objektas yra biofarmacinė kompozicija, kurią sudaro PO, bet kuria iš aukščiau nurodytų formų, ir kitos dalys, kurioje naudojamas nešėjas yra katijoninis polimeras.The present invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts wherein the carrier is a cationic polymer.

Taip pat išradimo objektas yra biofarmacinė kompozicija, kurią sudaro PO, bet kuria iš aukščiau nurodytų formų, ir kitos dalys, skirta aterosklerazės gydymui ar prevencijai.The invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts for the treatment or prevention of atherosclerosis.

Taip pat išradimo objektas yra biofarmacinė kompozicija, kurią sudaro PO, bet kuria iš aukščiau nurodytų formų, ir kitos dalys, skirta bakterinio endokardito gydymui ar prevencijai.The present invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts for the treatment or prevention of bacterial endocarditis.

Taip pat išradimo objektas yra biofarmacinė kompozicija, kurią sudaro PO, bet kuria iš aukščiau nurodytų formų, ir kitos dalys, skirta paviršių besiliečiančių su žmogaus krauju ir audiniais, pvz., vamzdelių, kateterių, dializės membranų, zondų, vožtuvų, protezų, implantų ir pan., apdorojimui, siekiant antibakterinio poveikio nukreipto į S. mutans ir S. sobrinus ant tokių paviršių.The present invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts for contacting surfaces with human blood and tissues such as tubing, catheters, dialysis membranes, probes, valves, prostheses, implants and the like. etc., for treatment with antibacterial activity against S. mutans and S. sobrinus on such surfaces.

Taip pat išradimo objektas yra biofarmacinė kompozicija, kurią sudaro PO, bet kuria iš aukščiau nurodytų formų, ir kitos dalys, skirta paviršių besiliečiančių su žmogaus krauju ir audiniais, pvz., vamzdelių, kateterių, dializės membranų, zondų, vožtuvų, protezų, implantų ir pan., apdorojimui, aterosklerozinių plokštelių ir/ar židinių susiformavimo profilaktikos, prevencijos, slopinimo ir mažinimo ant tokių paviršių.The present invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts for contacting surfaces with human blood and tissues such as tubing, catheters, dialysis membranes, probes, valves, prostheses, implants and the like. etc., for the treatment, prevention, prevention, suppression and reduction of the formation of atherosclerotic plaques and / or foci on such surfaces.

Taip pat išradimo objektas yra biofarmacinė kompozicija, kurią sudaro PO, bet kuria iš aukščiau nurodytų formų, ir kitos dalys, skirtas paviršių besiliečiančių su žmogaus krauju ir audiniais, pvz., vamzdelių, kateterių, dializės membranų, zondų, vožtuvų, protezų, implantų ir pan., apdorojimui, siekiant sumažinti bakterinių bioplėvelų atsiradimą ir augimą.The present invention also relates to a biopharmaceutical composition comprising a PO in any of the above forms and other parts for contacting surfaces with human blood and tissues such as tubing, catheters, dialysis membranes, probes, valves, prostheses, implants and the like. etc., to reduce the occurrence and growth of bacterial biofilms.

Galiausiai išradimas apima S. mutans ir S. sobrinus bakterijų kolonijų kontrolės būdą, kuris apima šių bakterijų gebėjimo sintetinti bioplėvelių karkasą sudarančių egzopolisacharidų slopinimą, panaudojant PO, specifiškai ir vienu metu slopinančio gtfB ir gtfC iRNR raišką S. mutans bakterijoje ir gtfl iRNR raišką S. sobrinus bakterijoje, administravimą, taip vienu metu slopinant šių bakterijų gebėjimą sintezuoti vandenyje netirpių gliukanų ir dalinai vandenyje tirpių gliukanų polimerus.Finally, the invention encompasses a method of controlling bacterial colonies in S. mutans and S. sobrinus, which comprises inhibiting the ability of these bacteria to synthesize exopolysaccharides forming biofilm backbone by using PO specifically and simultaneously inhibiting gtfB and gtfC iRNA expression in S. mutans and gtfl iRNA expression in S. administration of the bacterium, thereby inhibiting simultaneously the ability of these bacteria to synthesize polymers of water-insoluble glucans and partially water-soluble glucans.

Iliustracijų aprašymasDescription of illustrations

Fig. 1 rodo nukleotidų SEQ ID nr. 14 fragmentą:FIG. 1 shows nucleotide SEQ ID NO. Snippet 14:

5'UCUGUUAAGAUUAAGCAAUGGUCUGCCAAGUACUUUAAUGGGACAAAUAU5'UCUGUUAAGAUUAAGCAAUGGUCUGCCAAGUACUUUAAUGGGACAAAUAU

UUUAGGGCGCGGAGCAGGCUAUGUCUUAAAAGA-3', pateiktą originaliame Mfold programos formato rezultatuose, prognozuojančiuose S. mutans gtfB iRNR antrinės struktūros modelį su apibrėžta priešprasminio oligonukleotido prisijungimo sritimi. Kaip matoma šiame modelyje, apibrėžta sritis turi rutulinę kilpą, kuri yra sudaryta iš nesuporuotų nukleotidų (5'-UAAGCA-3'), lemiančių tai, kad pasirinkti PO gali būti stiprūs konkurentai beteroduplekso formavimesi. Simboliai „—UUUAGGGCGCGGAGCAGGCUAUGUCUUAAAAGA-3 'presented in the original results of the Mfold program format predicting a S. mutans gtfB iRNA secondary structure model with a defined antisense oligonucleotide binding region. As can be seen in this model, the defined region has a ball loop that is composed of unpaired nucleotides (5'-UAAGCA-3 '), which means that the selected POs may be strong competitors for beteroduplex formation. Symbols "-

----“ ir „\” reiškia sąryšį tarp atitinkamų nukleotidų ir jie yra panaudoti geresniam rutulinių ir smeigtukinių kilpų atvaizdavimui. Kaip parodyta Fig. 1, gtfB iRNR sritis prasideda nuo 3049 nt, o apibrėžta PO prisijungimo vieta prasideda nuo 3056 nt - tai yra taip pat kaip ir S. mutans gtfB gene (žr. 1 pavyzdį).---- "and" \ "represent the relationship between their respective nucleotides and are used to better represent ball and pin loops. As shown in Figs. 1, the gtfB iRNA region starts at 3049 nt and the defined PO binding site starts at 3056 nt - which is the same as the S. mutans gtfB gene (see Example 1).

Fig. 2 (fig. 2a, 2b ir 2c) rodo stikliuko su S. mutans kultūros bioplėvele optinį paviršiaus profilį po 24 vai. inkubacijos su skirtingais poveikiais Todd Hewitt buljone, turinčiame 1% sacharozės:FIG. 2 (Figures 2a, 2b and 2c) shows the optical surface profile of a slide with S. mutans culture biofilm after 24 h. incubations with different effects in Todd Hewitt broth containing 1% sucrose:

fig. 2a - bioplėvelės paviršiaus optinis profilis esant PO1 + TurboFect™ poveikiui;FIG. 2a is the optical profile of the biofilm surface under the influence of PO1 + TurboFect ™;

fig. 2b - bioplėvelės paviršiaus optinis profilis esant PO2 + TurboFect™ poveikiui;FIG. 2b - optical profile of the biofilm surface under the influence of PO2 + TurboFect ™;

fig. 2c - bioplėvelės paviršiaus optinis profilis esant PO3 + TurboFect™ poveikiui. Padidinimas *50. 1 lentelėje taip pat pateikti duomenys, susiję su Fig. 2FIG. 2c - Biofilm surface optical profile at PO3 + TurboFect ™ exposure. Magnification * 50. Table 1 also presents data related to Figs. 2

Fig. 3 rodo S. mutans kultūrų, augančių Todd Hewitt buljone be sacharozės (fig. 3a ) ir su 1% sacharozės (fig. 3b, 3c, 3d), optinius tankius 24 vai. poveikiuose su nukleazių neturinčiu vandeniu (fig. 3a, 3b, 3c), TurboFect™ reagentu (fig. 3a, 3b) arba abiejų kartu (fig. 3b, 3d), tik su PO (fig. 3c ) arba jų kombinacija su TurboFect™ (fig. 3d).FIG. Figure 3 shows the optical densities of S. mutans cultures grown in Todd Hewitt broth without sucrose (Fig. 3a) and with 1% sucrose (Fig. 3b, 3c, 3d) for 24 h. exposure to nuclease-free water (Fig. 3a, 3b, 3c), TurboFect ™ reagent (Fig. 3a, 3b), or both (Fig. 3b, 3d), PO alone (Fig. 3c) or a combination thereof with TurboFect ™ (fig. 3d).

Simboliai: ♦, terpė be bakterijų ir poveikių; , nepaveiktos bakterijos; ▲, nukleazių neturintis vanduo; O, TurboFect™; ·, nukleazių neturintis vanduo + TurboFect™; O, PO1 arba PO1 + TurboFect™; χ, PO2 arba PO2 + TurboFect™; *, PO3 arba PO3 + TurboFect™.Symbols: ♦ Bacteria-free medium; , unaffected bacteria; ▲, nuclease-free water; O, TurboFect ™; ·, Nuclease-free water + TurboFect ™; O, PO1 or PO1 + TurboFect ™; χ, PO2 or PO2 + TurboFect ™; *, PO3 or PO3 + TurboFect ™.

Fig. 4 rodo Gramo būdu dažytų S. mutans bakterijų morfologiją po 24 vai.FIG. Figure 4 shows the morphology of Gram stained S. mutans bacteria after 24 h.

inkubacijos Todd Hewitt buljone esant skirtingiems poveikiams: fig. 4a - bakterijos, augančios terpėje be sacharozės; fig. 4b - bakterijos, augančios terpėje su 1% sacharozė;incubations in Todd Hewitt broth at different effects: FIG. 4a - bacteria growing in sucrose-free medium; FIG. 4b - bacteria growing in medium containing 1% sucrose;

fig. 4c - bakterijos esant PO1 + TurboFect™ poveikiui Todd Hevvitt buljone suFIG. 4c - Bacteria at PO1 + TurboFect ™ effect in Todd Hevvitt broth with

1% sacharozė;1% sucrose;

fig. 4d - bakterijos esant PO2 + TurboFect™ poveikiui Todd Hevvitt buljone suFIG. 4d - Bacteria at PO2 + TurboFect ™ effect in Todd Hevvitt broth with

1% sacharozė;1% sucrose;

fig. 4e - bakterijos esant PO3 + TurboFect™ poveikiui Todd Hevvitt buljone suFIG. 4e - Bacteria at PO3 + TurboFect ™ effect in Todd Hevvitt broth with

1% sacharozė. Padidinimas *100 (imersinė sistema).1% sucrose. Magnification * 100 (immersion system).

Fig. 5 rodo S. mutans kultūrų, augančių Todd Hevvitt buljone be sacharozės, optinius tankius 24 vai. poveikiuose su nukleazių neturinčiu vandeniu (fig. 5a, 5b), TurboFect™ reagentu (fig. 5a) arba abiejų kartu (fig. 5a, 5c), tik su PO (fig. 5b) arba jų kombinacija su TurboFect™ (fig. 5c).FIG. Figure 5 shows the optical densities of S. mutans cultures grown in Todd Hevvitt broth without sucrose for 24 h. in action with nuclease-free water (Fig. 5a, 5b), TurboFect ™ reagent (Fig. 5a), or both together (Fig. 5a, 5c), PO alone (Fig. 5b) or a combination thereof with TurboFect ™ (Fig. 5c) ).

Simboliai: ♦, terpė be bakterijų ir poveikių; , nepaveiktos bakterijos; ▲, nukleazių neturintis vanduo; O, TurboFect™; ·, nukleazių neturintis vanduo + TurboFect™; O, PO1 arba PO1 + TurboFect™; x, PO2 arba PO2 + TurboFect™; *, PO3 arba PO3 + TurboFect™.Symbols: ♦ Bacteria-free medium; , unaffected bacteria; ▲, nuclease-free water; O, TurboFect ™; ·, Nuclease-free water + TurboFect ™; O, PO1 or PO1 + TurboFect ™; x, PO2 or PO2 + TurboFect ™; *, PO3 or PO3 + TurboFect ™.

Fig. 6 rodo gliukoziltransferazės genų daugybinę sekų palyginamąją atranką tarp įvairių Streptococcus rūšių ir padermių atliktą panaudojant MAFFT programos internetinj serverį, esantį Max Planck Institute for Development Biology. Konservatyvi tikslinė sritis (sudaryta iš 26 nukleotidų: 5'-GTTAAGATTAAGCAATGGTCTGCCAA-3', turinti SEQ ID nr. 16) yra apibrėžta dideliame stačiakampyje, o nesutapimai yra apibrėžti mažuose stačiakampiuose. Paveiksle nurodytos Streptococcus rūšys ir padermės yra šios:FIG. Figure 6 shows multiple sequence comparisons of glucosyltransferase genes between different Streptococcus species and strains using MAFFT web server at Max Planck Institute for Developmental Biology. The conservative target region (consisting of 26 nucleotides: 5'-GTTAAGATTAAGCAATGGTCTGCCAA-3 'having SEQ ID NO: 16) is defined in a large rectangle and mismatches are defined in small rectangles. The species and strains of Streptococcus shown in the figure are as follows:

ENA|AAN58705|AAN5870_0/1-4431 - Streptococcus mutans UA159 gliukoziltransferazė-l;ENA | AAN58705 | AAN5870_0 / 1-4431 - Streptococcus mutans UA159 glucosyltransferase-1;

ENA|AAN58706|AAN5870_1/1-4368 - Streptococcus mutans UA159 gliukoziltransferazė-SI;ENA | AAN58706 | AAN5870_1 / 1-4368 - Streptococcus mutans UA159 Glucosyltransferase-SI;

ENA|D88654|D88654.1_2/1-5684 - Streptococcus mutans gliukoziltransferazės-l genas, pilna koduojanti seka, klonas:PYT216;ENA | D88654 | D88654.1_2 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PYT216;

ENA|D88660|D88660.1_3/1-5684 - Streptococcus mutans gliukoziltransferazės-l genas, pilna koduojanti seka, klonas: PYT223;ENA | D88660 | D88660.1_3 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PYT223;

ENA|D89977|D89977.1_4/1-5684 - Streptococcus mutans gliukoziltransferazės-l genas, pilna koduojanti seka, klonas:PTH1;ENA | D89977 | D89977.1_4 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PTH1;

ENA|D88657|D88657.1_5/1-5686 - Streptococcus mutans gliukoziltransferazės-l genas, pilna koduojanti seka, klonas: PYT239;ENA | D88657 | D88657.1_5 / 1-5686 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PYT239;

ENA|M17361|M17361.1_6/1-10029 - Streptococcus mutans gliukoziltransferazių (gtfB ir gtfC) genai, pilnos koduojančios sekos;ENA | M17361 | M17361.1_6 / 1-10029 - Streptococcus mutans glucosyltransferase (gtfB and gtfC) genes, complete coding sequences;

ENA|D88651|D88651.1_7/1-5684 - Streptococcus mutans gliukoziltransferazės-l genas, pilna koduojanti seka, klonas:PSK6;ENA | D88651 | D88651.1_7 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PSK6;

ENA|AB299801 |AB29980_8/1 -4410 - Streptococcus criceti gtfl gliukoziltransferazėsI genas, pilna koduojanti seka;ENA | AB299801 | AB29980_8 / 1 -4410 - Streptococcus criceti gtfl glucosyltransferase I gene, full coding sequence;

ENA|AB273728|AB27372_9/1-4930 - Streptococcus criceti gtfl gliukoziltransferazėsI genas, pilna koduojanti seka, padermė: GTC242;ENA | AB273728 | AB27372_9 / 1-4930 - Streptococcus criceti gtfl glucosyltransferase I gene, full coding sequence, strain: GTC242;

ENA|AB355819|AB35581_10/1-4602 gliukoziltransferazės-l genas, pilna koduojanti seka;ENA | AB355819 | AB35581_10 / 1-4602 Glucosyltransferase-l gene, full coding sequence;

ENA|AB275384|AB27538_11/1-5423 gliukoziltransferazės-l genas, pilna koduojanti seka;ENA | AB275384 | AB27538_11 / 1-5423 Glucosyltransferase-l gene, full coding sequence;

Streptococcus dentirousetti gtfl gtflStreptococcus dentirousetti gtfl gtfl

Streptococcus dentisuisStreptococcus dentisuis

Streptococcus orisuis gtfStreptococcus orisuis gtf

ENA|AB272987|AB27298_12/1-4984 gliukoziltransferazės genas, pilna koduojanti seka;ENA | AB272987 | AB27298_12 / 1-4984 glucosyltransferase gene, full coding sequence;

ENA|D63570|D63570.1_13/1-6838 - Streptococcus sodrinus gliukoziltransferazės-l genas, pilna koduojanti seka;ENA | D63570 | D63570.1_13 / 1-6838 - Streptococcus sodrinus glucosyltransferase-1 gene, full coding sequence;

ENA|M17391|M17391.1_14/1-4995 - Streptococcus downei gliukoziltransferazės geno pirmtakas, pilna koduojanti seka.ENA | M17391 | M17391.1_14 / 1-4995 - Streptococcus downei glucosyltransferase gene precursor, full coding sequence.

Fig. 7 rodo gliukoziltransferazės genų daugybinę sekų palyginamąją atranką tarp įvairių Streptococcus rūšių ir padermių, aptinkamų žmogaus organizme, atliktą panaudojant MAFFT programos internetinj serverį, esantį Max Planck Institute for Development Biology. Konservatyvi tikslinė sritis (sudaryta iš 26 nukleotidų: 5'9FIG. 7 shows multiple sequence comparisons of glucosyltransferase genes between various species of Streptococcus and strains found in the human body using the MAFFT web server at the Max Planck Institute for Developmental Biology. Conservative target region (consisting of 26 nucleotides: 5'9

CGCGTCATGTTTGAAGGTTTCTCTAA-3', turinti SEQ ID nr. 18) yra apibrėžta stačiakampyje. Fig. 7 nurodytos Streptococcus rūšys ir padermės yra šios:CGCGTCATGTTTGAAGGTTTCTCTAA-3 'having SEQ ID NO. 18) is defined by a rectangle. FIG. The 7 species and strains of Streptococcus listed are:

ENA|AAN58705|AAN5870_0/1-4431 - Streptococcus mutans UA159 gliukoziltransferazė-l;ENA | AAN58705 | AAN5870_0 / 1-4431 - Streptococcus mutans UA159 glucosyltransferase-1;

ENA|AAN58706|AAN5870_1 /1-4368 - Streptococcus mutans UA159 gliukoziltransferazė-SI;ENA | AAN58706 | AAN5870_1 / 1-4368 - Streptococcus mutans UA159 Glucosyltransferase-SI;

ENA|D88654|D88654.1_2/1-5684 - Streptococcus mutans gliukoziltransferazės-l genas, pilna koduojanti seka,klonas:PYT216;ENA | D88654 | D88654.1_2 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PYT216;

ENA|D88660|D88660.1_3/1-5684 - Streptococcus mutans gliukoziltransferazės-l genas, pilna koduojanti seka, klonas:PYT223;ENA | D88660 | D88660.1_3 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PYT223;

ENA|D89977|D89977.1_4/1-5684 - Streptococcus mutans gliukoziltransferazės-l genas, pilna koduojanti seka, klonas:PTH1;ENA | D89977 | D89977.1_4 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PTH1;

ENA|D88657|D88657.1_5/1-5686 - Streptococcus mutans gliukoziltransferazės-l genas, pilna koduojanti seka, klonas:PYT239;ENA | D88657 | D88657.1_5 / 1-5686 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PYT239;

ENA|M17361|M17361.1_6/1-10029 - Streptococcus mutans gliukoziltransferazių (gtfB ir gtfC) genai, pilnos koduojančios sekos;ENA | M17361 | M17361.1_6 / 1-10029 - Streptococcus mutans glucosyltransferase (gtfB and gtfC) genes, complete coding sequences;

ENA|D88651|D88651.1_7/1-5684 - Streptococcus mutans gliukoziltransferazės-l genas, pilna koduojanti seka, klonas:PSK6;ENA | D88651 | D88651.1_7 / 1-5684 - Streptococcus mutans glucosyltransferase-1 gene, full coding sequence, clone: PSK6;

ENA|D63570|D63570.1_13/1-6838 - Streptococcus sobrinus gliukoziltransferazės-l genas, pilna koduojanti seka.ENA | D63570 | D63570.1_13 / 1-6838 - Streptococcus sobrinus glucosyltransferase-1 gene, full coding sequence.

Fig. 8 rodo stikliuko su maišytos S. mutans ir S. sobrinus kultūros bioplėvelės optinį paviršiaus profilį po 24 vai. inkubacijos su skirtingais poveikiais Todd Hewitt buljone, turinčiame 10% kraujo serumo ir 1% sacharozės:FIG. Fig. 8 shows the optical surface profile of a slide with mixed S. mutans and S. sobrinus culture biofilm after 24 h. incubations with different effects in Todd Hewitt's broth containing 10% serum and 1% sucrose:

fig. 8a - bioplėvelės paviršiaus optinis profilis nesant poveikiams;FIG. 8a - optical profile of the biofilm surface in the absence of effects;

fig. 8b - bioplėvelės paviršiaus optinis profilis esant PO1 + TF (TurboFect™) poveikiui;FIG. 8b is the optical profile of the biofilm surface under the influence of PO1 + TF (TurboFect ™);

fig.8c - bioplėvelės paviršiaus optinis profilis esant PO3 + TF (TurboFect™) poveikiui. Padidinimas χ50.Fig.8c - Optical profile of biofilm surface under the influence of PO3 + TF (TurboFect ™). Magnification χ50.

Fig. 9 rodo maišytos S. mutans ir S. sobrinus kultūros bioplėvelės kiekius susidariusios ant stikliuko paviršiaus, po 24 vai. inkubacijos su skirtingais poveikiaisFIG. 9 shows the amount of mixed biofilm of S. mutans and S. sobrinus cultures formed on the glass surface after 24 h. incubations with different effects

Todd Hewitt buljone, turinčiame 10% serumo ir 1% sacharozės:Todd Hewitt Broth with 10% Serum and 1% Sucrose:

fig. 9a - bioplėvelės paviršiaus šiurkštumo parametras Rq; fig. 9b - bioplėvelės storis.FIG. 9a - surface roughness parameter of biofilm Rq; FIG. 9b is the thickness of the biofilm.

Kontrolė - stikliuko paviršius po 24 vai. inkubacijos Todd Hewitt buljone, turinčiame 10% kraujo serumo ir 1% sacharozės, tačiau be bakterijų; nepaveiktos bakterijos (fig. 9a, 9b juodas stulpelis) - tai yra bakterijos, inkubuotos 24 vai. Todd Hewitt buljone su 10% serumo, tačiau be sacharozės ir poveikių; nepaveiktos bakterijos (fig. 9a, 9b baltas stulpelis) - tai yra bakterijos, inkubuotos 24 vai. Todd Hewitt buljone su 10% serumo ir 1% sacharozės, tačiau be poveikių; PO + TF - tai yra priešprasminis oligonukleotidas + TurboFect™ reagentas. Reikšmės (n = 6 [šiurkštumas Rqj; n = 5 [storis]) yra nurodytos kaip vidurkiai ± standartinė vidurkio paklaida. *p < 0,05 palyginus su nepaveiktomis bakterijomis (baltas stulpelis), **p < 0,05 palyginus su PO3 + TF.Control - glass surface after 24 hours. incubation in Todd Hewitt broth containing 10% blood serum and 1% sucrose but without bacteria; unaffected bacteria (Fig. 9a, 9b black column) - these are bacteria incubated for 24 hours. Todd Hewitt in broth with 10% serum but no sucrose and effects; unaffected bacteria (Fig. 9a, 9b white column) - these are bacteria incubated for 24 hours. Todd Hewitt in broth with 10% serum and 1% sucrose but no effects; PO + TF - This is the antisense oligonucleotide + TurboFect ™ reagent. Values (n = 6 [roughness Rqj; n = 5 [thickness]) are reported as means ± standard error of the mean. * p <0.05 versus unaffected bacteria (white column), ** p <0.05 versus PO3 + TF.

Sąvokų apibrėžimaiDefinitions

Šiame dokumente naudojama sąvoka “priešprasminis poveikis” reiškia oligonukleotido poveikį, kuris susidaro po to kai sudaromas junginys su papildoma seka, esančia iRNR, lemiantis specifinį geno raiškos ir baltymo transliacijos slopinimą.As used herein, the term "antisense effect" refers to the effect of an oligonucleotide that results from the formation of a compound with an additional sequence contained in an iRNA that results in specific inhibition of gene expression and protein translation.

Šiame dokumente naudojama sąvoka priešprasminiai oligonukleotidai (PO) apibūdina preparatus, kurie yra chemiškai modifikuotos arba nemodifikuotos viengubos nukleorūgšties molekulės (paprastai 15-30 nt ilgio), galinčios selektyviai jungtis su savo taikiniu iRNR sekoje pagal VVatson-Crick susiporavimo principą. POiRNR heterodupleksų formavimasis sąlygoja šiuos efektus:The term antisense oligonucleotides (PO), as used herein, refers to preparations that are chemically modified or unmodified single nucleic acid molecules (typically 15-30 nt in length) that can selectively bind to their target in the iRNA sequence according to the Watson-Crick mating principle. The formation of POiRNA heteroduplexes results in the following effects:

1) aktyvuojama RNazė H endonukleazė arba bakterijų endoribonukleazės RNazė III ir RNazė E - lemiančios iRNR degradaciją, tačiau paliekant PO nepažeistą;1) activation of RNase H endonuclease or bacterial endoribonuclease RNase III and RNase E - leading to degradation of the iRNA but leaving the PO intact;

2) sąlygojama transliacijos inhibiciją per ribosomų veiklos sferinį blokavimą;2) caused by translational inhibition through spherical blocking of ribosome activity;

3) slopinamas iRNR susijungimas;3) inhibiting iRNA binding;

4) destabilizuojamas iRNR pirmtakas.4) destabilizing the iRNA precursor.

Kuris efektas pasireikš, priklauso nuo PO cheminės struktūros ir hibridizacijos vietos, tačiau vėlesni rezultatai yra konkretaus geno-taikinio raiškos ir baltymų transliacijos derereguliacija.Which effect will occur depends on the chemical structure of the PO and the site of hybridization, but subsequent results are deregulation of specific gene-target expression and protein translation.

“Nukleotidų seka”, “nukleorūgštis“, „nukleorūgšties grandinė“ ir „nukleorūgšties seka“ reiškia, kad bet kas, kas jungiasi arba hibridizuojasi per bazių susijungimą įskaitant oligomerus arba polimerus, turinčius pagrindą, suformuotą iš natūraliai atsirandančių nukleotidų, tokių kaip DNR (dezoksiribonukleino rūgštis) arba RNR (ribonukleorūgštis) ir/arba nukleorūgšties analogai, susidedantys iš nestandartinių nukleobazių ir/arba nestandartinių karkasų, pavyzdžiui, peptidinė nukleorūgštis (PNR) arba užrakinta nukleorūgštis (UNR), arba be kokia išvestinė arba modifikuota nukleorūgšties forma, tame tarpe ir pakeitimai siekiant padidinti stabilumą ir atsparumą nukleazėms."Nucleotide sequence", "nucleic acid", "nucleic acid chain", and "nucleic acid sequence" means any one which binds or hybridizes through base fusion including oligomers or polymers based on naturally occurring nucleotides, such as DNA (deoxyribonucleotides). acid) or RNA (ribonucleic acid) and / or nucleic acid analogues consisting of non-standard nucleobases and / or non-standard backbones, such as peptide nucleic acid (PNR) or locked nucleic acid (UNR), or any derivative or modified nucleic acid, to increase the stability and resistance to nucleases.

Šiame dokumente naudojama sąvoka “peptidinė nukleorūgštis“ arba „PNR“ reiškia sintetinį oligomerą arba polimerą, turintį poliamido pagrindą su prisijungusiomis nukleobazėmis (atsirandančiomis natūraliai arba modifikuojamomis), įskaitant, bet neapsiribojant, bet kokie oligomerų ar polimerų segmentai nurodyti ar įvardinti kaip peptidinės nukleorūgštys JAV Pat. Nr. 5539082, 5527675, 5623049, 5714331, 5718262, 5736336, 5773571, 5766855, 5786461, 5837459, 5891625, 5972610, 5986053, 6107470 6201103, 6228982 ir 6357163, VV096/04000, kurie visi yra įtraukti kaip nuorodos arba yra naudojami kaip nuorodos kituose cituotuose dokumentuose. Prisijungusi nukleobazė, pavyzdžiui, purino ar pirimidino bazė PNR gali būti prijungta prie karkaso naudojantis viena iš jungčių apibūdintų PCT/US02/30573 ar bet kurioje kitoje nuorodoje, esančioje šiame dokumente. Jame PNR turi N-(2-aminoetilo)-glicino) pagrindą. PNR gali būti susintetinta (ir vizualiai paženklinta) kaip minima PCT/US02/30573 arba jame cituotose nuorodose. PNR stipriai jungiasi ir tai atlieka specifinio eiliškumo tvarka, su DNR ir RNR, nes PNR karkasas neturi krūvio. Taigi, trumpi PNR zondai gali demonstruoti panašią specifiką su ilgesniais DNR ir RNR zondais. PNR zondai taip pat gali rodyti didesnį detalumą prisijungiant prie papildomos DNR ar RNR.As used herein, the term "peptide nucleic acid" or "PNR" means a synthetic oligomer or polymer based on a polyamide with attached nucleobases (whether naturally occurring or modified), including, but not limited to, any segments of oligomers or polymers designated or designated as U.S. Patient Nucleic Acids . No. 5539082, 5527675, 5623049, 5714331, 5718262, 5736336, 5773571, 5766855, 5786461, 5837459, 5891625, 5972610, 5986053, 6107470, 6201103, 6228982 and 6357163, all of which are incorporated by reference or incorporated by reference in WO096 / 04000 in the documents. A bound nucleobase, such as a PNR base of purine or pyrimidine, can be linked to the backbone by using one of the linkages described in PCT / US02 / 30573 or any other reference herein. It contains an N- (2-aminoethyl) -glycine) backbone. The PNR can be synthesized (and visually labeled) as mentioned in PCT / US02 / 30573 or references cited therein. PNR binds strongly and does so in a specific order, with DNA and RNA, since the PNA backbone is not charged. Thus, short PNR probes may exhibit similar specificities with longer DNA and RNA probes. PNR probes can also show greater detail in binding to additional DNA or RNA.

Šiame dokumente naudojama sąvoka „užrakinta nukleorūgštis“ arba „UNR“ reiškia oligomerą arba polimerą, sudarytą bent iš vieno ar kelių UNR subvienetų.As used herein, the term "locked nucleic acid" or "UNR" refers to an oligomer or polymer composed of at least one or more UNR subunits.

Šiame dokumente naudojama sąvoka „UNR subvienetas“ reiškia ribonukleotidą, kuriame yra metileno tiltas, jungiantis 2’-deguonies ribozę su 4’-anglimi (žr. Kurreck Antisense technologies. Improvement through novel Chemical modifications. (Eur J Biochem 270 (2003). 1628-1644 p.)).As used herein, the term "UNR subunit" refers to a ribonucleotide containing a methylene bridge linking a 2'-oxygen ribose to a 4'-carbon (see Kurreck Antisense Technologies. Improvement through Novel Chemical Modifications. Eur J Biochem 270 (2003) 1628 Pp. -1644)).

Nukleino rūgščių ir nukleino rūgščių analogų pavyzdžiai, naudojam kaip izoliuotas PO, taip pat apima oligomerų ir nukleotidų monomerų polimerus, tarp jų dvigubi ir viengubi deoksiribonukleotidai (DNR), ribonukleotidai (RNR) tarp jų natūraliai susiformuojančios priešprasminės RNR molekulės, tokios kaip mikroRNR (miRNR) ir mažos trukdančios (interferuojančios) RNR (siRNR), randamos eukariotinėse ląstelėse, taip pat mažos priešprasminės RNR, randamos prokariotinėse ląstelėse (bakterijose), anomerinės jų formos, natūralūs ir sintetiniai analogai ir kita. Nukleorūgšties grandinė gali būti sudaryta vien tik iš deoksiribonukleotidų, ribonukleotidų, peptidinių nukleorūgščių (PNR), užrakintų nukleorūgščių (UNR), natūralių ar sintetinių analogų, tokių kaip fosforodiamidato morfolino ir tiofosforoamidato oligonukleotidai, ar jų mišiniai. DNR, RNR ir kitos natūralios ar šiame dokumente apibūdintos sintetinės nukleo rūgštys gali būti naudojamos metoduose ir išradimo kompozicijose.Examples of nucleic acids and nucleic acid analogues used as isolated PO also include oligomeric and nucleotide monomer polymers, including double and single deoxyribonucleotides (DNA), ribonucleotides (RNA) between naturally occurring antisense RNA molecules (such as microRNAs). and small interfering RNAs (siRNAs) found in eukaryotic cells, as well as small antisense RNAs found in prokaryotic cells (bacteria), anomeric forms thereof, natural and synthetic analogs, and others. The nucleic acid chain may consist solely of, or mixed with, deoxyribonucleotides, ribonucleotides, peptide nucleic acids (PNRs), locked nucleic acids (UNRs), natural or synthetic analogs such as phosphorodiamidate morpholine and thiophosphoroamidate oligonucleotides. DNA, RNA and other natural or synthetic nucleic acids described herein may be used in the methods and compositions of the invention.

Naudojant terminą „farmaciškai tinkamas“, pavyzdžiui, percituojant „farmaciškai tinkamas nešėjas“ arba „farmaciškai tinkamas priedas“ šiame dokumente norima pasakyti, kad medžiaga, kuri nėra biologiškai ar kaip nors kitaip nepageidaujama, t.y. medžiaga gali būti inkorporuota į farmacines kompozicijas, skiriamas pacientui, nesukeliant nepageidaujamų biologinių poveikių ar reaguojant į kitus komponentus, esančius kartu sudėtyje nesielgia žalingai. Be to, priedai ir nešėjai, esantys minimose sudėtyse, yra tinkami taikyti kardiovaskulinių audinių aplinkoje ir/ar kraujo terpėje nesukeliant jokio nepageidaujamo biologinio poveikio bei niekaip žalingai nereaguojant. Šiame dokumente yra pateikti tinkamų nešėjų ir priedų pavyzdžiai, kurių tarpe yra vanduo be nukleazių ar bet koks kitas reagentas, kurio pagalba yra suformuojamas kompaktiškas, stabilus, teigiamai įkrautas kompleksas su oligonukleotidu, skirtas saugoti nuo degradacijos ir padėti oligonukleotidui lengviau isiskverbti į bakterijų ląsteles, pavyzdžiui, komerciškai prieinamas TurboFect™ transfekcijos reagentas ir katijoninis polimeras (Thermo Fisher Scientific, Fermentas).As used herein, the term "pharmaceutically acceptable", for example, "pharmaceutically acceptable carrier" or "pharmaceutically acceptable additive" is intended to mean that a substance that is not biologically or otherwise undesirable, e.g. the substance may be incorporated into pharmaceutical compositions for administration to the patient without causing adverse biological effects or in response to other components present in the composition without deleterious effects. In addition, the additives and carriers contained in said compositions are suitable for application in the cardiovascular tissue environment and / or blood medium without causing any undesirable biological effects and without causing any adverse reaction. This document provides examples of suitable carriers and additives, including nuclease-free water or any other reagent that forms a compact, stable, positively charged oligonucleotide complex to prevent degradation and facilitate the penetration of the oligonucleotide into bacterial cells, e.g. , a commercially available TurboFect ™ transfection reagent and a cationic polymer (Thermo Fisher Scientific, Enzyme).

Šiame dokumente vartojama sąvoka „nukleazių neturintis vanduo“ reiškia sterilų dejonizuotą vandenį, kuriame nėra jokio tipo nukleazių, galinčių skaidyti oligonukleotidus.As used herein, the term "nuclease-free water" refers to sterile deionized water that does not contain any type of nuclease capable of cleaving oligonucleotides.

Šiame dokumente vartojamas terminas „bioplėvelė“ reiškia bioplėvelę, sudarytą iš polisacharidų matricos, kurią sudaro daugiausia vandenyje netirpūs ir dalinai tirpūs gliukanai ir bakterijos, galinčios iš gliukozės monomerų sintezuoti polisacharidinius polimerus, sudarančius egzopolisacharidinę matricą.As used herein, the term "biofilm" refers to a biofilm consisting of a polysaccharide matrix composed primarily of water-insoluble and partially soluble glucans and bacteria capable of synthesizing polysaccharide polymers forming an exopolysaccharide matrix from glucose monomers.

Išsamus išradimo aprašymasDetailed Description of the Invention

Kaip minima šiame dokumente, bakterijų kultūros gali būti tiek in vivo, tiek in vitro kultūros, jei nėra atskirai nurodoma, kokia būtent kultūra turima omeny. Minėtos kultūros gali būti suspenduotos ant kietų paviršių, tokių kaip stiklas (in vitro pavyzdys kietoje būsenoje) arba kraujagyslės sienelės audiniai (in vivo pavyzdys kietoje būsenoje) ar bet koks kitas kietas paviršius kardiovaskulinėje sistemoje, arba implantas ar kitoks paviršius kontaktuojantis su žmogaus audiniais ir krauju.As mentioned in this document, bacterial cultures can be either in vivo or in vitro cultures unless specific culture is specified. Said cultures may be suspended on solid surfaces such as glass (in vitro sample in solid state) or vascular wall tissue (in vivo sample in solid state) or any other solid surface in the cardiovascular system, or implant or other surface in contact with human tissues and blood. .

Kaip minėta anksčiau, išradimas parodo naują būdą, skirtą bioplėvelių, tokių kaip bioplėvelė, besiformuojanti iš burnos streptokokų, ypač S. mutans ir S. sobrinus, ir bioplėvelių junginių ant kietų paviršių, pavyzdžiui, stiklo ir kraujagyslių sienelių paviršių, formavimosi mažinimui, slopinimui ar kelio tam užkirtimui.As mentioned above, the present invention provides a novel method for reducing, inhibiting or inhibiting the formation of biofilms, such as biofilms formed from oral streptococci, especially S. mutans and S. sobrinus, and biofilm compounds on hard surfaces such as glass and vascular wall surfaces. way to prevent it.

Šiam naujam būdui taikomas efektyvus priešprasminių oligonukleotidų (PO) poveikis, siekiant vienu metu nusitaikyti ir slopinti gliukozilransferazės iRNR išraišką kelių rūšių streptokokuose, ypač S. mutans ir S. sobrinus, tokių kaip gtfB ir gtfC glukoziltransferazės iRNR, esančias S. mutans ir gtfl iRNR S. sobrinus, lemiančių vandenyje netirpių ir iš dalies vandenyje tirpių gliukano polimerų gamybos ir bakterijų ląstelių sukibimo slopinimą S. mutans ir S. sobrinus kultūrose taip lemiant bioplėvelių mažinimą, slopinimą arba kelio užkirtimą jų formavimuisi. Minėtos kultūros gali būti in vitro kultūros arba in vivo kultūros, pvz., kardiovaskulinėje sistemoje arba ant kitų kietų paviršių kontaktuojančių su žmogaus audiniais ir krauju.This novel method exerts an effective effect of antisense oligonucleotides (POs) to simultaneously target and inhibit the expression of glucosyl transferase iRNA in several species of streptococci, particularly S. mutans and S. sobrinus, such as gtfB and gtfC glucosyltransferase iRNAs in S. mutans and gtfl. sobrinus, leading to the production of water insoluble and partially water soluble glucan polymers and inhibition of bacterial cell adhesion in S. mutans and S. sobrinus cultures, thereby leading to reduction, inhibition or inhibition of biofilm formation. Said cultures may be in vitro cultures or in vivo cultures, e.g., in the cardiovascular system or on other solid surfaces in contact with human tissues and blood.

Išradime patentuojamų naujų PO sekų sąrašas ir aprašymas pateiktas 1 priede.A list and description of the novel PO sequences patented by the invention is provided in Annex 1.

Minėti PO gali būti chemiškai sintetinami fosforotioatų formos oligodeoksiribonukleotidai, savo sekomis atitinkantys nukleotidų SEQ ID nr. 1, 13, 19 sekas, priešprasminio efekto eksponavimui, kaip parodyta pavyzdyje, arba bet kurios kitos PO formos, apibūdintos šiame dokumente, t.y., SEQ ID nr. 4, 5, 6, 7, 8, 9,10,11, 12, 20, 21,22, 23, 24, arba išradimo specifikacijoje nurodytas sąlygas atitinkantys PO fragmentai ar modifikacijos.Said POs may be chemically synthesized oligodeoxyribonucleotides in the form of phosphorothioates corresponding to nucleotides SEQ ID NO. 1, 13, 19, for displaying the antisense effect as exemplified, or any other form of PO described in this document, i.e., SEQ ID NO. 4, 5, 6, 7, 8, 9,10,11, 12, 20, 21,22, 23, 24, or PO fragments or modifications according to the conditions of the specification.

Gliukanų, sudarančių bioplėvelės egzopolisacharidinę matricą, matavimas gali būti atliktas kaip aprašyta antrame ir penktame pavyzdžiuose, kur profilometrijos rezultatai aiškiai parodo, kad bakterijų adhezija prie stiklo paviršiaus yra stipriai sumažinama su PO molekulėmis, kurių nukleotidų seka atitinka SEQ ID nr. 1,13 arbaThe measurement of glucans constituting the biopolymer exopolysaccharide matrix can be carried out as described in the second and fifth examples, where profilometric results clearly show that bacterial adhesion to the glass surface is strongly reduced with PO molecules having the nucleotide sequence of SEQ ID NO. 1.13 or

19.19th

Bioplėvelės formavimosi mažėjimas rodo gliukano polimerų sintezės mažėjimą nes gliukanai yra būtini bioplėvelių formavimuisi, o gliukanų nebuvimas lemia bioplėvelės nesiformavimą.Decrease in biofilm formation indicates a decrease in glucan polymer synthesis because glucans are essential for biofilm formation and the absence of glucans leads to biofilm formation.

Gliukanų koncentraciją bakterinių ląstelių kultūrose taip pat galima išmatuoti naudojant kitus metodus, apibūdintus Guo ir kt. „Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibits GtfB expression and function“ (FEMS Microbial Lett 264 (2006), 8-14 p.) ir Masuko ir kt. „Carbohydrate analysis by a phenol-sulfuric acid method in microplate format“ (Anai Biochem 339 (2005) 69-72 p.).Glucan concentration in bacterial cell cultures can also be measured using other methods described by Guo et al. Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibition of GtfB expression and function (FEMS Microbial Lett 264 (2006), pp. 8-14) and Masuko et al. Carbohydrate analysis by a phenol-sulfuric acid method in a microplate format (Anai Biochem 339 (2005) pp. 69-72).

Kitas šio išradimo naujumo ir išradimo lygio aspektas suteikia priemones naudoti tik vieno tipo (vienos nukleotidų sekos) PO, kurie efektyviai slopina tiek vandenyje tirpius, tiek iš dalies vandenyje tirpius gliukanus S. mutans užkoduotus gtfB ir gtfC genais ir taip pat S. sobrinus gtfl.Another aspect of the present invention and the present invention provides means for using only one type (single nucleotide sequence) of POs that effectively inhibit both water-soluble and partially water-soluble glucans in S. mutans encoded by gtfB and gtfC genes and also S. sobrinus gtfl.

Šis naujas būdas leidžia naudoti vienus PO bakterinėse kultūrose tam, kad paveikti du taikinius - gtfB ir gtfC iRNR S. mutans ir tuo pačiu metu gliukoziltransferazės-l iRNR S. sobrinus.This new technique allows the use of single POs in bacterial cultures to target two targets, gtfB and gtfC, iRNA in S. mutans and simultaneous glucosyltransferase-l iRNA in S. sobrinus.

Taikiniai minėtuose S. mutans ir S. sobrinus genuose bei atitinkamai iRNR yra konservatyvūs - koduojančios nukleotidų sekos šių bakterijų genuose yra nekintančios. Todėl PO panaudojimas sumažina bakterijų gebėjimą kitais būdais sintetinti vandenyje netirpius ir dalinai tirpius gliukanus, kad būtų galima sukurti bioplėvelės polimerinę matricą. Taikinių konservatyvumas parodytas ir pagrįstas Fig. 6 ir Fig. 7Targets in the aforementioned S. mutans and S. sobrinus genes and, respectively, the iRNAs are conservative - the coding nucleotide sequences in these bacterial genes are constant. Therefore, the use of PO reduces the ability of bacteria to otherwise synthesize water-insoluble and partially soluble glucans to form a biofilm polymeric matrix. Target conservatism is shown and justified in Figs. 6 and FIG. 7th

Pagal šj išradimą nauji PO, kurie pasiekia priešprasminj efektą, gali būti chemiškai sintetinamos fosforotioatų oligodeoksiribonukleotidų sekos, atitinkančios nukleotidų sekas pagal SEQ ID nr. 1, 13, 19, arba gali būti bet kokia kita šiame dokumente apibūdinta PO forma, t.y., SEQ ID nr. 4, 5, 6, 7, 8, 9,10,11,12, 20, 21,22, 23, 24, ar jų fragmentai ar modifikacijos.In accordance with the present invention, novel POs that achieve the antisense effect may be chemically synthesized oligodeoxyribonucleotide sequences of phosphorothioates corresponding to the nucleotide sequences of SEQ ID NO. 1, 13, 19, or may be any other form of PO described herein, i.e. SEQ ID NO. 4, 5, 6, 7, 8, 9,10,11,12, 20, 21,22, 23, 24, or fragments or modifications thereof.

Trumpesnės sekos (SEQ ID nr. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24) turi tokį patį nukleotidų (nt) išsidėstymą kaip ir PO su SEQ ID nr. 1, 13, 19, todėl jos gali būti savarankiškai naudojamos nustatytiems bakterijų genomo taikiniams tarp gtfB ir gtfC S. mutans, taip pat S. sodrinus gtfl genų ir iRNR. Dėl termodinaminių savybių (tokių pačių kaip ir su PO SEQ ID nr. 1, 13,19), šie trumpesni fragmentai atitinkamoje bakterijų genomo srityje gali formuoti heterodupleksus.The shorter sequences (SEQ ID NOs: 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24) have the same nucleotide (nt) arrangement as the PO with SEQ ID NO: . 1, 13, 19, so they can be used independently for established bacterial genomic targets between gtfB and gtfC in S. mutans, as well as gtfl genes and iRNAs in S. sodrinus. Due to their thermodynamic properties (similar to those of PO SEQ ID NO: 1, 13,19), these shorter fragments can form heteroduplexes in the corresponding region of the bacterial genome.

Pažymėtina, kad PO, turintis SEQ ID nr. 1, jungiasi su nesuporuotais nukleotidais esančiais rutulinėje kilpoje S. mutans iRNR gtfB kaip tai yra nurodyta Fig. 1 Analogiškai ilgesnės sekos PO (SEQ ID nr. 13) gali formuoti heterodupleksus numatytoje srityje ir papildo bei jungiasi rutulinėje kilpoje su nesuporuotais nukleotidaisNotably, the PO having SEQ ID NO. 1, binds to unpaired nucleotides in the S. loop of mutant iRNA gtfB as shown in FIG. 1 Similarly, longer sequences of PO (SEQ ID NO: 13) can form heteroduplexes in the intended region and complement and bind in a loop with unpaired nucleotides

S. mutans iRNR gtfB kaip yra apibrėžta fig. 1S. mutans iRNA gtfB as defined in FIG. 1

Gausus literatūroje pristatytų tyrimų, atliktų in vitro ir in vivo sąlygomis, skaičius demonstruoja, kad nuo 8 nt iki 30 nt ilgio nukleotidų sekų PO būdingas priešprasminis poveikis. Net ir PO su vienu nesutampančiu nukleotidu taip pat būdingas stiprus priešprasminis poveikis (žr. Hamel ir kt. „Inhibition ofgene expression by anti-sense C-5 propyne oligonucleotides detected by a reporter enzyme“ (Biochem J 339 (1999), 547-553 p.); VVagner ir kt. „Potent and selective inhibition ofgene expression by an antisense heptanucleotide“ (Nat Biotechnol 14 (1996), 840-844 p.); Fakler ir kt. „Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration būt almost independent oflocation ofthe target sequence“ (J Biol Chem 269 (1994), 16187-16194 p.); Woolf ir kt. „Specificity of antisense oligonucleotides in vivo“ (Proc Natl Acad Sci USA 89 (1992), 7305-7309 p.)).The large number of literature studies in vitro and in vivo demonstrate that POs from 8 nt to 30 nt in length have antisense effects. Even PO with a single mismatched nucleotide also exhibits potent antisense activity (see Hamel et al., "Inhibition of gene expression by anti-sense C-5 propyne oligonucleotides detected by a reporter enzyme" (Biochem J 339 (1999), 547-553). Wagner et al., "Potent and selective inhibition of gene expression by an antisense heptanucleotide" (Nat Biotechnol 14 (1996), 840-844); Fakler et al., "Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration to be almost independent of the location of the target sequence "(J Biol Chem 269 (1994), 16187-16194); Woolf et al.," Specificity of antisense oligonucleotides in vivo "(Proc Natl Acad Sci USA 89 (1992)) , Pp. 7305-7309)).

PO sintezėPO Synthesis

Šiame išradime nurodytos naujos PO sekos gali būti sintetinamos ir modifikuojamos įvairiais būdais. Fosforotioatų formos oligodeoksiribonukleotidai, kaip pavaizduota 2 pavyzdyje, gali būti naudojami kaip skirtingų formų PO. Tokie fosforotioatų formos oligodeoksiribonukleotidai skiriasi nuo nemodifikuotų oligodeoksiribonukleotidų tuo, kad vienas iš deguonies atomų fosfodiesterio jungtyje yra pakeičiamas sieros atomu. Fosforotioatų formos oligodeoksiribonukleotidai gali būti chemiškai sintetinami, pavyzdžiui, Metabion International AG (Vokietija) naudojant automatizuota DNR sintezatorių ir forforamiditinį metodą pagal plačiai žinomą standartinį protokolą (žr., G. Zon „Oligonucleoside Phosphorothioates“ Ed. S. Agrawal „Protocols for Oligonucleotides and Analogs: Synthesis and Properties“ (methods Mol Biol 20 (1993), 165-189 p., Humama Press Ine., Totovva, NJ); Guzaev „Reactivity of 3H-1,2,4-diathiazole-3-thiones and 3H-1,2-dithiole-3-thiones as sulfurizing agents for oligonucleotide synffaes/s“ (Tetrahedron Lett 52 (2011), 434-437 p.); Sanghvi „A status update ofmodified oligonucleotides for chemotherapeutics applications“ (Curr ProtocThe novel PO sequences of the present invention can be synthesized and modified in various ways. Oligodeoxyribonucleotides in the form of phosphorothioates as depicted in Example 2 can be used as different forms of PO. Such oligodeoxyribonucleotides in the form of phosphorothioates differ from unmodified oligodeoxyribonucleotides in that one of the oxygen atoms in the phosphodiester bond is replaced by a sulfur atom. Oligodeoxyribonucleotides in the form of phosphorothioates can be chemically synthesized, for example, by Metabion International AG (Germany) using an automated DNA synthesizer and a phosphoramidite method according to a well-known standard protocol (see G. Zon, Oligonucleoside Phosphorothioates, Ed. S. Agrawal, Protocols for Oligon). Synthesis and Properties (Methods Mol Biol 20 (1993), pp. 165-189, Humama Press Ine., Totovva, NJ); Guzaev, "Reactivity of 3H-1,2,4-diathiazole-3-thiones and 3H-. 1,2-dithiole-3-thiones as sulfurizing agents for oligonucleotide synthesis / s "(Tetrahedron Lett 52 (2011), pp. 434-437); Sanghvi," A Status Update of Modified Oligonucleotides for Chemotherapeutics Applications "(Curr Protoc

Nucleic Acid Chem Suppl. 46 (2011), Unit 4.1.1-4.1.22)).Nucleic Acid Chem Suppl. 46 (2011), Unit 4.1.1-4.1.22)).

Fosforotioatų formos PO sintezė susideda iš 4 etapų sintetinių ciklų.Synthesis of phosphorothioate-form PO consists of 4-step synthetic cycles.

Sintetinis fosforotioatų formos oligodeoksiribonukleotidų ciklas prasideda nuo nukleotido, prisitvirtinusio prie kietos atramos (stiklo ar polisterino rutuliuko), atblokavimo 3'-pozicijoje. Šis pirmasis etapas vadinamas detrityliacija ir yra skirtas pašalinti rūgščiai atsparią dimetoksitritylo apsauginę grupę iš 5’-hidroksilo atraminės nukleozidų grupės, naudojant rūgšties tirpalą iš dichloracto rūgšties tirpalo dichlormetane ar toluene.The synthetic cycle of oligodeoxyribonucleotides in the form of phosphorothioates begins with the unblocking of the nucleotide attached to the solid support (glass or polystyrene bead) at the 3'-position. This first step is called detritylation and is intended to remove the acid-resistant dimethoxytrityl protecting group from the 5'-hydroxyl backbone nucleoside group using an acid solution of dichloroacetic acid in dichloromethane or toluene.

Tolesnis etapas yra 5‘hidroksilo nukleozidų grupės sujungimas su įeinančiu foforamidiniu reagentu, aktyvuojamu su 1H- tetrazolu arba 4,5-dicianoimidazolu.The next step is the coupling of the 5'-hydroxyl nucleoside group with the incoming phosphoramidic reagent activated with 1H-tetrazole or 4,5-dicyanimidazole.

Gautas 3’, 5’-internukleosido fosfito jungtis yra sulfurizuojama (trečiasis etapas) su Ν,Ν,Ν’Ν’-tetraetyltiuram disulfidu, kad suteikti tiono fosfotriesterio jungtį. Kita vertus, sulfurizacija gali būti atlikta naudojant kitus reagentus, pavyzdžiui, fenilacetil sulfidą su 3-pikolinu, 3H-1,2- benzoditiol-3-vienas-1,1-dioksidą (Beaucage reagentą) arba N,N-dimetil-N’-(3-tiokso-3H-1,2,4-ditazol-5-yl) metanimidamidą.The resulting 3 ', 5'-internucleoside phosphite bond is sulfurized (third step) with Ν, Ν, Ν'Ν'-tetraethylthiouram disulfide to provide a thionic phosphotriester bond. On the other hand, sulfurization can be accomplished using other reagents, such as phenylacetyl sulfide with 3-picoline, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent) or N, N-dimethyl-N '. - (3-Thioxo-3H-1,2,4-ditazol-5-yl) methanimidamide.

Ketvirtame etape yra pasiekiamas nesureagavusios 5’-hidroksilo nukleozidų grupės ribojimas su acto rūgšties anhidrido ir N-metilimidazolą/2,6-lutidiną/acetonitrilą.In a fourth step, limitation of the unreacted 5'-hydroxyl nucleoside group to acetic anhydride and N-methylimidazole / 2,6-lutidine / acetonitrile is achieved.

Šio keturių etapų sintezės ciklo rezultatas yra papildoma DNR bazė ir ciklas yra kartojamas tol kol sukuriama visa norimo ilgio seka pagal norimą PO seką.The result of this four-step fusion cycle is an additional DNA base and the cycle is repeated until the entire sequence of the desired length is created according to the desired PO sequence.

Po sintezės ciklų baigimo oligodeoksiribonukleotidai lieka prisijungę prie atramos su visomis apsaugos grupėmis. Todėl, siekiant atskirti ir pašalinti apsaugą nuo šių bazinių neatsparių grupių (pvz., cianoetilo grupė ant fosfatų triesterio), tvirta atrama yra veikiama trietilamino acetonitrilo tirpalu, o po to amonio hidroksidu.After completion of the fusion cycles, the oligodeoxyribonucleotides remain attached to the backbone with all protecting groups. Therefore, in order to separate and remove the protection from these basic non-reactive groups (e.g., cyanoethyl group on phosphate triester), the solid support is treated with triethylamine acetonitrile solution followed by ammonium hydroxide.

Po to, atramos yra pašalinamos filtracijos pagalba ir oligodeoksiribonukleotidai yra surenkami po amonio hidroksido išgarinimo. Galiausiai atliekamas susintetintų fosforotioatų formos oligodeoksiribonukleotidų išvalymas naudojant efektyvią skysčių chromatografiją (HPLC), nudruskinimą ir liofilizavimą.The supports are then removed by filtration and the oligodeoxyribonucleotides are collected after evaporation of the ammonium hydroxide. Finally, purification of the synthesized oligodeoxyribonucleotides in the form of the phosphorothioates is accomplished by efficient liquid chromatography (HPLC), desalting and lyophilization.

PO nešėjaiPO carriers

Šiame dokumente minimi PO gali būti efektyviau transportuojami j S. mutans ir S. sobrinus bakterijas (t.y., įsiskverbti per bakterijų ląstelės sienelę) naudojant nešėjus. Nešėjas gali būti transfekcijos reagentai ir katijoniniai polimerai, kurie yra žinomi. Visų PO formų su nešėju ar transfekcijos reagentu, sudarytu iš katijoninio polimero, pavyzdžiui, TurboFect™ (Thermo Fisher Scientific, Fermentas) gali būti naudojama tam, kad padidinti bakterijų PO įsisavinimą ir efektyviai padidinti bioplėvelės formavimosi S. mutans ir S. sobrinus inhibiciją.The POs mentioned in this document can be more efficiently transported to S. mutans and S. sobrinus bacteria (i.e., penetrate the bacterial cell wall) using carriers. The carrier may be the transfection reagents and cationic polymers known in the art. Any form of PO with carrier or transfection reagent consisting of a cationic polymer such as TurboFect ™ (Thermo Fisher Scientific, Enzyme) can be used to increase bacterial PO uptake and to effectively inhibit biofilm formation in S. mutans and S. sobrinus.

Fosforotioato formos PO SEQ ID nr. 1, 13, 19, naudojami bioplėvelės formavimosi slopinimui pademonstruoti ant kieto paviršiaus, parodant jų dėka pasiekiamą priešprasminį efektą. Toks pats efektas pasiekiamas ir su kitų formų PO, aprašytais šiame dokumente, pvz., SEQ ID nr. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24, arba jų fragmentais, arba jų modifikacijomis.Form of phosphorothioate PO SEQ ID NO. 1, 13, 19, are used to demonstrate the inhibition of biofilm formation on a solid surface by demonstrating the antisense effect they provide. The same effect is achieved with other forms of PO described in this document, such as SEQ ID NO. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24, or fragments thereof or modifications thereof.

Kiti nešėjai, naudojami įvairioms PO formoms, skirti PO įterpimui į eukariotines ir prokariotines ląsteles, gali būti įvairios cheminės medžiagos, galinčios sudaryti kompleksus su izoliuotais oligonukleotidais tam, kad apsaugoti juos nuo degradacijos ir pagerinti jų skvarbą į ląsteles. Šios medžiagos apima, bet neapsiriboja, kalcio druskos (pvz., kalcio fosfatas, kalcio chloridas), katijoniniai lipidai (pvz., N-(2,3 dioleoiloksipropyl) N, N, N-trimetilamonio chloridas, dioleoilfosfatidiletanolaminas, cholesterolis), katijoniniai polimerai (pvz., dietilaminoetilo dekstranas, polietileniminas, chitozanas, ciklodekstrinas, poliamidoamino dendrimerai, polipropilenimino dendrimerai), į ląsteles prasiskverbiantys peptidai (peptidai, paprastai turintys mažiau nei 30 amino rūgščių; pvz., penetratinas) ir skirtingų tipų nanodalelės (žr. D. Liu ir kt. „Chemical Methods for DNA Delivery“, Ed., E. C. Heiser, Volume 1 of Gene Delivery to Mammalian Cells (Methods Mol Biol 245 (2004), 3-23 p., Mumana Press Ine., Totovva, NJ); Zhu ir Mahato „Lipid andpolymeric carrier-mediatednucleic acid delivery (Expert Opin Drug Deliv 7 (2010), 1209-1226 p.); Bai ir kt. „Antisense antibioties: a brief revievv ofnovel target discovery and delivery“ (Curr Drug Discov Technol 7 (2010), 7685 p.); Yu ir kt. „Targeted delivery systems for oligonueleotide therapeuties” (AAPS J 11 (2009), 195-203 p.); Aalinkeel ir kt. „Quantum rods as nanocarriers ofgene therapy“ (Drug Deliv 19 (2012), 220-231 p.). Visi šie transfekcijos reagentai, išskyrus kalcio fosfatą, kuris formuoja kalcio-fosfato-DNR nuosėdas, veikia panašiai - jie sudaro junginius su oligonukleotidais per elektrostatinę sąveiką tarp neigiamo krūvio oligonukleotidų molekulių ir teigiamo krūvio reagento molekulių. Kadangi tokie kompleksai išlaiko teigiamą krūvį, jie gali susijungti su neigiamo krūvio eukariotinių ląstelių plazmine membrana ar bakterijos ląstelės sienele ir gali būti įsisavinti ląstelių.Other carriers used for various forms of PO for insertion of PO into eukaryotic and prokaryotic cells may be various chemicals that can complex with isolated oligonucleotides to protect them from degradation and improve their cellular penetration. These include, but are not limited to, calcium salts (e.g., calcium phosphate, calcium chloride), cationic lipids (e.g., N- (2,3 dioleoyloxypropyl) N, N, N-trimethylammonium chloride, dioleoylphosphatidylethanolamine, cholesterol), cationic polymers (e.g. diethylaminoethyl dextran, polyethyleneimine, chitosan, cyclodextrin, polyamidoamine dendrimers, polypropyleneimine dendrimers), intracellular peptides (peptides typically containing less than 30 amino acids; e.g. penetratin) and different types of nanoparticles (see. et al., Chemical Methods for DNA Delivery, Ed., EC Heiser, Volume 1 of Gene Delivery to Mammalian Cells (Methods Mol Biol 245 (2004), pp. 3-23, Mumana Press Ine., Totovva, NJ); Zhu and Mahato, "Lipid and Polymeric Carrier-Mediated Nucleic Acid Delivery (Expert Opin Drug Deliv 7 (2010), 1209-1226); Bai et al.," Antisense Antibiotic: A Brief Revision of the Target Discovery and Delivery "(Curr Drug Discov Technol.7 (2010), p. 7685); Yu et al. Targeted Delivery Systems for Oligonueleotide Therapies (AAPS J 11 (2009), pp. 195-203); Aalinkeel et al. Quantum rods as nanocarriers ofgene therapy (Drug Deliv 19 (2012), pp. 220-231). All of these transfection reagents, except calcium phosphate, which forms calcium-phosphate-DNA precipitates, act in a similar way - they form compounds with oligonucleotides through electrostatic interactions between negative charge oligonucleotide molecules and positive charge reagent molecules. Because such complexes retain a positive charge, they may bind to the plasma membrane or bacterial cell wall of a negatively charged eukaryotic cell and may be absorbed by cells.

Plačiausiai naudojama transfekcijos reagentai PO pristatymui į bakterines ląsteles yra katijoniniai polimerai ir į ląsteles įsiskverbiantys peptidai, kurie yra naudojami visiems šiame dokumente minimiems PO, skirtingoms šiame dokumente minimoms PO formoms ir modifikacijoms. Svarbu akcentuoti, kad j ląsteles prasiskverbiantys peptidai yra pajėgūs įsiskverbti j ląsteles ne tik elektrostatinės sąveikos dėka, bet ir formuojant trumpalaikes poras ląstelių plazminėje membranoje (žr. Guo ir kt. „Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibits GtfB expression and function“ (FEMS Microbial Lett 264 (2006), 8-14 p.) efektyviam fosforotioatų formos PO pristatymas ikiThe most widely used transfection reagents for delivery of PO to bacterial cells are cationic polymers and intracellular peptides, which are used for all the POs mentioned in this document, different forms and modifications of the PO mentioned herein. It is important to emphasize that cell-penetrating peptides are capable of penetrating cells, not only through electrostatic interaction but also through the formation of transient pores in the cellular plasma membrane (see Guo et al., "Treatment of Streptococcal Mutans with Antisense Oligodeoxyribonucleotides to gtfB mRNA Inhibitors"). (FEMS Microbial Lett 264 (2006), pp. 8-14) Effective delivery of phosphorothioate-form PO to

S. mutans bakterijų naudojant katijonų polimerą - So-Fast™ (Taiyangma).S. mutans bacteria using a cationic polymer - So-Fast ™ (Taiyangma).

Atliekant šj išradimą pagrindžiančius tyrimus buvo taikomas žinomas ir rinkoje prieinamas transfekcijos reagentas TurboFect™ (Thermo Fisher Scientific, Fermentas). Šio katijoninio polimero pagalba PO su SEQ ID nr. 1, 13, 19 buvo įterpti į S. mutans ir S. sobrinus bakterijas, tuo pademonstruojant šio transfekcijos reagento efektyvumą, eksperimentiškai.The known and commercially available transfection reagent TurboFect ™ (Thermo Fisher Scientific, Enzyme) was used in the assays to support the present invention. With the aid of this cationic polymer PO with SEQ ID NO. 1, 13, 19 were inserted into S. mutans and S. sobrinus bacteria to demonstrate the efficacy of this transfection reagent experimentally.

PanaudojimasApplication

Šis išradimas visomis savo išraiškomis suteikia priemones ir būdus bioplėvelės formavimosi ant kietų paviršių slopinimui be žymios įtakos S. mutans ir S. sobrinus bakterijų gyvybingumui. Išradime nurodytas būdas ir PO suteikia galimybę administruoti PO, atitinkančius SEQ nr. 1, 13, 19 ar jo fragmentus, atitinkančius SEQ ID nr. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24, į bakterinę kultūrą naudojant efektyvią koncentraciją tam, kad sumažinti S. mutans ir S. sobrinus adheziją, tarpusavio sukibimą ir bioplėvelės formavimąsi, bet be baktericidinio (bakterijas naikinančio) poveikio, kaip tai aiškiai pademonstruota su S. mutans Fig. 5The present invention provides, in all its expressions, means and methods for inhibiting biofilm formation on solid surfaces without significantly affecting the viability of S. mutans and S. sobrinus bacteria. The method and PO of the invention provide the ability to administer POs corresponding to SEQ ID NOs. 1, 13, 19 or fragments thereof corresponding to SEQ ID NO. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24, using an effective concentration to reduce adhesion, adhesion, and adhesion of S. mutans and S. sobrinus to the bacterial culture. biofilm formation but without bactericidal (bactericidal) effect, as clearly demonstrated with S. mutans FIG. 5

Išradimas leidžia naudoti PO, kurių seka yra SEQ ID nr. 1, 13, 19, arba šiame dokumente apibūdintų PO fragmentus, arba PO modifikacijas, pasiekiant priešprasminj efektą, aterosklerozės ir kardiovaskulinių infekcijų prefencijai ir kontrolei, be reikšmingo poveikio žmogaus mikrobiomui.The invention allows the use of POs having the sequence of SEQ ID NO. 1, 13, 19, or the PO fragments or modifications of the PO described herein to achieve antispasmodic effect, in the prefecture and control of atherosclerosis and cardiovascular infections, without significant effect on the human microbiome.

Kaip matoma 2-Fig. 5 ir 1 lentelėje, efektyvi PO koncentracija sumažina S. mutans ir S. sobrinus adheziją, bakterijų sukibimą ir bioplėvelės formavimąsi be išreikšto bakteriostatinio ir baktericidinio poveikio. 5 pavyzdyje specifiškai parodyta efektyvios PO koncentracijos poveikį kraujo terpėje (kraujo serume), tokiu būdu parodant poveikį ateroskrerozės židinių formavimuisi kardiovaskuliarinėje sistemoje, audiniuose ir kraujo terpėje.As can be seen in FIG. In Tables 5 and 1, effective PO concentrations reduce adhesion, bacterial adhesion, and biofilm formation of S. mutans and S. sobrinus without any pronounced bacteriostatic and bactericidal activity. Example 5 specifically illustrates the effect of effective PO concentration in blood medium (serum), thereby demonstrating the effect on the formation of foci of atherosclerosis in the cardiovascular system, tissues, and blood medium.

Visų šiame dokumente nurodytų poveikių atžvilgiu šis išradimas atskleidžia naują būdą kontroliuoti ir užkirsti kelią bioplėvėlių židiniams kardiovaskulinėje sistemoje, audiniuose ir kraujo terpėje, naudojant PO, kurių sekos yra SEQ ID nr. nr. 1, 13,19, arba visų šiame dokumente nurodytų PO fragmentus ar PO modifikacijas, ir taip pasiekiant priešprasminj poveikį S. mutans ir S. sobrinus gliukoziltransferazių atžvilgiu. Šis naujas būdas suteikia įrankį bioplėvelės formavimosi slopinimui ant įvairių kietų paviršių, tarp jų kardiovaskulinių audinių, implantų, taip pat, kitų paviršių kontaktuojančių su žmogaus audiniais ir krauju.With respect to all of the effects disclosed herein, the present invention provides a novel way of controlling and preventing biofilm foci in the cardiovascular system, tissues, and blood medium using POs set forth in SEQ ID NO. no. 1, 13,19, or any of the PO fragments or modifications of the PO disclosed herein, thereby achieving an antisense effect on glucosyltransferases of S. mutans and S. sobrinus. This new method provides a tool for inhibiting biofilm formation on various hard surfaces, including cardiovascular tissues, implants, and other surfaces in contact with human tissues and blood.

Išrasti nauji PO, kurių sekos SEQ ID nr. nr. 1, 13, 19, arba visų šiame dokumente nurodytų PO fragmentai ar PO modifikacijos, gali būti naudojami kaip biofarmacinių kompozicijų (tirpalų, suspensijų ir pan.) dalys, gali būti įtraukti j biofarmacinių kompozicijų formules, suteikiant tiek vietinį, tiek sisteminį aktualų poveikį gyvam organizmui - žmogui, arba negyviems paviršiams kontaktuojantiems su gyvo organizmo audiniais ir krauju.New POs having the sequence SEQ ID NO. no. 1, 13, 19, or any of the PO fragments or PO modifications referred to herein, may be used as part of biopharmaceutical compositions (solutions, suspensions, etc.), may be incorporated into biopharmaceutical formulations providing topical and systemic topical effects the body, human, or inanimate surfaces in contact with living body tissues and blood.

Šiame išradime atskleisti nauji PO, kurių sekos SEQ ID nr. 1, 13, 19, arba visi šiame dokumente nurodytų PO fragmentai ar PO modifikacijos, geba susijungti su atitinkamomis Streptococcus mutans genomo dalimis koduojančiomis gliukoziltransferazę B ir gliukoziltransferazę C, ir šių gliukoziltransferazių iRNR vienu metu, taip pat su gliukoziltransferazę I iRNR S. sobrinus ir tokiu būdu slopinti gliukanų gamybą, sumažinant bioplėvelės formavimąsi, taip užkertant kelią aterosklerozės ir infekcinių židinių formavimuisi.The present invention provides novel POs having the sequence SEQ ID NO. 1, 13, 19, or any of the PO fragments or modifications of the PO herein disclosed, is capable of binding to the respective portions of the Streptococcus mutans genome encoding glucosyltransferase B and glucosyltransferase C, and to the iRNA of these glucosyltransferases simultaneously, as well as the glucosyltransferase S1. inhibiting glucan production by reducing biofilm formation, thereby preventing the formation of atherosclerosis and infectious foci.

Be to, šiame išradime atskleisti nauji PO, kurių sekos SEQ ID nr. 1, 13, 19, arba visi šiame dokumente nurodytų PO fragmentai ar PO modifikacijos, užkerta kelią bakterijų adhezijai ir prikibimui prie kietų paviršių, tuo pačiu metu nesumažinant bakterijų gyvybingumo. Šis aspektas suteikia galimybę naudoti pateiktus PO kaip medžiagą kovai su ateroskleroze ir kardiovaskulinėmis infekcijomis, kuri reikšmingai nepaveikia žmogaus organizme esančios bakterijų ekosistemos - mikrobiomo.The present invention further provides novel POs having the sequence SEQ ID NO. 1, 13, 19, or any of the PO fragments or modifications of the PO herein, prevents bacterial adhesion and adherence to solid surfaces without at the same time reducing bacterial viability. This aspect allows the use of the POs provided as agents for combating atherosclerosis and cardiovascular infections, which do not significantly affect the microbiome of the bacterial ecosystem in the human body.

Patentuojamo išradimo tikslas yra suteikti priemones ir būdą bioplėvelės formavimosi slopinimui būtent kardiovaskuliarinėje sistemoje ir kraujo terpėje. Tikslas pasiekiamas veikiant šiame išradime apibrėžų PO molekulėms, kurios slopina gliukanų gamybą S. mutans ir S. sobrinus, vienu metu taikantis į abiejų rūšių bakterijų gliukanų sintezės mechanizmus, su vieno tipo PO molekule.It is an object of the present invention to provide means and a method for inhibiting biofilm formation, particularly in the cardiovascular system and the blood medium. The object is achieved by the action of the PO molecules of the present invention which inhibit glucan production in S. mutans and S. sobrinus, targeting simultaneously both types of bacterial glucan synthesis, with a single type of PO molecule.

Teiginys „vieno tipo priešprasminio oligonukleotido molekulė“ yra naudojamas norint pabrėžti, kad pastraipoje aukščiau nurodytas priešprasminis poveikis yra pasiekiamas su viena ar keliomis molekulėmis, kurių oligonukleotidų seka yra pirmą kartą atskleista šiame išradime.The claim "one type of antisense oligonucleotide molecule" is used to emphasize that the above antisense effect is achieved with one or more molecules having the oligonucleotide sequence first disclosed in the present invention.

PO pateikiami kaip viena ar kelios šiame išradime žemiau pateikiamų sekų molekulės, t.y., PO, kurių sekos yra SEQ ID nr. 1, 13, 19, taip pat jų fragmentai ir modifikacijos (pvz, kurių sekos yra viena iš SEQ ID nr. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24), tokiu kiekiu, kuris yra efektyvus ir pakankamos atsižvelgiant j terpę ir konkrečią kompoziciją.POs are provided as one or more molecules of the sequences set forth below in the present invention, i.e. POs having the sequence of SEQ ID NO. 1, 13, 19, as well as fragments and modifications thereof (e.g., having the sequence of SEQ ID NOs: 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24) in an amount that is effective and sufficient with respect to the medium and the particular composition.

Šio išradimo rezultate sukurtų naujų PO, kurių sekos SEQ ID nr. 1, 13, 19, arba visi šiame dokumente nurodytų PO fragmentai ar PO modifikacijos (pvz., kurių sekos yra viena iš SEQ ID nr. 4, 5, 6, 7, 8, 9,10, 11, 12, 20, 21, 22, 23, 24), efektas in vitro atitiko in silico sumodeliuotą poveikį į S.mutans ir S.sobrinus. Minėtos PO sekos slopina S.mutans ir S.sobrinus gebėjimą sintezuoti bioplėvelės formavimuisi reikalingus gliukanus. Ne bioplėvelėje esančios bakterijos yra lengviau atpažįstamos ir eliminuojamos natūraliu keliu žmogaus imuninės sistemos.As a result of the present invention, new POs having the sequence SEQ ID NO. 1, 13, 19, or any of the PO fragments or modifications of the PO referred to herein (e.g., having the sequence of one of SEQ ID NOs: 4, 5, 6, 7, 8, 9,10, 11, 12, 20, 21 , 22, 23, 24), the effect in vitro was consistent with the in silico modeled effect on S.mutans and S.sobrinus. These PO sequences inhibit the ability of S. mutans and S.sobrinus to synthesize the glucans required for biofilm formation. Non-biofilm bacteria are more easily recognized and eliminated naturally by the human immune system.

Atitinkamai, šis išradimas suteikia būdą ir priemones bioplėvelės slopinimui, mažinimui, taip pat užkerta kelią bioplėvelės židinių ant kietų paviršių in vitro ir in vivo atsiradimui. Jei in vivo kietas paviršius yra žmogaus audinių dalis, pavyzdžiui kraujagyslės sienelė, šį metodą sudaro efektyvios PO dozės, kaip aprašyta šiame dokumente, įvedimas į žmogaus kraują, t.y., PO kurių sekos yra SEQ ID nr. 1, 13, 19, arba visi šiame dokumente nurodytų PO fragmentai ar PO modifikacijos (pvz., kurių seka yra viena iš SEQ ID nr. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24), kaip biofarmacinės kompozicijos sudėtinės dalys yra panaudojamos bioplėvelės sąlygojamų kardiovaskulinės sistemos patologijų susijusių su ateroskleroze ir/ar S.mutans ar S.sobrinus sukeltomis infekcijomis prevencija ir gydymas.Accordingly, the present invention provides a method and means for inhibiting or reducing biofilm, as well as preventing the formation of biofilm foci on solid surfaces in vitro and in vivo. If the in vivo solid surface is part of human tissues, such as a vascular wall, the method comprises administering an effective dose of PO, as described herein, to human blood, i.e., PO having the sequence of SEQ ID NO. 1, 13, 19, or any of the PO fragments or modifications of the PO referred to herein (e.g., having the sequence of one of SEQ ID NOs: 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21 , 22, 23, 24) as a component of a biopharmaceutical composition for use in the prevention and treatment of biofilm-mediated cardiovascular pathologies associated with atherosclerosis and / or S. mutans or S. sobrinus infections.

TechnologijaTechnology

Priešprasminė technologija suteikia keletą privalumų, lyginant su kitomis antibakterinėmis technologijomis, tarp jų pagrindiniai privalumai yra:The antisense technology offers several advantages over other antibacterial technologies, among which the main advantages are:

specifinis ir sinchroninis gtf iRNR S. mutans ir S. sobrinus slopinimas;specific and synchronous inhibition of gtf iRNA in S. mutans and S. sobrinus;

šiame išradime atskleistų PO sekų naudojimas analogiškiems taikiniams dviejų rūšių streptokokuose (S. mutans ir S. sobrinus)', išorinis panaudojimas siekiant S. mutans ir S. sobrinus bioplėvelių inhibicijai ant negyvų paviršių, tokių kaip kateteriai, protezai ar implantai, siekiant maksimaliai sumažinti infekcijos ar atmetiko rizikas, taip pat sumažinti sisteminius šalutinius poveikius.use of the PO sequences disclosed in the present invention for analogous targets in two species of streptococci (S. mutans and S. sobrinus), external use for inhibition of biofilms of S. mutans and S. sobrinus on dead surfaces such as catheters, prostheses or implants to minimize infection. or foreclosed risks as well as reducing systemic side effects.

Šiame išradime atskleistas PO panaudojimo būdas ir PO, kurių sekos yra SEQ ID nr. 1, 13, 19, arba visi šiame dokumente nurodytų PO fragmentai ar PO modifikacijos (pvz, kurių seka yra viena iš SEQ ID nr. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24), slopina bioplėvelės formavimąsi ir tuo pačiu ligų ir patologijų, sukeltų bioplėvelės formavimosi, atsiradimą, pvz., aterosklerozė, infekcinis endokarditas, infekcinės ir uždegiminės reakcijos j implantuos ar protezus, jų atmetimo reakcijos ir pan.The present invention discloses a method of using a PO and a PO having the sequence set forth in SEQ ID NO. 1, 13, 19, or any of the PO fragments or PO modifications (e.g., having the sequence of one of SEQ ID NOs 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24), inhibit biofilm formation and thereby the occurrence of diseases and pathologies caused by biofilm formation, e.g., atherosclerosis, infectious endocarditis, infectious and inflammatory reactions to implants or prostheses, their rejection reactions and the like.

Gliukanai, sudarantys S. mutans ir S. sobrinus bioplėvelių egzopolisacharidus, yra sudaryti iš besikartojančių gliukozės monomerų vienetų ir yra sintetinami veikiant gliukoziltransferazių fermentinėms reakcijomis. Gliukanai gali būti netirpūs vandenyje, tirpūs vandenyje ir dalinai tirpūs vandenyje. Gliukanai tarnauja kaip polisacharidinė matrica bioplėvelei su keliomis funkcijomis:Glucans forming exopolysaccharides of biofilms of S. mutans and S. sobrinus are composed of repeating units of glucose monomers and are synthesized by enzymatic reactions of glucosyltransferases. Glucans can be water insoluble, water soluble and partially water soluble. Glucans serve as a polysaccharide matrix for biofilm with several functions:

1) didina bakterijų prisitvirtinimą ir tolesnį kaupimąsi ant audinių;1) increases bacterial attachment and subsequent accumulation on tissues;

2) suteikia struktūrinį vientisumą ir bioplėvelės lipnumą;2) provides structural integrity and adhesion of biofilm;

3) didina bioplėvelės matricos adhezines savybes.3) increases the adhesive properties of the biofilm matrix.

S. mutans gamina trijų rūšių gliukanų polimerus - netirpius vandenyje gliukanus su alfa (a)-1,3 gliukozidinėmis jungtimis, dalinai tirpius vandenyje turinčius a-1,3 ir a-1,6 gliukozidinių jungčių mišinį ir taip pat vandenyje tirpius gliukanus su a1,6 gliukozidinėmis jungtimis, kurie yra sintetinami atitinkamai GtfB, GtfC ir GtfD fermentų (baltymų). Yra trys genai - gtfB, gtfC ir gtfD, kurie koduoja atitinkamai GtfB, GtfC ir GtfD baltymus.S. mutans produces three types of glucan polymers, water-insoluble glucans with alpha (a) -1,3 glucosidic linkages, a partially water-soluble mixture of a-1,3 and a-1,6 glucosidic linkages, and also water-soluble glucans with a1 , 6 glucosidic linkages, which are synthesized by GtfB, GtfC and GtfD enzymes (proteins), respectively. There are three genes, gtfB, gtfC, and gtfD, which encode the GtfB, GtfC, and GtfD proteins, respectively.

Atskiras šio išradimo tikslas ir naujumas yra vienu metu ir lygiagrečiai slopinti gliukoziltransferazės iRNR ir gtf genų raišką S. mutans ir S. sobrinus.A separate object and novelty of the present invention is the simultaneous and parallel inhibition of the expression of glucosyltransferase iRNA and gtf genes in S. mutans and S. sobrinus.

Gliukoziltransferazės iRNR ir gtf genų raiškos inhibicijos efektas, taip pat vandenyje netirpių ir dalinai tirpių gliukanų sintezės slopinimo efektas ir atitinkamai bioplėvelės formavimosi slopinimo efektas pasiekiamas, panaudojant tokių sekų PO:The effect of inhibiting the expression of glucosyltransferase iRNA and gtf genes, as well as the effect of inhibiting the synthesis of water-insoluble and partially soluble glucans and, respectively, of biofilm formation is achieved by using the following sequences:

SEQ ID nr.1 (5'-GCAGACCATTGCTTAATCT-3'), kurios veikimo išdava yra visiškas vandenyje netirpių gliukanų gamybos ir rezultate bioplėvelės formavimosi slopinimas.SEQ ID NO: 1 (5'-GCAGACCATTGCTTAATCT-3 '), the action of which is the complete inhibition of the production of water-insoluble glucans and the resulting biofilm formation.

SEQ ID nr.13 (5’-TTGGCAGACCATTGCTTAATCTTAAC-3') ir/arba SEQ ID nr.19 (5-TTAGAGAAACCTTCAAACATGACGCG-3), veikimo išdava yra analogiška SEQ ID nr. 1;SEQ ID NO: 13 (5'-TTGGCAGACCATTGCTTAATCTTAAC-3 ') and / or SEQ ID NO: 19 (5-TTAGAGAAACCTTCAAACATGACGCG-3), the operating result is analogous to SEQ ID NO: 13. 1;

Taip pat analogiškas efektas kaip nurodyti aukščiau pasiekiamas veikiant PO sekų fragmentams ir modifikuotoms sekoms (pvz, kurių seka yra viena iš SEQ ID nr. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24).Likewise, an analogous effect as above is achieved by acting on PO sequence fragments and modified sequences (e.g., having one of SEQ ID NOs: 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22). , 23, 24).

PO gali būti specifinė sekos, kaip nurodyta SEQ ID nr. 1, 13, 19 arba tų sekų dalys ar fragmentai. Taip pat gali būti PO, kurių sekos yra SEQ ID nr. 1,13, 19 dalis ir fragmentas, pasirinkti iš šio sąrašo:The PO may be sequence specific as set forth in SEQ ID NO. 1, 13, 19 or portions or fragments of those sequences. There may also be POs having the sequence of SEQ ID NO. 1,13, paragraph 19, and a fragment selected from the following list:

5'-CAGACCATTGCTTAATCT-3' 5'-CAGACCATTGCTTAATCT-3 ' (SEQ ID nr. 4) (SEQ ID NO: 4) 5'-AGACCATTGCTTAATCT-3' 5'-AGACCATTGCTTAATCT-3 ' (SEQ ID nr. 5) (SEQ ID NO: 5) 5'-GACCATTGCTTAATCT-3' 5'-GACCATTGCTTAATCT-3 ' (SEQ ID nr. 6) (SEQ ID NO: 6) 5'-GCAGACCATTGCTTAATC-3' 5'-GCAGACCATTGCTTAATC-3 ' (SEQ ID nr. 7) (SEQ ID NO: 7) 5'-GCAGACCATTGCTTAAT-3' 5'-GCAGACCATTGCTTAAT-3 ' (SEQ ID nr. 8) (SEQ ID NO: 8) 5'-GCAGACCATTGCTTAA-3' 5'-GCAGACCATTGCTTAA-3 ' (SEQ ID nr. 9) (SEQ ID NO: 9) S'-CAGACCATTGCTTAATC-S' S'-CAGACCATTGCTTAATC-S ' (SEQ IDnr. 10) (SEQ ID NO: 10) 5'-AGACCATTGCTTAATC-3' 5'-AGACCATTGCTTAATC-3 ' (SEQ ID nr. 11) (SEQ ID NO: 11) S'-CAGACCATTGCTTAAT-S' S'-CAGACCATTGCTTAAT-S ' (SEQ IDnr. 12) (SEQ ID NO: 12) 5-TTGGCAGACCATTGCTTAATCTTAAC-3' (SEQ ID nr. 13) 5-TTGGCAGACCATTGCTTAATCTTAAC-3 '(SEQ ID NO: 13) 5-GAAACCTTCAAACATGACGC-3' 5-GAAACCTTCAAACATGACGC-3 ' (SEQ ID nr. 20) (SEQ ID NO: 20) 5-AAACCTTCAAACATGACGC-3' 5-AAACCTTCAAACATGACGC-3 ' (SEQ IDnr. 21) (SEQ ID NO: 21) 5'-GAAACCTTCAAACATGACGCG-3’ 5'-GAAACCTTCAAACATGACGCG-3 ' (SEQ ID nr. 22) (SEQ ID NO: 22) 5-GAAACCTTCAAACATGACG-3' 5-GAAACCTTCAAACATGACG-3 ' (SEQ ID nr. 23) (SEQ ID NO: 23)

5'-AGAAACCTTCAAACATGACGC-3' (SEQ ID nr. 24)5'-AGAAACCTTCAAACATGACGC-3 '(SEQ ID NO: 24)

PO, kurių seka yra SEQ ID nr. 15 yra gautas iš SEQ ID nr. 13, kuris yra 100% komplementarus 26 nt S. mutans gtfB, S. mutans gtfC genuose ir taip pat su vienu iš nesuderintų nukleotidų S. sobrinus gtfl regione (žr. 1 pavyzdį).POs having the sequence SEQ ID NO. 15 is derived from SEQ ID NO. 13, which is 100% complementary to the 26 nt S. mutans gtfB, S. mutans gtfC genes, and also to one of the mismatched nucleotides in the S. sobrinus gtfl region (see Example 1).

PO, kurių seka yra SEQ ID nr. nr. 1, yra optimizuota 19 nukleotidų molekulė, atsižvelgiant į termodinamines savybes reikalingas S. mutans gtfB ir gtfC, S. sobrinus gtfl iRNR slopinimui.POs having the sequence SEQ ID NO. no. 1, is an optimized 19 nucleotide molecule with respect to the thermodynamic properties required for the inhibition of S. mutans gtfB and gtfC, S. sobrinus gtfl iRNA.

PO su SEQ ID nr. 1 yra gaunami iš SEQ ID nr. 13 ir yra sudarytas iš 19 nt:PO with SEQ ID NO. 1 are derived from SEQ ID NO. 13 and is composed of 19 nt:

5'-TTG-GCAGACCATTGCTTAATCT-TAAC-3' (pabraukta ir nurodyta 1 pavyzdyje). SEQ ID nr. 4-12 yra gaunami iš SEQ ID nr. 1.5′-TTG-GCAGACCATTGCTTAATCT-TAAC-3 ′ (underlined and referenced in Example 1). SEQ ID NO: 4-12 are derived from SEQ ID NOs. 1.

PO su SEQ ID nr. 13 yra izoliuoti sintetiniai PO sudaryti iš 26 nt:PO with SEQ ID NO. 13 are isolated synthetic POs consisting of 26 nt:

5'-TTGGCAGACCATTGCTTAATCTTAAC-3', su kuriais pasiekiamas priešprasminis efektas natūraliai DNR sekos SEQ ID nr. 14 daliai.5'-TTGGCAGACCATTGCTTAATCTTAAC-3 ', with which the antisense effect is achieved by naturally occurring DNA sequence SEQ ID NO. For 14 parts.

PO su SEQ ID nr. 19 yra izoliuoti sintetiniai PO sudaryti iš 26nt:PO with SEQ ID NO. 19 are insulated synthetic POs consisting of 26pcs:

5'-TTAGAGAAACCTTCAAACATGACGCG-3', su kuriais pasiekiamas priešprasminis efektas natūraliai DNR sekai SEQ ID nr. 18.5'-TTAGAGAAACCTTCAAACATGACGCG-3 'with which the antisense effect on the native DNA sequence of SEQ ID NO. 18th

SEQ ID nr. 20-24 yra gaunamos iš SEQ ID nr. 19.SEQ ID NO: 20-24 are derived from SEQ ID NOs. 19th

Todėl bet koks PO fragmentai, net ir trumpesnis nei 26 nt seka atitinkantis SEQ ID nr. 1 arba SEQ ID nr. 13, arba SEQ ID nr. 19, kurie taip pat apima ir atitinka šiame dokumente apibrėžtus gliukoziltransferazių kodavimo regionus, turi priešprasminj poveikį ir patenka į šių išradimu apibrėžiamas (ir pareiškiamas patentavimui) PO formas, kurios efektas atitinka šiame išradime įvardintą būdą ir priemones.Therefore, any PO fragments, even shorter than 26 nt, will have the sequence of SEQ ID NO. 1 or SEQ ID NO. 13, or SEQ ID NO. 19, which also encompasses and corresponds to the coding regions for glucosyltransferases as defined herein, have antispasmodic effects and fall within the scope of the invention as defined (and claimed) in the PO forms having an effect consistent with the method and means disclosed herein.

Šiame išradime nurodyti izoliuoti PO gali būti izoliuoti iš natūralaus ar gamtinio šaltinio per išsgrynintą restrikcijos reakciją, taip pat gaminami sintetiniais būdais, t.y., sintetinami chemiškai arba gaminamas rekombinantiniu būdu ar naudojant genų inžineriją, ar polimerizacijos ir amplifikacijos metodus, pvz., polimerazės grandininę reakciją (PGR) ir PGR amplifikaciją ar kurį nors kitą metodą. PO taip pat gali būti paruoštas atliekant žinomus veiksmus ar kitus metodus, aprašytus šiame dokumente atsižvelgiant į šį išradimą.The isolated POs of the present invention may be isolated from a natural or natural source by a purified restriction reaction, or may be synthesized by synthetic means, i.e., chemically synthesized or recombinantly produced, or by genetic engineering, or polymerization and amplification methods, e.g. PCR) and PCR amplification or any other method. The PO may also be prepared by known procedures or other methods described herein in accordance with the present invention.

Šiame išradime nurodytais PO gali būti bet kokios molekulės, pagrįstos atitinkamomis nukleotidų sekomis, kurios jungiasi ar jungiasi naudojant bazinį nukleotindų suporavimą, įskaitant oligomerus arba polimerus, turinčius pagrindą, suformuotą iš natūraliai paplitusių nukleotidų ir/arba nukleino rūgščių analogų, sudarančių nestandartines nukleobazes ir/arba nestandartinius pagrindus, pvz., peptidinė nukleorūgštis (PNR) arba užrakinta nukleorūgštis (UNR), arba bet kokios išvestinės nukleorūgščių formos, kaip parodyta šiame dokumente. PO gali turėti dalinį, pvz., 10, 20, 30, 40, 50, 60, 70, 80 ar netgi 90% natūraliai paplitusių nukleotidų, o likusieji, t.y. 90, 80, 70, 60, 50, 40, 30, 20 ar netgi 10% yra nukleorūgšties analogai, sudaryti iš nestandartinių nukleobazių ir/arba nestandartinių pagrindų, kaip nurodyta šiame dokumente naudojant PNR, UNR ar bet kokią kitą išvestinę nukleorūgšties formą. PO gali būti toliau chemiškai modifikuojamas. Tokios modifikacijos gali būti fosforotioatų formos oligodeoksiribonukleotidai, kaip parodyta šiame dokumente. Visos šiame dokumente pateiktos PO sekos gali būti chemiškai susintetintos kaip fosforotioatų formos oligodeoksiribonukleotidai.The POs of the present invention may be any molecule based on the corresponding nucleotide sequences that bind or bind using basic nucleotide pairing, including oligomers or polymers based on naturally occurring nucleotides and / or nucleic acid analogs forming non-standard nucleobases and / or non-standard bases, such as peptide nucleic acid (PNR) or locked nucleic acid (UNR), or any derived form of nucleic acid as shown herein. The PO may have a partial, e.g., 10, 20, 30, 40, 50, 60, 70, 80, or even 90% naturally occurring nucleotides, and the rest, i.e. 90, 80, 70, 60, 50, 40, 30, 20 or even 10% are nucleic acid analogs consisting of non-standard nucleobases and / or non-standard bases as defined herein using PNR, UNR or any other derivative of the nucleic acid. The PO can be further chemically modified. Such modifications may be oligodeoxyribonucleotides in the form of phosphorothioates as shown herein. All PO sequences provided herein may be chemically synthesized as oligodeoxyribonucleotides in the form of phosphorothioates.

Fosforotioatų oligonukleotidai yra normalios DNR variantas, kuriame vienas iš nesujungtų deguonies atomų yra pakeistas sieros atomu. Vidinės nukleotido jungtys (sulfurizacija) ženkliai sumažina endonukleazių ir eksonukleozių veiklumą, tame tarpe, nuo 5' iki 3' ir nuo 3' iki 5' DNR pol 1 egzonukleazės, nukleazės S1 ir P1, RNazės, serumo nukleazės ir gyvatės nuodų fosfodiesterazės. Fosforotioatų formos PO turi padidintą potencialą įsiskverbti per lipidų dvisluoksnį.Phosphorothioate oligonucleotides are a variant of normal DNA in which one of the unbound oxygen atoms is replaced by a sulfur atom. Internal nucleotide linkages (sulfurization) significantly reduce the activity of endonucleases and exonucleoses, including 5 'to 3' and 3 'to 5' DNA pol 1 exonuclease, nuclease S1 and P1, RNase, serum nuclease and snake venom phosphodiesterase. POs in the form of phosphorothioates have an increased potential for penetration through the lipid bilayer.

Dar kitos PO formos gali būti pagrįstos nukleotidais, kur bent vienas nukleotidas turi modifikuotą pagrindą padidinti susijungimo savybes ir/arba sumažinti endonukleazių ir egzonukleazių, tame tarpe, nuo 5' iki 3' ir nuo 3' iki 5' DNR pol 1 egzonukleazės, nukleazės S1 ir P1, RNazės, serumo nukleazės ir gyvatės nuodų fosfodiesterazės.Still other forms of PO may be based on nucleotides, wherein at least one nucleotide has a modified basis for enhancing binding properties and / or reducing endonucleases and exonucleases, including 5 'to 3' and 3 'to 5' DNA pol 1 exonuclease, nuclease S1. and P1, RNase, serum nuclease and snake venom phosphodiesterase.

Pavyzdžiai pavyzdys - Priešprasminių oligonukleotidų sekos parinkimas gliukoziltransferazės raiškos slopinimuiExamples Example - Sequence Selection of Antisense Oligonucleotides for Inhibition of Glucosyltransferase Expression

Bioinformaciniai metodai ir rezultataiBioinformatics methods and results

Parenkant šiame išradime atskleistas naujas PO sekas, pirmiausiai buvo identifikuotos konservatyvios homologinės sritys burnos streptokokų gtf genuose.In selecting the novel PO sequences disclosed herein, conservative homologous regions in the gtf genes of oral streptococci were first identified.

Šiam tikslui pasiekti, pirmiausiai atlikta palyginamoji aminorūgščių sekų analizė tarp S. mutans GtfB baltymo ir kitų Gtf baltymų, esančių burnos streptokokuose. S. mutans (padermė UA159, Bratthall serotipas c, Amerikietiško tipo kultūrų kolekcijos (ATKK) nr. 700610) genomas yra visiškai sekvenuotas, o sekos yra patalpintos GenBank duomenų bazėje Nacionaliniame biotechnologijos informacijos centre (National Center for Biotechnology Information) (NCBI). Todėl naudojant S. mutans (padermė UA159) GtfB baltymo aminorūgščių sekas, kaip užklausą, buvo atlikta BLAST (Basic Local Alignment Search Tool) homologų paieška tarp visų žinomų baltymų (BLAST paslauga yra prieinama http://blast.ncbi.nlm.nih.gov/Blast.cgi, ir atlikta 2013 m. kovo mėn.). Buvo atskleista, kad S. mutans (padermė UA159) GtfB baltymas turi didelio laipsnio identiškumą su S. mutans GtfC baltymu (padermė UA159), o taip pat su kitais Gtf (t.y. Gtfl) baltymais S. criceti, S. dentirousetti, S. dentisuis, S. dovvnei ir S. sobrinus bakterijose, atsakinguose už vandenyje netirpių gliukanų sintezę. Galiausiai šiuos baltymus sudarančios aminorūgščių sekos buvo atrinktos ir daugybinė sekų palyginamoji analizė buvo atlikta naudojant MAFFT programos internetinj serverį, esantį Max-Planck Institute for Development Biology (http://toolkit.tuebingen.mpg.de/mafft, atlikta 2013 m. kovo mėn.). Taikant tokį metodą, buvo nustatyta konservatyvi sritis S. mutans (padermė UA159) GtfB baltymo aminorūgščių sekoje, kuri yra 100% homologiška su atitinkamomis sritimis S. mutans (padermė UA159) GtfC, S. criceti Gtfl, S. dentirousetti Gtfl, S. dentisuis Gtfl ir S. orisuis Gtf baltymuose. Atitinkamas koduojantis segmentas šiai sričiai S. mutans (padermė UA159) gtfB gene turi šią 26 nukleotidų (nt) seką:To this end, comparative amino acid sequences analysis was first performed between S. mutans GtfB protein and other Gtf proteins present in oral streptococci. The genome of S. mutans (strain UA159, Bratthall serotype c, American Type Culture Collection (ATCC) # 700610) is fully sequenced and the sequences are stored in the GenBank database at the National Center for Biotechnology Information (NCBI). Therefore, using the GtfB protein amino acid sequences of S. mutans (strain UA159) as a query, a BLAST (Basic Local Alignment Search Tool) homologue search was performed among all known proteins (BLAST service is available at http: //blast.ncbi.nlm.nih). gov / Blast.cgi, and March 2013). It has been revealed that S. mutans (strain UA159) GtfB protein has a high degree of identity to S. mutans GtfC protein (strain UA159) as well as other Gtf (ie Gtfl) proteins in S. criceti, S. dentirousetti, S. dentisuis , S. dovvnei and S. sobrinus in bacteria responsible for the synthesis of water-insoluble glucans. Finally, the amino acid sequences constituting these proteins were selected and multivariate sequence comparisons were performed using the MAFFT web server at the Max-Planck Institute for Developmental Biology (http://toolkit.tuebingen.mpg.de/mafft, March 2013). .). Using this method, a conserved region was identified in the S. mutans (strain UA159) amino acid sequence of the GtfB protein which is 100% homologous to the corresponding regions in S. mutans (strain UA159) GtfC, S. criceti Gtfl, S. dentirousetti Gtfl, S. dentisuis Gtfl and S. orisuis in Gtf proteins. The corresponding coding segment for this region in the S. mutans (strain UA159) gtfB gene has the following 26 nucleotide (nt) sequence:

5'-GTTAAGATTAAGCAATGGTCTGCCAA-3' (SEQ ID nr. 16). Kaip ir palyginamosios aminorūgščių sekų analizės atveju, šis S. mutans (padermė UA159) gtfB geno segmentas taip pat turi 100% homologines sritis S. mutans (padermė UA159) gtfC, S. criceti gtfl, S. dentirousetti gtfl, S. dentisuis gtfl ir S. orisuis gtf genuose. Be to, taip pat buvo rasta labai didelio identiškumo sritis, turinti tik dviejų nukleotidų nesutapimą, S. dovvnei gtf pirmtako ir S. sobrinus gtfl genuose. Remiantis geriausiais Primer3 programos (Primer3 paslauga buvo pasinaudota http://frodo.wi.mit.edu/primer3/input.htm. siekiant išanalizuoti termodinamiką ir kitus ypatumus heteroduplekso formavimosi metu, atlikta 2013 m. kovo mėn.) rezultatais, buvo parinkta 19 nt seka, komplementari aukščiau tekste nurodytai koduojančiai sričiai:5'-GTTAAGATTAAGCAATGGTCTGCCAA-3 '(SEQ ID NO: 16). As with the comparative amino acid sequence analysis, this segment of the gtfB gene of S. mutans (strain UA159) also has 100% homologous regions in S. mutans (strain UA159) gtfC, S. criceti gtfl, S. dentirousetti gtfl, S. dentisuis gtfl and In the gtf genes of S. orisuis. In addition, a region of very high identity with only two nucleotide mismatches in the genes of S. dovvnei gtf precursor and S. sobrinus gtfl was also found. Based on the best results of the Primer3 program (Primer3 service was used at http://frodo.wi.mit.edu/primer3/input.htm. To analyze thermodynamics and other features during heteroduplex formation in March 2013), 19 nt sequence complementary to the coding region above:

5'-AGATTAAGCAATGGTCTGC-3' (koduojančios srities seka [SEQ ID nr.17]5'-AGATTAAGCAATGGTCTGC-3 '(coding region sequence [SEQ ID NO: 17]

11111111111111111111111111111111111111

3'-TCTAATTCGTTACCAGACG-5' (komplementari seka) [SEQ ID nr. 1]3'-TCTAATTCGTTACCAGACG-5 '(complementary sequence) [SEQ ID NO. 1]

Eksperimentiniame darbe, atliktame remiantis šiais bioinformaciniais rezultatais, buvo panaudotas žemiau nurodytos sekos oligonukleotidas:An oligonucleotide of the following sequence was used in the experimental work based on the following bioinformative results:

5'-GCAGACCATTGCTTAATCT-3’ [SEQ ID nr. 1]5'-GCAGACCATTGCTTAATCT-3 '[SEQ ID NO. 1]

Tikslios šio segmento vietos S. mutans (padermė UA159) ir S. sobrinus (padermė SL1) gtf genuose kartu su duomenimis, esančiais NCBI GenBank duomenų bazėje, yra pateikti originaliame formate žemiau:The exact locations of this segment in the gtf genes of S. mutans (strain UA159) and S. sobrinus (strain SL1), together with data from the NCBI GenBank database, are presented in their original format below:

1. S. mutans (padermė UA159) gtfB gene (čia nurodytam kaip gtfl)·.1. S. mutans (strain UA159) in the gtfB gene (referred to as gtfl) ·.

GenBank accession no. gb ĮAE014133.1ĮGenBank accession no. gb INAE014133.1A

Streptococcus mutans UA159, complete genome Length=2030921Streptococcus mutans UA159, complete genome Length = 2030921

Features in this part glucosyltransferase-I of subject seguence:Features of this part glucosyltransferase-I of subject mix:

Query 1 1]Query 1 1]

Sbjct 954167 1]Sbjct 954167 1]

GCAGACCATTGCTTAATCTGCAGACCATTGCTTAATCT

GCAGACCATTGCTTAATCT [SEQ ID nr.GCAGACCATTGCTTAATCT [SEQ ID NO:

954149 [SEQ ID nr.954149 [SEQ ID NO.

2. S. mutans (padermė UA159) gtfC gene (čia nurodytam kaip gtfSI): GenBank accession no. gb ĮAE014133.1Į2. S. mutans (strain UA159) in the gtfC gene (herein referred to as gtfSI): GenBank accession no. gb INAE014133.1A

Streptococcus mutans UA159, complete genomeStreptococcus mutans UA159, complete genome

Length=2030921Length = 2030921

Features in this part of subject sequence:Features in this part of subject sequence:

glucosyltransferase-SIglucosyltransferase-SI

GCAGACCATTGCTTAATCT 19 [SEQ IDGCAGACCATTGCTTAATCT 19 [SEQ ID

1] lllllllllllllllllll1] lllllllllllllllllll

GCAGACCATTGCTTAATCT 958853 [SEO ID nr.GCAGACCATTGCTTAATCT 958853 [SEO ID no.

Query 1 nr.Query 1 no.

Sbjct 958871 1]Sbjct 958871 1]

3. S. sobrinus (padermė SL1) gtfl gene:3. In the gtfl gene of S. sobrinus (strain SL1):

GenBank accession no. dbj ĮD63570.1ĮGenBank accession no. dbj TOD63570.1A

Streptococcus sobrinus gene for glucosyltransferase GTFI, complete cdsStreptococcus sobrinus gene for glucosyltransferase GTFI, complete cds

Length=6838Length = 6838

Query 1 GCAGACCATTGCTTAATCTQuery 1 GCAGACCATTGCTTAATCT

Sbjct 4079 GCAGACCATTGTTTAATCT [SEQ ID nr. 1]Sbjct 4079 GCAGACCATTGTTTAATCT [SEQ ID NO. 1]

III III III II III III IIII III III II III III I

4061 [SEQ ID nr. 15]4061 [SEQ ID NO. 15]

Vieno nukleotido neatitikimas SEQ ID nr. 1 yra pabrauktas.Single nucleotide mismatch of SEQ ID NO. 1 is underlined.

Remiantis aukščiau pateiktais duomenimis, buvo sumodeliuotas PO efektas S. sobrinus gliukoziltransferazės iRNR raiškai slopinti, nes priešprasminis efektas išlieka nepriklausomai nuo vieno nesutampančio nukleotido, kuris yra apytiksliai sekos viduryje. S. mutans gtfB iRNR antrinės struktūros modeliavimas buvo atliktas naudojantis Mfold programa, esančia Rensselaer bioinformatikos internetiniame serveryje (http://www.bioinfo.rpi.edu/applications/mfold, naudota 2013 m. kovo mėn.) tam, kad įvertinti pasirinktų PO prisijungimo vietą. Dėl to buvo sugeneruota vienas šimtas iRNR modelių, iš kurių atrinktas patikimiausias konstrukcinis variantas, rodantis PO prisijungimo sritį (Fig.1).Based on the above data, the effect of PO on the suppression of S. sobrinus glucosyltransferase iRNA expression was modeled, since the antisense effect remains independent of a single mismatched nucleotide approximately in the middle of the sequence. S. mutans gtfB iRNA secondary structure modeling was performed using the Mfold program on the Rensselaer Bioinformatics Web Server (http://www.bioinfo.rpi.edu/applications/mfold, used in March 2013) to evaluate selected POs. login location. As a result, one hundred iRNA models were generated from which the most robust construct showing the PO binding region was selected (Fig.1).

Siekiant nustatyti konservatyvias homologines sritis tik tarp susijusių su žmogaus kardiovaskuline patologija burnos streptokokų - S. mutans ir S. sobrinus gliukoziltransferazės genų ir parinkti joms komplementarias PO sekas, iš Europos nukleotidų archyvo (European Nucleotide Archive) (ENA) buvo atrinktos šių bakterijų įvairių klinikinių padermių ir klonų gtf genų sekos, koduojančios vandenyje netirpių gliukanų sintezę (atranka atlikta 2013 m. rugsėjo mėn.). Po to, pasirinkus S. mutans (padermė UA159) gtfB geną kaip etaloną, buvo atlikta daugybinė šių sekų palyginamoji analizė naudojant MAFFT programos internetinį serverį, esantį Max-Planck Institute for Development Biology (http://toolkit.tuebingen.mpg.de/mafft, atlikta 2013 m. rugsėjo mėn.). Taikant tokį metodą, S. mutans ir S. sobrinus gliukoziltransferazės genuose buvo identifikuota konservatyvi homologinė sritis, sudaryta iš 26 nt: 5'CGCGTCATGTTTGAAGGTTTCTCTAA-3' (SEQ ID nr. 18). Komplementari priešprasminė šiai sričiai seka (t.y. priešprasminis oligonukleotidas) turi tokį 26 nt eiliškumą: 5'-TTAGAGAAACCTTCAAACATGACGCG-3' (SEQ ID nr. 19). Tikslios šio segmento vietos S. mutans (padermė UA159) ir S. sobrinus (padermė SL1) gtf genuose kartu su duomenimis, esančiais NCBI GenBank duomenų bazėje, yra pateikti originaliame formate žemiau:Various clinical strains of these bacteria were selected from the European Nucleotide Archive (ENA) to identify conservative homologous domains between the glucosyltransferase genes of oral mutant streptococci, S. mutans and S. sobrinus, and to select for their complementary PO sequences. and clonal gtf gene sequences encoding the synthesis of water-insoluble glucans (screened September 2013). Multiple comparative analysis of these sequences was then performed using the S. mutans (strain UA159) gtfB gene as a reference using the MAFFT program web server at the Max-Planck Institute for Developmental Biology (http://toolkit.tuebingen.mpg.de/ mafft, performed September 2013). Using this method, a conserved homologous region consisting of 26 nt: 5'CGCGTCATGTTTGAAGGTTTCTCTAA-3 '(SEQ ID NO: 18) was identified in the glucosyltransferase genes of S. mutans and S. sobrinus. The complementary antisense sequence for this region (i.e., the antisense oligonucleotide) has the following 26 nt sequence: 5'-TTAGAGAAACCTTCAAACATGACGCG-3 '(SEQ ID NO: 19). The exact locations of this segment in the gtf genes of S. mutans (strain UA159) and S. sobrinus (strain SL1), together with data from the NCBI GenBank database, are presented in their original format below:

1. S. mutans (padermė UA159) gtfB gene (čia nurodytam kaip gtfiy.1. S. mutans (strain UA159) in the gtfB gene (herein referred to as gtfiy.

GenBank accession no. gb ĮAE014133.2 ĮGenBank accession no. gb INAE014133.2 To

Streptococcus mutans UA159, complete genome Length=2032925Streptococcus mutans UA159, complete genome Length = 2032925

Features in this part of subject sequence:Features in this part of subject sequence:

glucosyltransferase-Iglucosyltransferase-I

Query 1 TTAGAGAAACCTTCAAACATGACGCG 26 [SEQQuery 1 TTAGAGAAACCTTCAAACATGACGCG 26 [SEQ

ID nr. 19] llllllllllllllllllllllllllID # 19] llllllllllllllllllllllllll

Sbjct 953618 TTAGAGAAACCTTCAAACATGACGCG 953593 [SEQSbjct 953618 TTAGAGAAACCTTCAAACATGACGCG 953593 [SEQ

ID nr. 19]ID # 19]

2. S. mutans (padermė UA159) gtfC gene (čia nurodytam kaip gtfSI)·.2. S. mutans (strain UA159) in the gtfC gene (herein referred to as gtfSI) ·.

GenBank accession no. gb ĮAE014133.2 ĮGenBank accession no. gb INAE014133.2 To

Streptococcus mutans UA159, complete genome Length=2032925Streptococcus mutans UA159, complete genome Length = 2032925

Feature in this part of subject seąuence: glucosyltransferase-SIFeature in this part of subject seąuence: glucosyltransferase-SI

Query 1 TTAGAGAAACCTTCAAACATGACGCG 26 [SEQQuery 1 TTAGAGAAACCTTCAAACATGACGCG 26 [SEQ

ID nr. 19] llllllllllllllllllllllllllID # 19] llllllllllllllllllllllllll

Sbjct 958322 TTAGAGAAACCTTCAAACATGACGCG 958297 [SEQSbjct 958322 TTAGAGAAACCTTCAAACATGACGCG 958297 [SEQ

ID nr. 19]ID # 19]

3. S. sobrinus (padermė SL1) gtfl gene:3. In the gtfl gene of S. sobrinus (strain SL1):

GenBank accession no. dbj ĮD63570.1ĮGenBank accession no. dbj TOD63570.1A

Streptococcus sobrinus gene for glucosyltransferase GTFI, complete cdsStreptococcus sobrinus gene for glucosyltransferase GTFI, complete cds

Length=6838Length = 6838

Query 1 ID nr. 19]Query 1 ID # 19]

TTAGAGAAACCTTCAAACATGACGCG 26 [SEQTTAGAGAAACCTTCAAACATGACGCG 26 [SEQ

Sbjct 3530 ID nr. 19]Sbjct 3530 ID no. 19]

TTAGAGAAACCTTCAAACATGACGCG 3505 [SEQTTAGAGAAACCTTCAAACATGACGCG 3505 [SEQ

Panaudojant „AntiSense Design“ programą, esančią Integrated DNA Technologies internetiniame serveryje (http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx7source =menu. atlikta 2013 m. rugsėjo mėn.), aukščiau tekste minėtai sričiai (SEQ ID nr. 18) buvo optimizuotos papildomos komplementarios priešprasminės 19-21 nt ilgio sekos (t.y. priešprasminiai oligonukleotidai), kurios yra SEQ ID nr. 19 išvestinės: 5'-GAAACCTTCAAACATGACGC-3' (SEQ ID nr. 20) 5'-AAACCTTCAAACATGACGC-3' (SEQ ID nr. 21) 5-GAAACCTTCAAACATGACGCG-3' (SEQ ID nr. 22) 5'-GAAACCTTCAAACATGACG-3' (SEQ ID nr. 23) 5-AGAAACCTTCAAACATGACGC-3' (SEQ ID nr. 24) pavyzdys - Priešprasminių oligonukleotidų poveikis į bioplėvelės formavimąsi S. mutans kultūroseUsing the AntiSense Design program hosted on the Integrated DNA Technologies web server (http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx7source = menu. Performed September 2013), for the above area ( SEQ ID NO: 18) has been optimized for additional complementary antisense sequences of 19-21 nt (i.e., antisense oligonucleotides) as set forth in SEQ ID NO: 18). 19 Derivatives: 5'-GAAACCTTCAAACATGACGC-3 '(SEQ ID NO: 20) 5'-AAACCTTCAAACATGACGC-3' (SEQ ID NO: 21) 5-GAAACCTTCAAACATGACGCG-3 '(SEQ ID NO: 22) 5'-GAAACCTTCAAAC Example '(SEQ ID NO: 23) 5-AGAAACCTTCAAACATGACGC-3' (SEQ ID NO: 24) - Effect of antisense oligonucleotides on biofilm formation in S. mutans cultures

Laboratoriniai metodai ir rezultataiLaboratory methods and results

S. mutans padermė UA159 (Bratthall serotipas c), gauta iš Amerikietiško tipo kultūrų kolekcijos (ATKK nr. 700610), 24 vai. buvo kultivuota Todd Hewitt (TH) buljone (Difco) anaerobinėmis sąlygomis (95% N2 ir 5% CO2) esant 37 °C temperatūrai. Kultūros grynumas buvo patikrintas Mitis salivarius agare (Difco) ir Kolumbijos kraujo agare (E&O Laboratories). Po to, bakterinės kultūros optinis tankis (OT) buvo pakoreguotas iki 0,2 naudojant mikroplokštelių skaitymo spektrofotometrą (Dynex MRX) ir parinkus 630 nm bangos ilgį.S. mutans strain UA159 (Bratthall serotype c) from American Type Culture Collection (ATCC No. 700610), 24 hrs. was cultured in Todd Hewitt (TH) broth (Difco) under anaerobic conditions (95% N2 and 5% CO2) at 37 ° C. The purity of the culture was tested on Mitis salivarius agar (Difco) and Columbia blood agar (E&O Laboratories). Subsequently, the optical density (OT) of the bacterial culture was adjusted to 0.2 using a microplate reading spectrophotometer (Dynex MRX) and a wavelength of 630 nm was selected.

Prieš bakterijų išsėjimą, 24-ių šulinėlių plokščiadugnės polistireno ląstelių kultūrų plokštelės (Sarstedt) buvo užpildytos TH buljonu. Tada trys skirtingų sekų fosforotioato oligodeoksiribonukleotidai buvo pridėti j plokštelės šulinėlius (galutinė koncentracija - 10 μΜ) arba atskirai, arba kartu su transfekcijos reagentu TurboFect™:Prior to bacterial growth, 24-well flat bottom polystyrene cell culture plates (Sarstedt) were filled with TH broth. Then, three phosphorothioate oligodeoxyribonucleotides of different sequences were added to plate wells (final concentration 10 μΜ) either alone or with the TurboFect ™ transfection reagent:

1. PO1, turintis seką 5'-GCAGACCATTGCTTAATCT-3' (SEQ ID nr. 1), ir kuris naudojamas kaip bandomoji PO molekulė.A PO1 having the sequence 5'-GCAGACCATTGCTTAATCT-3 '(SEQ ID NO: 1), which is used as a pilot molecule of PO.

2. PO2, turintis seką: 5'-ACGCACTTTCTTGTCCAT-3' (SEQ ID nr. 2),ir kuris naudojamas kaip teigiamos kontrolės molekulė, nes yra žinomas ir įrodytas jo efektyvumas slopinant S. mutans gtfB geno raišką (žr. Guo ir kt. Treatment of2. PO2 having the sequence: 5'-ACGCACTTTCTTGTCCAT-3 '(SEQ ID NO: 2), which is used as a positive control molecule because of its known and proven efficacy in suppressing S. mutans gtfB gene expression (see Guo et al. . Treatment of

Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibitsStreptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibitor

GtfB expression and function. FEMS Microbial. Lett. 264 (2006), 8-14 p.).GtfB expression and function. FEMS Microbial. Lett. 264 (2006), pp. 8-14).

3. PO3, turintis seką 5'-ACTCGTATGCTACAGCTAT-3' (SEQ ID nr. 3), ir kuris naudojamas kaip neigiamos kontrolės molekulė, besiskirianti nuo bandomosios molekulės tuo, kad nukleotidų eiliškumas sekoje yra išmaišytas atsitiktine tvarka.3. PO3 having the sequence 5'-ACTCGTATGCTACAGCTAT-3 '(SEQ ID NO: 3) and used as a negative control molecule different from the test molecule in that the nucleotide sequence in the sequence is shuffled randomly.

Šie PO buvo sintezuoti Metabion International AG (Vokietija), kaip pilnos fosforotioato formos oligodeoksiribonukleotidai, panaudojant 1 pmol sintezės skalę ir didelio efektyvumo skysčių chromatografijos gryninimą. Prieš eksperimentus, liofilizuoti PO buvo ištirpinti steriliame distiliuotame nukleazių neturinčiame vandenyje (Thermo Fisher Scientific, Fermentas), siekiant gauti pradinius koncentruotus tirpalus, turinčius 100 μΜ koncentraciją. Pagal reikalingumą, PO buvo derinami kombinacijoje su TurboFect™ reagentu atsižvelgiant į gamintojo protokolą - tai yra naudojant 2 pi reagento 1 pg oligonukleotidų ruošinio.These POs were synthesized by Metabion International AG (Germany) as complete phosphorothioate form oligodeoxyribonucleotides using a 1 pmol synthesis scale and high performance liquid chromatography purification. Prior to the experiments, the lyophilized POs were dissolved in sterile distilled nuclease-free water (Thermo Fisher Scientific, Enzyme) to obtain stock solutions of 100 μΜ concentration. As required, POs were combined in combination with TurboFect ™ reagent according to the manufacturer's protocol - that is, using 2 µg of reagent 1 pg oligonucleotide template.

Pridėjus j plokšteles PO, S. mutans kultūros bakterijos buvo išsėtos j šulinėlius taip, kad gauti galutinį praskiedimą 1:100. Nedelsiant, sterilios 1 mm storio stiklo plokštelės, išpjautos iš standartinių mikroskopo objektinių stikliukų (76 * 26 mm; Thermo Fisher Scientific), buvo vertikaliai įdėtos j šulinėlius, o plokštelės inkubuotos anaerobinėmis sąlygomis papildomoms 2 vai. 37 °C temperatūroje. Paskui, sterilus sacharozės tirpalas buvo pridėtas j atitinkamus šulinėlius iki 1% galutinės koncentracijos, o plokštelės vėl inkubuotos anaerobinėmis sąlygomis (95% N2 ir 5% CO2) 37 °C temperatūroje dar papildomoms 22 vai. Šiame eksperimente skystos terpės (TH buljono) tūris vienam šulinėliui buvo 1 mL; šulinėliai tik su terpe (buljonu) be bakterijų buvo naudoti kaip „tuščia“ kontrolė; o nepaveiktos S. mutans bakterijos ir S. mutans bakterijos, paveiktos vien tik nukleazių neturinčiu vandeniu arba TurboFect™ reagentu, naudotos kaip eksperimentinės kontrolės.After addition of PO to the plates, S. mutans culture bacteria were plated in wells to obtain a final dilution of 1: 100. Immediately, sterile 1 mm thick glass slides cut from standard microscope slides (76 * 26 mm; Thermo Fisher Scientific) were placed vertically in the wells and incubated under anaerobic conditions for an additional 2 hours. At 37 ° C. The sterile sucrose solution was then added to the appropriate wells to a final concentration of 1%, and the plates were again incubated under anaerobic conditions (95% N2 and 5% CO2) at 37 ° C for an additional 22 hours. In this experiment, the volume of liquid medium (TH broth) per well was 1 mL; wells containing only medium (broth) without bacteria were used as a "blank" control; o untreated S. mutans bacteria and S. mutans bacteria treated with nuclease-free water alone or TurboFect ™ reagent were used as experimental controls.

Praėjus 24 vai. bendram inkubacijos laikotarpiui, stiklo plokštelės buvo ištrauktos iš šulinėlių, išdžiovintos ir toliau panaudotos S. mutans bioplėvelės analizei MicroXAM™ (ADE Phase Shift) optiniu profilometru. Tuo tikslu buvo atlikti penki matavimai (kiekvieno matavimo plotas - 200 χ 260 pm) per stiklo plokštelės vidurį nuo matomos bioplėvelės apačios iki viršaus panaudojant 50Χ objektyvą su priartinimo faktoriumi - 0,625. Papildomai, Gauso filtras (50 χ 50 pm) buvo parinktas ir pritaikytas tam, kad pašalinti paviršiaus formos klaidas ir banguotumą. Šioje analizėje buvo įvertintas keletas svarbių bioplėvelės paviršiaus šiurkštumo parametrų: St maksimalus skirtumas tarp paviršiaus viršutinių ir apatinių taškų (t.y. paviršiaus „viršūnių“ ir „slėnių“), Sa - vidurkio skirtumas tarp paviršiaus viršutinių ir apatinių taškų (t.y. paviršiaus „viršūnių“ ir „slėnių“), Sdr - bendras paviršiaus plotas (jeigu visi paviršiaus nelygumai būtų išlyginti) remiantis VVennenberg ir Albrektsson straipsniu Suggested guidelines for the topographic evaluation of implant surfaces (Int. J. Orai Maxillofac. Implants. 15 (2000), 331-344 p.). Šie paviršiaus parametrai atspindi bioplėvelės išsivystymo laipsnį arba „brandą“ - tai yra prisitvirtinusių bakterijų ir susiformavusių mikrokolonijų kiekį. Nustatytų paviršiaus parametrų statistinis reikšmingumas buvo įvertintas pritaikant One-Way ANOVA metodą su Tukey’s testu. Mažesnė už 0,05 p reikšmė buvo laikyta statistiškai reikšminga.24 hours later. for a total incubation period, glass slides were removed from the wells, dried and further used for analysis of S. mutans biofilm by MicroXAM ™ (ADE Phase Shift) optical profilometer. For this purpose, five measurements (200 200 260 µm each) were made through the center of the glass plate from the bottom to the top of the visible biofilm using a 50Χ objective lens with a magnification of 0.625. Additionally, a Gaussian filter (50 χ 50 pm) was selected and applied to eliminate surface shape errors and waviness. In this analysis, several important parameters of the surface roughness of the biofilm were evaluated: St the maximum difference between the upper and lower points of the surface (ie, the "vertices" and "valleys"), S a - the average difference between the upper and lower points of the surface. "Valleys"), Sdr is the total surface area (if all surface irregularities are smoothed) according to Wennenberg and Albrektsson in "Suggested guidelines for the topographic evaluation of implant surfaces" (Int. J. Or. Maxillofac. Implants. 15 (2000), 331-344 p.). These surface parameters reflect the degree of maturity or "maturity" of the biofilm, which is the amount of bacterial attachment and the formation of micro-colonies. Statistical significance of the identified surface parameters was evaluated by applying the One-Way ANOVA method with Tukey's test. A p value of less than 0.05 was considered statistically significant.

Taikant optinės profilometrijos metodą stiklo plokštelių su S. mutans bioplėvele paviršiaus analizei buvo atskleista, kad 1% sacharozės TH buljone žymiai padidina paviršiaus šiurkštumo parametrus - Sa ir St palyginus su švarios stiklo plokštelės paviršiumi, panaudotos šiame eksperimente kaip etaloninė kontrolė (p < 0,05) (1 lentelė). Šiuo atveju, tai rodo, kad 1% sacharozės terpėje stimuliavo bakterijų prisitvirtinimą (adheziją) prie stiklo plokštelės paviršiaus ir bioplėvelės formavimąsi (1 lentelė). Tačiau bandomoji PO1 molekulė (SEQ ID nr. 1) kombinacijoje su TurboFect™ reagentu ženkliai sumažino bioplėvelės formavimąsi ant stiklo plokštelės paviršiaus nepaisant buljone esančios 1% sacharozės (p = 0,06 [Sa parametras]). Svarbiausia, kad šis efektas buvo statistiškai reikšmingas palyginus su bakterijomis, paveiktomis PO2 (SEQ ID nr. 2) ir PO3 (SEQ ID nr. 3) kombinacijoje su TurboFect™ reagentu (p < 0,05 [Sa ir Sdr parametrai]), kaip tai matoma 1 lentelėje bei fig. 2a, 2b ir 2c. Remiantis šiais rezultatais galima daryti išvadą, kad bandomoji PO1 molekulė (SEQ ID nr. 1) efektyviai sumažina S. mutans adheziją ir bioplėvelės formavimąsi ant standaus paviršiaus (stiklo plokštelės) in vitro sąlygomis.Optical profilometry for S. mutans biofilm surface analysis revealed that 1% sucrose in TH broth significantly increased the surface roughness parameters Sa and St compared to the clean glass surface used in this experiment as a reference control (p <0.05). ) (Table 1). In this case, it indicates that 1% sucrose in the medium stimulated bacterial attachment (adhesion) to the glass plate surface and biofilm formation (Table 1). However, the PO1 test molecule (SEQ ID NO: 1), in combination with TurboFect ™ reagent, significantly reduced biofilm formation on the glass plate surface despite 1% sucrose in the broth (p = 0.06 [Sa parameter]). Most importantly, this effect was statistically significant compared to bacteria exposed to PO2 (SEQ ID NO: 2) and PO3 (SEQ ID NO: 3) in combination with TurboFect ™ reagent (p <0.05 [Sa and Sdr parameters]) as this is shown in Table 1 and FIG. 2a, 2b and 2c. Based on these results, it can be concluded that the test PO1 molecule (SEQ ID NO: 1) is effective in reducing adhesion of S. mutans and biofilm formation on a rigid surface (glass plate) in vitro.

lentelė - Stiklo plokštelių su S. mutans bioplėvele paviršiaus parametraiTable 5 - Surface parameters of glass plates with S. mutans biofilm

Poveikiai Impact Sa pm You pm St pm St pm Sdr % Sdr% Nuoroda j Fig. 2 Reference j FIG. 2 Švari stiklo plokštelė (etaloninė kontrolė) Clean glass plate (reference control) 0,01 (0,00) 0.01 (0.00) 0,92 (0,53) 0.92 (0.53) 0,05 (0,02) 0.05 (0.02) Nepaveiktos bakterijos be sacharozės Sucrose-free bacteria 0,13 (0,03) 0.13 (0.03) 2,34 (1,12) 2.34 (1,12) 1,91 (1,38) 1.91 (1.38)

Nepaveiktos bakterijos + sacharozė Unaffected bacteria + sucrose 0,13 (0,04) 0.13 (0.04) 8,44 (4.03) 8.44 (4.03) 1,57 (0,95) 1.57 (0.95) Nepaveiktos bakterijos + sacharozė + nukleazių neturintis vanduo + TurboFect™ Unaffected bacteria + sucrose + nucleases water free + TurboFect ™ 0,05 (0,03) 0.05 (0.03) 3,80 (2,25) 3.80 (2.25) 0,57 (0,40) 0.57 (0.40) Bakterijos + sacharozė + PO1 Bacteria + sucrose + PO1 0,27 (0.01) 0.27 (0.01) 7,27 (1,91) 7.27 (1.91) 10,09 (0,90) 10.09 (0.90) Bakterijos + sacharozė + PO2 Bacteria + sucrose + PO2 0,45 (0,04) 0.45 (0.04) 13,03 (1,93) 13.03 (1.93) 18,60 (2,24) 18.60 (2.24) Bakterijos + sacharozė + PO3 Bacteria + sucrose + PO3 0,14 (0,05) 0.14 (0.05) 5,74 (2,62) 5.74 (2.62) 1,11 (0,71) 1.11 (0.71) Bakterijos + sacharozė + PO1 + TurboFect™ Bacteria + Sucrose + PO1 + TurboFect ™ 0,07 (0,04) 0.07 (0.04) 6,94 (5,81) 6.94 (5.81) 0,99(1,37) 0.99 (1.37) Fig. 2a FIG. 2a Bakterijos + sacharozė + PO2 + TurboFect™ Bacteria + Sucrose + PO2 + TurboFect ™ 0,31 (0,02) 0.31 (0.02) 7,99 (1,67) 7.99 (1.67) 10,08 (1,13) 10.08 (1.13) Fig. 2b FIG. 2b Bakterijos + sacharozė + PO3 + TurboFect™ Bacteria + Sucrose + PO3 + TurboFect ™ 0,31 (0,02) 0.31 (0.02) 7,18 (0,64) 7.18 (0.64) 9,19(0,82) 9.19 (0.82) Fig. 2c FIG. 2c

lentelė rodo stiklo plokštelių su S. mutans bioplėvele paviršiaus parametrus po 24 vai. inkubacijos esant skirtingiems poveikiams. Duomenys yra pateikti kaip 5 matavimų vidurkiai, o standartinės paklaidos yra pateiktos skliausteliuose.The table shows the surface parameters of glass plates with S. mutans biofilm after 24 h. incubations under different effects. Data are presented as means of 5 measurements and standard errors are given in parentheses.

pavyzdys - Priešprasminių oligonukleotidų poveikis j bakterijų agregaciją S. mutans kultūroseExample 1 - Effect of antisense oligonucleotides on bacterial aggregation in S. mutans cultures

Laboratoriniai metodai ir rezultataiLaboratory methods and results

Eksperimento planas ir sąlygos buvo tokios pačios kaip aprašyta 2 pavyzdyje išskyrus tai, kad j užsėtas 24-ių šulinėlių plokšteles nebuvo įdėtos stiklo plokštelės. Pridėjus sacharozės, bakterijų agregacija buvo tikrinama spektrofotometriškai 3 vai. intervalais iki 14 vai., o po to - 24 vai. Tuo tikslu, paimtų bandinių optinis tankis (OT) buvo matuojamas naudojant mikroplokštelių skaitymo spektrofotometrą (Dynex MRX) ir parinkus 630 nm bangos ilgį. Be to, eksperimento pabaigoje (po 24 vai. bendro inkubacijos laikotarpio), iš plokštelės šulinėlių buvo paimti papildomi bandiniai tam, kad įvertinti S. mutans bakterijų morfologiją bei jų agregaciją pritaikant Gramo dažymo metodą ir šviesinę mikroskopiją su Leica DM500 mikroskopu.The experimental design and conditions were the same as described in Example 2 except that no 24-well glass plates were inoculated. After sucrose addition, bacterial aggregation was checked spectrophotometrically for 3 h. at intervals of up to 14 hours, followed by 24 hours. For this purpose, the optical density (OD) of the samples taken was measured using a microplate reading spectrophotometer (Dynex MRX) and a wavelength of 630 nm. In addition, at the end of the experiment (after a total incubation period of 24 hours), additional samples were taken from the wells of the plate to assess the morphology of S. mutans bacteria and their aggregation using a Gram staining method and light microscopy with a Leica DM500 microscope.

Spektrofotometrinis bakterijų kultūrų, augančių plokštelės šulinėliuose, tikrinimas atskleidė, kad sacharozės pridėjimas ženkliai padidino OT 14 vai. ir 24 vai. palyginus su bakterijomis, augusiomis be sacharozės (fig. 3a ir 3b). Tai rodo, kad 1% sacharozės terpėje sukėlė bakterijų agregatų susidarymą dėl gliukano sintezės. Nei nukleazių neturintis vanduo, nei TurboFect™ reagentas neturėjo jokio ženklaus poveikio j šj procesą (fig. 3b). Tačiau poveikiai j bakterijas su bandomąja PO1 molekule (SEQ ID nr. 1) tiek atskirai, tiek ir kombinacijoje su TurboFect™ reagentu apytiksliai 1,5 karto sumažino OT lyginant su nepaveiktomis bakterijomis 24 vai., o tai žymi mažesnį bakterijų agregatų susiformavimą (fig. 3c ir 3d). Šis bandomosios PO1 molekulės (SEQ ID nr. 1) efektas toliau buvo patvirtintas dažant 24 vai. paimtus mėginius Gramo būdu. Kaip matoma fig.4b ir 4c, bandomoji PO1 molekulė (SEQ ID nr. 1) užslopino bakterijų agregatų susidarymą, o taip pat sumažino bakterijų grandinėlių ilgėjimą (buvo stebima daugiau paskirų bakterinių ląstelių) palyginus su nepaveiktomis bakterijomis. Priešingai, nei PO2 (SEQ ID nr. 2), nei PO3 (SEQ ID nr. 3) molekulės neturėjo tokio poveikio bakterijoms, augančioms TH buljone su 1% sacharozės (fig. 3c ir 3d, fig. 4d ir 4e). Todėl, sutinkant su šiais rezultatais, galima daryti išvadą, kad bandomoji PO1 molekulė (SEQ ID nr. 1) sumažina S. mutans bakterijų agregaciją, esant terpėje 1% sacharozės, ir netgi sumažina bakterijų grandinėlių ilgėjimą, o tai rodo užslopintą gliukanų gamybą.Spectrophotometric examination of bacterial cultures growing in plate wells revealed that addition of sucrose significantly increased OT for 14 h. is 24 or. compared to bacteria grown without sucrose (Figs. 3a and 3b). This indicates that 1% in sucrose medium caused the formation of bacterial aggregates due to glucan synthesis. Neither nuclease-free water nor TurboFect ™ reagent had any significant effect on this process (Fig. 3b). However, exposure to bacteria with the test PO1 molecule (SEQ ID NO: 1), alone or in combination with TurboFect ™ reagent, resulted in an approximately 1.5-fold reduction in OT compared to untreated bacteria for 24 hours, indicating reduced bacterial aggregate formation (FIG. 3c and 3d). This effect of the PO1 test molecule (SEQ ID NO: 1) was further confirmed by staining for 24 h. samples taken by the Gram method. As shown in Figures 4b and 4c, the test PO1 molecule (SEQ ID NO: 1) inhibited the formation of bacterial aggregates, as well as reduced the length of bacterial chains (more individual bacterial cells were observed) compared to unaffected bacteria. In contrast, neither PO2 (SEQ ID NO: 2) nor PO3 (SEQ ID NO: 3) molecules had this effect on bacteria growing in TH broth with 1% sucrose (Figs. 3c and 3d, Figs. 4d and 4e). Therefore, in agreement with these results, it can be concluded that the test PO1 molecule (SEQ ID NO: 1) reduces S. mutans bacterial aggregation in the presence of 1% sucrose in the medium and even reduces bacterial chain elongation, indicating inhibition of glucan production.

pavyzdys - Priešprasminių oligonukleotidų poveikis j S. mutans bakterijų gyvybingumąExample 1 - Effect of antisense oligonucleotides on the viability of S. mutans bacteria

Laboratoriniai metodai ir rezultataiLaboratory methods and results

Eksperimento planas ir sąlygos buvo tokios pačios kaip aprašyta 2 pavyzdyje išskyrus tai, kad j užsėtas 24-ių šulinėlių plokšteles nebuvo įdėtos stiklo plokštelės bei į TH buljoną nebuvo pridėta sacharozės. Praėjus pirminiam 2 vai. inkubacijos laikotarpiui, toliau bakterijų augimas buvo tikrinamas spektrofotometriškai 3 vai. intervalais iki 14 vai., o po to - 24 vai. Tuo tikslu, paimtų bandinių optinis tankis (OT) buvo matuojamas naudojant mikroplokštelių skaitymo spektrofotometrą (Dynex MRX) ir parinkus 630 nm bangos ilgį.The experimental design and conditions were the same as described in Example 2 except that 24-well plates were inoculated with glass plates and no sucrose was added to the TH broth. After the initial 2 hours. for the incubation period, bacterial growth was further monitored spectrophotometrically for 3 h. at intervals of up to 14 hours, followed by 24 hours. For this purpose, the optical density (OD) of the samples taken was measured using a microplate reading spectrophotometer (Dynex MRX) and a wavelength of 630 nm.

Spektrofotometrinis bakterijų kultūrų, augančių plokštelės šulinėliuose, tikrinimas atskleidė, kad nukleazių neturintis vanduo ir TurboFect™ reagentas nepaveikė normalaus bakterijų augimo proceso per visą 24 vai. inkubacijos laikotarpį (5A pav.). Poveikiai į bakterijas su PO1 (SEQ ID nr. 1), PO2 (SEQ ID nr. 2) ir PO3 (SEQ ID nr. 3) molekulėmis tiek atskirai, tiek ir kombinacijoje su TurboFect™ reagentu tik labai nežymiai sumažino bakterijų augimo kreives (OT) lyginant su nepaveiktomis bakterijomis (fig. 5b ir 5c). Remiantis šiais duomenimis, galima daryti išvadą, kad nei vienas iš panaudotų PO ženkliai neslopina S. mutans augimo - tai yra nemažina bakterijų gyvybingumo.Spectrophotometric examination of bacterial cultures growing in plate wells revealed that the nuclease-free water and TurboFect ™ reagent did not affect the normal bacterial growth process throughout the 24 hours. incubation period (Fig. 5A). Effects on bacteria with PO1 (SEQ ID NO: 1), PO2 (SEQ ID NO: 2), and PO3 (SEQ ID NO: 3) molecules, both alone and in combination with TurboFect ™, only slightly reduced bacterial growth curves (OT) ) as compared to unaffected bacteria (Figs. 5b and 5c). Based on these data, it can be concluded that none of the POs used significantly inhibits the growth of S. mutans, which does not impair bacterial viability.

pavyzdys - Priešprasminių oligonukleotidų poveikis j bioplėvelės formavimąsi maišytuose S. mutans ir S. sobrinus kultūrose su kraujo serumuExample 1 - Effect of antisense oligonucleotides on biofilm formation in mixed serum cultures of S. mutans and S. sobrinus

Laboratoriniai metodai ir rezultataiLaboratory methods and results

Siekiant įvertinti bandomosios PO1 molekulės (SEQ ID nr. 1) poveikį j bakterinės bioplėvelės formavimąsi in vitro terpėje, turinčioje pagrindinio kraujo sudėtinio komponento - serumo, buvo panaudotos maišytos S. mutans ir S. sobrinus kultūros. S. mutans padermė UA159 (Bratthall serotipas c) ir S. sobrinus padermė SL1, kurios gautos iš Amerikietiško tipo kultūrų kolekcijos (ATKK nr. 700610 ir ATKK nr. 33478 atitinkamai), 18 vai. buvo kultivuotos Todd Hevvitt (TH) buljone (Difco), turinčiame 10 % karščiu inaktyvuoto arklio serumo, anaerobinėmis sąlygomis (95% N2 ir 5% CO2) esant 37 °C temperatūrai. Kultūrų grynumas buvo patikrintas Mitis salivarius agare (Difco) ir Kolumbijos kraujo agare (E&O Laboratories). Po to, bakterinių kultūrų optinis tankis (OT) buvo pakoreguotas iki 0,2 naudojant mikroplokštelių skaitymo spektrofotometrą (Dynex MRX) ir parinkus 630 nm bangos ilgį.Mixed cultures of S. mutans and S. sobrinus were used to evaluate the effect of the PO1 test molecule (SEQ ID NO: 1) on bacterial biofilm formation in in vitro medium containing the main blood component, serum. S. mutans strain UA159 (Bratthall serotype c) and S. sobrinus strain SL1, obtained from the American Type Culture Collection (ATCC # 700610 and ATCC # 33478, respectively), 18 hrs. were cultured in Todd Hevvitt (TH) broth (Difco) containing 10% heat-inactivated horse serum under anaerobic conditions (95% N2 and 5% CO2) at 37 ° C. The purity of the cultures was tested on Mitis salivarius agar (Difco) and Columbia blood agar (E&O Laboratories). The optical density (OT) of the bacterial cultures was then adjusted to 0.2 using a microplate reading spectrophotometer (Dynex MRX) and a wavelength of 630 nm.

Prieš bakterijų išsėjimą, 24-ių šulinėlių plokščiadugnės polistireno ląstelių kultūrų plokštelės (Sarstedt) buvo užpildytos TH buljonu su 10 % karščiu inaktyvuoto arklio serumu. Tada PO1 (SEQ ID nr. 1) ir PO3 (SEQ ID nr. 3) fosforotioato oligodeoksiribonukleotidai, sintezuoti Metabion International AG kompanijoje (Vokietija) panaudojant 1 pmol sintezės skalę ir didelio efektyvumo skysčių chromatografijos gryninimą, buvo pridėti j plokštelės šulinėlius (galutinė koncentracija - 10 μΜ) kombinacijoje su transfekcijos reagentu - TurboFect™.Prior to bacterial growth, 24-well flat bottom polystyrene cell culture plates (Sarstedt) were filled with TH broth with 10% heat-inactivated horse serum. Then, the phosphorothioate oligodeoxyribonucleotides PO1 (SEQ ID NO: 1) and PO3 (SEQ ID NO: 3) synthesized using a 1 pmol synthesis scale and high performance liquid chromatography purification were added to plate wells (final concentration - 10 μΜ) in combination with a transfection reagent, TurboFect ™.

Pridėjus į plokšteles PO, S. mutans bei S. sobrinus kultūrų bakterijos buvo sumaišytos lygiomis dalimis ir išsėtos į šulinėlius taip, kad gauti galutinį praskiedimą 1:100. Nedelsiant, sterilios 1 mm storio stiklo plokštelės, išpjautos iš standartinių mikroskopo objektinių stikliukų (76 χ 26 mm; Thermo Fisher Scientific), buvo vertikaliai įdėtos į šulinėlius, o plokštelės inkubuotos anaerobinėmis sąlygomis papildomoms 4 vai. 37 °C temperatūroje. Paskui, sterilus sacharozės tirpalas buvo pridėtas į atitinkamus šulinėlius iki 1 % galutinės koncentracijos, o plokštelės vėl inkubuotos anaerobinėmis sąlygomis (95 % N2 ir 5 % CO2) 37 °C temperatūroje dar papildomoms 20 vai. Šiame eksperimente skystos terpės (TH buljono) tūris vienam šulinėliui buvo 1 mL; šulinėliai tik su terpe (buljonu) be bakterijų buvo naudoti kaip „tuščia“ kontrolė, o nepaveiktos maišytos S. mutans ir S. sobrinus bakterijos naudotos kaip eksperimentinė kontrolė.After addition of PO, S. bacteria, S. mutans and S. sobrinus cultures were mixed in equal volumes and plated to a final dilution of 1: 100. Immediately, sterile 1-mm-thick glass slides from standard microscope slides (76 χ 26 mm; Thermo Fisher Scientific) were placed vertically in the wells and incubated under anaerobic conditions for an additional 4 hours. At 37 ° C. The sterile sucrose solution was then added to the appropriate wells to a final concentration of 1%, and the plates were again incubated under anaerobic conditions (95% N2 and 5% CO2) at 37 ° C for an additional 20 hours. In this experiment, the volume of liquid medium (TH broth) per well was 1 mL; wells with bacterial-only medium (broth) were used as the "blank" control and untreated mixed S. mutans and S. sobrinus bacteria were used as the experimental control.

Praėjus 24 vai. bendram inkubacijos laikotarpiui, stiklo plokštelės buvo ištrauktos iš šulinėlių, išdžiovintos ir toliau panaudotos maišytos S. mutans ir S. sobrinus bioplėvelės analizei Sensofar PLu 2300 optiniu konfokaliniu profilometru. Tuo tikslu buvo atlikti šeši matavimai bioplėvelės šiurkštumui įvertinti ir penki matavimai bioplėvelės storiui įvertinti (kiekvieno matavimo plotas - 180 χ 240 pm) per stiklo plokštelės vidurį nuo matomos bioplėvelės apačios iki viršaus panaudojant 50Χ konfokalinį objektyvą. Nuskanuotų ir pamatuotų bandinių duomenys toliau buvo apdoroti Gvvyddion programa (2.27 versija, prieinama internete adresu http://gwyddion.net) tuo tikslu, kad kiekybiškai įvertinti bioplėvelės paviršiaus šiurkštumo ir jos storio parametrus, atspindinčius bioplėvelės susiformavimo laipsnį arba „brandą“. Papildomai, Medianinis filtras (dydis - 10 pikselių arba 3 pm) buvo parinktas ir pritaikytas tam, kad pašalinti paviršiaus formos klaidas ir banguotumą. Kiekybiškai vertinant bioplėvelės paviršiaus šiurkštumą buvo apskaičiuojamas vienas iš svarbiausių paviršiaus parametrų - Rq (išmatuoto aukščio nuokrypių vidurkis). Nustatytų paviršiaus parametrų statistinis reikšmingumas buvo įvertintas pritaikant SPSS statistinės programos (20.0 versija) One-Way ANOVA metodą su LSD Post Hoc testu. Mažesnė už 0,05 p reikšmė buvo laikyta statistiškai reikšminga.24 hours later. for a total incubation period, glass slides were removed from the wells, dried and further used for analysis of mixed S. mutans and S. sobrinus biofilms on a Sensofar PLu 2300 optical confocal profilometer. For this purpose, six measurements of biofilm roughness and five measurements of biofilm thickness (measuring 180 χ 240 µm each) were made through the middle of the glass slide from the bottom to the top of the visible biofilm using a 50Χ confocal lens. The scanned and measured specimens were further processed by the Gvvyddion software (version 2.27, available online at http://gwyddion.net) to quantify the surface roughness and thickness parameters of the biofilm, reflecting the degree or "maturity" of the biofilm. Additionally, a Median filter (size 10 pixels or 3 pm) was selected and applied to eliminate surface shape errors and waviness. One of the most important surface parameters - Rq (mean height deviation) - was calculated by quantifying the surface roughness of the biofilm. Statistical significance of the identified surface parameters was assessed by applying the One-Way ANOVA method of the SPSS statistical program (version 20.0) with the LSD Post Hoc test. A p-value of less than 0.05 was considered statistically significant.

Taikant optinės konfokalinės profilometrijos metodą stiklo plokštelių su maišytų S. mutans ir S. sobrinus bioplėvelių paviršiaus analizei buvo atskleista, kad 1% sacharozės ir 10% kraujo serumo TH buljone žymiai padidina bioplėvelės paviršiaus šiurkštumo parametrą - Rq bei bioplėvelės storį palyginus su nepaveiktomis bakterijomis, augusiomis su 10% serumu, bet be sacharozės (fig. 8a ir fig. 9a ir 9b). Šiuo atveju, tai rodo, kad 1% sacharozės terpėje stimuliavo bakterijų prisitvirtinimą (adheziją) prie stiklo plokštelės paviršiaus ir bioplėvelės formavimąsi. Tačiau bandomoji PO1 molekulė (SEQ ID nr. 1) kombinacijoje su TurboFect™ reagentu 25% sumažino maišytų S. mutans ir S. sobrinus kultūrų bioplėvelės šiurkštumą (Rq) TH buljone, turinčiame 1% sacharozės ir 10% kraujo serumo, lyginant su bakterijomis, paveiktomis PO3 (SEQ ID nr. 3) kombinacijoje su TurboFect™ reagentu (p < 0,05) (fig. 8b ir 8c ir fig.9a). Be to, bandomoji PO1 molekulė (SEQ ID nr. 1) kombinacijoje su TurboFect™ reagentu 44% sumažino maišytų S. mutans ir S. sobrinus kultūrų bioplėvelės storį TH buljone, turinčiame 1% sacharozės ir 10% kraujo serumo, palyginus su nepaveiktomis bakterijomis bei bakterijomis, paveiktomis PO3 (SEQ ID nr. 3) kombinacijoje su TurboFect™ reagentu (p < 0,05) (fig. 8 ir fig. 9b). Remiantis šiais rezultatais galima daryti išvadą, kad bandomoji PO1 molekulė (SEQ ID nr. 1) efektyviai sumažina S. mutans bei S. sobrinus adheziją ir bioplėvelės formavimąsi ant standaus paviršiaus (stiklo plokštelės) terpėje, turinčioje pagrindinio kraujo sudėtinio komponento - serumo, in vitro sąlygomis.Optical confocal profilometry for surface analysis of glass slides with mixed S. mutans and S. sobrinus biofilms revealed that 1% sucrose and 10% serum TH in broth significantly increased the biofilm surface roughness parameter, Rq, and biofilm thickness compared to untreated bacteria grown with 10% serum but without sucrose (Figures 8a and 9a and 9b). In this case, it indicates that 1% sucrose in the medium stimulated bacterial attachment (adhesion) to the surface of the glass plate and biofilm formation. However, the PO1 test molecule (SEQ ID NO: 1), in combination with TurboFect ™ reagent, reduced the biofilm roughness (Rq) of mixed S. mutans and S. sobrinus cultures in TH broth containing 1% sucrose and 10% blood serum compared to bacteria, treated with PO3 (SEQ ID NO: 3) in combination with TurboFect ™ reagent (p <0.05) (Figs. 8b and 8c and 9a). In addition, the PO1 test molecule (SEQ ID NO: 1) in combination with TurboFect ™ reagent reduced the biofilm thickness of mixed S. mutans and S. sobrinus cultures in TH broth containing 1% sucrose and 10% serum compared to untreated bacteria and bacteria exposed to PO3 (SEQ ID NO: 3) in combination with TurboFect ™ reagent (p <0.05) (Figure 8 and Figure 9b). Based on these results, it can be concluded that the test PO1 molecule (SEQ ID NO: 1) is effective in reducing adhesion and biofilm formation of S. mutans and S. sobrinus on a rigid surface (glass plate) in a medium containing a major blood component, serum, in vitro. conditions.

priedas. PO sekų sąrašas ir aprašymas Seka Nr. 1 (SEQ ID nr. 1): 5'-GCAGACCATTGCTTAATCT-3'Annex. List and Description of PO Sequences Sequence no. 1 (SEQ ID NO: 1): 5'-GCAGACCATTGCTTAATCT-3 '

Ilgis: 19 nukleotidų (nt)Length: 19 nucleotides (nt)

Cheminė struktūra: deoksiribonukleorūgštis (DNR)Chemical structure: deoxyribonucleic acid (DNA)

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr. 13 išvestinė, pagal komplementarumo principą jungiasi su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą. Esamuose eksperimentuose tai yra testuojama seka.Function: This sequence is SEQ ID NO. 13 derived by binding to the corresponding region of S. mutans gtfB and gtfC iRNA and S. sobrinus gtfl iRNA, resulting in an antisense effect. In existing experiments, this is a test sequence.

Seka Nr. 2 (SEQ ID nr. 2):Track # 2 (SEQ ID NO: 2):

5'-ACGCACTTTCTTGTCCAT-3'5'-ACGCACTTTCTTGTCCAT-3 '

Ilgis: 18 ntLength: 18 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka jungiasi pagal komplementarumo principą su sritimi, esančia S. mutans gtfB iRNR transliacijos pradžios srityje, sukeldama priešprasminj efektą, remiantis Guo ir kt. Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibits GtfB expression and function. FEMS Microbiol. Lett. 264 (2006), p. 8-14. Esamuose eksperimentuose ji naudojama kaip teigiama kontrolė.Function: This sequence binds by complementarity to the region within the S. mutans gtfB iRNA translation initiation region, resulting in an antisense effect according to Guo et al. Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibition of GtfB expression and function. FEMS Microbiol. Lett. 264 (2006), p. 8-14. It is used as a positive control in existing experiments.

Seka Nr. 3 (SEQ ID nr. 3):Track # 3 (SEQ ID NO: 3):

5'-ACTCGTATGCTACAGCTAT-3'5'-ACTCGTATGCTACAGCTAT-3 '

Ilgis: 19 ntLength: 19 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr.1 analogas su tokia pačia molekuline mase ir nukleotidų kiekiu, tačiau turinti išmaišytą atsitiktine tvarka nukleotidų eiliškumą. Dėl pastarosios priežasties ji nesukelia priešprasminio efekto ir todėl esamuose eksperimentuose naudojama kaip neigiama kontrolė.Function: This sequence is an analog of SEQ ID NO: 1 with the same molecular weight and nucleotide content but with a randomized nucleotide sequence. For the latter reason, it does not produce an antisense effect and is therefore used as a negative control in current experiments.

Seka Nr. 4 (SEQ ID nr. 4):Track # 4 (SEQ ID NO: 4):

5-CAGACCATTGCTTAATCT-3'5-CAGACCATTGCTTAATCT-3 '

Ilgis: 18 ntLength: 18 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr.1 analogas, turintis tokį patį nukleotidų išsidėstymo eiliškumą, tačiau sutrumpintas vienu nukleotidu nuo 5'- galo. Pagal komplementarumo principą ji gali jungtis su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą, remiantis literatūros duomenimis (Fakler ir kt. Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration būt almost independent of location ofthe target seguence. J. Biol. Chem. 269 (1994), p. 16187-16194).Function: This sequence is an analog of SEQ ID NO: 1, having the same nucleotide sequence order, but truncated by one nucleotide from the 5 'end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotide-mediated inhibition independent of location of the target mixture (J. Biol. Chem. 269 (1994), pp. 16187-16194).

Seka Nr. 5 (SEQ ID nr. 5):Track # 5 (SEQ ID NO: 5):

5-AGACCATTGCTTAATCT-3'5-AGACCATTGCTTAATCT-3 '

Ilgis: 17 ntLength: 17 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr.1 analogas, turintis tokį patį nukleotidų išsidėstymo eiliškumą, tačiau sutrumpintas dviem nukleotidais nuo 5'- galo. Pagal komplementarumo principą ji gali jungtis su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą, remiantis literatūros duomenimis (Fakler ir kt. Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration būt almost independent of location ofthe target seguence. J. Biol. Chem. 269 (1994), p. 16187-16194).Function: This sequence is an analog of SEQ ID NO: 1, having the same nucleotide sequence sequence, but truncated by two nucleotides from the 5 'end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotide-mediated inhibition independent of location of the target mixture (J. Biol. Chem. 269 (1994), pp. 16187-16194).

Seka Nr. 6 (SEQ ID nr. 6): 5-GACCATTGCTTAATCT-3'Track # 6 (SEQ ID NO: 6): 5-GACCATTGCTTAATCT-3 '

Ilgis: 16 ntLength: 16 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr.1 analogas, turintis tokį patį nukleotidų išsidėstymo eiliškumą, tačiau sutrumpintas trimis nukleotidais nuo 5'- galo. Pagal komplementarumo principą ji gali jungtis su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminį efektą, remiantis literatūros duomenimis (Fakler ir kt. Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration būt almost independent of location ofthe target seguence. J. Biol. Chem. 269 (1994), p. 16187-16194).Function: This sequence is an analog of SEQ ID NO: 1, having the same nucleotide sequence sequence, but truncated by three nucleotides from the 5 'end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration to be almost independent of location of the target mixture (J. Biol. Chem. 269 (1994), pp. 16187-16194).

Seka Nr. 7 (SEQ ID nr. 7):Track # 7 (SEQ ID NO: 7):

5'-GCAGACCATTGCTTAATC-3'5'-GCAGACCATTGCTTAATC-3 '

Ilgis: 18 ntLength: 18 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr.1 analogas, turintis tokį patį nukleotidų išsidėstymo eiliškumą, tačiau sutrumpintas vienu nukleotidų nuo 3'- galo. Pagal komplementarumo principą ji gali jungtis su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminį efektą, remiantis literatūros duomenimis (Fakler ir kt. Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration būt almost independent of location ofthe target seguence. J. Biol. Chem. 269 (1994), p. 16187-16194).Function: This sequence is an analog of SEQ ID NO: 1 having the same sequence of nucleotide arrangement but truncated by one nucleotide from the 3 'end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration to be almost independent of location of the target mixture (J. Biol. Chem. 269 (1994), pp. 16187-16194).

Seka Nr. 8 (SEQ ID nr. 8):Track # 8 (SEQ ID NO: 8):

5-GCAGACCATTGCTTAAT-3'5-GCAGACCATTGCTTAAT-3 '

Ilgis: 17 ntLength: 17 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr.1 analogas, turintis tokį patį nukleotidų išsidėstymo eiliškumą, tačiau sutrumpintas dviem nukleotidais nuo 3'- galo. Pagal komplementarumo principą ji gali jungtis su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą, remiantis literatūros duomenimis (Fakler ir kt. Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration būt almost independent of location ofthe target seguence. J. Biol. Chem. 269 (1994), p. 16187-16194).Function: This sequence is an analog of SEQ ID NO: 1 having the same nucleotide sequence sequence but truncated by two nucleotides from the 3 'end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotide-mediated inhibition independent of location of the target mixture (J. Biol. Chem. 269 (1994), pp. 16187-16194).

Seka Nr. 9 (SEQ ID nr. 9):Track # 9 (SEQ ID NO: 9):

5'-GCAGACCATTGCTTAA-3'5'-GCAGACCATTGCTTAA-3 '

Ilgis: 16 ntLength: 16 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr.1 analogas, turintis tokį patj nukleotidų išsidėstymo eiliškumą, tačiau sutrumpintas trimis nukleotidais nuo 3'- galo. Pagal komplementarumo principą ji gali jungtis su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą, remiantis literatūros duomenimis (Fakler ir kt. Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration būt almost independent of location ofthe target seguence. J. Biol. Chem. 269 (1994), p. 16187-16194).Function: This sequence is an analog of SEQ ID NO: 1 having the same sequence of nucleotide arrangement, but truncated by three nucleotides from the 3 'end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotide-mediated inhibition independent of location of the target mixture (J. Biol. Chem. 269 (1994), pp. 16187-16194).

Seka Nr. 10(SEQ ID nr. 10):Track # 10 (SEQ ID NO: 10):

5-CAGACCATTGCTTAATC-3'5-CAGACCATTGCTTAATC-3 '

Ilgis: 17 ntLength: 17 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr.1 analogas, turintis tokj patį nukleotidų išsidėstymo eiliškumą, tačiau sutrumpintas dviem nukleotidais - vienu nuo 5'- galo ir vienu nuo 3'- galo. Pagal komplementarumo principą ji gali jungtis su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą, remiantis literatūros duomenimis (Fakler ir kt. Short antisense oligonucleotidemediated inhibition is strongly dependent on oligo length and concentration būt almost independent of location ofthe target sequence. J. Biol. Chem. 269 (1994), p. 1618716194).Function: This sequence is an analog of SEQ ID NO: 1, having the same nucleotide sequence sequence, but truncated by two nucleotides, one from the 5'-end and one from the 3'-end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotidemediated inhibition is highly dependent on oligo length and concentration to be almost independent of location of the target sequence (J. Biol. Chem. 269 (1994), p. 1618716194).

Seka Nr. 11 (SEQ ID nr. 11):Track # 11 (SEQ ID NO: 11):

5'-AGACCATTGCTTAATC-3'5'-AGACCATTGCTTAATC-3 '

Ilgis: 16 ntLength: 16 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr.1 analogas, turintis tokį patį nukleotidų išsidėstymo eiliškumą, tačiau sutrumpintas trimis nukleotidais - dviem nuo 5'- galo ir vienu nuo 3'- galo. Pagal komplementarumo principą ji gali jungtis su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą, remiantis literatūros duomenimis (Fakler ir kt. Short antisense oligonucleotidemediated inhibition is strongly dependent on oligo length and concentration būt almost independent of location ofthe target sequence. J. Biol. Chem. 269 (1994), p. 1618716194).Function: This sequence is an analog of SEQ ID NO: 1, having the same nucleotide sequence sequence, but truncated by three nucleotides, two from the 5'-end and one from the 3'-end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotidemediated inhibition is highly dependent on oligo length and concentration to be almost independent of location of the target sequence (J. Biol. Chem. 269 (1994), p. 1618716194).

Seka Nr. 12 (SEQ ID nr. 12):Track # 12 (SEQ ID NO: 12):

5-CAGACCATTGCTTAAT-3'5-CAGACCATTGCTTAAT-3 '

Ilgis: 16 ntLength: 16 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr.1 analogas, turintis tokį patį nukleotidų išsidėstymo eiliškumą, tačiau sutrumpintas trimis nukleotidais - vienu nuo 5'- galo ir dviem nuo 3'- galo. Pagal komplementarumo principą ji gali jungtis su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą, remiantis literatūros duomenimis (Fakler ir kt. Short antisense oligonucleotidemediated inhibition is strongly dependent on oligo length and concentration būt almost independent of location ofthe target sequence. J. Biol. Chem. 269 (1994), p. 1618716194).Function: This sequence is an analog of SEQ ID NO: 1, having the same nucleotide sequence order, but truncated by three nucleotides, one at the 5'-end and two at the 3'-end. According to the complementarity principle, it can bind to the corresponding region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, leading to an antisense effect according to the literature (Fakler et al., Short antisense oligonucleotidemediated inhibition is highly dependent on oligo length and concentration to be almost independent of location of the target sequence (J. Biol. Chem. 269 (1994), p. 1618716194).

Seka Nr. 13(SEQ ID nr. 13):Track # 13 (SEQ ID NO: 13):

5'-TTGGCAGACCATTGCTTAATCTTAAC-3'5'-TTGGCAGACCATTGCTTAATCTTAAC-3 '

Ilgis: 26 ntLength: 26 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka pagal komplementarumo principą gali jungtis su atitinkama 26 nt sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą. Ji yra komplementari sekai Nr. 16, kuri turi 100% homologines sritis S. mutans gtfB, gtfC, S. criceti gtfl, S. dentirousetti gtfl, S. dentisuis gtfl \r S. orisuis gtf genuose, o taip pat homologines sritis su dviejų nukleotidų neatitikimu S. dovvnei gtf pirmtako ir S. sobrinus gtfl genuose.Function: This sequence may, according to the complementarity principle, bind to the corresponding 26 nt region of S. mutans gtfB and gtfC iRNAs and S. sobrinus gtfl iRNAs, resulting in an antisense effect. It is complementary to sequence no. 16, which has 100% homologous regions in the S. mutans gtfB, gtfC, S. criceti gtfl, S. dentirousetti gtfl, S. dentisuis gtfl \ r S. orisuis gtf genes, as well as homologous regions with two nucleotide mismatches in S. dovvnei gtf. of the precursor and S. sobrinus gtfl genes.

Seka Nr. 14 (SEQ ID nr. 14):Track # 14 (SEQ ID NO: 14):

5'UCUGUUAAGAUUAAGCAAUGGUCUGCCAAGUACUUUAAUGGGACAAA5'UCUGUUAAGAUUAAGCAAUGGUCUGCCAAGUACUUUAAUGGGACAAA

UAUUUUAGGGCGCGGAGCAGGCUAUGUCUUAAAAGA-3'UAUUUUAGGGCGCGGAGCAGGCUAUGUCUUAAAAGA-3 '

Ilgis: 83 ntLength: 83 nt

Cheminė struktūra: ribonukleorūgštis (RNR)Chemical structure: ribonucleic acid (RNA)

Kilmė: natūrali seka, esanti S. mutans gtfB iRNROrigin: Natural sequence present in S. mutans gtfB iRNA

Funkcija: reikalinga transliacijai atlikti; koduoja amino rūgštis atitinkamoje S. mutans GtfB baltymo srityje. Prie šios sekos atitinkamos srities gali jungtis priešprasminiai oligonukleotidai, turintys sekas Nr. 1 ir Nr. 4-13, sukeldami priešprasminj efektą.Function: Required for streaming; encodes amino acids in the corresponding region of the S. mutans GtfB protein. The corresponding region of this sequence can be joined by antisense oligonucleotides having the sequence no. 1 and No. 4-13, causing an antispasmodic effect.

Seka Nr. 15 (SEQ ID nr. 15): 5'-GCAGACCATTGTTTAATCT-3'Track # 15 (SEQ ID NO: 15): 5'-GCAGACCATTGTTTAATCT-3 '

Ilgis: 19 ntLength: 19 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: natūrali seka, esanti S. sobrinus gtfl geneOrigin: Natural sequence present in the S. sobrinus gtfl gene

Funkcija: koduoja sritį S. sobrinus gtfl iRNR, prie kurios gali jungtis priešprasminiai oligonukleotidai (su vieno nukleotido neatitikimu), turintys sekas Nr. 1 ir Nr. 4-12, sukeldami priešprasminj efektą.Function: Encodes a region of S. sobrinus gtfl iRNA to which antisense oligonucleotides (with a single nucleotide mismatch) having sequence no. 1 and No. 4-12, producing an antispasmodic effect.

Seka Nr. 16 (SEQ ID nr. 16):Track # 16 (SEQ ID NO: 16):

5'-GTTAAGATTAAGCAATGGTCTGCCAA-3'5'-GTTAAGATTAAGCAATGGTCTGCCAA-3 '

Ilgis: 26 ntLength: 26 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: natūrali seka, esanti S. mutans gtfB geneOrigin: Natural sequence present in the S. mutans gtfB gene

Funkcija: koduoja sritį S. mutans gtfB iRNR, prie kurios gali jungtis priešprasminiai oligonukleotidai, turintys sekas Nr. 1 ir Nr. 4-13, sukeldami priešprasminj efektą. Ši seka turi 100% homologines sritis S. mutans gtfC, S. criceti gtfl, S. dentirousetti gtfl, S. dentisuis gtfl ir S. orisuis gtf genuose, o taip pat homologines sritis su dviejų nukleotidų neatitikimu S. dovvnei gtf pirmtako ir S. sobrinus gtfl genuose.Function: Encodes a region of S. mutans gtfB iRNA to which antisense oligonucleotides having the sequence no. 1 and No. 4-13, causing an antispasmodic effect. This sequence has 100% homologous regions in the S. mutans gtfC, S. criceti gtfl, S. dentirousetti gtfl, S. dentisuis gtfl, and S. orisuis gtf genes, as well as homologous regions with two nucleotide mismatches in S. dovvnei gtf precursor and S. sobrinus in the gtfl gene.

Seka N r. 17(SEQIDnr. 17):Follows N r. 17 (SEQ ID NO: 17):

5'-AGATTAAGCAATGGTCTGC-3'5'-AGATTAAGCAATGGTCTGC-3 '

Ilgis: 19 ntLength: 19 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: natūrali seka, esanti S. mutans gtfB geneOrigin: Natural sequence present in the S. mutans gtfB gene

Funkcija: koduoja sritį S. mutans gtfB iRNR, prie kurios gali jungtis priešprasminiai oligonukleotidai, turintys sekas Nr. 1 ir Nr. 4-12, sukeldami priešprasminj efektą. Ši seka yra SEQ ID nr. 16 išvestinė.Function: Encodes a region of S. mutans gtfB iRNA to which antisense oligonucleotides having the sequence no. 1 and No. 4-12, producing an antispasmodic effect. This sequence is SEQ ID NO. 16 derivative.

Seka Nr. 18 (SEQ ID nr. 18):Track # 18 (SEQ ID NO: 18):

5'-CGCGTCATGTTTGAAGGTTTCTCTAA-3'5'-CGCGTCATGTTTGAAGGTTTCTCTAA-3 '

Ilgis: 26 ntLength: 26 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: natūrali seka, esanti S. mutans gtfB geneOrigin: Natural sequence present in the S. mutans gtfB gene

Funkcija: koduoja sritį S. mutans gtfB iRNR, prie kurios gali jungtis priešprasminiai oligonukleotidai, turintys sekas Nr. 19-24, sukeldami priešprasminį efektą. Ši seka turi 100% homologines sritis fig. 7 nurodytuose Streptococcus rūšių ir padermių gliukoziltransferazių genuose.Function: Encodes a region of S. mutans gtfB iRNA to which antisense oligonucleotides having the sequence no. 19-24, causing a counter-sensory effect. This sequence has 100% homologous regions in FIG. 7 in the genes for glucosyltransferases of Streptococcus species and strains.

Seka Nr. 19(SEQ ID nr. 19):Track # 19 (SEQ ID NO: 19):

5-TTAGAGAAACCTTCAAACATGACGCG-3'5-TTAGAGAAACCTTCAAACATGACGCG-3 '

Ilgis: 26 ntLength: 26 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka pagal komplementarumo principą gali jungtis su atitinkama 26 nt sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminį efektą. Ji yra komplementari sekai Nr. 18, kuri turi 100% homologines sritis fig. 7 nurodytuose Streptococcus rūšių ir padermių gliukoziltransferazių genuose.Function: This sequence may, by complementarity, bind to the corresponding 26 nt region of the S. mutans gtfB and gtfC iRNA and the S. sobrinus gtfl iRNA, resulting in an antisense effect. It is complementary to sequence no. 18, which has 100% homologous regions in FIG. 7 in the genes for glucosyltransferases of Streptococcus species and strains.

Seka Nr. 20 (SEQ ID nr. 20):Track # 20 (SEQ ID NO: 20):

5'-GAAACCTTCAAACATGACGC-3'5'-GAAACCTTCAAACATGACGC-3 '

Ilgis: 20 ntLength: 20 nt

Cheminė struktūra: DNRChemical structure: DNA

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr. 19 išvestinė, pagal komplementarumo principą jungiasi su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminį efektą. Tai yra testuojama seka, kuri parinkta panaudojant „Antisense Design“ programą (Integrated DNA Technologies:Function: This sequence is SEQ ID NO. 19 derivative, binds to the corresponding region in the S. mutans gtfB and gtfC iRNAs and in the S. sobrinus gtfl iRNA according to the principle of complementarity, causing an antisense effect. This is a test sequence selected using Antisense Design (Integrated DNA Technologies:

http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).

Seka Nr. 21 (SEQ ID nr. 21):Track # 21 (SEQ ID NO: 21):

5-AAACCTTCAAACATGACGC-3'5-AAACCTTCAAACATGACGC-3 '

Ilgis: 19 ntLength: 19 nt

Cheminė struktūra: deoksiribonukleorūgštis (DNR)Chemical structure: deoxyribonucleic acid (DNA)

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr. 19 išvestinė, pagal komplementarumo principą jungiasi su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą. Tai yra testuojama seka, kuri parinkta panaudojant „Antisense Design“ programą (Integrated DNA Technologies: http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).Function: This sequence is SEQ ID NO. 19 derivative, binds to the corresponding region of S. mutans gtfB and gtfC iRNA and S. sobrinus gtfl iRNA according to the principle of complementarity, causing an antisense effect. This is a test sequence selected using Antisense Design (Integrated DNA Technologies: http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).

Seka Nr. 22 (SEQ ID nr. 22):Track # 22 (SEQ ID NO: 22):

5-GAAACCTTCAAACATGACGCG-3'5-GAAACCTTCAAACATGACGCG-3 '

Ilgis: 21 ntLength: 21 nt

Cheminė struktūra: deoksiribonukleorūgštis (DNR)Chemical structure: deoxyribonucleic acid (DNA)

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr. 19 išvestinė, pagal komplementarumo principą jungiasi su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą. Tai yra testuojama seka, kuri parinkta panaudojant „Antisense Design“ programą (Integrated DNA Technologies: http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).Function: This sequence is SEQ ID NO. 19 derivative, binds to the corresponding region of S. mutans gtfB and gtfC iRNA and S. sobrinus gtfl iRNA according to the principle of complementarity, causing an antisense effect. This is a test sequence selected using Antisense Design (Integrated DNA Technologies: http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).

Seka Nr. 23 (SEQ ID nr. 23):Track # 23 (SEQ ID NO: 23):

5-GAAACCTTCAAACATGACG-3'5-GAAACCTTCAAACATGACG-3 '

Ilgis: 19 ntLength: 19 nt

Cheminė struktūra: deoksiribonukleorūgštis (DNR)Chemical structure: deoxyribonucleic acid (DNA)

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr. 19 išvestinė, pagal komplementarumo principą jungiasi su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą. Tai yra testuojama seka, kuri parinkta panaudojant „Antisense Design“ programą (Integrated DNA Technologies: http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).Function: This sequence is SEQ ID NO. 19 derivative, binds to the corresponding region of S. mutans gtfB and gtfC iRNA and S. sobrinus gtfl iRNA according to the principle of complementarity, causing an antisense effect. This is a test sequence selected using Antisense Design (Integrated DNA Technologies: http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).

Seka Nr. 24 (SEQ ID nr. 24):Track # 24 (SEQ ID NO: 24):

5'-AGAAACCTTCAAACATGACGC-3'5'-AGAAACCTTCAAACATGACGC-3 '

Ilgis: 21 ntLength: 21 nt

Cheminė struktūra: deoksiribonukleorūgštis (DNR)Chemical structure: deoxyribonucleic acid (DNA)

Kilmė: dirbtinai susintetinta izoliuota priešprasminė nukleotidų sekaOrigin: an artificially synthesized isolated antisense nucleotide sequence

Funkcija: ši seka yra SEQ ID nr. 19 išvestinė, pagal komplementarumo principą jungiasi su atitinkama sritimi S. mutans gtfB ir gtfC iRNR bei S. sobrinus gtfl iRNR sukeldama priešprasminj efektą. Tai yra testuojama seka, kuri parinkta panaudojant „Antisense Design“ programą (Integrated DNA Technologies: http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).Function: This sequence is SEQ ID NO. 19 derivative, binds to the corresponding region of S. mutans gtfB and gtfC iRNA and S. sobrinus gtfl iRNA according to the principle of complementarity, causing an antisense effect. This is a test sequence selected using Antisense Design (Integrated DNA Technologies: http://eu.idtdna.com/Scitools/Applications/AntiSense/Antisense.aspx?source=menu).

Claims (13)

IŠRADIMO APIBRĖŽTISDEFINITION OF INVENTION 1. Priešprasminiai oligonukleotidai (PO) aterosklerozės ir kardiovaskuliarinių infekcijų prevencijai, atitinkantys šiuos požymius:1. Antispasmodic oligonucleotides (PO) for the prevention of atherosclerosis and cardiovascular infections, having the following characteristics: a) PO sudaryti iš nukleotidų sekų pagal SEQ ID nr. 1, 13, 19;a) POs consisting of nucleotide sequences according to SEQ ID NO. 1, 13, 19; b) PO sudaryti iš sekų SEQ ID nr. 1, 13, 19 fragmentų: arbab) The PO is composed of the sequences SEQ ID NO. 1, 13, 19 fragments: or c) PO, kurių nukleotidų sekos ne mažiau kaip 85% sutampa su sekomis SEQ IDnr. 1, 13, 19.c) POs having at least 85% nucleotide sequences matching SEQ ID NOs. 1, 13, 19. 2. PO pagal 1 punktą, besiskiriantys tuo, kad nukleotidų sekos nurodytos SEQ ID nr. 1,13,19 skiriasi vienu, dviem, trim arba keturiais nukleotidais.2. The PO of claim 1, wherein the nucleotide sequences are set forth in SEQ ID NO. 1,13,19 differ by one, two, three or four nucleotides. 3. PO pagal 1 punktą, besiskiriantys tuo, kad nukleotidų sekas sudaro fragmentai ar dalys, kurie parinkti iš šių sekų grupės: SEQ ID nr. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24.3. The PO of claim 1, wherein the nucleotide sequences comprise fragments or portions selected from the group consisting of SEQ ID NO. 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, 21, 22, 23, 24. 4. PO pagal bet kurj iš 1-3 punktų, besiskiriantys tuo, kad PO konjuguoti su peptidu prasiskverbiančiu per ląstelės membraną.The PO according to any one of claims 1 to 3, wherein the PO is conjugated to a peptide penetrating the cell membrane. 5. PO pagal bet kurj iš 1-4 punktų, panaudojami aterosklerozinių plokštelių ir/ar židinių susiformavimo profilaktikai, prevencijai, slopinimui ir mažinimui ant žmogaus kardiovaskulinių audinių ir/ar žmogaus kraujo terpėje.The PO of any one of claims 1 to 4 for use in the prevention, prevention, inhibition and reduction of atherosclerotic plaque and / or focal formation on human cardiovascular tissues and / or human blood medium. 6. Biofarmacinė kompozicija medicininiam panaudojimui susidedanti iš aktyviosios medžiagos ir adjuvantų ir/ar nešėjų, besiskirianti tuo, kad jos aktyviąją medžiagą sudaro PO pagal bet kurj iš 1-4 punktų.A biopharmaceutical composition for medical use, comprising the active ingredient and adjuvants and / or carriers, wherein the active ingredient is a PO according to any one of claims 1-4. 7. Biofarmacinė kompozicija pagal 6 punktą, besiskirianti tuo, kad joje naudojamas nešėjas yra katijoninis polimeras.7. The biopharmaceutical composition of claim 6, wherein the carrier used is a cationic polymer. 8. Biofarmacinė kompozicija, pagal bet kurj iš 6,7 punktus, skirta aterosklerozės gydymui ar prevencijai.A biopharmaceutical composition according to any one of claims 6.7 for the treatment or prevention of atherosclerosis. 9. Biofarmacinė kompozicija, pagal bet kurį iš 6,7 punktus, skirta bakterinio endokardito gydymui ar prevencijai.A biopharmaceutical composition according to any one of claims 6.7 for the treatment or prevention of bacterial endocarditis. 10. Biofarmacinė kompozicija pagal bet kurj iš 6,7 punktus, skirta paviršių besiliečiančių su žmogaus krauju ir audiniais, vamzdelių, kateterių, dializės membranų, zondų, vožtuvų, protezų, implantų apdorojimui, siekiant antibakterinio poveikio nukreipto į S. mutans ir S. sobrinus ant tokių paviršių.A biopharmaceutical composition according to any of claims 6.7 for the treatment of surfaces in contact with human blood and tissues, tubes, catheters, dialysis membranes, probes, valves, prostheses, implants for antibacterial activity against S. mutans and S. sobrinus. on such surfaces. 11. Biofarmacinė kompozicija, pagal bet kurį iš 6,7 punktus, skirta paviršių besiliečiančių su žmogaus krauju ir audiniais, vamzdelių, kateterių, dializės membranų, zondų, vožtuvų, protezų, implantų apdorojimui, aterosklerozinių plokštelių ir/ar židinių susiformavimo profilaktikai, prevencijai, slopinimui ir mažinimui ant tokių paviršių.A biopharmaceutical composition according to any one of claims 6.7 for the treatment of surfaces in contact with human blood and tissues, tubes, catheters, dialysis membranes, probes, valves, prostheses, implants, prophylaxis of atherosclerotic plaques and / or foci. damping and reduction on such surfaces. 12. Biofarmacinė kompozicija, pagal bet kurį iš 6,7 punktus, skirta paviršių besiliečiančių su žmogaus krauju ir audiniais, vamzdelių, kateterių, dializės membranų, zondų, vožtuvų, protezų, implantų apdorojimui, siekiant sumažinti bakterinių bioplėvelų atsiradimą ir augimą.A biopharmaceutical composition according to any one of claims 6.7 for the treatment of surfaces in contact with human blood and tissues, tubes, catheters, dialysis membranes, probes, valves, prostheses, implants to reduce the emergence and growth of bacterial biofilms. 13. S. mutans ir S. sobrinus bakterijų kolonijų kontrolės būdas, b e s i s k i r i antis tuo, kad naudojant biofarmacinę kompoziciją pagal 6,7 punktus specifiškai ir vienu metu slopina gtfB ir gtfC iRNR raišką S. mutans bakterijoje ir gtfl iRNR raišką S. sobrinus bakterijoje , taip pat vienu metu slopina šių bakterijų gebėjimą sintezuoti vandenyje netirpių gliukanų ir dalinai vandenyje tirpių gliukanų polimerus ir mažina šių bakterijų gebėjimą sintetinti bioplėvelių karkasą sudarančius ekzopolisacharidus.A method of controlling bacterial colonies in S. mutans and S. sobrinus, characterized in that the biopharmaceutical composition of claim 6.7 specifically and simultaneously inhibits gtfB and gtfC iRNA expression in S. mutans and gtfl iRNA expression in S. sobrinus, it also inhibits the ability of these bacteria to synthesize water-insoluble glucans and partially water-soluble glucans at the same time and reduces the ability of these bacteria to synthesize exopolysaccharides forming biofilm backbones.
LT2013109A 2013-10-07 2013-10-07 Antisense oligonucleotide for prevention of atherosclerosis and cardivascular infections LT6214B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
LT2013109A LT6214B (en) 2013-10-07 2013-10-07 Antisense oligonucleotide for prevention of atherosclerosis and cardivascular infections
PCT/IB2014/065084 WO2015052630A1 (en) 2013-10-07 2014-10-06 Antisense oligonucleotides for prevention of atherosclerosis and cardiovascular infections

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
LT2013109A LT6214B (en) 2013-10-07 2013-10-07 Antisense oligonucleotide for prevention of atherosclerosis and cardivascular infections

Publications (2)

Publication Number Publication Date
LT2013109A LT2013109A (en) 2015-04-27
LT6214B true LT6214B (en) 2015-08-25

Family

ID=51871111

Family Applications (1)

Application Number Title Priority Date Filing Date
LT2013109A LT6214B (en) 2013-10-07 2013-10-07 Antisense oligonucleotide for prevention of atherosclerosis and cardivascular infections

Country Status (2)

Country Link
LT (1) LT6214B (en)
WO (1) WO2015052630A1 (en)

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US6228982B1 (en) 1992-05-22 2001-05-08 Benget Norden Double-stranded peptide nucleic acids
US5766855A (en) 1991-05-24 1998-06-16 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity and sequence specificity
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
DK51092D0 (en) 1991-05-24 1992-04-15 Ole Buchardt OLIGONUCLEOTIDE ANALOGUE DESCRIBED BY PEN, MONOMERIC SYNTHONES AND PROCEDURES FOR PREPARING THEREOF, AND APPLICATIONS THEREOF
US5641625A (en) 1992-05-22 1997-06-24 Isis Pharmaceuticals, Inc. Cleaving double-stranded DNA with peptide nucleic acids
GB9211979D0 (en) 1992-06-05 1992-07-15 Buchard Ole Uses of nucleic acid analogues
US5527675A (en) 1993-08-20 1996-06-18 Millipore Corporation Method for degradation and sequencing of polymers which sequentially eliminate terminal residues
DE4331012A1 (en) 1993-09-13 1995-03-16 Bayer Ag Nucleic acid-binding oligomers with N-branching for therapy and diagnostics
GB2284209A (en) 1993-11-25 1995-05-31 Ole Buchardt Nucleic acid analogue-induced transcription of RNA from a double-stranded DNA template
US5705333A (en) 1994-08-05 1998-01-06 The Regents Of The University Of California Peptide-based nucleic acid mimics(PENAMS)
EP0912193A4 (en) * 1996-06-21 2000-11-02 Univ Virginia Commonwealth VACCINE FOR PREVENTING STREPTOCOCCAL ENDOCARDITY
US6107470A (en) 1997-05-29 2000-08-22 Nielsen; Peter E. Histidine-containing peptide nucleic acids
EP1833844A4 (en) * 2004-12-06 2009-05-13 Kane Biotech Inc Signal peptides, nucleic acid molecules and methods of treatment
WO2014033314A1 (en) * 2012-09-03 2014-03-06 Uab Bioseka Antisense oligonucleotide targeting bacterial glucosyltransferases

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BOWEN ET AL.: "Biology of Streptococcus mutans-derived glucosyltransferases: role in extracellular matrix formation of cariogenic biofilms", CARIES RES., 2011, pages 69 - 86
KOREN ET AL.: "Human oral, gut and plaque microbiota in patients with atherosclerosis", PROC. NATL. ACAD. SCI. USA, 2011, pages 4592 - 4598, XP055001767, DOI: doi:10.1073/pnas.1011383107
NAKANO ET AL.: "Detection of cariogenic Streptococcus mutans in extirpated heart valve and atheromatous plaque specimens", J. CLIN. MICROBIOL., 2006, pages 3313 - 3317
NAKANO ET AL.: "Detection of oral bacteria in cardiovascular specimens", ORAL MICROBIOL. IMMUNOL., 2009, pages 64 - 68
NAKANO ET AL.: "Streptococcus mutans and cardiovascular diseases.", J. DENT. SCI. REV., 2008, pages 29 - 37, XP025406280, DOI: doi:10.1016/j.jdsr.2007.09.001
S. MENDIS ET AL.: "Global Atlas on cardiovascular disease prevention and control", pages: 8 - 14

Also Published As

Publication number Publication date
LT2013109A (en) 2015-04-27
WO2015052630A1 (en) 2015-04-16

Similar Documents

Publication Publication Date Title
CN102307997B (en) Treatment of sirtuin 1 (SIRT1)-associated diseases by inhibiting natural antisense transcripts against sirtuin 1
CN102803492B (en) TTP relevant disease is treated for the natural antisense transcript of triple four proline (TTP) by suppression
US20250270555A1 (en) Organic compositions to treat beta-catenin-related diseases
US10941404B2 (en) Treatment of angiopoietin like 7 (ANGPTL7) related diseases
JP2021104035A (en) Composition for modulating ataxin 2 expression
TW202307207A (en) Rnai agents for inhibiting expression of xanthine dehydrogenase (xdh), pharmaceutical compositions thereof, and methods of use
US20180153919A1 (en) Organic compositions to treat kras-related diseases
CN108513588A (en) Modulators of KRAS expression
KR20160054595A (en) Modulators of complement factor b
KR20210008498A (en) Compounds and methods for reducing FXI expression
CN113151261A (en) Antisense oligonucleotides as inhibitors of TGF-R signaling
EP3545094B1 (en) Aptamers for use in inhibition and/or suppression of tlr9 activation
TW201202418A (en) Treatment of Methionine Sulfoxide Reductase A (MSRA) related diseases by inhibition of natural antisense transcript to MSRA
CN109328236A (en) In vitro nephrotoxicity screening assay
KR20150103739A (en) Immune regulatory oligonucleotide (iro) compounds to modulate toll-like receptor based immune response
JP2024525868A (en) Products and Compositions
KR102061924B1 (en) Composition for preventing or treating of cardiovascular disease comprising p32 inhibitor
KR102588627B1 (en) Composition for preparing extracellular matrix using MAST4 gene and method for preparing the same
LT6214B (en) Antisense oligonucleotide for prevention of atherosclerosis and cardivascular infections
WO2009147742A1 (en) Sirna of human osteopontin
WO2023192828A2 (en) Compositions and methods for the treatment of angiopoietin like 7 (angptl7) related diseases
EP1720984A1 (en) Methods and compositions for treatment or prevention of secondary ischemic injury
US7655773B2 (en) Anti-apoptotically active apatamers
KR20010042796A (en) Antisense oligonucleotides for the inhibition of integrin αv-subunit expression
WO2007058323A1 (en) Method for production of nucleic acid homopolymer-bound functional nucleic acid medicine

Legal Events

Date Code Title Description
BB1A Patent application published

Effective date: 20150427

FG9A Patent granted

Effective date: 20150825

MM9A Lapsed patents

Effective date: 20161007